>Feature sequence01 1262 183 gene locus_tag LOCUS_00010 1262 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2306 1275 gene locus_tag LOCUS_00020 2306 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3796 2303 gene locus_tag LOCUS_00030 3796 2303 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_00030 4626 3943 gene locus_tag LOCUS_00040 4626 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6601 4922 gene locus_tag LOCUS_00050 gene mrdA 6601 4922 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_00050 7047 6607 gene locus_tag LOCUS_00060 7047 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7890 7048 gene locus_tag LOCUS_00070 7890 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8530 7946 gene locus_tag LOCUS_00080 8530 7946 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_00080 10710 8686 gene locus_tag LOCUS_00090 10710 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11210 10779 gene locus_tag LOCUS_00100 11210 10779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11383 11976 gene locus_tag LOCUS_00110 gene pth 11383 11976 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_00110 12028 15429 gene locus_tag LOCUS_00120 gene mfd 12028 15429 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_00120 16391 15474 gene locus_tag LOCUS_00130 16391 15474 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945539.1 protein_id gnl|my_center|LOCUS_00130 16606 16370 gene locus_tag LOCUS_00140 16606 16370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16783 17271 gene locus_tag LOCUS_00150 16783 17271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17278 18462 gene locus_tag LOCUS_00160 17278 18462 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207481.1 protein_id gnl|my_center|LOCUS_00160 18459 19877 gene locus_tag LOCUS_00170 18459 19877 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_00170 20682 19867 gene locus_tag LOCUS_00180 20682 19867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 20954 20694 gene locus_tag LOCUS_00190 20954 20694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21180 20986 gene locus_tag LOCUS_00200 21180 20986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 21397 23610 gene locus_tag LOCUS_00210 21397 23610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23779 25764 gene locus_tag LOCUS_00220 gene gyrB 23779 25764 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_00220 25837 27516 gene locus_tag LOCUS_00230 25837 27516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27570 27785 gene locus_tag LOCUS_00240 27570 27785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27896 30145 gene locus_tag LOCUS_00250 gene gyrA 27896 30145 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632827.1 protein_id gnl|my_center|LOCUS_00250 30142 30864 gene locus_tag LOCUS_00260 30142 30864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 30908 30983 gene locus_tag LOCUS_t00010 30908 30983 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 31511 31038 gene locus_tag LOCUS_00270 31511 31038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 31697 33139 gene locus_tag LOCUS_00280 gene proS 31697 33139 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040960.1 protein_id gnl|my_center|LOCUS_00280 34437 33610 gene locus_tag LOCUS_00290 34437 33610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 34599 34907 gene locus_tag LOCUS_00300 34599 34907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 36106 35384 gene locus_tag LOCUS_00310 36106 35384 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774590.1 protein_id gnl|my_center|LOCUS_00310 36872 36093 gene locus_tag LOCUS_00320 36872 36093 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903444.1 protein_id gnl|my_center|LOCUS_00320 37817 36963 gene locus_tag LOCUS_00330 37817 36963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38799 38023 gene locus_tag LOCUS_00340 38799 38023 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_00340 42257 38970 gene locus_tag LOCUS_00350 42257 38970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 42453 42782 gene locus_tag LOCUS_00360 42453 42782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 43142 43444 gene locus_tag LOCUS_00370 43142 43444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 45075 43486 gene locus_tag LOCUS_00380 45075 43486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 45636 45388 gene locus_tag LOCUS_00390 45636 45388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00390 45988 46968 gene locus_tag LOCUS_00400 45988 46968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 46972 47976 gene locus_tag LOCUS_00410 46972 47976 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_00410 49223 48066 gene locus_tag LOCUS_00420 49223 48066 CDS product DUF4263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389913.1 protein_id gnl|my_center|LOCUS_00420 50938 49220 gene locus_tag LOCUS_00430 50938 49220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 52843 50951 gene locus_tag LOCUS_00440 52843 50951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 54499 53249 gene locus_tag LOCUS_00450 54499 53249 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392573.1 protein_id gnl|my_center|LOCUS_00450 56894 54525 gene locus_tag LOCUS_00460 56894 54525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 57652 56945 gene locus_tag LOCUS_00470 57652 56945 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_00470 58888 57680 gene locus_tag LOCUS_00480 58888 57680 CDS product D-aspartate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294441.1 protein_id gnl|my_center|LOCUS_00480 61251 58984 gene locus_tag LOCUS_00490 61251 58984 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810772.1 protein_id gnl|my_center|LOCUS_00490 63373 61274 gene locus_tag LOCUS_00500 gene recJ 63373 61274 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_00500 65278 63515 gene locus_tag LOCUS_00510 65278 63515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 67268 65319 gene locus_tag LOCUS_00520 67268 65319 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791061.1 protein_id gnl|my_center|LOCUS_00520 68874 67441 gene locus_tag LOCUS_00530 68874 67441 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_00530 70572 69166 gene locus_tag LOCUS_00540 70572 69166 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965728.1 protein_id gnl|my_center|LOCUS_00540 71118 70852 gene locus_tag LOCUS_00550 gene rpsT 71118 70852 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_00550 71319 72230 gene locus_tag LOCUS_00560 gene gpr 71319 72230 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460511.1 protein_id gnl|my_center|LOCUS_00560 72743 72306 gene locus_tag LOCUS_00570 gene rnhA 72743 72306 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044664291.1 protein_id gnl|my_center|LOCUS_00570 75316 72740 gene locus_tag LOCUS_00580 gene gyrA 75316 72740 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_00580 76086 75400 gene locus_tag LOCUS_00590 gene prsW 76086 75400 CDS product glutamic-type intramembrane protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230542.1 protein_id gnl|my_center|LOCUS_00590 78072 76126 gene locus_tag LOCUS_00600 gene gyrB 78072 76126 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435982.1 protein_id gnl|my_center|LOCUS_00600 78358 78092 gene locus_tag LOCUS_00610 78358 78092 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026196.1 protein_id gnl|my_center|LOCUS_00610 79545 78376 gene locus_tag LOCUS_00620 gene recF 79545 78376 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_00620 79754 79542 gene locus_tag LOCUS_00630 gene yaaA 79754 79542 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963332.1 protein_id gnl|my_center|LOCUS_00630 80882 79770 gene locus_tag LOCUS_00640 gene dnaN 80882 79770 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_00640 82507 81191 gene locus_tag LOCUS_00650 gene dnaA 82507 81191 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_00650 82927 83061 gene locus_tag LOCUS_00660 82927 83061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 83189 83545 gene locus_tag LOCUS_00670 83189 83545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 83542 83760 gene locus_tag LOCUS_00680 gene yidD 83542 83760 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081754.1 protein_id gnl|my_center|LOCUS_00680 83827 85041 gene locus_tag LOCUS_00690 83827 85041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 85057 85878 gene locus_tag LOCUS_00700 85057 85878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 85966 86907 gene locus_tag LOCUS_00710 85966 86907 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_00710 86957 87697 gene locus_tag LOCUS_00720 86957 87697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 87731 89158 gene locus_tag LOCUS_00730 87731 89158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 89520 90779 gene locus_tag LOCUS_00740 89520 90779 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889545.1 protein_id gnl|my_center|LOCUS_00740 90886 91860 gene locus_tag LOCUS_00750 90886 91860 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889546.1 protein_id gnl|my_center|LOCUS_00750 92059 92964 gene locus_tag LOCUS_00760 92059 92964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 92937 95075 gene locus_tag LOCUS_00770 92937 95075 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421678.1 protein_id gnl|my_center|LOCUS_00770 96384 95536 gene locus_tag LOCUS_00780 96384 95536 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_00780 97296 96520 gene locus_tag LOCUS_00790 97296 96520 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_00790 97663 99243 gene locus_tag LOCUS_00800 gene spoVB 97663 99243 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964335.1 protein_id gnl|my_center|LOCUS_00800 99240 99710 gene locus_tag LOCUS_00810 gene tadA 99240 99710 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 protein_id gnl|my_center|LOCUS_00810 100162 99923 gene locus_tag LOCUS_00820 100162 99923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 100362 103595 gene locus_tag LOCUS_00830 100362 103595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 104712 103723 gene locus_tag LOCUS_00840 104712 103723 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_00840 105874 104705 gene locus_tag LOCUS_00850 105874 104705 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_00850 107420 105867 gene locus_tag LOCUS_00860 107420 105867 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_00860 108775 107600 gene locus_tag LOCUS_00870 108775 107600 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064307.1 protein_id gnl|my_center|LOCUS_00870 109529 108900 gene locus_tag LOCUS_00880 109529 108900 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389803.1 protein_id gnl|my_center|LOCUS_00880 109863 111203 gene locus_tag LOCUS_00890 109863 111203 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461055.1 protein_id gnl|my_center|LOCUS_00890 111696 112520 gene locus_tag LOCUS_00900 gene noc 111696 112520 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_00900 112735 113511 gene locus_tag LOCUS_00910 112735 113511 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_00910 113516 114394 gene locus_tag LOCUS_00920 113516 114394 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_00920 114391 114942 gene locus_tag LOCUS_00930 114391 114942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 115003 116292 gene locus_tag LOCUS_00940 gene serS 115003 116292 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963346.1 protein_id gnl|my_center|LOCUS_00940 116374 116859 gene locus_tag LOCUS_00950 gene mscL 116374 116859 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104883.1 protein_id gnl|my_center|LOCUS_00950 116872 117072 gene locus_tag LOCUS_00960 116872 117072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 117085 117804 gene locus_tag LOCUS_00970 gene rsmG 117085 117804 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048453.1 protein_id gnl|my_center|LOCUS_00970 117881 118618 gene locus_tag LOCUS_00980 gene minD 117881 118618 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503309.1 protein_id gnl|my_center|LOCUS_00980 118745 119161 gene locus_tag LOCUS_00990 gene mgsA 118745 119161 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_00990 119262 120620 gene locus_tag LOCUS_01000 gene hisS 119262 120620 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036976.1 protein_id gnl|my_center|LOCUS_01000 120634 121095 gene locus_tag LOCUS_01010 120634 121095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 121105 121569 gene locus_tag LOCUS_01020 121105 121569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 121676 123481 gene locus_tag LOCUS_01030 gene aspS 121676 123481 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_01030 124526 123564 gene locus_tag LOCUS_01040 124526 123564 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754206.1 protein_id gnl|my_center|LOCUS_01040 125463 124702 gene locus_tag LOCUS_01050 125463 124702 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_01050 125968 125531 gene locus_tag LOCUS_01060 125968 125531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 126366 126064 gene locus_tag LOCUS_01070 126366 126064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 128148 127312 gene locus_tag LOCUS_01080 128148 127312 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_01080 129181 128243 gene locus_tag LOCUS_01090 129181 128243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 130740 129277 gene locus_tag LOCUS_01100 130740 129277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 131354 130737 gene locus_tag LOCUS_01110 131354 130737 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_01110 131824 131390 gene locus_tag LOCUS_01120 gene dtd 131824 131390 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_01120 133075 132251 gene locus_tag LOCUS_01130 133075 132251 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897816.1 protein_id gnl|my_center|LOCUS_01130 134043 133129 gene locus_tag LOCUS_01140 134043 133129 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_01140 134510 134040 gene locus_tag LOCUS_01150 gene lspA 134510 134040 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295859.1 protein_id gnl|my_center|LOCUS_01150 135582 134533 gene locus_tag LOCUS_01160 135582 134533 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176645.1 protein_id gnl|my_center|LOCUS_01160 138438 135682 gene locus_tag LOCUS_01170 gene ileS 138438 135682 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_01170 139306 138587 gene locus_tag LOCUS_01180 139306 138587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 139887 139360 gene locus_tag LOCUS_01190 139887 139360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 140671 139940 gene locus_tag LOCUS_01200 140671 139940 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_01200 141902 140676 gene locus_tag LOCUS_01210 141902 140676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 142232 141978 gene locus_tag LOCUS_01220 gene hfq 142232 141978 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811582.1 protein_id gnl|my_center|LOCUS_01220 143220 142264 gene locus_tag LOCUS_01230 gene miaA 143220 142264 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_01230 145374 143284 gene locus_tag LOCUS_01240 145374 143284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 147987 145399 gene locus_tag LOCUS_01250 gene mutS 147987 145399 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_01250 149651 148248 gene locus_tag LOCUS_01260 gene miaB 149651 148248 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_01260 150079 149771 gene locus_tag LOCUS_01270 150079 149771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 150335 150069 gene locus_tag LOCUS_01280 150335 150069 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814556.1 protein_id gnl|my_center|LOCUS_01280 150656 151798 gene locus_tag LOCUS_01290 150656 151798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 151824 152774 gene locus_tag LOCUS_01300 151824 152774 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814607.1 protein_id gnl|my_center|LOCUS_01300 152834 153712 gene locus_tag LOCUS_01310 152834 153712 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272300.1 protein_id gnl|my_center|LOCUS_01310 156471 153877 gene locus_tag LOCUS_01320 gene clpB 156471 153877 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365367.1 protein_id gnl|my_center|LOCUS_01320 157137 156709 gene locus_tag LOCUS_01330 157137 156709 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461281.1 protein_id gnl|my_center|LOCUS_01330 157798 158988 gene locus_tag LOCUS_01340 157798 158988 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966117.1 protein_id gnl|my_center|LOCUS_01340 159136 159831 gene locus_tag LOCUS_01350 159136 159831 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_01350 159828 161954 gene locus_tag LOCUS_01360 159828 161954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 162083 162547 gene locus_tag LOCUS_01370 162083 162547 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228021.1 protein_id gnl|my_center|LOCUS_01370 162644 163351 gene locus_tag LOCUS_01380 162644 163351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 163348 164346 gene locus_tag LOCUS_01390 gene spoIID 163348 164346 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_01390 164343 165038 gene locus_tag LOCUS_01400 164343 165038 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289749.1 protein_id gnl|my_center|LOCUS_01400 165136 167013 gene locus_tag LOCUS_01410 165136 167013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 167206 167562 gene locus_tag LOCUS_01420 167206 167562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 167861 169690 gene locus_tag LOCUS_01430 167861 169690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 170420 169824 gene locus_tag LOCUS_01440 gene lexA 170420 169824 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812299.1 protein_id gnl|my_center|LOCUS_01440 170816 170532 gene locus_tag LOCUS_01450 170816 170532 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944457.1 protein_id gnl|my_center|LOCUS_01450 171088 170813 gene locus_tag LOCUS_01460 171088 170813 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_01460 173741 171228 gene locus_tag LOCUS_01470 173741 171228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 174562 173765 gene locus_tag LOCUS_01480 gene rlmB 174562 173765 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_01480 174834 176960 gene locus_tag LOCUS_01490 gene ftsH 174834 176960 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048280.1 protein_id gnl|my_center|LOCUS_01490 176960 177700 gene locus_tag LOCUS_01500 176960 177700 CDS product DUF3658 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100871.1 protein_id gnl|my_center|LOCUS_01500 178165 177758 gene locus_tag LOCUS_01510 178165 177758 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130484.1 protein_id gnl|my_center|LOCUS_01510 179309 178608 gene locus_tag LOCUS_01520 179309 178608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 181424 179439 gene locus_tag LOCUS_01530 gene metG 181424 179439 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_01530 182388 181477 gene locus_tag LOCUS_01540 182388 181477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 183206 182559 gene locus_tag LOCUS_01550 183206 182559 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_01550 184581 183241 gene locus_tag LOCUS_01560 184581 183241 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_01560 184884 185528 gene locus_tag LOCUS_01570 184884 185528 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322652.1 protein_id gnl|my_center|LOCUS_01570 185535 186299 gene locus_tag LOCUS_01580 185535 186299 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_01580 186330 189095 gene locus_tag LOCUS_01590 186330 189095 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_01590 189644 191044 gene locus_tag LOCUS_01600 189644 191044 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_01600 191196 192587 gene locus_tag LOCUS_01610 gene mnmE 191196 192587 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258674.1 protein_id gnl|my_center|LOCUS_01610 192709 194004 gene locus_tag LOCUS_01620 192709 194004 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_01620 195083 194070 gene locus_tag LOCUS_01630 195083 194070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 195457 195080 gene locus_tag LOCUS_01640 195457 195080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 196582 195476 gene locus_tag LOCUS_01650 196582 195476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 197067 196579 gene locus_tag LOCUS_01660 197067 196579 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_01660 >Feature sequence02 387 752 gene locus_tag LOCUS_01670 387 752 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016333.1 protein_id gnl|my_center|LOCUS_01670 887 1375 gene locus_tag LOCUS_01680 887 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 1401 2003 gene locus_tag LOCUS_01690 1401 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 1996 2649 gene locus_tag LOCUS_01700 1996 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 4104 2740 gene locus_tag LOCUS_01710 4104 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 4488 4189 gene locus_tag LOCUS_01720 4488 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 5832 4615 gene locus_tag LOCUS_01730 5832 4615 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_01730 6941 5847 gene locus_tag LOCUS_01740 gene mltG 6941 5847 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_01740 7594 7004 gene locus_tag LOCUS_01750 7594 7004 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834298.1 protein_id gnl|my_center|LOCUS_01750 8282 7575 gene locus_tag LOCUS_01760 8282 7575 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812008.1 protein_id gnl|my_center|LOCUS_01760 9008 8286 gene locus_tag LOCUS_01770 9008 8286 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393842.1 protein_id gnl|my_center|LOCUS_01770 9189 9707 gene locus_tag LOCUS_01780 9189 9707 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130536.1 protein_id gnl|my_center|LOCUS_01780 10450 9788 gene locus_tag LOCUS_01790 10450 9788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 11661 10885 gene locus_tag LOCUS_01800 11661 10885 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_01800 13005 11722 gene locus_tag LOCUS_01810 13005 11722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 13910 13071 gene locus_tag LOCUS_01820 13910 13071 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_01820 15019 13907 gene locus_tag LOCUS_01830 15019 13907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 16294 15044 gene locus_tag LOCUS_01840 16294 15044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 16507 17304 gene locus_tag LOCUS_01850 16507 17304 CDS product DUF4866 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930717.1 protein_id gnl|my_center|LOCUS_01850 18694 17363 gene locus_tag LOCUS_01860 18694 17363 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475463.1 protein_id gnl|my_center|LOCUS_01860 21652 18728 gene locus_tag LOCUS_01870 21652 18728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 22525 21680 gene locus_tag LOCUS_01880 gene uppP 22525 21680 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_01880 24573 22561 gene locus_tag LOCUS_01890 24573 22561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 25199 24570 gene locus_tag LOCUS_01900 25199 24570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 26259 25192 gene locus_tag LOCUS_01910 gene prfA 26259 25192 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966168.1 protein_id gnl|my_center|LOCUS_01910 26555 26259 gene locus_tag LOCUS_01920 26555 26259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 28482 26593 gene locus_tag LOCUS_01930 28482 26593 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460094.1 protein_id gnl|my_center|LOCUS_01930 28639 29691 gene locus_tag LOCUS_01940 gene mtnA 28639 29691 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583294.1 protein_id gnl|my_center|LOCUS_01940 31158 29770 gene locus_tag LOCUS_01950 31158 29770 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_01950 32238 31189 gene locus_tag LOCUS_01960 32238 31189 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_01960 33075 32587 gene locus_tag LOCUS_01970 33075 32587 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675005.1 protein_id gnl|my_center|LOCUS_01970 33365 33177 gene locus_tag LOCUS_01980 33365 33177 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020514.1 protein_id gnl|my_center|LOCUS_01980 33530 33685 gene locus_tag LOCUS_01990 33530 33685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 33682 35724 gene locus_tag LOCUS_02000 33682 35724 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870144.1 protein_id gnl|my_center|LOCUS_02000 36558 35797 gene locus_tag LOCUS_02010 36558 35797 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213043995.1 protein_id gnl|my_center|LOCUS_02010 37022 36579 gene locus_tag LOCUS_02020 37022 36579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 37223 40195 gene locus_tag LOCUS_02030 37223 40195 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_02030 40188 41489 gene locus_tag LOCUS_02040 40188 41489 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016932.1 protein_id gnl|my_center|LOCUS_02040 41633 43072 gene locus_tag LOCUS_02050 41633 43072 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812813.1 protein_id gnl|my_center|LOCUS_02050 43311 45749 gene locus_tag LOCUS_02060 43311 45749 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964652.1 protein_id gnl|my_center|LOCUS_02060 46206 47576 gene locus_tag LOCUS_02070 46206 47576 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956936.1 protein_id gnl|my_center|LOCUS_02070 48925 48074 gene locus_tag LOCUS_02080 48925 48074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 49367 48912 gene locus_tag LOCUS_02090 49367 48912 CDS product DUF6323 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966705.1 protein_id gnl|my_center|LOCUS_02090 50714 49527 gene locus_tag LOCUS_02100 50714 49527 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119279.1 protein_id gnl|my_center|LOCUS_02100 51406 50711 gene locus_tag LOCUS_02110 gene bioD 51406 50711 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986727.1 protein_id gnl|my_center|LOCUS_02110 52393 51410 gene locus_tag LOCUS_02120 gene bioB 52393 51410 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_02120 52996 52421 gene locus_tag LOCUS_02130 52996 52421 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986729.1 protein_id gnl|my_center|LOCUS_02130 53267 53194 gene locus_tag LOCUS_t00020 53267 53194 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 55626 53371 gene locus_tag LOCUS_02140 55626 53371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 55837 56925 gene locus_tag LOCUS_02150 55837 56925 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948050.1 protein_id gnl|my_center|LOCUS_02150 57118 57042 gene locus_tag LOCUS_t00030 57118 57042 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 57493 57305 gene locus_tag LOCUS_02160 57493 57305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 58206 57583 gene locus_tag LOCUS_02170 58206 57583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 58393 58932 gene locus_tag LOCUS_02180 gene yfcE 58393 58932 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706165.1 protein_id gnl|my_center|LOCUS_02180 61029 58936 gene locus_tag LOCUS_02190 61029 58936 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486311.1 protein_id gnl|my_center|LOCUS_02190 62362 61022 gene locus_tag LOCUS_02200 gene dsdA 62362 61022 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016476.1 protein_id gnl|my_center|LOCUS_02200 63069 62488 gene locus_tag LOCUS_02210 63069 62488 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_02210 63943 63074 gene locus_tag LOCUS_02220 63943 63074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 64445 64116 gene locus_tag LOCUS_02230 64445 64116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 64947 64438 gene locus_tag LOCUS_02240 64947 64438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 66035 64953 gene locus_tag LOCUS_02250 66035 64953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 66315 66037 gene locus_tag LOCUS_02260 66315 66037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 67115 66426 gene locus_tag LOCUS_02270 67115 66426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 68113 67160 gene locus_tag LOCUS_02280 68113 67160 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013877237.1 protein_id gnl|my_center|LOCUS_02280 68233 68469 gene locus_tag LOCUS_02290 68233 68469 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811908.1 protein_id gnl|my_center|LOCUS_02290 69239 68649 gene locus_tag LOCUS_02300 69239 68649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 70190 69258 gene locus_tag LOCUS_02310 gene murB 70190 69258 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963832.1 protein_id gnl|my_center|LOCUS_02310 74264 70383 gene locus_tag LOCUS_02320 gene rpoC 74264 70383 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001788197.1 protein_id gnl|my_center|LOCUS_02320 78144 74287 gene locus_tag LOCUS_02330 gene rpoB 78144 74287 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_02330 79039 78434 gene locus_tag LOCUS_02340 79039 78434 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 protein_id gnl|my_center|LOCUS_02340 79633 79043 gene locus_tag LOCUS_02350 79633 79043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 80099 79758 gene locus_tag LOCUS_02360 gene rplQ 80099 79758 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_02360 81098 80151 gene locus_tag LOCUS_02370 81098 80151 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_02370 81778 81176 gene locus_tag LOCUS_02380 gene rpsD 81778 81176 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_02380 82201 81803 gene locus_tag LOCUS_02390 gene rpsK 82201 81803 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401717.1 protein_id gnl|my_center|LOCUS_02390 82587 82219 gene locus_tag LOCUS_02400 gene rpsM 82587 82219 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_02400 82978 82751 gene locus_tag LOCUS_02410 gene infA 82978 82751 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_02410 83266 82982 gene locus_tag LOCUS_02420 83266 82982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 83988 83263 gene locus_tag LOCUS_02430 gene map 83988 83263 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_02430 84659 84027 gene locus_tag LOCUS_02440 84659 84027 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 protein_id gnl|my_center|LOCUS_02440 86013 84673 gene locus_tag LOCUS_02450 gene secY 86013 84673 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_02450 86453 86013 gene locus_tag LOCUS_02460 gene rplO 86453 86013 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393918.1 protein_id gnl|my_center|LOCUS_02460 86649 86467 gene locus_tag LOCUS_02470 gene rpmD 86649 86467 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814541.1 protein_id gnl|my_center|LOCUS_02470 87165 86665 gene locus_tag LOCUS_02480 gene rpsE 87165 86665 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_02480 87543 87184 gene locus_tag LOCUS_02490 gene rplR 87543 87184 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_02490 88106 87561 gene locus_tag LOCUS_02500 gene rplF 88106 87561 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_02500 88523 88122 gene locus_tag LOCUS_02510 gene rpsH 88523 88122 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_02510 88891 88706 gene locus_tag LOCUS_02520 88891 88706 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_02520 89457 88909 gene locus_tag LOCUS_02530 gene rplE 89457 88909 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_02530 89792 89475 gene locus_tag LOCUS_02540 gene rplX 89792 89475 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_02540 90175 89807 gene locus_tag LOCUS_02550 gene rplN 90175 89807 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966402.1 protein_id gnl|my_center|LOCUS_02550 90452 90189 gene locus_tag LOCUS_02560 gene rpsQ 90452 90189 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_02560 90667 90467 gene locus_tag LOCUS_02570 gene rpmC 90667 90467 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_02570 91107 90664 gene locus_tag LOCUS_02580 gene rplP 91107 90664 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_02580 91940 91107 gene locus_tag LOCUS_02590 gene rpsC 91940 91107 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421163.1 protein_id gnl|my_center|LOCUS_02590 92291 91956 gene locus_tag LOCUS_02600 gene rplV 92291 91956 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887891.1 protein_id gnl|my_center|LOCUS_02600 92579 92307 gene locus_tag LOCUS_02610 gene rpsS 92579 92307 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_02610 93434 92598 gene locus_tag LOCUS_02620 gene rplB 93434 92598 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_02620 93746 93450 gene locus_tag LOCUS_02630 gene rplW 93746 93450 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_02630 94363 93743 gene locus_tag LOCUS_02640 gene rplD 94363 93743 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_02640 95108 94383 gene locus_tag LOCUS_02650 gene rplC 95108 94383 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_02650 95561 95250 gene locus_tag LOCUS_02660 gene rpsJ 95561 95250 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_02660 96047 96628 gene locus_tag LOCUS_02670 96047 96628 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999314.1 protein_id gnl|my_center|LOCUS_02670 96857 98266 gene locus_tag LOCUS_02680 96857 98266 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901990.1 protein_id gnl|my_center|LOCUS_02680 99401 98445 gene locus_tag LOCUS_02690 99401 98445 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459063.1 protein_id gnl|my_center|LOCUS_02690 99766 99470 gene locus_tag LOCUS_02700 99766 99470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 102059 99798 gene locus_tag LOCUS_02710 gene cutC 102059 99798 CDS product choline trimethylamine-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272795.1 protein_id gnl|my_center|LOCUS_02710 102898 102122 gene locus_tag LOCUS_02720 102898 102122 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902971.1 protein_id gnl|my_center|LOCUS_02720 103040 103954 gene locus_tag LOCUS_02730 103040 103954 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989930.1 protein_id gnl|my_center|LOCUS_02730 105308 104013 gene locus_tag LOCUS_02740 gene lysA 105308 104013 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280659.1 protein_id gnl|my_center|LOCUS_02740 106094 105366 gene locus_tag LOCUS_02750 gene dapB 106094 105366 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438808.1 protein_id gnl|my_center|LOCUS_02750 107015 106122 gene locus_tag LOCUS_02760 gene dapA 107015 106122 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_02760 107542 107796 gene locus_tag LOCUS_02770 107542 107796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 110068 108044 gene locus_tag LOCUS_02780 110068 108044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 110563 110069 gene locus_tag LOCUS_02790 110563 110069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 110771 112168 gene locus_tag LOCUS_02800 110771 112168 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461040.1 protein_id gnl|my_center|LOCUS_02800 112352 112277 gene locus_tag LOCUS_t00040 112352 112277 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 112631 112467 gene locus_tag LOCUS_02810 112631 112467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 112780 113952 gene locus_tag LOCUS_02820 112780 113952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 113949 115937 gene locus_tag LOCUS_02830 113949 115937 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_02830 116694 116002 gene locus_tag LOCUS_02840 116694 116002 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_02840 117845 116691 gene locus_tag LOCUS_02850 117845 116691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 118637 117885 gene locus_tag LOCUS_02860 118637 117885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 119385 118654 gene locus_tag LOCUS_02870 119385 118654 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812187.1 protein_id gnl|my_center|LOCUS_02870 120724 119501 gene locus_tag LOCUS_02880 120724 119501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 121325 120921 gene locus_tag LOCUS_02890 121325 120921 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813029.1 protein_id gnl|my_center|LOCUS_02890 121532 121347 gene locus_tag LOCUS_02900 121532 121347 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669524.1 protein_id gnl|my_center|LOCUS_02900 122554 121703 gene locus_tag LOCUS_02910 122554 121703 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888619.1 protein_id gnl|my_center|LOCUS_02910 122773 123045 gene locus_tag LOCUS_02920 122773 123045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 123080 123286 gene locus_tag LOCUS_02930 123080 123286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 123283 124086 gene locus_tag LOCUS_02940 123283 124086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 125034 124156 gene locus_tag LOCUS_02950 125034 124156 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288377.1 protein_id gnl|my_center|LOCUS_02950 127078 125432 gene locus_tag LOCUS_02960 127078 125432 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_02960 127841 127164 gene locus_tag LOCUS_02970 gene maeM 127841 127164 CDS product two-component system response regulator MaeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968074.1 protein_id gnl|my_center|LOCUS_02970 129420 128002 gene locus_tag LOCUS_02980 129420 128002 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346373.1 protein_id gnl|my_center|LOCUS_02980 131127 129640 gene locus_tag LOCUS_02990 131127 129640 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 protein_id gnl|my_center|LOCUS_02990 131605 132507 gene locus_tag LOCUS_03000 131605 132507 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700054.1 protein_id gnl|my_center|LOCUS_03000 132677 133462 gene locus_tag LOCUS_03010 132677 133462 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199877.1 protein_id gnl|my_center|LOCUS_03010 133459 134223 gene locus_tag LOCUS_03020 133459 134223 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243784.1 protein_id gnl|my_center|LOCUS_03020 134306 135391 gene locus_tag LOCUS_03030 134306 135391 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808730.1 protein_id gnl|my_center|LOCUS_03030 135484 136050 gene locus_tag LOCUS_03040 135484 136050 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_03040 136079 137131 gene locus_tag LOCUS_03050 136079 137131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 137357 140308 gene locus_tag LOCUS_03060 137357 140308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 140489 140719 gene locus_tag LOCUS_03070 140489 140719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 140807 141454 gene locus_tag LOCUS_03080 140807 141454 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089970.1 protein_id gnl|my_center|LOCUS_03080 141462 142871 gene locus_tag LOCUS_03090 gene pepV 141462 142871 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027398.1 protein_id gnl|my_center|LOCUS_03090 142885 143430 gene locus_tag LOCUS_03100 142885 143430 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_03100 143427 143990 gene locus_tag LOCUS_03110 143427 143990 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_03110 144642 144064 gene locus_tag LOCUS_03120 144642 144064 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047752.1 protein_id gnl|my_center|LOCUS_03120 146309 144675 gene locus_tag LOCUS_03130 146309 144675 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_03130 147113 146313 gene locus_tag LOCUS_03140 147113 146313 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362363.1 protein_id gnl|my_center|LOCUS_03140 147973 147110 gene locus_tag LOCUS_03150 gene accD 147973 147110 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173351.1 protein_id gnl|my_center|LOCUS_03150 149315 148008 gene locus_tag LOCUS_03160 149315 148008 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287622.1 protein_id gnl|my_center|LOCUS_03160 149734 149297 gene locus_tag LOCUS_03170 gene fabZ 149734 149297 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939641.1 protein_id gnl|my_center|LOCUS_03170 150158 149745 gene locus_tag LOCUS_03180 150158 149745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 151399 150155 gene locus_tag LOCUS_03190 gene fabF 151399 150155 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_03190 152215 151475 gene locus_tag LOCUS_03200 gene fabG 152215 151475 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_03200 153126 152212 gene locus_tag LOCUS_03210 gene fabD 153126 152212 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765648.1 protein_id gnl|my_center|LOCUS_03210 154058 153114 gene locus_tag LOCUS_03220 gene fabK 154058 153114 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460502.1 protein_id gnl|my_center|LOCUS_03220 154276 154055 gene locus_tag LOCUS_03230 154276 154055 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257841.1 protein_id gnl|my_center|LOCUS_03230 154994 154500 gene locus_tag LOCUS_03240 154994 154500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 155449 154991 gene locus_tag LOCUS_03250 155449 154991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 155746 155456 gene locus_tag LOCUS_03260 155746 155456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 156335 155898 gene locus_tag LOCUS_03270 156335 155898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 157037 156540 gene locus_tag LOCUS_03280 157037 156540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 157278 156919 gene locus_tag LOCUS_03290 157278 156919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 158149 157265 gene locus_tag LOCUS_03300 158149 157265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 158517 158146 gene locus_tag LOCUS_03310 158517 158146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 158724 158521 gene locus_tag LOCUS_03320 158724 158521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 158904 159470 gene locus_tag LOCUS_03330 gene yfcE 158904 159470 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_03330 159461 160801 gene locus_tag LOCUS_03340 159461 160801 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_03340 161642 161115 gene locus_tag LOCUS_03350 161642 161115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 161998 162417 gene locus_tag LOCUS_03360 161998 162417 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459277.1 protein_id gnl|my_center|LOCUS_03360 164196 162544 gene locus_tag LOCUS_03370 164196 162544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 164600 165979 gene locus_tag LOCUS_03380 gene mgtE 164600 165979 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_03380 166597 166127 gene locus_tag LOCUS_03390 166597 166127 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814552.1 protein_id gnl|my_center|LOCUS_03390 166723 167400 gene locus_tag LOCUS_03400 166723 167400 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765568.1 protein_id gnl|my_center|LOCUS_03400 167439 168347 gene locus_tag LOCUS_03410 167439 168347 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_03410 168360 169244 gene locus_tag LOCUS_03420 168360 169244 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494241.1 protein_id gnl|my_center|LOCUS_03420 172769 169341 gene locus_tag LOCUS_03430 172769 169341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 174396 173134 gene locus_tag LOCUS_03440 174396 173134 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_03440 175598 174393 gene locus_tag LOCUS_03450 gene thiI 175598 174393 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_03450 177296 175776 gene locus_tag LOCUS_03460 177296 175776 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_03460 178771 177419 gene locus_tag LOCUS_03470 178771 177419 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_03470 178965 179258 gene locus_tag LOCUS_03480 178965 179258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 181252 179345 gene locus_tag LOCUS_03490 gene htpG 181252 179345 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 protein_id gnl|my_center|LOCUS_03490 181507 182802 gene locus_tag LOCUS_03500 181507 182802 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_03500 184069 183389 gene locus_tag LOCUS_03510 184069 183389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 184277 184651 gene locus_tag LOCUS_03520 184277 184651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 184648 185304 gene locus_tag LOCUS_03530 184648 185304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 185397 185681 gene locus_tag LOCUS_03540 185397 185681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 185675 185950 gene locus_tag LOCUS_03550 185675 185950 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_03550 187638 186022 gene locus_tag LOCUS_03560 187638 186022 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869253.1 protein_id gnl|my_center|LOCUS_03560 189371 187749 gene locus_tag LOCUS_03570 189371 187749 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_03570 190440 189478 gene locus_tag LOCUS_03580 190440 189478 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_03580 191419 190433 gene locus_tag LOCUS_03590 191419 190433 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533422.1 protein_id gnl|my_center|LOCUS_03590 192344 191403 gene locus_tag LOCUS_03600 192344 191403 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_03600 193283 192357 gene locus_tag LOCUS_03610 193283 192357 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_03610 194844 193528 gene locus_tag LOCUS_03620 gene rpoN 194844 193528 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462176.1 protein_id gnl|my_center|LOCUS_03620 195873 194938 gene locus_tag LOCUS_03630 195873 194938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 196069 196461 gene locus_tag LOCUS_03640 196069 196461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 >Feature sequence03 1410 991 gene locus_tag LOCUS_03650 1410 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03650 2310 1576 gene locus_tag LOCUS_03660 2310 1576 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_03660 3222 2425 gene locus_tag LOCUS_03670 3222 2425 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223077.1 protein_id gnl|my_center|LOCUS_03670 3911 3210 gene locus_tag LOCUS_03680 3911 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 4186 3971 gene locus_tag LOCUS_03690 4186 3971 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_03690 6358 4400 gene locus_tag LOCUS_03700 6358 4400 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811135.1 protein_id gnl|my_center|LOCUS_03700 6969 6355 gene locus_tag LOCUS_03710 6969 6355 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439452.1 protein_id gnl|my_center|LOCUS_03710 7649 6966 gene locus_tag LOCUS_03720 gene cmk 7649 6966 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565355.1 protein_id gnl|my_center|LOCUS_03720 8903 7653 gene locus_tag LOCUS_03730 8903 7653 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_03730 9769 8900 gene locus_tag LOCUS_03740 9769 8900 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_03740 10602 9877 gene locus_tag LOCUS_03750 10602 9877 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_03750 11820 10714 gene locus_tag LOCUS_03760 11820 10714 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_03760 14539 11885 gene locus_tag LOCUS_03770 gene polA 14539 11885 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723249.1 protein_id gnl|my_center|LOCUS_03770 16302 14626 gene locus_tag LOCUS_03780 16302 14626 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036677.1 protein_id gnl|my_center|LOCUS_03780 16673 16323 gene locus_tag LOCUS_03790 16673 16323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 16856 17053 gene locus_tag LOCUS_03800 16856 17053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 17637 17152 gene locus_tag LOCUS_03810 17637 17152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 18538 17621 gene locus_tag LOCUS_03820 18538 17621 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_03820 19300 18542 gene locus_tag LOCUS_03830 19300 18542 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_03830 19620 21107 gene locus_tag LOCUS_03840 19620 21107 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_03840 21163 22179 gene locus_tag LOCUS_03850 gene asnA 21163 22179 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_03850 23807 22272 gene locus_tag LOCUS_03860 23807 22272 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_03860 24572 23952 gene locus_tag LOCUS_03870 24572 23952 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965893.1 protein_id gnl|my_center|LOCUS_03870 25735 24587 gene locus_tag LOCUS_03880 25735 24587 CDS product serine-tRNA(Ala) deacylase AlaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435901.1 protein_id gnl|my_center|LOCUS_03880 26880 25861 gene locus_tag LOCUS_03890 26880 25861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 27716 27000 gene locus_tag LOCUS_03900 gene sigE 27716 27000 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_03900 28584 27727 gene locus_tag LOCUS_03910 gene spoIIGA 28584 27727 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_03910 29083 28802 gene locus_tag LOCUS_03920 29083 28802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 29293 29682 gene locus_tag LOCUS_03930 29293 29682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 30435 29779 gene locus_tag LOCUS_03940 30435 29779 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_03940 31149 30439 gene locus_tag LOCUS_03950 gene trmB 31149 30439 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939002.1 protein_id gnl|my_center|LOCUS_03950 31337 32026 gene locus_tag LOCUS_03960 gene radC 31337 32026 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328269.1 protein_id gnl|my_center|LOCUS_03960 32043 34016 gene locus_tag LOCUS_03970 gene uvrB 32043 34016 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_03970 34047 34949 gene locus_tag LOCUS_03980 34047 34949 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904266.1 protein_id gnl|my_center|LOCUS_03980 34956 35447 gene locus_tag LOCUS_03990 gene ybaK 34956 35447 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244878.1 protein_id gnl|my_center|LOCUS_03990 35467 38292 gene locus_tag LOCUS_04000 gene uvrA 35467 38292 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_04000 38321 40573 gene locus_tag LOCUS_04010 38321 40573 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_04010 40598 41257 gene locus_tag LOCUS_04020 40598 41257 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_04020 41357 42385 gene locus_tag LOCUS_04030 41357 42385 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393848.1 protein_id gnl|my_center|LOCUS_04030 42800 42528 gene locus_tag LOCUS_04040 42800 42528 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_04040 42989 44071 gene locus_tag LOCUS_04050 gene spoIVB 42989 44071 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965372.1 protein_id gnl|my_center|LOCUS_04050 44238 45464 gene locus_tag LOCUS_04060 44238 45464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 45755 47023 gene locus_tag LOCUS_04070 45755 47023 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_04070 47097 47552 gene locus_tag LOCUS_04080 47097 47552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 48970 47630 gene locus_tag LOCUS_04090 48970 47630 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_04090 50370 49012 gene locus_tag LOCUS_04100 50370 49012 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_04100 52411 50675 gene locus_tag LOCUS_04110 gene iorA 52411 50675 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_04110 52777 53544 gene locus_tag LOCUS_04120 gene spo0A 52777 53544 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_04120 54055 54498 gene locus_tag LOCUS_04130 gene infC 54055 54498 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886591.1 protein_id gnl|my_center|LOCUS_04130 54523 54726 gene locus_tag LOCUS_04140 gene rpmI 54523 54726 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015481.1 protein_id gnl|my_center|LOCUS_04140 54760 55116 gene locus_tag LOCUS_04150 gene rplT 54760 55116 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028296.1 protein_id gnl|my_center|LOCUS_04150 56019 55255 gene locus_tag LOCUS_04160 56019 55255 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948811.1 protein_id gnl|my_center|LOCUS_04160 56950 56012 gene locus_tag LOCUS_04170 56950 56012 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948810.1 protein_id gnl|my_center|LOCUS_04170 58022 57003 gene locus_tag LOCUS_04180 58022 57003 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_04180 58823 58626 gene locus_tag LOCUS_04190 58823 58626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 59039 59911 gene locus_tag LOCUS_04200 59039 59911 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731454.1 protein_id gnl|my_center|LOCUS_04200 60035 60217 gene locus_tag LOCUS_04210 60035 60217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 60321 60473 gene locus_tag LOCUS_04220 60321 60473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 62275 60872 gene locus_tag LOCUS_04230 gene cysS 62275 60872 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_04230 62945 62262 gene locus_tag LOCUS_04240 62945 62262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 63384 63716 gene locus_tag LOCUS_04250 63384 63716 CDS product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963786.1 protein_id gnl|my_center|LOCUS_04250 64868 64056 gene locus_tag LOCUS_04260 64868 64056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 65582 64881 gene locus_tag LOCUS_04270 65582 64881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 66115 65579 gene locus_tag LOCUS_04280 66115 65579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 67114 66149 gene locus_tag LOCUS_04290 67114 66149 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206433.1 protein_id gnl|my_center|LOCUS_04290 67338 67772 gene locus_tag LOCUS_04300 67338 67772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 68870 68052 gene locus_tag LOCUS_04310 68870 68052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 69020 69232 gene locus_tag LOCUS_04320 69020 69232 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_04320 69322 70221 gene locus_tag LOCUS_04330 69322 70221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 71590 70433 gene locus_tag LOCUS_04340 71590 70433 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459150.1 protein_id gnl|my_center|LOCUS_04340 73215 71731 gene locus_tag LOCUS_04350 73215 71731 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903237.1 protein_id gnl|my_center|LOCUS_04350 74345 73437 gene locus_tag LOCUS_04360 74345 73437 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966679.1 protein_id gnl|my_center|LOCUS_04360 74499 74633 gene locus_tag LOCUS_04370 74499 74633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 74710 78717 gene locus_tag LOCUS_04380 74710 78717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 79186 78758 gene locus_tag LOCUS_04390 gene ytfJ 79186 78758 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392871.1 protein_id gnl|my_center|LOCUS_04390 79889 79161 gene locus_tag LOCUS_04400 79889 79161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 80425 79886 gene locus_tag LOCUS_04410 gene scpB 80425 79886 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259764.1 protein_id gnl|my_center|LOCUS_04410 81218 80457 gene locus_tag LOCUS_04420 81218 80457 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351869.1 protein_id gnl|my_center|LOCUS_04420 81930 81232 gene locus_tag LOCUS_04430 81930 81232 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_04430 83930 82092 gene locus_tag LOCUS_04440 gene recQ 83930 82092 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058493.1 protein_id gnl|my_center|LOCUS_04440 84868 84005 gene locus_tag LOCUS_04450 84868 84005 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_04450 85001 84861 gene locus_tag LOCUS_04460 85001 84861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 85642 84998 gene locus_tag LOCUS_04470 85642 84998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 85833 86804 gene locus_tag LOCUS_04480 gene pta 85833 86804 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641060.1 protein_id gnl|my_center|LOCUS_04480 87411 86971 gene locus_tag LOCUS_04490 87411 86971 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288290.1 protein_id gnl|my_center|LOCUS_04490 87516 88505 gene locus_tag LOCUS_04500 87516 88505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 89538 89017 gene locus_tag LOCUS_04510 89538 89017 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_04510 90057 89581 gene locus_tag LOCUS_04520 gene smpB 90057 89581 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_04520 90606 90187 gene locus_tag LOCUS_04530 90606 90187 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861328.1 protein_id gnl|my_center|LOCUS_04530 91314 90787 gene locus_tag LOCUS_04540 91314 90787 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_04540 91512 91802 gene locus_tag LOCUS_04550 91512 91802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 91833 92720 gene locus_tag LOCUS_04560 91833 92720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 92875 93135 gene locus_tag LOCUS_04570 92875 93135 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812819.1 protein_id gnl|my_center|LOCUS_04570 93167 93454 gene locus_tag LOCUS_04580 93167 93454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 93806 93534 gene locus_tag LOCUS_04590 93806 93534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 93975 94952 gene locus_tag LOCUS_04600 93975 94952 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966723.1 protein_id gnl|my_center|LOCUS_04600 96387 94975 gene locus_tag LOCUS_04610 96387 94975 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_04610 96936 100409 gene locus_tag LOCUS_04620 96936 100409 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425597.1 protein_id gnl|my_center|LOCUS_04620 100881 100474 gene locus_tag LOCUS_04630 100881 100474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 101757 100882 gene locus_tag LOCUS_04640 101757 100882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 103126 101900 gene locus_tag LOCUS_04650 103126 101900 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_04650 103658 104740 gene locus_tag LOCUS_04660 gene mtnA 103658 104740 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392493.1 protein_id gnl|my_center|LOCUS_04660 104737 105399 gene locus_tag LOCUS_04670 104737 105399 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256490.1 protein_id gnl|my_center|LOCUS_04670 105711 106094 gene locus_tag LOCUS_04680 105711 106094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 106270 107496 gene locus_tag LOCUS_04690 106270 107496 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816160.1 protein_id gnl|my_center|LOCUS_04690 108899 107571 gene locus_tag LOCUS_04700 108899 107571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 110965 108896 gene locus_tag LOCUS_04710 110965 108896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 111136 112194 gene locus_tag LOCUS_04720 111136 112194 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065256.1 protein_id gnl|my_center|LOCUS_04720 112238 113062 gene locus_tag LOCUS_04730 gene rlmA 112238 113062 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072721.1 protein_id gnl|my_center|LOCUS_04730 114099 113131 gene locus_tag LOCUS_04740 114099 113131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 114477 114124 gene locus_tag LOCUS_04750 114477 114124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 114910 115557 gene locus_tag LOCUS_04760 gene rpe 114910 115557 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_04760 115596 116198 gene locus_tag LOCUS_04770 gene recR 115596 116198 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963454.1 protein_id gnl|my_center|LOCUS_04770 116348 117757 gene locus_tag LOCUS_04780 116348 117757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 118005 117838 gene locus_tag LOCUS_04790 118005 117838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 118808 118086 gene locus_tag LOCUS_04800 118808 118086 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989471.1 protein_id gnl|my_center|LOCUS_04800 120363 118876 gene locus_tag LOCUS_04810 120363 118876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 120654 121451 gene locus_tag LOCUS_04820 120654 121451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 123221 121509 gene locus_tag LOCUS_04830 123221 121509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 123907 123236 gene locus_tag LOCUS_04840 123907 123236 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_04840 124627 123935 gene locus_tag LOCUS_04850 124627 123935 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_04850 124841 125518 gene locus_tag LOCUS_04860 124841 125518 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_04860 125512 126735 gene locus_tag LOCUS_04870 125512 126735 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814514.1 protein_id gnl|my_center|LOCUS_04870 127593 126808 gene locus_tag LOCUS_04880 127593 126808 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144055.1 protein_id gnl|my_center|LOCUS_04880 128263 127607 gene locus_tag LOCUS_04890 128263 127607 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120838.1 protein_id gnl|my_center|LOCUS_04890 129239 128382 gene locus_tag LOCUS_04900 129239 128382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 130524 129436 gene locus_tag LOCUS_04910 130524 129436 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286870.1 protein_id gnl|my_center|LOCUS_04910 130626 131321 gene locus_tag LOCUS_04920 gene dapD 130626 131321 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286875.1 protein_id gnl|my_center|LOCUS_04920 132717 131449 gene locus_tag LOCUS_04930 132717 131449 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272456.1 protein_id gnl|my_center|LOCUS_04930 133406 132714 gene locus_tag LOCUS_04940 133406 132714 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460542.1 protein_id gnl|my_center|LOCUS_04940 133558 134472 gene locus_tag LOCUS_04950 133558 134472 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460543.1 protein_id gnl|my_center|LOCUS_04950 134469 135218 gene locus_tag LOCUS_04960 134469 135218 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272457.1 protein_id gnl|my_center|LOCUS_04960 135222 135950 gene locus_tag LOCUS_04970 135222 135950 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460545.1 protein_id gnl|my_center|LOCUS_04970 136784 135951 gene locus_tag LOCUS_04980 gene dapF 136784 135951 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_04980 137145 138665 gene locus_tag LOCUS_04990 137145 138665 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048415.1 protein_id gnl|my_center|LOCUS_04990 >Feature sequence04 1600 119 gene locus_tag LOCUS_05000 1600 119 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945999.1 protein_id gnl|my_center|LOCUS_05000 3089 1704 gene locus_tag LOCUS_05010 gene ygjG 3089 1704 CDS product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633381.1 protein_id gnl|my_center|LOCUS_05010 3411 4184 gene locus_tag LOCUS_05020 3411 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 4382 5761 gene locus_tag LOCUS_05030 4382 5761 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477816.1 protein_id gnl|my_center|LOCUS_05030 6814 5909 gene locus_tag LOCUS_05040 6814 5909 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925599.1 protein_id gnl|my_center|LOCUS_05040 7688 6819 gene locus_tag LOCUS_05050 gene truB 7688 6819 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100522.1 protein_id gnl|my_center|LOCUS_05050 8631 7681 gene locus_tag LOCUS_05060 8631 7681 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_05060 8987 8628 gene locus_tag LOCUS_05070 gene rbfA 8987 8628 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428234.1 protein_id gnl|my_center|LOCUS_05070 11574 9076 gene locus_tag LOCUS_05080 11574 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 12015 11593 gene locus_tag LOCUS_05090 12015 11593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 12283 12008 gene locus_tag LOCUS_05100 12283 12008 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_05100 13689 12355 gene locus_tag LOCUS_05110 gene nusA 13689 12355 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_05110 14234 13779 gene locus_tag LOCUS_05120 14234 13779 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_05120 14615 15733 gene locus_tag LOCUS_05130 14615 15733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 16230 17723 gene locus_tag LOCUS_05140 16230 17723 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_05140 18468 17935 gene locus_tag LOCUS_05150 gene dcd 18468 17935 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_05150 18878 18549 gene locus_tag LOCUS_05160 18878 18549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 19203 20477 gene locus_tag LOCUS_05170 19203 20477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 20474 24013 gene locus_tag LOCUS_05180 gene nifJ 20474 24013 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_05180 24010 25377 gene locus_tag LOCUS_05190 gene gltA 24010 25377 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_05190 25802 28291 gene locus_tag LOCUS_05200 25802 28291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 28395 28877 gene locus_tag LOCUS_05210 28395 28877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 28920 29570 gene locus_tag LOCUS_05220 28920 29570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 29584 30474 gene locus_tag LOCUS_05230 29584 30474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 31396 30569 gene locus_tag LOCUS_05240 31396 30569 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_05240 31645 32514 gene locus_tag LOCUS_05250 gene cdaA 31645 32514 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420697.1 protein_id gnl|my_center|LOCUS_05250 32511 33755 gene locus_tag LOCUS_05260 32511 33755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 33807 34253 gene locus_tag LOCUS_05270 33807 34253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 34238 35158 gene locus_tag LOCUS_05280 34238 35158 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_05280 35155 35736 gene locus_tag LOCUS_05290 35155 35736 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_05290 35798 36676 gene locus_tag LOCUS_05300 35798 36676 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_05300 36697 36960 gene locus_tag LOCUS_05310 36697 36960 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392410.1 protein_id gnl|my_center|LOCUS_05310 36957 37553 gene locus_tag LOCUS_05320 gene gmk 36957 37553 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_05320 37560 37961 gene locus_tag LOCUS_05330 37560 37961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 37974 40460 gene locus_tag LOCUS_05340 gene priA 37974 40460 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_05340 40523 41014 gene locus_tag LOCUS_05350 gene def 40523 41014 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_05350 41027 41947 gene locus_tag LOCUS_05360 gene fmt 41027 41947 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 protein_id gnl|my_center|LOCUS_05360 41977 43311 gene locus_tag LOCUS_05370 gene rsmB 41977 43311 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_05370 43308 44354 gene locus_tag LOCUS_05380 gene rlmN 43308 44354 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_05380 44380 45114 gene locus_tag LOCUS_05390 gene prpC 44380 45114 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_05390 45131 47113 gene locus_tag LOCUS_05400 gene pknB 45131 47113 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087065956.1 protein_id gnl|my_center|LOCUS_05400 47110 47994 gene locus_tag LOCUS_05410 gene rsgA 47110 47994 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113935.1 protein_id gnl|my_center|LOCUS_05410 48228 49754 gene locus_tag LOCUS_05420 48228 49754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 51084 49837 gene locus_tag LOCUS_05430 51084 49837 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_05430 51297 52232 gene locus_tag LOCUS_05440 gene fba 51297 52232 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948010.1 protein_id gnl|my_center|LOCUS_05440 52338 53945 gene locus_tag LOCUS_05450 52338 53945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 53963 57322 gene locus_tag LOCUS_05460 gene addB 53963 57322 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_05460 57300 60905 gene locus_tag LOCUS_05470 gene addA 57300 60905 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572274.1 protein_id gnl|my_center|LOCUS_05470 61008 61211 gene locus_tag LOCUS_05480 gene rpmE 61008 61211 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_05480 61353 61850 gene locus_tag LOCUS_05490 61353 61850 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434028.1 protein_id gnl|my_center|LOCUS_05490 61899 63206 gene locus_tag LOCUS_05500 gene hflX 61899 63206 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_05500 63211 63852 gene locus_tag LOCUS_05510 63211 63852 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965593.1 protein_id gnl|my_center|LOCUS_05510 63989 64993 gene locus_tag LOCUS_05520 63989 64993 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_05520 65026 66786 gene locus_tag LOCUS_05530 gene dnaG 65026 66786 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896376.1 protein_id gnl|my_center|LOCUS_05530 66551 66462 gene locus_tag LOCUS_t00050 66551 66462 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 66789 68090 gene locus_tag LOCUS_05540 gene rpoD 66789 68090 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964612.1 protein_id gnl|my_center|LOCUS_05540 69000 68152 gene locus_tag LOCUS_05550 69000 68152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 69791 68997 gene locus_tag LOCUS_05560 69791 68997 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_05560 70031 70831 gene locus_tag LOCUS_05570 70031 70831 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948565.1 protein_id gnl|my_center|LOCUS_05570 70825 71328 gene locus_tag LOCUS_05580 70825 71328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 71454 71999 gene locus_tag LOCUS_05590 71454 71999 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393868.1 protein_id gnl|my_center|LOCUS_05590 73276 72134 gene locus_tag LOCUS_05600 gene acdA 73276 72134 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_05600 75197 73800 gene locus_tag LOCUS_05610 75197 73800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 75975 75349 gene locus_tag LOCUS_05620 75975 75349 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965678.1 protein_id gnl|my_center|LOCUS_05620 76856 76044 gene locus_tag LOCUS_05630 76856 76044 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404186.1 protein_id gnl|my_center|LOCUS_05630 81077 77055 gene locus_tag LOCUS_05640 gene carB 81077 77055 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_05640 82150 81077 gene locus_tag LOCUS_05650 82150 81077 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723080.1 protein_id gnl|my_center|LOCUS_05650 83770 82439 gene locus_tag LOCUS_05660 gene glnA 83770 82439 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393265.1 protein_id gnl|my_center|LOCUS_05660 84140 84862 gene locus_tag LOCUS_05670 84140 84862 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_05670 84876 86702 gene locus_tag LOCUS_05680 gene glmS 84876 86702 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432446.1 protein_id gnl|my_center|LOCUS_05680 86741 87469 gene locus_tag LOCUS_05690 gene nadE 86741 87469 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808614.1 protein_id gnl|my_center|LOCUS_05690 88732 87563 gene locus_tag LOCUS_05700 88732 87563 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989507.1 protein_id gnl|my_center|LOCUS_05700 88940 90058 gene locus_tag LOCUS_05710 88940 90058 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644645.1 protein_id gnl|my_center|LOCUS_05710 90078 90944 gene locus_tag LOCUS_05720 90078 90944 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416734.1 protein_id gnl|my_center|LOCUS_05720 90966 91736 gene locus_tag LOCUS_05730 90966 91736 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_05730 92179 92778 gene locus_tag LOCUS_05740 92179 92778 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_05740 92811 94160 gene locus_tag LOCUS_05750 92811 94160 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_05750 94478 95644 gene locus_tag LOCUS_05760 94478 95644 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903799.1 protein_id gnl|my_center|LOCUS_05760 97298 95808 gene locus_tag LOCUS_05770 gene gltX 97298 95808 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_05770 97496 98494 gene locus_tag LOCUS_05780 gene trpS 97496 98494 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048270.1 protein_id gnl|my_center|LOCUS_05780 98530 99699 gene locus_tag LOCUS_05790 98530 99699 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356585.1 protein_id gnl|my_center|LOCUS_05790 99611 100756 gene locus_tag LOCUS_05800 gene wecB 99611 100756 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966158.1 protein_id gnl|my_center|LOCUS_05800 100789 101523 gene locus_tag LOCUS_05810 100789 101523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 101778 101518 gene locus_tag LOCUS_05820 101778 101518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 102166 101771 gene locus_tag LOCUS_05830 102166 101771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 102475 102203 gene locus_tag LOCUS_05840 102475 102203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 102679 103458 gene locus_tag LOCUS_05850 102679 103458 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861999.1 protein_id gnl|my_center|LOCUS_05850 104153 103500 gene locus_tag LOCUS_05860 gene nth 104153 103500 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_05860 104358 105602 gene locus_tag LOCUS_05870 gene glyA 104358 105602 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 protein_id gnl|my_center|LOCUS_05870 105793 106974 gene locus_tag LOCUS_05880 105793 106974 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_05880 107891 106971 gene locus_tag LOCUS_05890 107891 106971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 107992 108186 gene locus_tag LOCUS_05900 107992 108186 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_05900 108205 109083 gene locus_tag LOCUS_05910 108205 109083 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965718.1 protein_id gnl|my_center|LOCUS_05910 109532 110662 gene locus_tag LOCUS_05920 109532 110662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437819.1 protein_id gnl|my_center|LOCUS_05920 111783 110923 gene locus_tag LOCUS_05930 111783 110923 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_05930 112499 111780 gene locus_tag LOCUS_05940 112499 111780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 113329 112496 gene locus_tag LOCUS_05950 113329 112496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 114008 113307 gene locus_tag LOCUS_05960 114008 113307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 114583 114005 gene locus_tag LOCUS_05970 114583 114005 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861377.1 protein_id gnl|my_center|LOCUS_05970 114955 114872 gene locus_tag LOCUS_t00060 114955 114872 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 116053 115127 gene locus_tag LOCUS_05980 116053 115127 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_05980 116212 116838 gene locus_tag LOCUS_05990 116212 116838 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082876.1 protein_id gnl|my_center|LOCUS_05990 117271 116906 gene locus_tag LOCUS_06000 117271 116906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 117511 118038 gene locus_tag LOCUS_06010 117511 118038 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_06010 118055 119152 gene locus_tag LOCUS_06020 118055 119152 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530805.1 protein_id gnl|my_center|LOCUS_06020 119195 120022 gene locus_tag LOCUS_06030 119195 120022 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530806.1 protein_id gnl|my_center|LOCUS_06030 120019 120822 gene locus_tag LOCUS_06040 120019 120822 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530807.1 protein_id gnl|my_center|LOCUS_06040 120815 121813 gene locus_tag LOCUS_06050 gene potG 120815 121813 CDS product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367526.1 protein_id gnl|my_center|LOCUS_06050 122698 123702 gene locus_tag LOCUS_06060 122698 123702 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530803.1 protein_id gnl|my_center|LOCUS_06060 123722 124303 gene locus_tag LOCUS_06070 123722 124303 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966279.1 protein_id gnl|my_center|LOCUS_06070 124679 124311 gene locus_tag LOCUS_06080 gene spoVAE 124679 124311 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence05 1764 2054 gene locus_tag LOCUS_06090 1764 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 2077 2640 gene locus_tag LOCUS_06100 2077 2640 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945394.1 protein_id gnl|my_center|LOCUS_06100 2812 3144 gene locus_tag LOCUS_06110 2812 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 3134 3805 gene locus_tag LOCUS_06120 3134 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06120 4302 3868 gene locus_tag LOCUS_06130 4302 3868 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963997.1 protein_id gnl|my_center|LOCUS_06130 4880 4374 gene locus_tag LOCUS_06140 4880 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 5683 4877 gene locus_tag LOCUS_06150 gene queG 5683 4877 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438992.1 protein_id gnl|my_center|LOCUS_06150 7932 5779 gene locus_tag LOCUS_06160 gene pnp 7932 5779 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_06160 8425 8159 gene locus_tag LOCUS_06170 gene rpsO 8425 8159 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_06170 9233 8646 gene locus_tag LOCUS_06180 9233 8646 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_06180 10184 9450 gene locus_tag LOCUS_06190 10184 9450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 10814 10404 gene locus_tag LOCUS_06200 gene mutT 10814 10404 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_06200 11204 10869 gene locus_tag LOCUS_06210 11204 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 11368 11219 gene locus_tag LOCUS_06220 11368 11219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 12001 11384 gene locus_tag LOCUS_06230 12001 11384 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809641.1 protein_id gnl|my_center|LOCUS_06230 12335 12012 gene locus_tag LOCUS_06240 12335 12012 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814555.1 protein_id gnl|my_center|LOCUS_06240 12607 12332 gene locus_tag LOCUS_06250 12607 12332 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814556.1 protein_id gnl|my_center|LOCUS_06250 15488 13125 gene locus_tag LOCUS_06260 15488 13125 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861587.1 protein_id gnl|my_center|LOCUS_06260 16225 15551 gene locus_tag LOCUS_06270 16225 15551 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454838.1 protein_id gnl|my_center|LOCUS_06270 17647 16403 gene locus_tag LOCUS_06280 17647 16403 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021362799.1 protein_id gnl|my_center|LOCUS_06280 18333 17644 gene locus_tag LOCUS_06290 18333 17644 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861589.1 protein_id gnl|my_center|LOCUS_06290 19985 18354 gene locus_tag LOCUS_06300 gene rlmD 19985 18354 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914581.1 protein_id gnl|my_center|LOCUS_06300 20190 22118 gene locus_tag LOCUS_06310 20190 22118 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_06310 25006 22184 gene locus_tag LOCUS_06320 25006 22184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 27412 25607 gene locus_tag LOCUS_06330 gene lepA 27412 25607 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 protein_id gnl|my_center|LOCUS_06330 27894 27502 gene locus_tag LOCUS_06340 27894 27502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 28207 28893 gene locus_tag LOCUS_06350 28207 28893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 29214 29750 gene locus_tag LOCUS_06360 29214 29750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 29918 30196 gene locus_tag LOCUS_06370 29918 30196 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_06370 30193 30372 gene locus_tag LOCUS_06380 30193 30372 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944457.1 protein_id gnl|my_center|LOCUS_06380 30628 31209 gene locus_tag LOCUS_06390 30628 31209 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965241.1 protein_id gnl|my_center|LOCUS_06390 31266 33266 gene locus_tag LOCUS_06400 31266 33266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 33367 34152 gene locus_tag LOCUS_06410 33367 34152 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_06410 34208 34930 gene locus_tag LOCUS_06420 34208 34930 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476483.1 protein_id gnl|my_center|LOCUS_06420 34927 35232 gene locus_tag LOCUS_06430 34927 35232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 35261 37150 gene locus_tag LOCUS_06440 gene mnmG 35261 37150 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_06440 37157 38071 gene locus_tag LOCUS_06450 37157 38071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 38064 39086 gene locus_tag LOCUS_06460 gene mnmA 38064 39086 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_06460 39102 40094 gene locus_tag LOCUS_06470 39102 40094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 40076 41035 gene locus_tag LOCUS_06480 40076 41035 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964712.1 protein_id gnl|my_center|LOCUS_06480 41551 41102 gene locus_tag LOCUS_06490 41551 41102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 44168 41946 gene locus_tag LOCUS_06500 44168 41946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 46354 44195 gene locus_tag LOCUS_06510 46354 44195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 47096 46377 gene locus_tag LOCUS_06520 47096 46377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 47001 47357 gene locus_tag LOCUS_06530 47001 47357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 48482 47337 gene locus_tag LOCUS_06540 48482 47337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 50521 48494 gene locus_tag LOCUS_06550 50521 48494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 50911 50546 gene locus_tag LOCUS_06560 50911 50546 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814133.1 protein_id gnl|my_center|LOCUS_06560 52269 51043 gene locus_tag LOCUS_06570 52269 51043 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_06570 52410 53246 gene locus_tag LOCUS_06580 gene yidA 52410 53246 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704455.1 protein_id gnl|my_center|LOCUS_06580 53976 53182 gene locus_tag LOCUS_06590 53976 53182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 54986 54147 gene locus_tag LOCUS_06600 54986 54147 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_06600 55954 55622 gene locus_tag LOCUS_06610 55954 55622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 56772 55972 gene locus_tag LOCUS_06620 56772 55972 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729274.1 protein_id gnl|my_center|LOCUS_06620 57025 57372 gene locus_tag LOCUS_06630 57025 57372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018213024.1 protein_id gnl|my_center|LOCUS_06630 57385 57939 gene locus_tag LOCUS_06640 57385 57939 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789526.1 protein_id gnl|my_center|LOCUS_06640 58093 59178 gene locus_tag LOCUS_06650 gene serC 58093 59178 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_06650 59429 60565 gene locus_tag LOCUS_06660 59429 60565 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490251.1 protein_id gnl|my_center|LOCUS_06660 60583 61080 gene locus_tag LOCUS_06670 60583 61080 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_06670 61203 61859 gene locus_tag LOCUS_06680 61203 61859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460670.1 protein_id gnl|my_center|LOCUS_06680 62408 61959 gene locus_tag LOCUS_06690 62408 61959 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418487.1 protein_id gnl|my_center|LOCUS_06690 62892 62479 gene locus_tag LOCUS_06700 62892 62479 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130484.1 protein_id gnl|my_center|LOCUS_06700 63927 63019 gene locus_tag LOCUS_06710 63927 63019 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_06710 64202 64999 gene locus_tag LOCUS_06720 64202 64999 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272484.1 protein_id gnl|my_center|LOCUS_06720 65046 65270 gene locus_tag LOCUS_06730 65046 65270 CDS product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939394.1 protein_id gnl|my_center|LOCUS_06730 65357 65716 gene locus_tag LOCUS_06740 65357 65716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 66217 65783 gene locus_tag LOCUS_06750 66217 65783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 67081 66620 gene locus_tag LOCUS_06760 67081 66620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 67368 67901 gene locus_tag LOCUS_06770 67368 67901 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_06770 68318 70720 gene locus_tag LOCUS_06780 gene feoB 68318 70720 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_06780 70796 71518 gene locus_tag LOCUS_06790 70796 71518 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963957.1 protein_id gnl|my_center|LOCUS_06790 71515 72789 gene locus_tag LOCUS_06800 71515 72789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 73169 72882 gene locus_tag LOCUS_06810 73169 72882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 74672 73218 gene locus_tag LOCUS_06820 gene abfD 74672 73218 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_06820 76613 75057 gene locus_tag LOCUS_06830 76613 75057 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459194.1 protein_id gnl|my_center|LOCUS_06830 76814 77032 gene locus_tag LOCUS_06840 76814 77032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06840 77063 78016 gene locus_tag LOCUS_06850 77063 78016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06850 78076 78426 gene locus_tag LOCUS_06860 78076 78426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 78764 79285 gene locus_tag LOCUS_06870 78764 79285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 79891 79358 gene locus_tag LOCUS_06880 79891 79358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 81729 80011 gene locus_tag LOCUS_06890 81729 80011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 83435 81777 gene locus_tag LOCUS_06900 83435 81777 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_06900 83806 84138 gene locus_tag LOCUS_06910 83806 84138 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812158.1 protein_id gnl|my_center|LOCUS_06910 84135 85115 gene locus_tag LOCUS_06920 84135 85115 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943261.1 protein_id gnl|my_center|LOCUS_06920 85130 86089 gene locus_tag LOCUS_06930 85130 86089 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_06930 86095 87030 gene locus_tag LOCUS_06940 86095 87030 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948854.1 protein_id gnl|my_center|LOCUS_06940 87045 89027 gene locus_tag LOCUS_06950 87045 89027 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966642.1 protein_id gnl|my_center|LOCUS_06950 89054 89617 gene locus_tag LOCUS_06960 89054 89617 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_06960 92252 90213 gene locus_tag LOCUS_06970 gene ftsH 92252 90213 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373798.1 protein_id gnl|my_center|LOCUS_06970 92861 92322 gene locus_tag LOCUS_06980 gene hpt 92861 92322 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356260.1 protein_id gnl|my_center|LOCUS_06980 94255 92858 gene locus_tag LOCUS_06990 gene tilS 94255 92858 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_06990 95594 94239 gene locus_tag LOCUS_07000 95594 94239 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 protein_id gnl|my_center|LOCUS_07000 96073 95624 gene locus_tag LOCUS_07010 gene rplI 96073 95624 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_07010 98166 96166 gene locus_tag LOCUS_07020 98166 96166 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966978.1 protein_id gnl|my_center|LOCUS_07020 99096 98260 gene locus_tag LOCUS_07030 99096 98260 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_07030 99201 100319 gene locus_tag LOCUS_07040 99201 100319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 101143 100400 gene locus_tag LOCUS_07050 101143 100400 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294240.1 protein_id gnl|my_center|LOCUS_07050 102102 101143 gene locus_tag LOCUS_07060 102102 101143 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943967.1 protein_id gnl|my_center|LOCUS_07060 103135 102206 gene locus_tag LOCUS_07070 103135 102206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 103631 104020 gene locus_tag LOCUS_07080 103631 104020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 104025 104528 gene locus_tag LOCUS_07090 104025 104528 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_07090 104533 105516 gene locus_tag LOCUS_07100 104533 105516 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_07100 105535 105921 gene locus_tag LOCUS_07110 105535 105921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386950.1 protein_id gnl|my_center|LOCUS_07110 107475 105994 gene locus_tag LOCUS_07120 107475 105994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 108177 107491 gene locus_tag LOCUS_07130 108177 107491 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_07130 108291 108440 gene locus_tag LOCUS_07140 108291 108440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 >Feature sequence06 31 1383 gene locus_tag LOCUS_07150 31 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 1580 2020 gene locus_tag LOCUS_07160 1580 2020 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_07160 2100 3290 gene locus_tag LOCUS_07170 2100 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 3418 4632 gene locus_tag LOCUS_07180 3418 4632 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_07180 5021 5830 gene locus_tag LOCUS_07190 gene etfB 5021 5830 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986693.1 protein_id gnl|my_center|LOCUS_07190 5852 6871 gene locus_tag LOCUS_07200 5852 6871 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417347.1 protein_id gnl|my_center|LOCUS_07200 6964 8112 gene locus_tag LOCUS_07210 6964 8112 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_07210 8202 8774 gene locus_tag LOCUS_07220 8202 8774 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817527.1 protein_id gnl|my_center|LOCUS_07220 8900 10498 gene locus_tag LOCUS_07230 8900 10498 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_07230 10600 12294 gene locus_tag LOCUS_07240 10600 12294 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_07240 12455 13264 gene locus_tag LOCUS_07250 12455 13264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 13785 17186 gene locus_tag LOCUS_07260 13785 17186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 17896 17279 gene locus_tag LOCUS_07270 17896 17279 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_07270 18039 18692 gene locus_tag LOCUS_07280 18039 18692 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390012.1 protein_id gnl|my_center|LOCUS_07280 21015 18784 gene locus_tag LOCUS_07290 21015 18784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 21501 21079 gene locus_tag LOCUS_07300 21501 21079 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813977.1 protein_id gnl|my_center|LOCUS_07300 21921 22454 gene locus_tag LOCUS_07310 21921 22454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 22817 24577 gene locus_tag LOCUS_07320 22817 24577 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_07320 25494 24664 gene locus_tag LOCUS_07330 25494 24664 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_07330 26798 25491 gene locus_tag LOCUS_07340 gene mtaB 26798 25491 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_07340 26985 27581 gene locus_tag LOCUS_07350 gene yfbR 26985 27581 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482513.1 protein_id gnl|my_center|LOCUS_07350 27668 27940 gene locus_tag LOCUS_07360 27668 27940 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392891.1 protein_id gnl|my_center|LOCUS_07360 27961 29319 gene locus_tag LOCUS_07370 27961 29319 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_07370 29365 30699 gene locus_tag LOCUS_07380 29365 30699 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048231.1 protein_id gnl|my_center|LOCUS_07380 30918 31331 gene locus_tag LOCUS_07390 30918 31331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_07390 31381 31950 gene locus_tag LOCUS_07400 31381 31950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 33202 32030 gene locus_tag LOCUS_07410 33202 32030 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460576.1 protein_id gnl|my_center|LOCUS_07410 33410 33485 gene locus_tag LOCUS_t00070 33410 33485 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 33587 33871 gene locus_tag LOCUS_07420 33587 33871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 33885 35150 gene locus_tag LOCUS_07430 gene yqfD 33885 35150 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392129.1 protein_id gnl|my_center|LOCUS_07430 35156 36124 gene locus_tag LOCUS_07440 35156 36124 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_07440 36124 37575 gene locus_tag LOCUS_07450 36124 37575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 37602 38363 gene locus_tag LOCUS_07460 37602 38363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 38360 40735 gene locus_tag LOCUS_07470 38360 40735 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_07470 40883 41146 gene locus_tag LOCUS_07480 40883 41146 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_07480 41237 43087 gene locus_tag LOCUS_07490 gene uvrC 41237 43087 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_07490 43091 43639 gene locus_tag LOCUS_07500 gene rsmD 43091 43639 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_07500 43682 44194 gene locus_tag LOCUS_07510 gene coaD 43682 44194 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388467.1 protein_id gnl|my_center|LOCUS_07510 44175 44735 gene locus_tag LOCUS_07520 44175 44735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 46430 44805 gene locus_tag LOCUS_07530 46430 44805 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435782.1 protein_id gnl|my_center|LOCUS_07530 46723 47670 gene locus_tag LOCUS_07540 gene rsmH 46723 47670 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731975.1 protein_id gnl|my_center|LOCUS_07540 47726 48316 gene locus_tag LOCUS_07550 47726 48316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 48438 50870 gene locus_tag LOCUS_07560 48438 50870 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949034.1 protein_id gnl|my_center|LOCUS_07560 50995 52449 gene locus_tag LOCUS_07570 50995 52449 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_07570 52547 53572 gene locus_tag LOCUS_07580 gene mraY 52547 53572 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965426.1 protein_id gnl|my_center|LOCUS_07580 53606 54841 gene locus_tag LOCUS_07590 gene spoVE 53606 54841 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753510.1 protein_id gnl|my_center|LOCUS_07590 54867 55979 gene locus_tag LOCUS_07600 gene murG 54867 55979 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181833.1 protein_id gnl|my_center|LOCUS_07600 56102 57355 gene locus_tag LOCUS_07610 gene murA 56102 57355 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_07610 57412 58224 gene locus_tag LOCUS_07620 57412 58224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 58374 59468 gene locus_tag LOCUS_07630 gene ftsZ 58374 59468 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_07630 60023 59523 gene locus_tag LOCUS_07640 60023 59523 CDS product SLOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323417.1 protein_id gnl|my_center|LOCUS_07640 60498 61085 gene locus_tag LOCUS_07650 60498 61085 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583215.1 protein_id gnl|my_center|LOCUS_07650 61155 61442 gene locus_tag LOCUS_07660 61155 61442 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221875345.1 protein_id gnl|my_center|LOCUS_07660 61657 61899 gene locus_tag LOCUS_07670 61657 61899 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459096.1 protein_id gnl|my_center|LOCUS_07670 61999 62421 gene locus_tag LOCUS_07680 gene rpsL 61999 62421 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142340.1 protein_id gnl|my_center|LOCUS_07680 62683 63153 gene locus_tag LOCUS_07690 gene rpsG 62683 63153 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137493.1 protein_id gnl|my_center|LOCUS_07690 63172 65274 gene locus_tag LOCUS_07700 gene fusA 63172 65274 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_07700 65416 66618 gene locus_tag LOCUS_07710 gene tuf 65416 66618 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_07710 66715 67590 gene locus_tag LOCUS_07720 66715 67590 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_07720 67583 68614 gene locus_tag LOCUS_07730 67583 68614 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 protein_id gnl|my_center|LOCUS_07730 69168 68671 gene locus_tag LOCUS_07740 69168 68671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 69309 70007 gene locus_tag LOCUS_07750 69309 70007 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989966.1 protein_id gnl|my_center|LOCUS_07750 70182 71273 gene locus_tag LOCUS_07760 70182 71273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 71318 72004 gene locus_tag LOCUS_07770 gene ftsE 71318 72004 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 protein_id gnl|my_center|LOCUS_07770 71994 72884 gene locus_tag LOCUS_07780 gene ftsX 71994 72884 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_07780 72916 73047 gene locus_tag LOCUS_07790 72916 73047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 73150 74319 gene locus_tag LOCUS_07800 73150 74319 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257882.1 protein_id gnl|my_center|LOCUS_07800 74434 74907 gene locus_tag LOCUS_07810 gene greA 74434 74907 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_07810 74929 76878 gene locus_tag LOCUS_07820 gene lysS 74929 76878 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861998.1 protein_id gnl|my_center|LOCUS_07820 77306 77656 gene locus_tag LOCUS_07830 77306 77656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 77678 78442 gene locus_tag LOCUS_07840 77678 78442 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903251.1 protein_id gnl|my_center|LOCUS_07840 78700 79986 gene locus_tag LOCUS_07850 78700 79986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 80053 82515 gene locus_tag LOCUS_07860 gene topA 80053 82515 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813282.1 protein_id gnl|my_center|LOCUS_07860 82508 83815 gene locus_tag LOCUS_07870 gene trmFO 82508 83815 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357486.1 protein_id gnl|my_center|LOCUS_07870 83835 84884 gene locus_tag LOCUS_07880 gene plsX 83835 84884 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_07880 84981 85217 gene locus_tag LOCUS_07890 gene acpP 84981 85217 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965054.1 protein_id gnl|my_center|LOCUS_07890 85287 85967 gene locus_tag LOCUS_07900 gene rnc 85287 85967 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_07900 85964 86131 gene locus_tag LOCUS_07910 85964 86131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 86247 87065 gene locus_tag LOCUS_07920 86247 87065 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_07920 87067 88020 gene locus_tag LOCUS_07930 87067 88020 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_07930 88024 89178 gene locus_tag LOCUS_07940 88024 89178 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921856.1 protein_id gnl|my_center|LOCUS_07940 89777 89274 gene locus_tag LOCUS_07950 89777 89274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 91320 89944 gene locus_tag LOCUS_07960 91320 89944 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_07960 91756 92628 gene locus_tag LOCUS_07970 91756 92628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807791.1 protein_id gnl|my_center|LOCUS_07970 94361 92727 gene locus_tag LOCUS_07980 94361 92727 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810050.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence07 876 166 gene locus_tag LOCUS_07990 876 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 2380 968 gene locus_tag LOCUS_08000 2380 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 3812 2490 gene locus_tag LOCUS_08010 3812 2490 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205413.1 protein_id gnl|my_center|LOCUS_08010 3989 4984 gene locus_tag LOCUS_08020 gene dusB 3989 4984 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_08020 5309 7384 gene locus_tag LOCUS_08030 gene fusA 5309 7384 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_08030 7532 8698 gene locus_tag LOCUS_08040 7532 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 10066 8768 gene locus_tag LOCUS_08050 10066 8768 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_08050 10577 10080 gene locus_tag LOCUS_08060 10577 10080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 11871 10591 gene locus_tag LOCUS_08070 11871 10591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 13643 11868 gene locus_tag LOCUS_08080 gene walK 13643 11868 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288851.1 protein_id gnl|my_center|LOCUS_08080 14402 13689 gene locus_tag LOCUS_08090 gene yycF 14402 13689 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288850.1 protein_id gnl|my_center|LOCUS_08090 14976 14440 gene locus_tag LOCUS_08100 14976 14440 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_08100 15128 15376 gene locus_tag LOCUS_08110 15128 15376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 15744 17042 gene locus_tag LOCUS_08120 15744 17042 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_08120 17182 17664 gene locus_tag LOCUS_08130 gene rlmH 17182 17664 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704775.1 protein_id gnl|my_center|LOCUS_08130 17713 19449 gene locus_tag LOCUS_08140 17713 19449 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396540.1 protein_id gnl|my_center|LOCUS_08140 19573 20709 gene locus_tag LOCUS_08150 gene dacF 19573 20709 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831996.1 protein_id gnl|my_center|LOCUS_08150 20782 21000 gene locus_tag LOCUS_08160 20782 21000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 21349 21110 gene locus_tag LOCUS_08170 21349 21110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 21490 22449 gene locus_tag LOCUS_08180 21490 22449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 22591 23733 gene locus_tag LOCUS_08190 22591 23733 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_08190 23748 24125 gene locus_tag LOCUS_08200 23748 24125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 24392 25771 gene locus_tag LOCUS_08210 24392 25771 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080841.1 protein_id gnl|my_center|LOCUS_08210 26075 25851 gene locus_tag LOCUS_08220 26075 25851 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_08220 26298 27029 gene locus_tag LOCUS_08230 26298 27029 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410658.1 protein_id gnl|my_center|LOCUS_08230 27026 27352 gene locus_tag LOCUS_08240 gene azlD 27026 27352 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_08240 29261 27375 gene locus_tag LOCUS_08250 29261 27375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 29922 29593 gene locus_tag LOCUS_08260 29922 29593 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423377.1 protein_id gnl|my_center|LOCUS_08260 30365 30021 gene locus_tag LOCUS_08270 30365 30021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 32245 30527 gene locus_tag LOCUS_08280 32245 30527 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_08280 34068 32239 gene locus_tag LOCUS_08290 34068 32239 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_08290 34579 35862 gene locus_tag LOCUS_08300 34579 35862 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_08300 35904 36764 gene locus_tag LOCUS_08310 35904 36764 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015839.1 protein_id gnl|my_center|LOCUS_08310 36799 37452 gene locus_tag LOCUS_08320 36799 37452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 38007 37525 gene locus_tag LOCUS_08330 38007 37525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 39428 38004 gene locus_tag LOCUS_08340 39428 38004 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258298.1 protein_id gnl|my_center|LOCUS_08340 40152 39463 gene locus_tag LOCUS_08350 gene yycF 40152 39463 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701473.1 protein_id gnl|my_center|LOCUS_08350 40568 40173 gene locus_tag LOCUS_08360 40568 40173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 40711 42717 gene locus_tag LOCUS_08370 40711 42717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 42992 43726 gene locus_tag LOCUS_08380 42992 43726 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_08380 43757 44506 gene locus_tag LOCUS_08390 43757 44506 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428245.1 protein_id gnl|my_center|LOCUS_08390 44575 45939 gene locus_tag LOCUS_08400 gene fumC 44575 45939 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857888.1 protein_id gnl|my_center|LOCUS_08400 45987 47159 gene locus_tag LOCUS_08410 45987 47159 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_08410 50925 47299 gene locus_tag LOCUS_08420 50925 47299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 51708 51091 gene locus_tag LOCUS_08430 51708 51091 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_08430 53558 51810 gene locus_tag LOCUS_08440 gene argS 53558 51810 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462258.1 protein_id gnl|my_center|LOCUS_08440 54045 53587 gene locus_tag LOCUS_08450 54045 53587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 55942 54170 gene locus_tag LOCUS_08460 55942 54170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 56175 56594 gene locus_tag LOCUS_08470 56175 56594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 56623 57219 gene locus_tag LOCUS_08480 56623 57219 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583891.1 protein_id gnl|my_center|LOCUS_08480 59063 57297 gene locus_tag LOCUS_08490 59063 57297 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_08490 59344 60825 gene locus_tag LOCUS_08500 gene spoIVA 59344 60825 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 protein_id gnl|my_center|LOCUS_08500 60922 61707 gene locus_tag LOCUS_08510 60922 61707 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 protein_id gnl|my_center|LOCUS_08510 61899 63092 gene locus_tag LOCUS_08520 61899 63092 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_08520 63296 64405 gene locus_tag LOCUS_08530 63296 64405 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_08530 64427 65689 gene locus_tag LOCUS_08540 64427 65689 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047742.1 protein_id gnl|my_center|LOCUS_08540 65686 67326 gene locus_tag LOCUS_08550 65686 67326 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047743.1 protein_id gnl|my_center|LOCUS_08550 68214 67393 gene locus_tag LOCUS_08560 68214 67393 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902960.1 protein_id gnl|my_center|LOCUS_08560 68351 69700 gene locus_tag LOCUS_08570 68351 69700 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438549.1 protein_id gnl|my_center|LOCUS_08570 70165 70752 gene locus_tag LOCUS_08580 70165 70752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 70871 70947 gene locus_tag LOCUS_t00080 70871 70947 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 71808 71167 gene locus_tag LOCUS_08590 71808 71167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 72019 72888 gene locus_tag LOCUS_08600 72019 72888 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_08600 72901 73773 gene locus_tag LOCUS_08610 72901 73773 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_08610 73779 74648 gene locus_tag LOCUS_08620 73779 74648 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_08620 74649 75458 gene locus_tag LOCUS_08630 74649 75458 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_08630 75472 76236 gene locus_tag LOCUS_08640 gene truA 75472 76236 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_08640 76277 77623 gene locus_tag LOCUS_08650 76277 77623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 77626 78111 gene locus_tag LOCUS_08660 77626 78111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 78203 80578 gene locus_tag LOCUS_08670 78203 80578 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_08670 81587 80718 gene locus_tag LOCUS_08680 81587 80718 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_08680 82286 81624 gene locus_tag LOCUS_08690 82286 81624 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680231.1 protein_id gnl|my_center|LOCUS_08690 82573 83877 gene locus_tag LOCUS_08700 82573 83877 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788204.1 protein_id gnl|my_center|LOCUS_08700 83929 84360 gene locus_tag LOCUS_08710 83929 84360 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_08710 84534 85073 gene locus_tag LOCUS_08720 84534 85073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 86335 85406 gene locus_tag LOCUS_08730 gene tsf 86335 85406 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_08730 87154 86432 gene locus_tag LOCUS_08740 gene rpsB 87154 86432 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_08740 88219 87443 gene locus_tag LOCUS_08750 gene sigG 88219 87443 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_08750 88556 88741 gene locus_tag LOCUS_08760 88556 88741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 89600 88689 gene locus_tag LOCUS_08770 89600 88689 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896738.1 protein_id gnl|my_center|LOCUS_08770 90302 89643 gene locus_tag LOCUS_08780 90302 89643 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_08780 91655 90306 gene locus_tag LOCUS_08790 gene glmM 91655 90306 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521474.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence08 271 180 gene locus_tag LOCUS_t00090 271 180 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 395 309 gene locus_tag LOCUS_t00100 395 309 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 820 1092 gene locus_tag LOCUS_08800 820 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1169 2275 gene locus_tag LOCUS_08810 1169 2275 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048278.1 protein_id gnl|my_center|LOCUS_08810 3185 4402 gene locus_tag LOCUS_08820 3185 4402 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940010.1 protein_id gnl|my_center|LOCUS_08820 4623 5510 gene locus_tag LOCUS_08830 4623 5510 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_08830 5519 6733 gene locus_tag LOCUS_08840 5519 6733 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080270.1 protein_id gnl|my_center|LOCUS_08840 6730 7581 gene locus_tag LOCUS_08850 6730 7581 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937856.1 protein_id gnl|my_center|LOCUS_08850 7574 8284 gene locus_tag LOCUS_08860 7574 8284 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_08860 8659 9132 gene locus_tag LOCUS_08870 8659 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 9634 10176 gene locus_tag LOCUS_08880 9634 10176 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_08880 10173 13256 gene locus_tag LOCUS_08890 10173 13256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 13260 15077 gene locus_tag LOCUS_08900 13260 15077 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_08900 15941 15165 gene locus_tag LOCUS_08910 gene trmD 15941 15165 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965065.1 protein_id gnl|my_center|LOCUS_08910 16438 15947 gene locus_tag LOCUS_08920 gene rimM 16438 15947 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_08920 16728 16498 gene locus_tag LOCUS_08930 16728 16498 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_08930 16980 16741 gene locus_tag LOCUS_08940 gene rpsP 16980 16741 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_08940 18408 17050 gene locus_tag LOCUS_08950 gene ffh 18408 17050 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_08950 18784 18416 gene locus_tag LOCUS_08960 18784 18416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 19032 20315 gene locus_tag LOCUS_08970 19032 20315 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886510.1 protein_id gnl|my_center|LOCUS_08970 20319 21599 gene locus_tag LOCUS_08980 20319 21599 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411976.1 protein_id gnl|my_center|LOCUS_08980 21596 22465 gene locus_tag LOCUS_08990 gene lgt 21596 22465 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646080.1 protein_id gnl|my_center|LOCUS_08990 22469 23308 gene locus_tag LOCUS_09000 22469 23308 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162927877.1 protein_id gnl|my_center|LOCUS_09000 23431 23808 gene locus_tag LOCUS_09010 23431 23808 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_09010 23994 24509 gene locus_tag LOCUS_09020 gene nusB 23994 24509 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_09020 24513 25451 gene locus_tag LOCUS_09030 24513 25451 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_09030 25451 26671 gene locus_tag LOCUS_09040 gene xseA 25451 26671 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_09040 26653 26886 gene locus_tag LOCUS_09050 26653 26886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 26891 27763 gene locus_tag LOCUS_09060 gene ispA 26891 27763 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150378.1 protein_id gnl|my_center|LOCUS_09060 27799 29652 gene locus_tag LOCUS_09070 gene dxs 27799 29652 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_09070 29642 30457 gene locus_tag LOCUS_09080 29642 30457 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965376.1 protein_id gnl|my_center|LOCUS_09080 30454 31329 gene locus_tag LOCUS_09090 30454 31329 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880555.1 protein_id gnl|my_center|LOCUS_09090 31326 31787 gene locus_tag LOCUS_09100 gene argR 31326 31787 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935393.1 protein_id gnl|my_center|LOCUS_09100 31812 33503 gene locus_tag LOCUS_09110 gene recN 31812 33503 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_09110 33867 35096 gene locus_tag LOCUS_09120 gene tyrS 33867 35096 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_09120 35500 35252 gene locus_tag LOCUS_09130 35500 35252 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_09130 38000 35601 gene locus_tag LOCUS_09140 gene pheT 38000 35601 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357703.1 protein_id gnl|my_center|LOCUS_09140 39044 38019 gene locus_tag LOCUS_09150 gene pheS 39044 38019 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436795.1 protein_id gnl|my_center|LOCUS_09150 39440 40291 gene locus_tag LOCUS_09160 39440 40291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 40314 40925 gene locus_tag LOCUS_09170 40314 40925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 40946 42088 gene locus_tag LOCUS_09180 gene alr 40946 42088 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_09180 42324 42689 gene locus_tag LOCUS_09190 42324 42689 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_09190 42795 43289 gene locus_tag LOCUS_09200 42795 43289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 44630 43479 gene locus_tag LOCUS_09210 44630 43479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 45686 46825 gene locus_tag LOCUS_09220 45686 46825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 46825 48192 gene locus_tag LOCUS_09230 46825 48192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 48182 48601 gene locus_tag LOCUS_09240 48182 48601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 49843 51201 gene locus_tag LOCUS_09250 49843 51201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 51270 52985 gene locus_tag LOCUS_09260 51270 52985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 53951 54685 gene locus_tag LOCUS_09270 gene cwlD 53951 54685 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966373.1 protein_id gnl|my_center|LOCUS_09270 54682 56049 gene locus_tag LOCUS_09280 gene radA 54682 56049 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_09280 57577 56315 gene locus_tag LOCUS_09290 57577 56315 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_09290 57845 58993 gene locus_tag LOCUS_09300 57845 58993 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732062.1 protein_id gnl|my_center|LOCUS_09300 59178 59465 gene locus_tag LOCUS_09310 59178 59465 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_09310 59496 61133 gene locus_tag LOCUS_09320 gene groL 59496 61133 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357641.1 protein_id gnl|my_center|LOCUS_09320 61318 61980 gene locus_tag LOCUS_09330 61318 61980 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681526.1 protein_id gnl|my_center|LOCUS_09330 62036 62344 gene locus_tag LOCUS_09340 62036 62344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 62372 62797 gene locus_tag LOCUS_09350 62372 62797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 62787 63710 gene locus_tag LOCUS_09360 62787 63710 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_09360 63752 64882 gene locus_tag LOCUS_09370 63752 64882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 64903 65850 gene locus_tag LOCUS_09380 64903 65850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 69077 65925 gene locus_tag LOCUS_09390 69077 65925 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_09390 70246 69074 gene locus_tag LOCUS_09400 70246 69074 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214669.1 protein_id gnl|my_center|LOCUS_09400 70766 70302 gene locus_tag LOCUS_09410 70766 70302 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_09410 70955 72712 gene locus_tag LOCUS_09420 70955 72712 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948922.1 protein_id gnl|my_center|LOCUS_09420 72809 73333 gene locus_tag LOCUS_09430 gene vanZ1 72809 73333 CDS product glycopeptide resistance protein VanZ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889012.1 protein_id gnl|my_center|LOCUS_09430 74809 73439 gene locus_tag LOCUS_09440 74809 73439 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_09440 75064 75651 gene locus_tag LOCUS_09450 75064 75651 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807769.1 protein_id gnl|my_center|LOCUS_09450 75740 80446 gene locus_tag LOCUS_09460 75740 80446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986914.1 protein_id gnl|my_center|LOCUS_09460 80706 81674 gene locus_tag LOCUS_09470 80706 81674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 81671 82735 gene locus_tag LOCUS_09480 81671 82735 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986916.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence09 737 429 gene locus_tag LOCUS_09490 gene trxA 737 429 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_09490 2145 826 gene locus_tag LOCUS_09500 2145 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 3362 2256 gene locus_tag LOCUS_09510 3362 2256 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113569.1 protein_id gnl|my_center|LOCUS_09510 3963 3406 gene locus_tag LOCUS_09520 3963 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 4184 4109 gene locus_tag LOCUS_t00110 4184 4109 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4719 6404 gene locus_tag LOCUS_09530 4719 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 6430 6801 gene locus_tag LOCUS_09540 6430 6801 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_09540 6848 7804 gene locus_tag LOCUS_09550 6848 7804 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963416.1 protein_id gnl|my_center|LOCUS_09550 7837 8250 gene locus_tag LOCUS_09560 7837 8250 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264782.1 protein_id gnl|my_center|LOCUS_09560 9287 8310 gene locus_tag LOCUS_09570 9287 8310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 9489 10685 gene locus_tag LOCUS_09580 9489 10685 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020871.1 protein_id gnl|my_center|LOCUS_09580 10843 12345 gene locus_tag LOCUS_09590 10843 12345 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_09590 12544 13695 gene locus_tag LOCUS_09600 12544 13695 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948401.1 protein_id gnl|my_center|LOCUS_09600 13708 13878 gene locus_tag LOCUS_09610 13708 13878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 13899 14657 gene locus_tag LOCUS_09620 13899 14657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 14762 17545 gene locus_tag LOCUS_09630 14762 17545 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948403.1 protein_id gnl|my_center|LOCUS_09630 18311 17604 gene locus_tag LOCUS_09640 18311 17604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 19638 18352 gene locus_tag LOCUS_09650 19638 18352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 19901 20365 gene locus_tag LOCUS_09660 19901 20365 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015665.1 protein_id gnl|my_center|LOCUS_09660 20396 21346 gene locus_tag LOCUS_09670 20396 21346 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_09670 21451 22206 gene locus_tag LOCUS_09680 21451 22206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 22342 23193 gene locus_tag LOCUS_09690 22342 23193 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964020.1 protein_id gnl|my_center|LOCUS_09690 23386 24753 gene locus_tag LOCUS_09700 23386 24753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 25534 24839 gene locus_tag LOCUS_09710 gene tsaA 25534 24839 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_09710 25511 25735 gene locus_tag LOCUS_09720 25511 25735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 25732 27378 gene locus_tag LOCUS_09730 25732 27378 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_09730 27393 28232 gene locus_tag LOCUS_09740 gene nudC 27393 28232 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102051.1 protein_id gnl|my_center|LOCUS_09740 29319 28276 gene locus_tag LOCUS_09750 29319 28276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 30779 29334 gene locus_tag LOCUS_09760 30779 29334 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_09760 31861 30830 gene locus_tag LOCUS_09770 31861 30830 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922574.1 protein_id gnl|my_center|LOCUS_09770 32561 31881 gene locus_tag LOCUS_09780 32561 31881 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_09780 32661 33368 gene locus_tag LOCUS_09790 32661 33368 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_09790 33732 37304 gene locus_tag LOCUS_09800 gene nifJ 33732 37304 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_09800 37566 37327 gene locus_tag LOCUS_09810 37566 37327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 37493 39181 gene locus_tag LOCUS_09820 37493 39181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 39704 39246 gene locus_tag LOCUS_09830 gene nrdR 39704 39246 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399430.1 protein_id gnl|my_center|LOCUS_09830 40359 39778 gene locus_tag LOCUS_09840 40359 39778 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383642.1 protein_id gnl|my_center|LOCUS_09840 40619 41812 gene locus_tag LOCUS_09850 40619 41812 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_09850 42052 44481 gene locus_tag LOCUS_09860 42052 44481 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263668.1 protein_id gnl|my_center|LOCUS_09860 44493 45227 gene locus_tag LOCUS_09870 gene cas5c 44493 45227 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009051.1 protein_id gnl|my_center|LOCUS_09870 45227 47032 gene locus_tag LOCUS_09880 45227 47032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 47036 47884 gene locus_tag LOCUS_09890 gene cas7c 47036 47884 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 protein_id gnl|my_center|LOCUS_09890 47874 48413 gene locus_tag LOCUS_09900 47874 48413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09900 48523 49554 gene locus_tag LOCUS_09910 gene cas1c 48523 49554 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_09910 49591 49878 gene locus_tag LOCUS_09920 gene cas2 49591 49878 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_09920 50052 50221 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtccctccccacacggggagggtggattgaaac 51926 50385 gene locus_tag LOCUS_09930 gene guaA 51926 50385 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679432.1 protein_id gnl|my_center|LOCUS_09930 52156 51971 gene locus_tag LOCUS_09940 52156 51971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 52140 52820 gene locus_tag LOCUS_09950 52140 52820 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_09950 52817 53197 gene locus_tag LOCUS_09960 52817 53197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 53982 53203 gene locus_tag LOCUS_09970 53982 53203 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_09970 54146 54829 gene locus_tag LOCUS_09980 54146 54829 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808611.1 protein_id gnl|my_center|LOCUS_09980 54998 55894 gene locus_tag LOCUS_09990 54998 55894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 57258 55867 gene locus_tag LOCUS_10000 57258 55867 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643131.1 protein_id gnl|my_center|LOCUS_10000 58920 57262 gene locus_tag LOCUS_10010 58920 57262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 60972 59200 gene locus_tag LOCUS_10020 60972 59200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807777.1 protein_id gnl|my_center|LOCUS_10020 61162 61863 gene locus_tag LOCUS_10030 61162 61863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 62602 61931 gene locus_tag LOCUS_10040 62602 61931 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438070.1 protein_id gnl|my_center|LOCUS_10040 64433 62595 gene locus_tag LOCUS_10050 64433 62595 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099491.1 protein_id gnl|my_center|LOCUS_10050 65232 64507 gene locus_tag LOCUS_10060 65232 64507 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence10 235 26 gene locus_tag LOCUS_10070 235 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 537 462 gene locus_tag LOCUS_t00120 537 462 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 627 541 gene locus_tag LOCUS_t00130 627 541 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 796 975 gene locus_tag LOCUS_10080 796 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1107 2228 gene locus_tag LOCUS_10090 gene prfB 1107 2228 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191976281.1 protein_id gnl|my_center|LOCUS_10090 2614 2285 gene locus_tag LOCUS_10100 2614 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 2880 2611 gene locus_tag LOCUS_10110 2880 2611 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272532.1 protein_id gnl|my_center|LOCUS_10110 3068 3364 gene locus_tag LOCUS_10120 3068 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 3500 5023 gene locus_tag LOCUS_10130 3500 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 5036 5749 gene locus_tag LOCUS_10140 5036 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 5746 6600 gene locus_tag LOCUS_10150 5746 6600 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_10150 6597 7103 gene locus_tag LOCUS_10160 6597 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 7221 8771 gene locus_tag LOCUS_10170 7221 8771 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_10170 9025 9255 gene locus_tag LOCUS_10180 9025 9255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 9378 9650 gene locus_tag LOCUS_10190 9378 9650 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994775.1 protein_id gnl|my_center|LOCUS_10190 9631 9963 gene locus_tag LOCUS_10200 9631 9963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 10719 10033 gene locus_tag LOCUS_10210 10719 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 11013 11345 gene locus_tag LOCUS_10220 11013 11345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 12040 11402 gene locus_tag LOCUS_10230 12040 11402 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740920.1 protein_id gnl|my_center|LOCUS_10230 12698 11976 gene locus_tag LOCUS_10240 12698 11976 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054641.1 protein_id gnl|my_center|LOCUS_10240 13763 12840 gene locus_tag LOCUS_10250 13763 12840 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_10250 14856 13756 gene locus_tag LOCUS_10260 14856 13756 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 protein_id gnl|my_center|LOCUS_10260 15320 16618 gene locus_tag LOCUS_10270 15320 16618 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901990.1 protein_id gnl|my_center|LOCUS_10270 16655 17767 gene locus_tag LOCUS_10280 16655 17767 CDS product 4-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861531.1 protein_id gnl|my_center|LOCUS_10280 17826 19178 gene locus_tag LOCUS_10290 gene gabT 17826 19178 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964736.1 protein_id gnl|my_center|LOCUS_10290 19306 20790 gene locus_tag LOCUS_10300 19306 20790 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 protein_id gnl|my_center|LOCUS_10300 22615 20873 gene locus_tag LOCUS_10310 gene pyk 22615 20873 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_10310 23565 22720 gene locus_tag LOCUS_10320 23565 22720 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678776.1 protein_id gnl|my_center|LOCUS_10320 24527 23562 gene locus_tag LOCUS_10330 24527 23562 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678777.1 protein_id gnl|my_center|LOCUS_10330 26266 24629 gene locus_tag LOCUS_10340 26266 24629 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678775.1 protein_id gnl|my_center|LOCUS_10340 27274 26273 gene locus_tag LOCUS_10350 gene hprK 27274 26273 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_10350 27608 27420 gene locus_tag LOCUS_10360 gene rpmB 27608 27420 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_10360 28760 27759 gene locus_tag LOCUS_10370 28760 27759 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_10370 29442 28783 gene locus_tag LOCUS_10380 gene plsY 29442 28783 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016461.1 protein_id gnl|my_center|LOCUS_10380 30784 29450 gene locus_tag LOCUS_10390 gene der 30784 29450 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_10390 32155 30845 gene locus_tag LOCUS_10400 32155 30845 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_10400 32416 32231 gene locus_tag LOCUS_10410 gene rpmF 32416 32231 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_10410 32967 32470 gene locus_tag LOCUS_10420 32967 32470 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094714.1 protein_id gnl|my_center|LOCUS_10420 33217 34191 gene locus_tag LOCUS_10430 33217 34191 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_10430 34717 35835 gene locus_tag LOCUS_10440 34717 35835 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_10440 35832 36725 gene locus_tag LOCUS_10450 35832 36725 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964157.1 protein_id gnl|my_center|LOCUS_10450 36729 38708 gene locus_tag LOCUS_10460 36729 38708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 39415 38771 gene locus_tag LOCUS_10470 39415 38771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 43703 39504 gene locus_tag LOCUS_10480 gene polC 43703 39504 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966712.1 protein_id gnl|my_center|LOCUS_10480 44774 43734 gene locus_tag LOCUS_10490 gene ispG 44774 43734 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 protein_id gnl|my_center|LOCUS_10490 45836 44778 gene locus_tag LOCUS_10500 gene rseP 45836 44778 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_10500 47012 45867 gene locus_tag LOCUS_10510 47012 45867 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188776689.1 protein_id gnl|my_center|LOCUS_10510 47833 47024 gene locus_tag LOCUS_10520 47833 47024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 48604 47837 gene locus_tag LOCUS_10530 48604 47837 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_10530 49230 48673 gene locus_tag LOCUS_10540 gene frr 49230 48673 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430598.1 protein_id gnl|my_center|LOCUS_10540 49952 49227 gene locus_tag LOCUS_10550 gene pyrH 49952 49227 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293877.1 protein_id gnl|my_center|LOCUS_10550 50592 51704 gene locus_tag LOCUS_10560 gene ribD 50592 51704 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905672.1 protein_id gnl|my_center|LOCUS_10560 51705 52367 gene locus_tag LOCUS_10570 51705 52367 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_10570 52390 53589 gene locus_tag LOCUS_10580 52390 53589 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905673.1 protein_id gnl|my_center|LOCUS_10580 53659 54126 gene locus_tag LOCUS_10590 gene ribE 53659 54126 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099502.1 protein_id gnl|my_center|LOCUS_10590 54911 54231 gene locus_tag LOCUS_10600 54911 54231 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964820.1 protein_id gnl|my_center|LOCUS_10600 55574 54957 gene locus_tag LOCUS_10610 gene ysxC 55574 54957 CDS product ribosome biogenesis GTP-binding protein YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869113.1 protein_id gnl|my_center|LOCUS_10610 58031 55584 gene locus_tag LOCUS_10620 gene lon 58031 55584 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_10620 59493 58174 gene locus_tag LOCUS_10630 gene clpX 59493 58174 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_10630 60144 59563 gene locus_tag LOCUS_10640 gene clpP 60144 59563 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence11 144 1106 gene locus_tag LOCUS_10650 144 1106 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136824.1 protein_id gnl|my_center|LOCUS_10650 1126 1338 gene locus_tag LOCUS_10660 1126 1338 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796544.1 protein_id gnl|my_center|LOCUS_10660 1857 1402 gene locus_tag LOCUS_10670 gene spoVAC 1857 1402 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418420.1 protein_id gnl|my_center|LOCUS_10670 2210 2506 gene locus_tag LOCUS_10680 gene rpsF 2210 2506 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_10680 2520 3038 gene locus_tag LOCUS_10690 2520 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 3100 3339 gene locus_tag LOCUS_10700 gene rpsR 3100 3339 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_10700 3427 4233 gene locus_tag LOCUS_10710 3427 4233 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763805.1 protein_id gnl|my_center|LOCUS_10710 4318 4833 gene locus_tag LOCUS_10720 4318 4833 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_10720 5456 4917 gene locus_tag LOCUS_10730 5456 4917 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_10730 5735 6496 gene locus_tag LOCUS_10740 5735 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 7548 6556 gene locus_tag LOCUS_10750 7548 6556 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945452.1 protein_id gnl|my_center|LOCUS_10750 7803 8021 gene locus_tag LOCUS_10760 7803 8021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 8058 9941 gene locus_tag LOCUS_10770 8058 9941 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459352.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10770 10088 10954 gene locus_tag LOCUS_10780 gene dinD 10088 10954 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_10780 11093 11007 gene locus_tag LOCUS_t00140 11093 11007 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11280 12635 gene locus_tag LOCUS_10790 11280 12635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 12695 13378 gene locus_tag LOCUS_10800 12695 13378 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896932.1 protein_id gnl|my_center|LOCUS_10800 13386 14897 gene locus_tag LOCUS_10810 13386 14897 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_10810 15001 16014 gene locus_tag LOCUS_10820 15001 16014 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421392.1 protein_id gnl|my_center|LOCUS_10820 16060 16965 gene locus_tag LOCUS_10830 gene prmC 16060 16965 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_10830 16973 18163 gene locus_tag LOCUS_10840 gene recA 16973 18163 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_10840 18153 18764 gene locus_tag LOCUS_10850 18153 18764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 18787 20199 gene locus_tag LOCUS_10860 gene rimO 18787 20199 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_10860 20196 20726 gene locus_tag LOCUS_10870 gene pgsA 20196 20726 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_10870 21348 20806 gene locus_tag LOCUS_10880 21348 20806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 21633 22523 gene locus_tag LOCUS_10890 21633 22523 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079134.1 protein_id gnl|my_center|LOCUS_10890 22537 23586 gene locus_tag LOCUS_10900 gene mutY 22537 23586 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296955.1 protein_id gnl|my_center|LOCUS_10900 23583 24476 gene locus_tag LOCUS_10910 23583 24476 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048395.1 protein_id gnl|my_center|LOCUS_10910 26890 24551 gene locus_tag LOCUS_10920 gene spoIIE 26890 24551 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243026.1 protein_id gnl|my_center|LOCUS_10920 28363 27167 gene locus_tag LOCUS_10930 gene coaBC 28363 27167 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_10930 28818 28423 gene locus_tag LOCUS_10940 28818 28423 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287876.1 protein_id gnl|my_center|LOCUS_10940 29671 28820 gene locus_tag LOCUS_10950 gene panC 29671 28820 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287875.1 protein_id gnl|my_center|LOCUS_10950 30580 29705 gene locus_tag LOCUS_10960 gene panB 30580 29705 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_10960 31362 30577 gene locus_tag LOCUS_10970 31362 30577 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287872.1 protein_id gnl|my_center|LOCUS_10970 32150 31728 gene locus_tag LOCUS_10980 32150 31728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 32349 32131 gene locus_tag LOCUS_10990 32349 32131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 32495 32570 gene locus_tag LOCUS_t00150 32495 32570 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 32580 32664 gene locus_tag LOCUS_t00160 32580 32664 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 33296 32862 gene locus_tag LOCUS_11000 gene aroQ 33296 32862 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 protein_id gnl|my_center|LOCUS_11000 34509 33268 gene locus_tag LOCUS_11010 34509 33268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 35654 34509 gene locus_tag LOCUS_11020 gene pheA 35654 34509 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468591.1 protein_id gnl|my_center|LOCUS_11020 36761 35658 gene locus_tag LOCUS_11030 gene aroC 36761 35658 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_11030 38073 36799 gene locus_tag LOCUS_11040 gene aroA 38073 36799 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_11040 39128 38070 gene locus_tag LOCUS_11050 gene aroB 39128 38070 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775572.1 protein_id gnl|my_center|LOCUS_11050 39961 39125 gene locus_tag LOCUS_11060 39961 39125 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_11060 40965 39958 gene locus_tag LOCUS_11070 gene aroF 40965 39958 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_11070 42698 41469 gene locus_tag LOCUS_11080 42698 41469 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460305.1 protein_id gnl|my_center|LOCUS_11080 42967 44133 gene locus_tag LOCUS_11090 42967 44133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 45488 44211 gene locus_tag LOCUS_11100 45488 44211 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_11100 46068 45511 gene locus_tag LOCUS_11110 46068 45511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 47463 46327 gene locus_tag LOCUS_11120 47463 46327 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721377.1 protein_id gnl|my_center|LOCUS_11120 48404 47460 gene locus_tag LOCUS_11130 gene prmA 48404 47460 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816472.1 protein_id gnl|my_center|LOCUS_11130 48600 50225 gene locus_tag LOCUS_11140 48600 50225 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_11140 50361 50669 gene locus_tag LOCUS_11150 gene rplU 50361 50669 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_11150 50669 50998 gene locus_tag LOCUS_11160 50669 50998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 51002 51289 gene locus_tag LOCUS_11170 gene rpmA 51002 51289 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816541.1 protein_id gnl|my_center|LOCUS_11170 51378 52658 gene locus_tag LOCUS_11180 gene obgE 51378 52658 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_11180 52806 52952 gene locus_tag LOCUS_11190 gene scfA 52806 52952 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815210.1 protein_id gnl|my_center|LOCUS_11190 53042 54421 gene locus_tag LOCUS_11200 gene scfB 53042 54421 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_11200 54447 54647 gene locus_tag LOCUS_11210 54447 54647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 54811 55461 gene locus_tag LOCUS_11220 54811 55461 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948375.1 protein_id gnl|my_center|LOCUS_11220 55639 55715 gene locus_tag LOCUS_t00170 55639 55715 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 56187 55864 gene locus_tag LOCUS_11230 56187 55864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 57072 56206 gene locus_tag LOCUS_11240 57072 56206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 57644 57069 gene locus_tag LOCUS_11250 57644 57069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 57973 58404 gene locus_tag LOCUS_11260 gene rplM 57973 58404 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_11260 58419 58823 gene locus_tag LOCUS_11270 gene rpsI 58419 58823 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence12 51 1343 gene locus_tag LOCUS_11280 51 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1370 2962 gene locus_tag LOCUS_11290 1370 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 3209 3634 gene locus_tag LOCUS_11300 3209 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 3631 5685 gene locus_tag LOCUS_11310 3631 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 5787 7283 gene locus_tag LOCUS_11320 5787 7283 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132414.1 protein_id gnl|my_center|LOCUS_11320 7280 7486 gene locus_tag LOCUS_11330 7280 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 7470 8291 gene locus_tag LOCUS_11340 7470 8291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 8360 9778 gene locus_tag LOCUS_11350 8360 9778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 9890 11029 gene locus_tag LOCUS_11360 9890 11029 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_11360 11042 12448 gene locus_tag LOCUS_11370 11042 12448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 12461 13573 gene locus_tag LOCUS_11380 12461 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 14245 13709 gene locus_tag LOCUS_11390 14245 13709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 14418 14966 gene locus_tag LOCUS_11400 14418 14966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 15964 15074 gene locus_tag LOCUS_11410 15964 15074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 18527 16452 gene locus_tag LOCUS_11420 18527 16452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 20786 18546 gene locus_tag LOCUS_11430 gene nuoF 20786 18546 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_11430 23469 21142 gene locus_tag LOCUS_11440 23469 21142 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459055.1 protein_id gnl|my_center|LOCUS_11440 24281 23790 gene locus_tag LOCUS_11450 24281 23790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 25330 24278 gene locus_tag LOCUS_11460 25330 24278 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939995.1 protein_id gnl|my_center|LOCUS_11460 25718 25356 gene locus_tag LOCUS_11470 25718 25356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 26086 25715 gene locus_tag LOCUS_11480 26086 25715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 27069 26116 gene locus_tag LOCUS_11490 27069 26116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 27687 27085 gene locus_tag LOCUS_11500 27687 27085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 28200 27718 gene locus_tag LOCUS_11510 28200 27718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 28841 28197 gene locus_tag LOCUS_11520 28841 28197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 29224 28838 gene locus_tag LOCUS_11530 29224 28838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 30284 29241 gene locus_tag LOCUS_11540 30284 29241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 30790 30272 gene locus_tag LOCUS_11550 30790 30272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 31128 30787 gene locus_tag LOCUS_11560 31128 30787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 31511 31125 gene locus_tag LOCUS_11570 31511 31125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 32549 31515 gene locus_tag LOCUS_11580 32549 31515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 32929 32579 gene locus_tag LOCUS_11590 32929 32579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 33929 32979 gene locus_tag LOCUS_11600 33929 32979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 35115 33892 gene locus_tag LOCUS_11610 35115 33892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 36410 35151 gene locus_tag LOCUS_11620 36410 35151 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_11620 36721 36407 gene locus_tag LOCUS_11630 36721 36407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 36860 38929 gene locus_tag LOCUS_11640 gene recG 36860 38929 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_11640 39724 39014 gene locus_tag LOCUS_11650 39724 39014 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_11650 40560 39730 gene locus_tag LOCUS_11660 40560 39730 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_11660 41629 40562 gene locus_tag LOCUS_11670 41629 40562 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_11670 42521 41640 gene locus_tag LOCUS_11680 42521 41640 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_11680 43856 42654 gene locus_tag LOCUS_11690 43856 42654 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_11690 44648 44136 gene locus_tag LOCUS_11700 44648 44136 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946311.1 protein_id gnl|my_center|LOCUS_11700 45234 44656 gene locus_tag LOCUS_11710 45234 44656 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963791.1 protein_id gnl|my_center|LOCUS_11710 45500 45742 gene locus_tag LOCUS_11720 45500 45742 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963633.1 protein_id gnl|my_center|LOCUS_11720 46179 48860 gene locus_tag LOCUS_11730 46179 48860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 49010 49930 gene locus_tag LOCUS_11740 49010 49930 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437151.1 protein_id gnl|my_center|LOCUS_11740 51261 50149 gene locus_tag LOCUS_11750 51261 50149 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678909.1 protein_id gnl|my_center|LOCUS_11750 52169 51390 gene locus_tag LOCUS_11760 52169 51390 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054430.1 protein_id gnl|my_center|LOCUS_11760 53100 52162 gene locus_tag LOCUS_11770 53100 52162 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_11770 54267 53248 gene locus_tag LOCUS_11780 54267 53248 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_11780 55708 54416 gene locus_tag LOCUS_11790 55708 54416 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214414.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence13 138 213 gene locus_tag LOCUS_t00180 138 213 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 268 344 gene locus_tag LOCUS_t00190 268 344 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 348 423 gene locus_tag LOCUS_t00200 348 423 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 428 504 gene locus_tag LOCUS_t00210 428 504 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 510 585 gene locus_tag LOCUS_t00220 510 585 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1115 642 gene locus_tag LOCUS_11800 1115 642 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948359.1 protein_id gnl|my_center|LOCUS_11800 1282 2676 gene locus_tag LOCUS_11810 1282 2676 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459583.1 protein_id gnl|my_center|LOCUS_11810 2724 3473 gene locus_tag LOCUS_11820 2724 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11820 3431 3571 gene locus_tag LOCUS_11830 3431 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3568 4842 gene locus_tag LOCUS_11840 3568 4842 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007785170.1 protein_id gnl|my_center|LOCUS_11840 5197 4820 gene locus_tag LOCUS_11850 5197 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 5524 6072 gene locus_tag LOCUS_11860 5524 6072 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812910.1 protein_id gnl|my_center|LOCUS_11860 6100 7764 gene locus_tag LOCUS_11870 6100 7764 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042338789.1 protein_id gnl|my_center|LOCUS_11870 8124 9065 gene locus_tag LOCUS_11880 8124 9065 CDS product DUF4428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459959.1 protein_id gnl|my_center|LOCUS_11880 9241 11190 gene locus_tag LOCUS_11890 9241 11190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 12213 11257 gene locus_tag LOCUS_11900 12213 11257 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 protein_id gnl|my_center|LOCUS_11900 12390 14660 gene locus_tag LOCUS_11910 12390 14660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 14664 15812 gene locus_tag LOCUS_11920 14664 15812 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964720.1 protein_id gnl|my_center|LOCUS_11920 15847 16428 gene locus_tag LOCUS_11930 15847 16428 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420269.1 protein_id gnl|my_center|LOCUS_11930 16456 17040 gene locus_tag LOCUS_11940 16456 17040 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146731.1 protein_id gnl|my_center|LOCUS_11940 17077 17685 gene locus_tag LOCUS_11950 17077 17685 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454512.1 protein_id gnl|my_center|LOCUS_11950 17701 18312 gene locus_tag LOCUS_11960 17701 18312 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246350.1 protein_id gnl|my_center|LOCUS_11960 18387 21065 gene locus_tag LOCUS_11970 18387 21065 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068264.1 protein_id gnl|my_center|LOCUS_11970 21157 22308 gene locus_tag LOCUS_11980 21157 22308 CDS product phosphoribosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285478.1 protein_id gnl|my_center|LOCUS_11980 22283 23338 gene locus_tag LOCUS_11990 22283 23338 CDS product cysteine protease StiP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861280.1 protein_id gnl|my_center|LOCUS_11990 23335 24090 gene locus_tag LOCUS_12000 23335 24090 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861281.1 protein_id gnl|my_center|LOCUS_12000 24531 25358 gene locus_tag LOCUS_12010 24531 25358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 25764 27884 gene locus_tag LOCUS_12020 25764 27884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 27881 29254 gene locus_tag LOCUS_12030 27881 29254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 29748 30788 gene locus_tag LOCUS_12040 29748 30788 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966690.1 protein_id gnl|my_center|LOCUS_12040 30812 31666 gene locus_tag LOCUS_12050 30812 31666 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064968.1 protein_id gnl|my_center|LOCUS_12050 33186 31729 gene locus_tag LOCUS_12060 33186 31729 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393748.1 protein_id gnl|my_center|LOCUS_12060 33462 34010 gene locus_tag LOCUS_12070 33462 34010 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861585.1 protein_id gnl|my_center|LOCUS_12070 34352 35701 gene locus_tag LOCUS_12080 gene gdhA 34352 35701 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020063.1 protein_id gnl|my_center|LOCUS_12080 36432 35836 gene locus_tag LOCUS_12090 36432 35836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 37314 36487 gene locus_tag LOCUS_12100 37314 36487 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860835.1 protein_id gnl|my_center|LOCUS_12100 37602 38435 gene locus_tag LOCUS_12110 37602 38435 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_12110 38475 39671 gene locus_tag LOCUS_12120 38475 39671 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861504.1 protein_id gnl|my_center|LOCUS_12120 39757 42819 gene locus_tag LOCUS_12130 39757 42819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 43191 42820 gene locus_tag LOCUS_12140 gene crcB 43191 42820 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_12140 43560 43285 gene locus_tag LOCUS_12150 43560 43285 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814866.1 protein_id gnl|my_center|LOCUS_12150 44381 43557 gene locus_tag LOCUS_12160 44381 43557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 46019 44409 gene locus_tag LOCUS_12170 46019 44409 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_12170 47354 46047 gene locus_tag LOCUS_12180 47354 46047 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_12180 48206 47373 gene locus_tag LOCUS_12190 48206 47373 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_12190 48635 48396 gene locus_tag LOCUS_12200 48635 48396 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234876.1 protein_id gnl|my_center|LOCUS_12200 49295 48648 gene locus_tag LOCUS_12210 49295 48648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 51250 49358 gene locus_tag LOCUS_12220 51250 49358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 52344 51247 gene locus_tag LOCUS_12230 52344 51247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 53174 52389 gene locus_tag LOCUS_12240 gene ymdB 53174 52389 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_12240 55035 53341 gene locus_tag LOCUS_12250 gene rny 55035 53341 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_12250 55184 55873 gene locus_tag LOCUS_12260 55184 55873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 57226 55928 gene locus_tag LOCUS_12270 57226 55928 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930806.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence14 2236 719 gene locus_tag LOCUS_12280 gene gpmI 2236 719 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541097.1 protein_id gnl|my_center|LOCUS_12280 3106 2333 gene locus_tag LOCUS_12290 gene tpiA 3106 2333 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_12290 4326 3127 gene locus_tag LOCUS_12300 4326 3127 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_12300 4941 4429 gene locus_tag LOCUS_12310 gene trmL 4941 4429 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_12310 5530 5228 gene locus_tag LOCUS_12320 5530 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 6142 5588 gene locus_tag LOCUS_12330 6142 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 6368 6712 gene locus_tag LOCUS_12340 6368 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 6717 6959 gene locus_tag LOCUS_12350 6717 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 7029 7241 gene locus_tag LOCUS_12360 7029 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 7868 7347 gene locus_tag LOCUS_12370 7868 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 8778 7945 gene locus_tag LOCUS_12380 8778 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 9037 10131 gene locus_tag LOCUS_12390 gene ychF 9037 10131 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_12390 10124 10891 gene locus_tag LOCUS_12400 10124 10891 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_12400 10989 11669 gene locus_tag LOCUS_12410 10989 11669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 12493 11804 gene locus_tag LOCUS_12420 12493 11804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 14094 12682 gene locus_tag LOCUS_12430 14094 12682 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_12430 14451 16694 gene locus_tag LOCUS_12440 14451 16694 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_12440 16717 17937 gene locus_tag LOCUS_12450 16717 17937 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_12450 17934 18425 gene locus_tag LOCUS_12460 gene folA 17934 18425 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_12460 18558 18394 gene locus_tag LOCUS_12470 18558 18394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 19136 18756 gene locus_tag LOCUS_12480 19136 18756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 20755 19202 gene locus_tag LOCUS_12490 20755 19202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 20984 21862 gene locus_tag LOCUS_12500 20984 21862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 22322 21936 gene locus_tag LOCUS_12510 22322 21936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 22482 24941 gene locus_tag LOCUS_12520 gene pcrA 22482 24941 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233919.1 protein_id gnl|my_center|LOCUS_12520 25343 25014 gene locus_tag LOCUS_12530 25343 25014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 25645 25340 gene locus_tag LOCUS_12540 25645 25340 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994780.1 protein_id gnl|my_center|LOCUS_12540 26331 25711 gene locus_tag LOCUS_12550 26331 25711 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148797.1 protein_id gnl|my_center|LOCUS_12550 26831 26328 gene locus_tag LOCUS_12560 26831 26328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 27006 28397 gene locus_tag LOCUS_12570 gene murC 27006 28397 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_12570 28496 29491 gene locus_tag LOCUS_12580 28496 29491 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_12580 29488 31200 gene locus_tag LOCUS_12590 29488 31200 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008568.1 protein_id gnl|my_center|LOCUS_12590 31355 32989 gene locus_tag LOCUS_12600 31355 32989 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_12600 33010 33351 gene locus_tag LOCUS_12610 33010 33351 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_12610 33348 35075 gene locus_tag LOCUS_12620 gene iorA 33348 35075 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_12620 35096 35671 gene locus_tag LOCUS_12630 35096 35671 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_12630 36136 38787 gene locus_tag LOCUS_12640 gene alaS 36136 38787 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_12640 38807 39136 gene locus_tag LOCUS_12650 38807 39136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 39167 39505 gene locus_tag LOCUS_12660 39167 39505 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047999.1 protein_id gnl|my_center|LOCUS_12660 39643 41874 gene locus_tag LOCUS_12670 39643 41874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 41875 42939 gene locus_tag LOCUS_12680 41875 42939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 42933 43523 gene locus_tag LOCUS_12690 42933 43523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 43701 44246 gene locus_tag LOCUS_12700 43701 44246 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_12700 44456 44271 gene locus_tag LOCUS_12710 44456 44271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 44631 44903 gene locus_tag LOCUS_12720 44631 44903 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461031.1 protein_id gnl|my_center|LOCUS_12720 44890 45201 gene locus_tag LOCUS_12730 44890 45201 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817080.1 protein_id gnl|my_center|LOCUS_12730 46916 45297 gene locus_tag LOCUS_12740 46916 45297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 47059 47265 gene locus_tag LOCUS_12750 47059 47265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 47341 47877 gene locus_tag LOCUS_12760 47341 47877 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868802.1 protein_id gnl|my_center|LOCUS_12760 48216 47968 gene locus_tag LOCUS_12770 gene spoIIID 48216 47968 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_12770 48913 48371 gene locus_tag LOCUS_12780 gene spoVT 48913 48371 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966490.1 protein_id gnl|my_center|LOCUS_12780 49492 53595 gene locus_tag LOCUS_12790 49492 53595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence15 1150 191 gene locus_tag LOCUS_12800 1150 191 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_12800 1994 1152 gene locus_tag LOCUS_12810 1994 1152 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_12810 2160 2235 gene locus_tag LOCUS_t00230 2160 2235 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2331 3350 gene locus_tag LOCUS_12820 gene tsaD 2331 3350 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_12820 3560 3634 gene locus_tag LOCUS_t00240 3560 3634 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4461 3670 gene locus_tag LOCUS_12830 4461 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 4838 4491 gene locus_tag LOCUS_12840 4838 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 4966 6543 gene locus_tag LOCUS_12850 gene hcp 4966 6543 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_12850 6730 7971 gene locus_tag LOCUS_12860 6730 7971 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_12860 8796 8038 gene locus_tag LOCUS_12870 8796 8038 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861832.1 protein_id gnl|my_center|LOCUS_12870 9225 8815 gene locus_tag LOCUS_12880 9225 8815 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705736.1 protein_id gnl|my_center|LOCUS_12880 9877 9248 gene locus_tag LOCUS_12890 9877 9248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 10319 9864 gene locus_tag LOCUS_12900 gene rimI 10319 9864 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367190.1 protein_id gnl|my_center|LOCUS_12900 11133 10444 gene locus_tag LOCUS_12910 11133 10444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 11641 11216 gene locus_tag LOCUS_12920 11641 11216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 12492 11776 gene locus_tag LOCUS_12930 12492 11776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 13010 12489 gene locus_tag LOCUS_12940 13010 12489 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795316.1 protein_id gnl|my_center|LOCUS_12940 15839 13185 gene locus_tag LOCUS_12950 15839 13185 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_12950 16382 15855 gene locus_tag LOCUS_12960 16382 15855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 18751 16598 gene locus_tag LOCUS_12970 18751 16598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 19379 20125 gene locus_tag LOCUS_12980 gene sufC 19379 20125 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_12980 20139 21557 gene locus_tag LOCUS_12990 gene sufB 20139 21557 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_12990 21580 22647 gene locus_tag LOCUS_13000 gene sufD 21580 22647 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_13000 22640 23881 gene locus_tag LOCUS_13010 22640 23881 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_13010 23871 24302 gene locus_tag LOCUS_13020 23871 24302 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_13020 25407 24382 gene locus_tag LOCUS_13030 25407 24382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 25622 26560 gene locus_tag LOCUS_13040 25622 26560 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067939.1 protein_id gnl|my_center|LOCUS_13040 26591 27871 gene locus_tag LOCUS_13050 26591 27871 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986389.1 protein_id gnl|my_center|LOCUS_13050 28499 28002 gene locus_tag LOCUS_13060 28499 28002 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017896.1 protein_id gnl|my_center|LOCUS_13060 28887 28636 gene locus_tag LOCUS_13070 28887 28636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 28862 29107 gene locus_tag LOCUS_13080 28862 29107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 30286 29189 gene locus_tag LOCUS_13090 gene rodA 30286 29189 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_13090 30446 30919 gene locus_tag LOCUS_13100 gene tsaE 30446 30919 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_13100 30916 31635 gene locus_tag LOCUS_13110 gene tsaB 30916 31635 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_13110 31666 32295 gene locus_tag LOCUS_13120 gene upp 31666 32295 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_13120 32484 32571 gene locus_tag LOCUS_t00250 32484 32571 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 33060 32638 gene locus_tag LOCUS_13130 33060 32638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 33334 34527 gene locus_tag LOCUS_13140 33334 34527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 35447 34641 gene locus_tag LOCUS_13150 35447 34641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 35731 37404 gene locus_tag LOCUS_13160 35731 37404 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_13160 38075 37479 gene locus_tag LOCUS_13170 38075 37479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 38967 38233 gene locus_tag LOCUS_13180 38967 38233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 39280 39077 gene locus_tag LOCUS_13190 39280 39077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 39188 40189 gene locus_tag LOCUS_13200 39188 40189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 40352 42025 gene locus_tag LOCUS_13210 40352 42025 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_13210 43223 42129 gene locus_tag LOCUS_13220 43223 42129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 44530 43439 gene locus_tag LOCUS_13230 44530 43439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 45119 44640 gene locus_tag LOCUS_13240 45119 44640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 46216 45431 gene locus_tag LOCUS_13250 46216 45431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence16 562 2022 gene locus_tag LOCUS_13260 562 2022 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964320.1 protein_id gnl|my_center|LOCUS_13260 2075 2593 gene locus_tag LOCUS_13270 2075 2593 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356248.1 protein_id gnl|my_center|LOCUS_13270 2698 3804 gene locus_tag LOCUS_13280 2698 3804 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_13280 4022 4189 gene locus_tag LOCUS_13290 4022 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 4331 6730 gene locus_tag LOCUS_13300 4331 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 7374 6838 gene locus_tag LOCUS_13310 7374 6838 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532362.1 protein_id gnl|my_center|LOCUS_13310 7898 7458 gene locus_tag LOCUS_13320 7898 7458 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_13320 8772 8230 gene locus_tag LOCUS_13330 gene raiA 8772 8230 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671185.1 protein_id gnl|my_center|LOCUS_13330 9673 9134 gene locus_tag LOCUS_13340 9673 9134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 10015 9737 gene locus_tag LOCUS_13350 10015 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 10828 10541 gene locus_tag LOCUS_13360 10828 10541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 11740 11084 gene locus_tag LOCUS_13370 11740 11084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 13547 11772 gene locus_tag LOCUS_13380 13547 11772 CDS product aminopeptidase P family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986733.1 protein_id gnl|my_center|LOCUS_13380 13811 14728 gene locus_tag LOCUS_13390 13811 14728 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812829.1 protein_id gnl|my_center|LOCUS_13390 15202 16920 gene locus_tag LOCUS_13400 gene ilvB 15202 16920 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_13400 16935 17486 gene locus_tag LOCUS_13410 gene ilvN 16935 17486 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810756.1 protein_id gnl|my_center|LOCUS_13410 17467 18486 gene locus_tag LOCUS_13420 gene ilvC 17467 18486 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_13420 18682 19719 gene locus_tag LOCUS_13430 18682 19719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 19716 19958 gene locus_tag LOCUS_13440 19716 19958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 20102 20647 gene locus_tag LOCUS_13450 gene raiA 20102 20647 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722643.1 protein_id gnl|my_center|LOCUS_13450 20949 20749 gene locus_tag LOCUS_13460 20949 20749 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461361.1 protein_id gnl|my_center|LOCUS_13460 21249 20953 gene locus_tag LOCUS_13470 21249 20953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 22304 21627 gene locus_tag LOCUS_13480 22304 21627 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287585.1 protein_id gnl|my_center|LOCUS_13480 22457 24121 gene locus_tag LOCUS_13490 gene ilvD 22457 24121 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_13490 24219 25283 gene locus_tag LOCUS_13500 24219 25283 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_13500 25374 26690 gene locus_tag LOCUS_13510 25374 26690 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_13510 26988 28070 gene locus_tag LOCUS_13520 gene hrcA 26988 28070 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454754.1 protein_id gnl|my_center|LOCUS_13520 28112 28753 gene locus_tag LOCUS_13530 28112 28753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 28822 30690 gene locus_tag LOCUS_13540 gene dnaK 28822 30690 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_13540 30848 32029 gene locus_tag LOCUS_13550 gene dnaJ 30848 32029 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048002.1 protein_id gnl|my_center|LOCUS_13550 32057 32857 gene locus_tag LOCUS_13560 32057 32857 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459478.1 protein_id gnl|my_center|LOCUS_13560 32882 33316 gene locus_tag LOCUS_13570 gene rpiB 32882 33316 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932826.1 protein_id gnl|my_center|LOCUS_13570 33999 33385 gene locus_tag LOCUS_13580 33999 33385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 34533 34027 gene locus_tag LOCUS_13590 34533 34027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 35073 36167 gene locus_tag LOCUS_13600 gene gcvT 35073 36167 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_13600 36220 36603 gene locus_tag LOCUS_13610 gene gcvH 36220 36603 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973527.1 protein_id gnl|my_center|LOCUS_13610 36606 37919 gene locus_tag LOCUS_13620 gene gcvPA 36606 37919 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678346.1 protein_id gnl|my_center|LOCUS_13620 37919 39355 gene locus_tag LOCUS_13630 gene gcvPB 37919 39355 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679310.1 protein_id gnl|my_center|LOCUS_13630 39407 40390 gene locus_tag LOCUS_13640 39407 40390 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812232.1 protein_id gnl|my_center|LOCUS_13640 40397 41764 gene locus_tag LOCUS_13650 gene lpdA 40397 41764 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461729.1 protein_id gnl|my_center|LOCUS_13650 41797 42486 gene locus_tag LOCUS_13660 41797 42486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 43068 42553 gene locus_tag LOCUS_13670 43068 42553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 44232 43072 gene locus_tag LOCUS_13680 44232 43072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 45750 44824 gene locus_tag LOCUS_13690 gene metA 45750 44824 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_13690 45665 45913 gene locus_tag LOCUS_13700 45665 45913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 45939 46268 gene locus_tag LOCUS_13710 45939 46268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence17 <1 2509 gene locus_tag LOCUS_13720 <1 2509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000714663.1:S-layer homology domain-containing protein 2632 2811 gene locus_tag LOCUS_13730 2632 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 3239 4909 gene locus_tag LOCUS_13740 3239 4909 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_13740 4921 5220 gene locus_tag LOCUS_13750 4921 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 5415 7982 gene locus_tag LOCUS_13760 5415 7982 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227616.1 protein_id gnl|my_center|LOCUS_13760 7994 9433 gene locus_tag LOCUS_13770 gene casA 7994 9433 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227614.1 protein_id gnl|my_center|LOCUS_13770 9430 9954 gene locus_tag LOCUS_13780 9430 9954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 9958 11100 gene locus_tag LOCUS_13790 gene cas7e 9958 11100 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227612.1 protein_id gnl|my_center|LOCUS_13790 11152 11793 gene locus_tag LOCUS_13800 11152 11793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 11774 12385 gene locus_tag LOCUS_13810 11774 12385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 12482 13054 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtatgccccacgtatgtggggatgaaccg 13120 13281 gene locus_tag LOCUS_13820 13120 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 13742 14170 gene locus_tag LOCUS_13830 13742 14170 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814584.1 protein_id gnl|my_center|LOCUS_13830 14200 14655 gene locus_tag LOCUS_13840 14200 14655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 14652 15980 gene locus_tag LOCUS_13850 14652 15980 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017864221.1 protein_id gnl|my_center|LOCUS_13850 16056 16229 gene locus_tag LOCUS_13860 16056 16229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 16284 16673 gene locus_tag LOCUS_13870 16284 16673 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_13870 17165 16764 gene locus_tag LOCUS_13880 17165 16764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 19024 17219 gene locus_tag LOCUS_13890 gene thrS 19024 17219 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_13890 20190 19528 gene locus_tag LOCUS_13900 20190 19528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 22346 20919 gene locus_tag LOCUS_13910 22346 20919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 22975 22427 gene locus_tag LOCUS_13920 22975 22427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 24331 23003 gene locus_tag LOCUS_13930 24331 23003 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_13930 24603 25613 gene locus_tag LOCUS_13940 24603 25613 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_13940 25846 25673 gene locus_tag LOCUS_13950 25846 25673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 26139 25924 gene locus_tag LOCUS_13960 26139 25924 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916506.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13960 26401 26132 gene locus_tag LOCUS_13970 26401 26132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 27183 26590 gene locus_tag LOCUS_13980 27183 26590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 28478 27279 gene locus_tag LOCUS_13990 28478 27279 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793744.1 protein_id gnl|my_center|LOCUS_13990 28672 30036 gene locus_tag LOCUS_14000 28672 30036 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_14000 30190 30405 gene locus_tag LOCUS_14010 30190 30405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 30422 31414 gene locus_tag LOCUS_14020 30422 31414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 31508 32383 gene locus_tag LOCUS_14030 31508 32383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 32383 33555 gene locus_tag LOCUS_14040 32383 33555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 33573 34589 gene locus_tag LOCUS_14050 33573 34589 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682008.1 protein_id gnl|my_center|LOCUS_14050 34606 35727 gene locus_tag LOCUS_14060 34606 35727 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682004.1 protein_id gnl|my_center|LOCUS_14060 35717 36856 gene locus_tag LOCUS_14070 gene cbiD 35717 36856 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168467.1 protein_id gnl|my_center|LOCUS_14070 36841 37545 gene locus_tag LOCUS_14080 gene cobI 36841 37545 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 protein_id gnl|my_center|LOCUS_14080 37542 38297 gene locus_tag LOCUS_14090 gene cobM 37542 38297 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392606.1 protein_id gnl|my_center|LOCUS_14090 38294 39280 gene locus_tag LOCUS_14100 gene cbiG 38294 39280 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721596.1 protein_id gnl|my_center|LOCUS_14100 39282 39509 gene locus_tag LOCUS_14110 39282 39509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence18 1490 2110 gene locus_tag LOCUS_14120 1490 2110 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_14120 3637 2198 gene locus_tag LOCUS_14130 3637 2198 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_14130 3922 4668 gene locus_tag LOCUS_14140 gene truA 3922 4668 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294728.1 protein_id gnl|my_center|LOCUS_14140 4696 5121 gene locus_tag LOCUS_14150 4696 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 5843 5232 gene locus_tag LOCUS_14160 5843 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 6256 7626 gene locus_tag LOCUS_14170 6256 7626 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_14170 7630 8850 gene locus_tag LOCUS_14180 7630 8850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 8850 9452 gene locus_tag LOCUS_14190 8850 9452 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852949.1 protein_id gnl|my_center|LOCUS_14190 9458 10261 gene locus_tag LOCUS_14200 gene thiD 9458 10261 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_14200 10725 10240 gene locus_tag LOCUS_14210 10725 10240 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067975.1 protein_id gnl|my_center|LOCUS_14210 10879 12312 gene locus_tag LOCUS_14220 gene purB 10879 12312 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_14220 12461 13378 gene locus_tag LOCUS_14230 12461 13378 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966232.1 protein_id gnl|my_center|LOCUS_14230 13416 15197 gene locus_tag LOCUS_14240 13416 15197 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861202.1 protein_id gnl|my_center|LOCUS_14240 15818 15612 gene locus_tag LOCUS_14250 15818 15612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 17583 15832 gene locus_tag LOCUS_14260 17583 15832 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_14260 17991 17587 gene locus_tag LOCUS_14270 17991 17587 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393960.1 protein_id gnl|my_center|LOCUS_14270 18124 18867 gene locus_tag LOCUS_14280 18124 18867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 19847 19476 gene locus_tag LOCUS_14290 19847 19476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 21422 19962 gene locus_tag LOCUS_14300 21422 19962 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945989.1 protein_id gnl|my_center|LOCUS_14300 23215 21845 gene locus_tag LOCUS_14310 23215 21845 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_14310 24060 23212 gene locus_tag LOCUS_14320 24060 23212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 24813 24190 gene locus_tag LOCUS_14330 24813 24190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 25356 24826 gene locus_tag LOCUS_14340 25356 24826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 25841 25353 gene locus_tag LOCUS_14350 25841 25353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 26973 25858 gene locus_tag LOCUS_14360 26973 25858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 27353 26970 gene locus_tag LOCUS_14370 27353 26970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 27557 27363 gene locus_tag LOCUS_14380 gene spoIIIAC 27557 27363 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888937.1 protein_id gnl|my_center|LOCUS_14380 28076 27573 gene locus_tag LOCUS_14390 28076 27573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 28960 28073 gene locus_tag LOCUS_14400 gene spoIIIAA 28960 28073 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393045.1 protein_id gnl|my_center|LOCUS_14400 29256 30068 gene locus_tag LOCUS_14410 29256 30068 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986756.1 protein_id gnl|my_center|LOCUS_14410 30628 30065 gene locus_tag LOCUS_14420 30628 30065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 31375 30725 gene locus_tag LOCUS_14430 31375 30725 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272550.1 protein_id gnl|my_center|LOCUS_14430 32159 31377 gene locus_tag LOCUS_14440 gene udp 32159 31377 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_14440 32599 32156 gene locus_tag LOCUS_14450 gene ruvX 32599 32156 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810863.1 protein_id gnl|my_center|LOCUS_14450 32805 34160 gene locus_tag LOCUS_14460 32805 34160 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_14460 34627 34250 gene locus_tag LOCUS_14470 gene rplL 34627 34250 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357259.1 protein_id gnl|my_center|LOCUS_14470 35249 34710 gene locus_tag LOCUS_14480 gene rplJ 35249 34710 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 protein_id gnl|my_center|LOCUS_14480 36194 35502 gene locus_tag LOCUS_14490 gene rplA 36194 35502 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_14490 36638 36213 gene locus_tag LOCUS_14500 gene rplK 36638 36213 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_14500 37226 36732 gene locus_tag LOCUS_14510 gene nusG 37226 36732 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_14510 37596 37270 gene locus_tag LOCUS_14520 37596 37270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 37802 37638 gene locus_tag LOCUS_14530 gene rpmG 37802 37638 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_14530 <39198 38116 gene locus_tag LOCUS_14540 <39198 38116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016357.1:radical SAM protein >Feature sequence19 1480 164 gene locus_tag LOCUS_14550 1480 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2202 1480 gene locus_tag LOCUS_14560 2202 1480 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_14560 2393 2752 gene locus_tag LOCUS_14570 2393 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 2803 3198 gene locus_tag LOCUS_14580 2803 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 3319 4866 gene locus_tag LOCUS_14590 3319 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 5352 6242 gene locus_tag LOCUS_14600 5352 6242 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230236.1 protein_id gnl|my_center|LOCUS_14600 6325 6582 gene locus_tag LOCUS_14610 6325 6582 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_14610 6575 7630 gene locus_tag LOCUS_14620 gene hydE 6575 7630 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_14620 7650 9098 gene locus_tag LOCUS_14630 gene hydG 7650 9098 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_14630 10577 9195 gene locus_tag LOCUS_14640 10577 9195 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390018.1 protein_id gnl|my_center|LOCUS_14640 10747 11586 gene locus_tag LOCUS_14650 10747 11586 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475880.1 protein_id gnl|my_center|LOCUS_14650 12143 11643 gene locus_tag LOCUS_14660 gene greA 12143 11643 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830881.1 protein_id gnl|my_center|LOCUS_14660 13499 12213 gene locus_tag LOCUS_14670 13499 12213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 14441 13701 gene locus_tag LOCUS_14680 14441 13701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 14829 14434 gene locus_tag LOCUS_14690 14829 14434 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379040.1 protein_id gnl|my_center|LOCUS_14690 14998 15564 gene locus_tag LOCUS_14700 14998 15564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 15567 17516 gene locus_tag LOCUS_14710 15567 17516 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964362.1 protein_id gnl|my_center|LOCUS_14710 18560 17583 gene locus_tag LOCUS_14720 18560 17583 CDS product chromosome condensation regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000385090.1 protein_id gnl|my_center|LOCUS_14720 19660 18590 gene locus_tag LOCUS_14730 gene leuB 19660 18590 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_14730 20161 19664 gene locus_tag LOCUS_14740 gene leuD 20161 19664 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_14740 21424 20165 gene locus_tag LOCUS_14750 gene leuC 21424 20165 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_14750 23215 21521 gene locus_tag LOCUS_14760 23215 21521 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_14760 24907 23600 gene locus_tag LOCUS_14770 24907 23600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 26439 25039 gene locus_tag LOCUS_14780 26439 25039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 26666 27778 gene locus_tag LOCUS_14790 gene hisZ 26666 27778 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393533.1 protein_id gnl|my_center|LOCUS_14790 27775 28425 gene locus_tag LOCUS_14800 gene hisG 27775 28425 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943722.1 protein_id gnl|my_center|LOCUS_14800 28422 29720 gene locus_tag LOCUS_14810 gene hisD 28422 29720 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949111.1 protein_id gnl|my_center|LOCUS_14810 29717 30781 gene locus_tag LOCUS_14820 gene hisC 29717 30781 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966312.1 protein_id gnl|my_center|LOCUS_14820 30783 31367 gene locus_tag LOCUS_14830 gene hisB 30783 31367 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_14830 31364 31987 gene locus_tag LOCUS_14840 gene hisH 31364 31987 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_14840 31989 32714 gene locus_tag LOCUS_14850 gene hisA 31989 32714 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012897810.1 protein_id gnl|my_center|LOCUS_14850 32711 33466 gene locus_tag LOCUS_14860 gene hisF 32711 33466 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964259.1 protein_id gnl|my_center|LOCUS_14860 33485 34132 gene locus_tag LOCUS_14870 gene hisIE 33485 34132 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_14870 34322 34741 gene locus_tag LOCUS_14880 34322 34741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 34758 35261 gene locus_tag LOCUS_14890 34758 35261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 35405 36184 gene locus_tag LOCUS_14900 gene proB 35405 36184 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_14900 36193 37236 gene locus_tag LOCUS_14910 36193 37236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14910 >Feature sequence20 56 277 gene locus_tag LOCUS_14920 56 277 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_14920 399 2816 gene locus_tag LOCUS_14930 399 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 2872 3039 gene locus_tag LOCUS_14940 2872 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 3256 4641 gene locus_tag LOCUS_14950 gene murD 3256 4641 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_14950 4651 5691 gene locus_tag LOCUS_14960 4651 5691 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_14960 5681 6709 gene locus_tag LOCUS_14970 5681 6709 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_14970 6727 7737 gene locus_tag LOCUS_14980 6727 7737 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_14980 7739 8986 gene locus_tag LOCUS_14990 7739 8986 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_14990 9017 11035 gene locus_tag LOCUS_15000 gene ligA 9017 11035 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_15000 11173 11493 gene locus_tag LOCUS_15010 11173 11493 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_15010 12479 11496 gene locus_tag LOCUS_15020 12479 11496 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_15020 13653 13225 gene locus_tag LOCUS_15030 13653 13225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 14026 13721 gene locus_tag LOCUS_15040 gene yajC 14026 13721 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426573.1 protein_id gnl|my_center|LOCUS_15040 15239 14109 gene locus_tag LOCUS_15050 gene tgt 15239 14109 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_15050 16289 15252 gene locus_tag LOCUS_15060 gene queA 16289 15252 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_15060 17934 16276 gene locus_tag LOCUS_15070 17934 16276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 18165 19250 gene locus_tag LOCUS_15080 gene asd 18165 19250 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_15080 19371 20261 gene locus_tag LOCUS_15090 gene dapA 19371 20261 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_15090 21100 21693 gene locus_tag LOCUS_15100 21100 21693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 21687 22505 gene locus_tag LOCUS_15110 21687 22505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 23915 22602 gene locus_tag LOCUS_15120 gene thiC 23915 22602 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966296.1 protein_id gnl|my_center|LOCUS_15120 24259 24729 gene locus_tag LOCUS_15130 24259 24729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 24734 25345 gene locus_tag LOCUS_15140 24734 25345 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392905.1 protein_id gnl|my_center|LOCUS_15140 26764 25397 gene locus_tag LOCUS_15150 26764 25397 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_15150 27414 27004 gene locus_tag LOCUS_15160 27414 27004 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564973.1 protein_id gnl|my_center|LOCUS_15160 28811 27414 gene locus_tag LOCUS_15170 gene atpD 28811 27414 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_15170 29797 28835 gene locus_tag LOCUS_15180 gene atpG 29797 28835 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_15180 31302 29785 gene locus_tag LOCUS_15190 gene atpA 31302 29785 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_15190 31823 31308 gene locus_tag LOCUS_15200 31823 31308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 32311 31820 gene locus_tag LOCUS_15210 32311 31820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 32546 32328 gene locus_tag LOCUS_15220 32546 32328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 33302 32613 gene locus_tag LOCUS_15230 33302 32613 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966155.1 protein_id gnl|my_center|LOCUS_15230 33529 35151 gene locus_tag LOCUS_15240 33529 35151 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948042.1 protein_id gnl|my_center|LOCUS_15240 35171 35854 gene locus_tag LOCUS_15250 gene maeM 35171 35854 CDS product two-component system response regulator MaeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968074.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence21 1471 119 gene locus_tag LOCUS_15260 1471 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1654 2259 gene locus_tag LOCUS_15270 1654 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 2855 5614 gene locus_tag LOCUS_15280 gene secA 2855 5614 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_15280 5717 6529 gene locus_tag LOCUS_15290 gene pgeF 5717 6529 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227882.1 protein_id gnl|my_center|LOCUS_15290 6574 8643 gene locus_tag LOCUS_15300 6574 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 8862 9542 gene locus_tag LOCUS_15310 8862 9542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 9543 10379 gene locus_tag LOCUS_15320 9543 10379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 10490 10417 gene locus_tag LOCUS_t00260 10490 10417 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10684 11601 gene locus_tag LOCUS_15330 10684 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965639.1 protein_id gnl|my_center|LOCUS_15330 11756 12616 gene locus_tag LOCUS_15340 11756 12616 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817462.1 protein_id gnl|my_center|LOCUS_15340 12613 14847 gene locus_tag LOCUS_15350 12613 14847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 14837 15451 gene locus_tag LOCUS_15360 14837 15451 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_15360 15539 15718 gene locus_tag LOCUS_15370 15539 15718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 15838 16203 gene locus_tag LOCUS_15380 15838 16203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 16316 16795 gene locus_tag LOCUS_15390 16316 16795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 16848 18503 gene locus_tag LOCUS_15400 16848 18503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 18666 19118 gene locus_tag LOCUS_15410 18666 19118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 19264 20520 gene locus_tag LOCUS_15420 19264 20520 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_15420 20788 25071 gene locus_tag LOCUS_15430 20788 25071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 25265 26770 gene locus_tag LOCUS_15440 25265 26770 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_15440 26801 27664 gene locus_tag LOCUS_15450 gene rapZ 26801 27664 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_15450 27695 28594 gene locus_tag LOCUS_15460 gene whiA 27695 28594 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_15460 28659 29099 gene locus_tag LOCUS_15470 28659 29099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 29104 32577 gene locus_tag LOCUS_15480 29104 32577 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_15480 32661 34199 gene locus_tag LOCUS_15490 gene cls 32661 34199 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence22 196 120 gene locus_tag LOCUS_t00270 196 120 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 332 631 gene locus_tag LOCUS_15500 332 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 612 1199 gene locus_tag LOCUS_15510 612 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1287 1622 gene locus_tag LOCUS_15520 1287 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 2626 1715 gene locus_tag LOCUS_15530 gene argF 2626 1715 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_15530 3843 2665 gene locus_tag LOCUS_15540 3843 2665 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_15540 4761 3901 gene locus_tag LOCUS_15550 gene argB 4761 3901 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_15550 6029 4794 gene locus_tag LOCUS_15560 gene argJ 6029 4794 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_15560 6980 6048 gene locus_tag LOCUS_15570 gene argC 6980 6048 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919254.1 protein_id gnl|my_center|LOCUS_15570 8362 6983 gene locus_tag LOCUS_15580 gene argH 8362 6983 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_15580 9736 8498 gene locus_tag LOCUS_15590 9736 8498 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_15590 9986 10070 gene locus_tag LOCUS_t00280 9986 10070 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10319 12487 gene locus_tag LOCUS_15600 10319 12487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 12689 13888 gene locus_tag LOCUS_15610 gene dpaL 12689 13888 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812104.1 protein_id gnl|my_center|LOCUS_15610 13893 15257 gene locus_tag LOCUS_15620 13893 15257 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_15620 16145 15318 gene locus_tag LOCUS_15630 16145 15318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 16305 17018 gene locus_tag LOCUS_15640 16305 17018 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068399.1 protein_id gnl|my_center|LOCUS_15640 17178 18410 gene locus_tag LOCUS_15650 17178 18410 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016570.1 protein_id gnl|my_center|LOCUS_15650 18470 18928 gene locus_tag LOCUS_15660 18470 18928 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_15660 19023 19211 gene locus_tag LOCUS_15670 19023 19211 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811990.1 protein_id gnl|my_center|LOCUS_15670 19369 19824 gene locus_tag LOCUS_15680 19369 19824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 19831 20961 gene locus_tag LOCUS_15690 19831 20961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 20980 21297 gene locus_tag LOCUS_15700 20980 21297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 21316 21618 gene locus_tag LOCUS_15710 21316 21618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 21633 21830 gene locus_tag LOCUS_15720 21633 21830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 21843 22289 gene locus_tag LOCUS_15730 21843 22289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 22312 22773 gene locus_tag LOCUS_15740 22312 22773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 22960 23163 gene locus_tag LOCUS_15750 22960 23163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 23184 23744 gene locus_tag LOCUS_15760 23184 23744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 23761 24666 gene locus_tag LOCUS_15770 23761 24666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 25085 25669 gene locus_tag LOCUS_15780 25085 25669 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_15780 25666 25974 gene locus_tag LOCUS_15790 25666 25974 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582672.1 protein_id gnl|my_center|LOCUS_15790 25971 27152 gene locus_tag LOCUS_15800 25971 27152 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582673.1 protein_id gnl|my_center|LOCUS_15800 27159 28100 gene locus_tag LOCUS_15810 27159 28100 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_15810 28227 29093 gene locus_tag LOCUS_15820 gene rsmA 28227 29093 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651548.1 protein_id gnl|my_center|LOCUS_15820 29172 30935 gene locus_tag LOCUS_15830 29172 30935 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391166.1 protein_id gnl|my_center|LOCUS_15830 31094 31588 gene locus_tag LOCUS_15840 gene ruvC 31094 31588 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_15840 31625 32227 gene locus_tag LOCUS_15850 gene ruvA 31625 32227 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_15850 32254 33294 gene locus_tag LOCUS_15860 gene ruvB 32254 33294 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_15860 33409 34089 gene locus_tag LOCUS_15870 33409 34089 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387199.1 protein_id gnl|my_center|LOCUS_15870 34150 34425 gene locus_tag LOCUS_15880 34150 34425 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391912.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence23 519 1139 gene locus_tag LOCUS_15890 519 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1999 1157 gene locus_tag LOCUS_15900 1999 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 2409 2191 gene locus_tag LOCUS_15910 2409 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 3887 2604 gene locus_tag LOCUS_15920 3887 2604 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404565.1 protein_id gnl|my_center|LOCUS_15920 4126 4446 gene locus_tag LOCUS_15930 4126 4446 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357450.1 protein_id gnl|my_center|LOCUS_15930 4430 5257 gene locus_tag LOCUS_15940 4430 5257 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_15940 5241 6158 gene locus_tag LOCUS_15950 gene hslO 5241 6158 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_15950 6334 6409 gene locus_tag LOCUS_t00290 6334 6409 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6417 6493 gene locus_tag LOCUS_t00300 6417 6493 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 6528 6603 gene locus_tag LOCUS_t00310 6528 6603 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6628 6703 gene locus_tag LOCUS_t00320 6628 6703 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6706 6779 gene locus_tag LOCUS_t00330 6706 6779 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6870 7556 gene locus_tag LOCUS_15960 6870 7556 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_15960 7561 8739 gene locus_tag LOCUS_15970 7561 8739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 8743 10143 gene locus_tag LOCUS_15980 8743 10143 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_15980 11422 10217 gene locus_tag LOCUS_15990 gene hydF 11422 10217 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108016.1 protein_id gnl|my_center|LOCUS_15990 11952 11578 gene locus_tag LOCUS_16000 11952 11578 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_16000 12127 12777 gene locus_tag LOCUS_16010 12127 12777 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_16010 13285 12866 gene locus_tag LOCUS_16020 13285 12866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 13896 13507 gene locus_tag LOCUS_16030 13896 13507 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227791.1 protein_id gnl|my_center|LOCUS_16030 15474 13924 gene locus_tag LOCUS_16040 15474 13924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 16175 15462 gene locus_tag LOCUS_16050 16175 15462 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460117.1 protein_id gnl|my_center|LOCUS_16050 16370 18739 gene locus_tag LOCUS_16060 16370 18739 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183138.1 protein_id gnl|my_center|LOCUS_16060 18754 19167 gene locus_tag LOCUS_16070 18754 19167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 19702 19289 gene locus_tag LOCUS_16080 19702 19289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 20325 19699 gene locus_tag LOCUS_16090 20325 19699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 21329 20436 gene locus_tag LOCUS_16100 21329 20436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 22717 21326 gene locus_tag LOCUS_16110 22717 21326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 23448 22714 gene locus_tag LOCUS_16120 gene rgbR 23448 22714 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_16120 24925 23756 gene locus_tag LOCUS_16130 24925 23756 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_16130 26315 24909 gene locus_tag LOCUS_16140 26315 24909 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948690.1 protein_id gnl|my_center|LOCUS_16140 27347 26448 gene locus_tag LOCUS_16150 27347 26448 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390170.1 protein_id gnl|my_center|LOCUS_16150 28351 27392 gene locus_tag LOCUS_16160 28351 27392 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861477.1 protein_id gnl|my_center|LOCUS_16160 29050 28370 gene locus_tag LOCUS_16170 29050 28370 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359998.1 protein_id gnl|my_center|LOCUS_16170 30077 29031 gene locus_tag LOCUS_16180 30077 29031 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356948.1 protein_id gnl|my_center|LOCUS_16180 30647 30264 gene locus_tag LOCUS_16190 30647 30264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 31777 30644 gene locus_tag LOCUS_16200 gene mnmA 31777 30644 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393152.1 protein_id gnl|my_center|LOCUS_16200 32537 31878 gene locus_tag LOCUS_16210 32537 31878 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272550.1 protein_id gnl|my_center|LOCUS_16210 33629 32553 gene locus_tag LOCUS_16220 33629 32553 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261890.1 protein_id gnl|my_center|LOCUS_16220 33997 33842 gene locus_tag LOCUS_16230 33997 33842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence24 2963 372 gene locus_tag LOCUS_16240 2963 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 3448 5562 gene locus_tag LOCUS_16250 3448 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 6371 5676 gene locus_tag LOCUS_16260 6371 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 6858 6343 gene locus_tag LOCUS_16270 6858 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 7851 7030 gene locus_tag LOCUS_16280 7851 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816588.1 protein_id gnl|my_center|LOCUS_16280 8540 7845 gene locus_tag LOCUS_16290 8540 7845 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_16290 8926 8537 gene locus_tag LOCUS_16300 8926 8537 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816592.1 protein_id gnl|my_center|LOCUS_16300 9166 10182 gene locus_tag LOCUS_16310 9166 10182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 11678 10263 gene locus_tag LOCUS_16320 11678 10263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 11856 13685 gene locus_tag LOCUS_16330 11856 13685 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873616.1 protein_id gnl|my_center|LOCUS_16330 13716 14315 gene locus_tag LOCUS_16340 13716 14315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 14355 16397 gene locus_tag LOCUS_16350 14355 16397 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903241.1 protein_id gnl|my_center|LOCUS_16350 16566 18401 gene locus_tag LOCUS_16360 gene typA 16566 18401 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_16360 18511 18714 gene locus_tag LOCUS_16370 18511 18714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 18707 19450 gene locus_tag LOCUS_16380 18707 19450 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460586.1 protein_id gnl|my_center|LOCUS_16380 19437 19697 gene locus_tag LOCUS_16390 19437 19697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 20621 20028 gene locus_tag LOCUS_16400 20621 20028 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459560.1 protein_id gnl|my_center|LOCUS_16400 21237 20638 gene locus_tag LOCUS_16410 21237 20638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 22088 21234 gene locus_tag LOCUS_16420 22088 21234 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_16420 22483 22085 gene locus_tag LOCUS_16430 22483 22085 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_16430 22633 22709 gene locus_tag LOCUS_t00340 22633 22709 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 22854 24086 gene locus_tag LOCUS_16440 22854 24086 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_16440 24222 24779 gene locus_tag LOCUS_16450 24222 24779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 26720 25020 gene locus_tag LOCUS_16460 26720 25020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 28083 26749 gene locus_tag LOCUS_16470 28083 26749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 28333 28728 gene locus_tag LOCUS_16480 28333 28728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 28725 29033 gene locus_tag LOCUS_16490 28725 29033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 29030 29476 gene locus_tag LOCUS_16500 29030 29476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence25 106 4416 gene locus_tag LOCUS_16510 106 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 14129 4524 gene locus_tag LOCUS_16520 14129 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 14477 14295 gene locus_tag LOCUS_16530 14477 14295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 14608 14474 gene locus_tag LOCUS_16540 14608 14474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 16313 14775 gene locus_tag LOCUS_16550 16313 14775 CDS product BCCT family carnitine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120258.1 protein_id gnl|my_center|LOCUS_16550 17509 16352 gene locus_tag LOCUS_16560 17509 16352 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986546.1 protein_id gnl|my_center|LOCUS_16560 18757 17531 gene locus_tag LOCUS_16570 18757 17531 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986697.1 protein_id gnl|my_center|LOCUS_16570 19377 18835 gene locus_tag LOCUS_16580 19377 18835 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430880.1 protein_id gnl|my_center|LOCUS_16580 20117 19377 gene locus_tag LOCUS_16590 20117 19377 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869338.1 protein_id gnl|my_center|LOCUS_16590 21187 20132 gene locus_tag LOCUS_16600 gene vorB 21187 20132 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890635.1 protein_id gnl|my_center|LOCUS_16600 21408 21202 gene locus_tag LOCUS_16610 21408 21202 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869340.1 protein_id gnl|my_center|LOCUS_16610 23479 21815 gene locus_tag LOCUS_16620 23479 21815 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_16620 32146 23651 gene locus_tag LOCUS_16630 32146 23651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence26 872 1525 gene locus_tag LOCUS_16640 gene deoC 872 1525 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439345.1 protein_id gnl|my_center|LOCUS_16640 1786 2202 gene locus_tag LOCUS_16650 1786 2202 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_16650 2374 2847 gene locus_tag LOCUS_16660 2374 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 2844 5420 gene locus_tag LOCUS_16670 2844 5420 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906085.1 protein_id gnl|my_center|LOCUS_16670 5921 7387 gene locus_tag LOCUS_16680 gene trpE 5921 7387 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_16680 7384 7971 gene locus_tag LOCUS_16690 7384 7971 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545428.1 protein_id gnl|my_center|LOCUS_16690 7968 9002 gene locus_tag LOCUS_16700 gene trpD 7968 9002 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_16700 8999 9787 gene locus_tag LOCUS_16710 gene trpC 8999 9787 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_16710 9784 10407 gene locus_tag LOCUS_16720 9784 10407 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169926.1 protein_id gnl|my_center|LOCUS_16720 10404 11594 gene locus_tag LOCUS_16730 gene trpB 10404 11594 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_16730 11587 12357 gene locus_tag LOCUS_16740 gene trpA 11587 12357 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_16740 12573 14129 gene locus_tag LOCUS_16750 12573 14129 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017097.1 protein_id gnl|my_center|LOCUS_16750 14177 15118 gene locus_tag LOCUS_16760 14177 15118 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086014.1 protein_id gnl|my_center|LOCUS_16760 15154 16008 gene locus_tag LOCUS_16770 15154 16008 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970011.1 protein_id gnl|my_center|LOCUS_16770 16065 16853 gene locus_tag LOCUS_16780 16065 16853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 16858 17601 gene locus_tag LOCUS_16790 16858 17601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16790 17906 17694 gene locus_tag LOCUS_16800 17906 17694 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_16800 19164 18109 gene locus_tag LOCUS_16810 19164 18109 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_16810 19445 20182 gene locus_tag LOCUS_16820 19445 20182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 20275 20937 gene locus_tag LOCUS_16830 20275 20937 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437036.1 protein_id gnl|my_center|LOCUS_16830 20973 22187 gene locus_tag LOCUS_16840 20973 22187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 22219 22809 gene locus_tag LOCUS_16850 22219 22809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 23819 22863 gene locus_tag LOCUS_16860 23819 22863 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359343.1 protein_id gnl|my_center|LOCUS_16860 24495 24100 gene locus_tag LOCUS_16870 24495 24100 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811644.1 protein_id gnl|my_center|LOCUS_16870 24712 25584 gene locus_tag LOCUS_16880 gene pdxS 24712 25584 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813582.1 protein_id gnl|my_center|LOCUS_16880 25586 26146 gene locus_tag LOCUS_16890 gene pdxT 25586 26146 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113516.1 protein_id gnl|my_center|LOCUS_16890 27566 26259 gene locus_tag LOCUS_16900 27566 26259 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944264.1 protein_id gnl|my_center|LOCUS_16900 28224 27571 gene locus_tag LOCUS_16910 gene catA 28224 27571 CDS product type A chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986550.1 protein_id gnl|my_center|LOCUS_16910 29244 28390 gene locus_tag LOCUS_16920 29244 28390 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_16920 29836 31056 gene locus_tag LOCUS_16930 29836 31056 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_16930 31177 32043 gene locus_tag LOCUS_16940 31177 32043 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence27 223 1044 gene locus_tag LOCUS_16950 223 1044 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391588.1 protein_id gnl|my_center|LOCUS_16950 1194 1391 gene locus_tag LOCUS_16960 gene thiS 1194 1391 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_16960 1393 2049 gene locus_tag LOCUS_16970 gene thiF 1393 2049 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858442.1 protein_id gnl|my_center|LOCUS_16970 2074 2847 gene locus_tag LOCUS_16980 2074 2847 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 protein_id gnl|my_center|LOCUS_16980 2899 4152 gene locus_tag LOCUS_16990 gene thiH 2899 4152 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_16990 4424 4738 gene locus_tag LOCUS_17000 4424 4738 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812401.1 protein_id gnl|my_center|LOCUS_17000 7323 4786 gene locus_tag LOCUS_17010 7323 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 8138 7323 gene locus_tag LOCUS_17020 8138 7323 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272547.1 protein_id gnl|my_center|LOCUS_17020 8449 9795 gene locus_tag LOCUS_17030 8449 9795 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_17030 10036 9860 gene locus_tag LOCUS_17040 10036 9860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 12192 10036 gene locus_tag LOCUS_17050 12192 10036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 13398 12226 gene locus_tag LOCUS_17060 13398 12226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 14344 13403 gene locus_tag LOCUS_17070 14344 13403 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242543.1 protein_id gnl|my_center|LOCUS_17070 18981 14341 gene locus_tag LOCUS_17080 18981 14341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 20678 18978 gene locus_tag LOCUS_17090 20678 18978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 22174 20972 gene locus_tag LOCUS_17100 22174 20972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 22326 23528 gene locus_tag LOCUS_17110 gene hemW 22326 23528 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_17110 24581 23592 gene locus_tag LOCUS_17120 24581 23592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 25038 24592 gene locus_tag LOCUS_17130 25038 24592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 25481 25068 gene locus_tag LOCUS_17140 25481 25068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 26049 25534 gene locus_tag LOCUS_17150 26049 25534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 26638 26105 gene locus_tag LOCUS_17160 26638 26105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 27200 28438 gene locus_tag LOCUS_17170 27200 28438 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_17170 28506 29783 gene locus_tag LOCUS_17180 28506 29783 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_17180 29780 30670 gene locus_tag LOCUS_17190 gene ispE 29780 30670 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722719.1 protein_id gnl|my_center|LOCUS_17190 30742 31368 gene locus_tag LOCUS_17200 gene spoIIR 30742 31368 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768304.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence28 290 60 gene locus_tag LOCUS_17210 290 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1332 2330 gene locus_tag LOCUS_17220 1332 2330 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_17220 4327 3644 gene locus_tag LOCUS_17230 4327 3644 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890976.1 protein_id gnl|my_center|LOCUS_17230 5391 4321 gene locus_tag LOCUS_17240 5391 4321 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454156.1 protein_id gnl|my_center|LOCUS_17240 5748 7295 gene locus_tag LOCUS_17250 5748 7295 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_17250 7292 8548 gene locus_tag LOCUS_17260 7292 8548 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_17260 8545 9576 gene locus_tag LOCUS_17270 8545 9576 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_17270 9723 11051 gene locus_tag LOCUS_17280 9723 11051 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072447.1 protein_id gnl|my_center|LOCUS_17280 12478 11057 gene locus_tag LOCUS_17290 gene purF 12478 11057 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_17290 14094 12475 gene locus_tag LOCUS_17300 14094 12475 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_17300 15671 14091 gene locus_tag LOCUS_17310 gene asnB 15671 14091 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_17310 17795 15750 gene locus_tag LOCUS_17320 17795 15750 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_17320 18381 18142 gene locus_tag LOCUS_17330 18381 18142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 19071 18700 gene locus_tag LOCUS_17340 19071 18700 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166961.1 protein_id gnl|my_center|LOCUS_17340 20343 19147 gene locus_tag LOCUS_17350 20343 19147 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476376.1 protein_id gnl|my_center|LOCUS_17350 20593 21396 gene locus_tag LOCUS_17360 gene proC 20593 21396 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836906.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence29 83 292 gene locus_tag LOCUS_17370 83 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1404 355 gene locus_tag LOCUS_17380 gene rsmH 1404 355 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_17380 2168 1464 gene locus_tag LOCUS_17390 2168 1464 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 protein_id gnl|my_center|LOCUS_17390 3239 2181 gene locus_tag LOCUS_17400 3239 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 3355 3738 gene locus_tag LOCUS_17410 3355 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 3754 4980 gene locus_tag LOCUS_17420 3754 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17420 4977 5540 gene locus_tag LOCUS_17430 4977 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 5650 6396 gene locus_tag LOCUS_17440 5650 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 6579 9305 gene locus_tag LOCUS_17450 6579 9305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 9793 9371 gene locus_tag LOCUS_17460 9793 9371 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_17460 10712 9795 gene locus_tag LOCUS_17470 gene pyrB 10712 9795 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_17470 11397 10765 gene locus_tag LOCUS_17480 gene pyrE 11397 10765 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232105.1 protein_id gnl|my_center|LOCUS_17480 12127 11429 gene locus_tag LOCUS_17490 gene pyrF 12127 11429 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_17490 13038 12127 gene locus_tag LOCUS_17500 13038 12127 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905897.1 protein_id gnl|my_center|LOCUS_17500 13760 13032 gene locus_tag LOCUS_17510 gene pyrK 13760 13032 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983359.1 protein_id gnl|my_center|LOCUS_17510 15037 13763 gene locus_tag LOCUS_17520 15037 13763 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016377.1 protein_id gnl|my_center|LOCUS_17520 15208 16110 gene locus_tag LOCUS_17530 15208 16110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 17221 16067 gene locus_tag LOCUS_17540 17221 16067 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247133.1 protein_id gnl|my_center|LOCUS_17540 18216 17281 gene locus_tag LOCUS_17550 18216 17281 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808885.1 protein_id gnl|my_center|LOCUS_17550 19845 18238 gene locus_tag LOCUS_17560 19845 18238 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228677.1 protein_id gnl|my_center|LOCUS_17560 20297 19845 gene locus_tag LOCUS_17570 20297 19845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 20608 20429 gene locus_tag LOCUS_17580 20608 20429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence30 1783 116 gene locus_tag LOCUS_17590 1783 116 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_17590 3387 1879 gene locus_tag LOCUS_17600 3387 1879 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_17600 7106 3420 gene locus_tag LOCUS_17610 7106 3420 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_17610 8380 7106 gene locus_tag LOCUS_17620 gene purD 8380 7106 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964705.1 protein_id gnl|my_center|LOCUS_17620 9577 8399 gene locus_tag LOCUS_17630 9577 8399 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_17630 10305 9595 gene locus_tag LOCUS_17640 10305 9595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 10916 10302 gene locus_tag LOCUS_17650 gene purN 10916 10302 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_17650 11953 10910 gene locus_tag LOCUS_17660 gene purM 11953 10910 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_17660 13380 11959 gene locus_tag LOCUS_17670 13380 11959 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_17670 13909 13415 gene locus_tag LOCUS_17680 gene purE 13909 13415 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_17680 15807 14401 gene locus_tag LOCUS_17690 15807 14401 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930859.1 protein_id gnl|my_center|LOCUS_17690 17856 16426 gene locus_tag LOCUS_17700 17856 16426 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666065.1 protein_id gnl|my_center|LOCUS_17700 19586 18180 gene locus_tag LOCUS_17710 19586 18180 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930859.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence31 64 435 gene locus_tag LOCUS_17720 64 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1885 491 gene locus_tag LOCUS_17730 gene asnS 1885 491 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432161.1 protein_id gnl|my_center|LOCUS_17730 2565 1930 gene locus_tag LOCUS_17740 gene udk 2565 1930 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225916.1 protein_id gnl|my_center|LOCUS_17740 4197 2590 gene locus_tag LOCUS_17750 4197 2590 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_17750 5670 4363 gene locus_tag LOCUS_17760 5670 4363 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016570.1 protein_id gnl|my_center|LOCUS_17760 5896 6129 gene locus_tag LOCUS_17770 5896 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 6113 6520 gene locus_tag LOCUS_17780 6113 6520 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814887.1 protein_id gnl|my_center|LOCUS_17780 6596 7360 gene locus_tag LOCUS_17790 6596 7360 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942025.1 protein_id gnl|my_center|LOCUS_17790 7701 7820 gene locus_tag LOCUS_17800 7701 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 9390 8011 gene locus_tag LOCUS_17810 9390 8011 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_17810 10796 9699 gene locus_tag LOCUS_17820 10796 9699 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546390.1 protein_id gnl|my_center|LOCUS_17820 11057 11980 gene locus_tag LOCUS_17830 gene rarD 11057 11980 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019815.1 protein_id gnl|my_center|LOCUS_17830 12708 12013 gene locus_tag LOCUS_17840 gene sfsA 12708 12013 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_17840 12849 14081 gene locus_tag LOCUS_17850 gene pepT 12849 14081 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460034.1 protein_id gnl|my_center|LOCUS_17850 14169 14245 gene locus_tag LOCUS_t00350 14169 14245 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14284 14358 gene locus_tag LOCUS_t00360 14284 14358 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 14362 14437 gene locus_tag LOCUS_t00370 14362 14437 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 14654 14562 gene locus_tag LOCUS_t00380 14654 14562 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15778 14837 gene locus_tag LOCUS_17860 15778 14837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 16412 16023 gene locus_tag LOCUS_17870 16412 16023 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_17870 16734 18143 gene locus_tag LOCUS_17880 16734 18143 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901990.1 protein_id gnl|my_center|LOCUS_17880 18370 18774 gene locus_tag LOCUS_17890 18370 18774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence32 382 1971 gene locus_tag LOCUS_17900 382 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 2007 2876 gene locus_tag LOCUS_17910 gene metF 2007 2876 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_17910 2873 3499 gene locus_tag LOCUS_17920 2873 3499 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_17920 3571 6003 gene locus_tag LOCUS_17930 3571 6003 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_17930 6173 7375 gene locus_tag LOCUS_17940 6173 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 7574 10732 gene locus_tag LOCUS_17950 7574 10732 CDS product chromosome segregation SMC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480229.1 protein_id gnl|my_center|LOCUS_17950 10748 11614 gene locus_tag LOCUS_17960 gene ftsY 10748 11614 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393780.1 protein_id gnl|my_center|LOCUS_17960 11689 12435 gene locus_tag LOCUS_17970 gene rph 11689 12435 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870262.1 protein_id gnl|my_center|LOCUS_17970 12432 13028 gene locus_tag LOCUS_17980 gene rdgB 12432 13028 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926068.1 protein_id gnl|my_center|LOCUS_17980 13012 13341 gene locus_tag LOCUS_17990 13012 13341 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034585320.1 protein_id gnl|my_center|LOCUS_17990 13407 14615 gene locus_tag LOCUS_18000 13407 14615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 14612 16240 gene locus_tag LOCUS_18010 14612 16240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 16303 16671 gene locus_tag LOCUS_18020 gene rsfS 16303 16671 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence33 1184 141 gene locus_tag LOCUS_18030 1184 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 2997 1186 gene locus_tag LOCUS_18040 2997 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 5080 3281 gene locus_tag LOCUS_18050 5080 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 6782 5100 gene locus_tag LOCUS_18060 6782 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 7905 6772 gene locus_tag LOCUS_18070 7905 6772 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127133531.1 protein_id gnl|my_center|LOCUS_18070 9644 7899 gene locus_tag LOCUS_18080 9644 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 10025 9651 gene locus_tag LOCUS_18090 10025 9651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 10923 10027 gene locus_tag LOCUS_18100 10923 10027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 12610 10946 gene locus_tag LOCUS_18110 12610 10946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 12719 12925 gene locus_tag LOCUS_18120 12719 12925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 13161 12979 gene locus_tag LOCUS_18130 13161 12979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 14666 13158 gene locus_tag LOCUS_18140 14666 13158 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence34 434 57 gene locus_tag LOCUS_18150 434 57 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_18150 1593 448 gene locus_tag LOCUS_18160 1593 448 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943945.1 protein_id gnl|my_center|LOCUS_18160 2225 1596 gene locus_tag LOCUS_18170 2225 1596 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459534.1 protein_id gnl|my_center|LOCUS_18170 3066 2296 gene locus_tag LOCUS_18180 3066 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 3201 3854 gene locus_tag LOCUS_18190 3201 3854 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_18190 5596 3902 gene locus_tag LOCUS_18200 gene cdr 5596 3902 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087552.1 protein_id gnl|my_center|LOCUS_18200 5918 5598 gene locus_tag LOCUS_18210 5918 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 6236 5931 gene locus_tag LOCUS_18220 gene trxA 6236 5931 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311093.1 protein_id gnl|my_center|LOCUS_18220 6700 6311 gene locus_tag LOCUS_18230 6700 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 7504 6758 gene locus_tag LOCUS_18240 gene fabG 7504 6758 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_18240 8573 7605 gene locus_tag LOCUS_18250 8573 7605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 8897 9061 gene locus_tag LOCUS_18260 8897 9061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 9124 9450 gene locus_tag LOCUS_18270 9124 9450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 9485 9670 gene locus_tag LOCUS_18280 9485 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 9749 10012 gene locus_tag LOCUS_18290 9749 10012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 10063 10428 gene locus_tag LOCUS_18300 10063 10428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 10416 10853 gene locus_tag LOCUS_18310 10416 10853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 10856 11047 gene locus_tag LOCUS_18320 10856 11047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 11206 11523 gene locus_tag LOCUS_18330 11206 11523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 11523 12680 gene locus_tag LOCUS_18340 11523 12680 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_18340 12804 13604 gene locus_tag LOCUS_18350 12804 13604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946975.1 protein_id gnl|my_center|LOCUS_18350 15157 14003 gene locus_tag LOCUS_18360 15157 14003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 15466 15179 gene locus_tag LOCUS_18370 15466 15179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence35 283 2010 gene locus_tag LOCUS_18380 283 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 2048 2176 gene locus_tag LOCUS_18390 2048 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 3053 2283 gene locus_tag LOCUS_18400 3053 2283 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_18400 5679 3079 gene locus_tag LOCUS_18410 5679 3079 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_18410 7053 5701 gene locus_tag LOCUS_18420 7053 5701 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389377.1 protein_id gnl|my_center|LOCUS_18420 9191 7263 gene locus_tag LOCUS_18430 9191 7263 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_18430 10939 9191 gene locus_tag LOCUS_18440 10939 9191 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_18440 11402 10902 gene locus_tag LOCUS_18450 11402 10902 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_18450 13109 11628 gene locus_tag LOCUS_18460 13109 11628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 14415 13237 gene locus_tag LOCUS_18470 14415 13237 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424103.1 protein_id gnl|my_center|LOCUS_18470 15676 15293 gene locus_tag LOCUS_18480 15676 15293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence36 126 1184 gene locus_tag LOCUS_18490 gene cobT 126 1184 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_18490 1202 1711 gene locus_tag LOCUS_18500 gene cobU 1202 1711 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338347.1 protein_id gnl|my_center|LOCUS_18500 1708 2478 gene locus_tag LOCUS_18510 gene cobS 1708 2478 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460078.1 protein_id gnl|my_center|LOCUS_18510 2475 2813 gene locus_tag LOCUS_18520 2475 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 2810 3406 gene locus_tag LOCUS_18530 2810 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 3403 4374 gene locus_tag LOCUS_18540 gene cbiB 3403 4374 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_18540 4374 5423 gene locus_tag LOCUS_18550 gene cobD 4374 5423 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 protein_id gnl|my_center|LOCUS_18550 5420 6904 gene locus_tag LOCUS_18560 5420 6904 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836536.1 protein_id gnl|my_center|LOCUS_18560 6901 7569 gene locus_tag LOCUS_18570 6901 7569 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_18570 8226 7654 gene locus_tag LOCUS_18580 8226 7654 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_18580 8485 11133 gene locus_tag LOCUS_18590 8485 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 11114 14599 gene locus_tag LOCUS_18600 11114 14599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 15537 14605 gene locus_tag LOCUS_18610 15537 14605 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681808.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence37 1357 1650 gene locus_tag LOCUS_18620 1357 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 2299 3453 gene locus_tag LOCUS_18630 2299 3453 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065465.1 protein_id gnl|my_center|LOCUS_18630 3616 4905 gene locus_tag LOCUS_18640 3616 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 4940 6223 gene locus_tag LOCUS_18650 4940 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 7016 6351 gene locus_tag LOCUS_18660 7016 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 7371 8750 gene locus_tag LOCUS_18670 7371 8750 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_18670 8917 11289 gene locus_tag LOCUS_18680 8917 11289 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384650.1 protein_id gnl|my_center|LOCUS_18680 12659 11430 gene locus_tag LOCUS_18690 12659 11430 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_18690 12827 14017 gene locus_tag LOCUS_18700 12827 14017 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_18700 14680 14099 gene locus_tag LOCUS_18710 14680 14099 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214742.1 protein_id gnl|my_center|LOCUS_18710 14933 15151 gene locus_tag LOCUS_18720 14933 15151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 15148 15399 gene locus_tag LOCUS_18730 15148 15399 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence38 2619 847 gene locus_tag LOCUS_18740 2619 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 7542 2659 gene locus_tag LOCUS_18750 7542 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 11192 7587 gene locus_tag LOCUS_18760 11192 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 14373 11224 gene locus_tag LOCUS_18770 14373 11224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 14855 14400 gene locus_tag LOCUS_18780 14855 14400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 >Feature sequence39 102 443 gene locus_tag LOCUS_18790 102 443 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122372.1 protein_id gnl|my_center|LOCUS_18790 2726 612 gene locus_tag LOCUS_18800 2726 612 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_18800 3132 2827 gene locus_tag LOCUS_18810 3132 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 4273 3368 gene locus_tag LOCUS_18820 4273 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 4861 4496 gene locus_tag LOCUS_18830 4861 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 5090 6295 gene locus_tag LOCUS_18840 gene ilvA 5090 6295 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_18840 6363 7790 gene locus_tag LOCUS_18850 6363 7790 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903800.1 protein_id gnl|my_center|LOCUS_18850 7831 10179 gene locus_tag LOCUS_18860 7831 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 13107 10318 gene locus_tag LOCUS_18870 13107 10318 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072762.1 protein_id gnl|my_center|LOCUS_18870 14249 13104 gene locus_tag LOCUS_18880 14249 13104 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733226.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence40 <1 749 gene locus_tag LOCUS_18890 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461245.1:MBOAT family protein 765 1898 gene locus_tag LOCUS_18900 765 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 1916 2683 gene locus_tag LOCUS_18910 1916 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 2814 2644 gene locus_tag LOCUS_18920 2814 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2798 4081 gene locus_tag LOCUS_18930 2798 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 4163 4849 gene locus_tag LOCUS_18940 4163 4849 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_18940 4846 6507 gene locus_tag LOCUS_18950 4846 6507 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_18950 6504 7187 gene locus_tag LOCUS_18960 6504 7187 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_18960 7394 8290 gene locus_tag LOCUS_18970 7394 8290 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_18970 8341 9315 gene locus_tag LOCUS_18980 gene pstC 8341 9315 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462956.1 protein_id gnl|my_center|LOCUS_18980 9319 10188 gene locus_tag LOCUS_18990 gene pstA 9319 10188 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_18990 10195 11004 gene locus_tag LOCUS_19000 gene pstB 10195 11004 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_19000 11004 11693 gene locus_tag LOCUS_19010 gene phoU 11004 11693 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_19010 11808 13568 gene locus_tag LOCUS_19020 11808 13568 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_19020 14162 14470 gene locus_tag LOCUS_19030 14162 14470 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679244.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence41 762 181 gene locus_tag LOCUS_19040 762 181 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_19040 892 1752 gene locus_tag LOCUS_19050 892 1752 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888619.1 protein_id gnl|my_center|LOCUS_19050 2780 1821 gene locus_tag LOCUS_19060 2780 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 4411 2801 gene locus_tag LOCUS_19070 4411 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 4667 5494 gene locus_tag LOCUS_19080 4667 5494 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_19080 6245 5565 gene locus_tag LOCUS_19090 6245 5565 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466811.1 protein_id gnl|my_center|LOCUS_19090 8225 6249 gene locus_tag LOCUS_19100 8225 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 8780 11566 gene locus_tag LOCUS_19110 8780 11566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 >Feature sequence42 1748 75 gene locus_tag LOCUS_19120 1748 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 3149 1806 gene locus_tag LOCUS_19130 gene gltD 3149 1806 CDS product glutamate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231462.1 protein_id gnl|my_center|LOCUS_19130 7651 3152 gene locus_tag LOCUS_19140 gene gltB 7651 3152 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_19140 11605 7940 gene locus_tag LOCUS_19150 11605 7940 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084053047.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence43 434 766 gene locus_tag LOCUS_19160 434 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 763 1644 gene locus_tag LOCUS_19170 763 1644 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475831.1 protein_id gnl|my_center|LOCUS_19170 1970 1752 gene locus_tag LOCUS_19180 1970 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 2123 2656 gene locus_tag LOCUS_19190 2123 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2668 3804 gene locus_tag LOCUS_19200 2668 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 3952 4281 gene locus_tag LOCUS_19210 3952 4281 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393007.1 protein_id gnl|my_center|LOCUS_19210 4284 4736 gene locus_tag LOCUS_19220 gene spoIIAB 4284 4736 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_19220 4733 5443 gene locus_tag LOCUS_19230 gene sigF 4733 5443 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 protein_id gnl|my_center|LOCUS_19230 6416 5430 gene locus_tag LOCUS_19240 gene gluQRS 6416 5430 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_19240 6556 7485 gene locus_tag LOCUS_19250 6556 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 7533 8006 gene locus_tag LOCUS_19260 7533 8006 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_19260 8530 8159 gene locus_tag LOCUS_19270 8530 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 9222 8527 gene locus_tag LOCUS_19280 9222 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 9706 9206 gene locus_tag LOCUS_19290 9706 9206 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_19290 10423 9854 gene locus_tag LOCUS_19300 10423 9854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence44 1970 789 gene locus_tag LOCUS_19310 gene metK 1970 789 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_19310 3276 2035 gene locus_tag LOCUS_19320 3276 2035 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392227.1 protein_id gnl|my_center|LOCUS_19320 4405 3635 gene locus_tag LOCUS_19330 4405 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 5463 4402 gene locus_tag LOCUS_19340 5463 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 5757 6647 gene locus_tag LOCUS_19350 5757 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 6663 7055 gene locus_tag LOCUS_19360 6663 7055 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_19360 7160 7777 gene locus_tag LOCUS_19370 7160 7777 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 protein_id gnl|my_center|LOCUS_19370 9066 8056 gene locus_tag LOCUS_19380 gene ansA 9066 8056 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_19380 <10908 9083 gene locus_tag LOCUS_19390 <10908 9083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015945209.1:S41 family peptidase >Feature sequence45 3051 3641 gene locus_tag LOCUS_19400 3051 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 4657 3704 gene locus_tag LOCUS_19410 4657 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 5517 4687 gene locus_tag LOCUS_19420 5517 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 5639 6043 gene locus_tag LOCUS_19430 5639 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 6994 6062 gene locus_tag LOCUS_19440 gene cysK 6994 6062 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_19440 7295 7729 gene locus_tag LOCUS_19450 7295 7729 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479949.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence46 2121 448 gene locus_tag LOCUS_19460 2121 448 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_19460 5026 2309 gene locus_tag LOCUS_19470 5026 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 6231 5125 gene locus_tag LOCUS_19480 6231 5125 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_19480 6793 6224 gene locus_tag LOCUS_19490 6793 6224 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 protein_id gnl|my_center|LOCUS_19490 6885 7184 gene locus_tag LOCUS_19500 6885 7184 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869934.1 protein_id gnl|my_center|LOCUS_19500 7171 7527 gene locus_tag LOCUS_19510 7171 7527 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_19510 8556 7642 gene locus_tag LOCUS_19520 8556 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 9665 8559 gene locus_tag LOCUS_19530 9665 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 9884 9744 gene locus_tag LOCUS_19540 9884 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 10228 9881 gene locus_tag LOCUS_19550 10228 9881 CDS product DUF3846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272736.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence47 2202 1510 gene locus_tag LOCUS_19560 2202 1510 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_19560 3700 2213 gene locus_tag LOCUS_19570 gene thrC 3700 2213 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_19570 4141 3767 gene locus_tag LOCUS_19580 4141 3767 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223856.1 protein_id gnl|my_center|LOCUS_19580 4740 4138 gene locus_tag LOCUS_19590 gene rnhB 4740 4138 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_19590 5611 4727 gene locus_tag LOCUS_19600 gene ylqF 5611 4727 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236706.1 protein_id gnl|my_center|LOCUS_19600 6155 5811 gene locus_tag LOCUS_19610 gene rplS 6155 5811 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583883.1 protein_id gnl|my_center|LOCUS_19610 7153 6311 gene locus_tag LOCUS_19620 gene rsmI 7153 6311 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_19620 7831 7178 gene locus_tag LOCUS_19630 7831 7178 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_19630 8469 7828 gene locus_tag LOCUS_19640 8469 7828 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435254.1 protein_id gnl|my_center|LOCUS_19640 9021 8494 gene locus_tag LOCUS_19650 gene nrdG 9021 8494 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_19650 9227 9997 gene locus_tag LOCUS_19660 9227 9997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 10392 10084 gene locus_tag LOCUS_19670 10392 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence48 235 1014 gene locus_tag LOCUS_19680 235 1014 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_19680 1032 1508 gene locus_tag LOCUS_19690 1032 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 1939 1505 gene locus_tag LOCUS_19700 1939 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2801 2346 gene locus_tag LOCUS_19710 2801 2346 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860931.1 protein_id gnl|my_center|LOCUS_19710 3165 2812 gene locus_tag LOCUS_19720 3165 2812 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_19720 3339 3686 gene locus_tag LOCUS_19730 3339 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 3968 3666 gene locus_tag LOCUS_19740 3968 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 3856 5070 gene locus_tag LOCUS_19750 3856 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 5901 5146 gene locus_tag LOCUS_19760 5901 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 6349 7248 gene locus_tag LOCUS_19770 6349 7248 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023177.1 protein_id gnl|my_center|LOCUS_19770 7803 9002 gene locus_tag LOCUS_19780 7803 9002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 9373 9062 gene locus_tag LOCUS_19790 9373 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 9581 9375 gene locus_tag LOCUS_19800 9581 9375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 <10282 9737 gene locus_tag LOCUS_19810 <10282 9737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003828945.1:zinc ribbon domain-containing protein >Feature sequence49 3618 2857 gene locus_tag LOCUS_19820 3618 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 5499 3820 gene locus_tag LOCUS_19830 5499 3820 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_19830 5595 5762 gene locus_tag LOCUS_19840 5595 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 5759 5899 gene locus_tag LOCUS_19850 5759 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 5978 7084 gene locus_tag LOCUS_19860 5978 7084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 7087 8001 gene locus_tag LOCUS_19870 7087 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 8187 8693 gene locus_tag LOCUS_19880 8187 8693 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 protein_id gnl|my_center|LOCUS_19880 8686 9792 gene locus_tag LOCUS_19890 8686 9792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence50 265 579 gene locus_tag LOCUS_19900 265 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 732 941 gene locus_tag LOCUS_19910 732 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 989 1537 gene locus_tag LOCUS_19920 989 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1524 1886 gene locus_tag LOCUS_19930 1524 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 1873 2499 gene locus_tag LOCUS_19940 1873 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2496 3125 gene locus_tag LOCUS_19950 2496 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 3284 3637 gene locus_tag LOCUS_19960 3284 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence51 1424 48 gene locus_tag LOCUS_19970 1424 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2878 1424 gene locus_tag LOCUS_19980 2878 1424 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964632.1 protein_id gnl|my_center|LOCUS_19980 3022 5331 gene locus_tag LOCUS_19990 3022 5331 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764744.1 protein_id gnl|my_center|LOCUS_19990 6953 5595 gene locus_tag LOCUS_20000 6953 5595 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682237.1 protein_id gnl|my_center|LOCUS_20000 8378 7047 gene locus_tag LOCUS_20010 8378 7047 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_20010 8829 8359 gene locus_tag LOCUS_20020 8829 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence52 456 1085 gene locus_tag LOCUS_20030 456 1085 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890811.1 protein_id gnl|my_center|LOCUS_20030 1202 2557 gene locus_tag LOCUS_20040 gene brnQ 1202 2557 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032833879.1 protein_id gnl|my_center|LOCUS_20040 4334 2640 gene locus_tag LOCUS_20050 4334 2640 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817202.1 protein_id gnl|my_center|LOCUS_20050 4921 4331 gene locus_tag LOCUS_20060 4921 4331 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860883.1 protein_id gnl|my_center|LOCUS_20060 5268 4918 gene locus_tag LOCUS_20070 5268 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 5926 5255 gene locus_tag LOCUS_20080 5926 5255 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_20080 6710 5943 gene locus_tag LOCUS_20090 6710 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 7778 6855 gene locus_tag LOCUS_20100 7778 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 9139 7871 gene locus_tag LOCUS_20110 9139 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence53 575 835 gene locus_tag LOCUS_20120 575 835 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_20120 1538 879 gene locus_tag LOCUS_20130 1538 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 2377 1742 gene locus_tag LOCUS_20140 2377 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 2632 3951 gene locus_tag LOCUS_20150 gene rsxC 2632 3951 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428488.1 protein_id gnl|my_center|LOCUS_20150 3964 5013 gene locus_tag LOCUS_20160 3964 5013 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_20160 5016 5582 gene locus_tag LOCUS_20170 5016 5582 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_20170 5596 6231 gene locus_tag LOCUS_20180 5596 6231 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_20180 6231 6818 gene locus_tag LOCUS_20190 gene rsxA 6231 6818 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_20190 6837 7805 gene locus_tag LOCUS_20200 6837 7805 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_20200 8069 7884 gene locus_tag LOCUS_20210 8069 7884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 8188 8400 gene locus_tag LOCUS_20220 8188 8400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 8596 8669 gene locus_tag LOCUS_t00390 8596 8669 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8735 8811 gene locus_tag LOCUS_t00400 8735 8811 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8842 8918 gene locus_tag LOCUS_t00410 8842 8918 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 8988 9062 gene locus_tag LOCUS_t00420 8988 9062 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence54 299 120 gene locus_tag LOCUS_20230 299 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 1833 499 gene locus_tag LOCUS_20240 1833 499 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_20240 2083 3444 gene locus_tag LOCUS_20250 gene trkA 2083 3444 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_20250 3457 4893 gene locus_tag LOCUS_20260 3457 4893 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_20260 4921 6357 gene locus_tag LOCUS_20270 4921 6357 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_20270 6574 8691 gene locus_tag LOCUS_20280 6574 8691 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783961.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence55 102 929 gene locus_tag LOCUS_20290 102 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 933 2009 gene locus_tag LOCUS_20300 933 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 4039 2366 gene locus_tag LOCUS_20310 4039 2366 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_20310 4218 4565 gene locus_tag LOCUS_20320 4218 4565 CDS product DUF3846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272736.1 protein_id gnl|my_center|LOCUS_20320 4562 4702 gene locus_tag LOCUS_20330 4562 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 4781 5887 gene locus_tag LOCUS_20340 4781 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 5889 6803 gene locus_tag LOCUS_20350 5889 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 6989 7495 gene locus_tag LOCUS_20360 6989 7495 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 protein_id gnl|my_center|LOCUS_20360 7488 8594 gene locus_tag LOCUS_20370 7488 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 >Feature sequence56 1425 439 gene locus_tag LOCUS_20380 1425 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 1937 1422 gene locus_tag LOCUS_20390 1937 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 4700 2055 gene locus_tag LOCUS_20400 4700 2055 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377094.1 protein_id gnl|my_center|LOCUS_20400 5679 6692 gene locus_tag LOCUS_20410 5679 6692 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_20410 6685 7365 gene locus_tag LOCUS_20420 6685 7365 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112597.1 protein_id gnl|my_center|LOCUS_20420 7404 8282 gene locus_tag LOCUS_20430 7404 8282 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_20430 >Feature sequence57 1370 807 gene locus_tag LOCUS_20440 1370 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 2291 1410 gene locus_tag LOCUS_20450 2291 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 3742 2330 gene locus_tag LOCUS_20460 3742 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 3969 3739 gene locus_tag LOCUS_20470 3969 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 4872 5648 gene locus_tag LOCUS_20480 gene murI 4872 5648 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048400.1 protein_id gnl|my_center|LOCUS_20480 5672 6460 gene locus_tag LOCUS_20490 5672 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 6631 6707 gene locus_tag LOCUS_t00430 6631 6707 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6788 7012 gene locus_tag LOCUS_20500 6788 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 7017 7418 gene locus_tag LOCUS_20510 7017 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 7453 7668 gene locus_tag LOCUS_20520 7453 7668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 7665 7895 gene locus_tag LOCUS_20530 7665 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 7909 8181 gene locus_tag LOCUS_20540 7909 8181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 8165 8440 gene locus_tag LOCUS_20550 8165 8440 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613391.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence58 3578 3279 gene locus_tag LOCUS_20560 3578 3279 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869934.1 protein_id gnl|my_center|LOCUS_20560 5080 3794 gene locus_tag LOCUS_20570 5080 3794 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_20570 7252 5669 gene locus_tag LOCUS_20580 7252 5669 CDS product funZ protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957049.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence59 1398 166 gene locus_tag LOCUS_20590 1398 166 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538219.1 protein_id gnl|my_center|LOCUS_20590 2039 1395 gene locus_tag LOCUS_20600 gene thiE 2039 1395 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948211.1 protein_id gnl|my_center|LOCUS_20600 2847 2026 gene locus_tag LOCUS_20610 gene thiM 2847 2026 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_20610 3621 2938 gene locus_tag LOCUS_20620 3621 2938 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_20620 4662 4195 gene locus_tag LOCUS_20630 4662 4195 CDS product DUF5684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028234.1 protein_id gnl|my_center|LOCUS_20630 6976 4769 gene locus_tag LOCUS_20640 6976 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 >Feature sequence60 2657 3361 gene locus_tag LOCUS_20650 2657 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 3373 4362 gene locus_tag LOCUS_20660 3373 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 4476 4811 gene locus_tag LOCUS_20670 4476 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 5823 5200 gene locus_tag LOCUS_20680 5823 5200 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813668.1 protein_id gnl|my_center|LOCUS_20680 6001 5816 gene locus_tag LOCUS_20690 6001 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 6070 6447 gene locus_tag LOCUS_20700 6070 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 6806 7081 gene locus_tag LOCUS_20710 6806 7081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 >Feature sequence61 874 311 gene locus_tag LOCUS_20720 874 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 1043 4216 gene locus_tag LOCUS_20730 1043 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 4349 4717 gene locus_tag LOCUS_20740 4349 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 4859 5731 gene locus_tag LOCUS_20750 4859 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence62 128 994 gene locus_tag LOCUS_20760 128 994 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368724.1 protein_id gnl|my_center|LOCUS_20760 1008 1802 gene locus_tag LOCUS_20770 1008 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 1960 2382 gene locus_tag LOCUS_20780 1960 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20780 2375 2779 gene locus_tag LOCUS_20790 2375 2779 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368721.1 protein_id gnl|my_center|LOCUS_20790 2733 4856 gene locus_tag LOCUS_20800 2733 4856 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence63 44 964 gene locus_tag LOCUS_20810 44 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 1408 1794 gene locus_tag LOCUS_20820 1408 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 1816 2652 gene locus_tag LOCUS_20830 1816 2652 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986775.1 protein_id gnl|my_center|LOCUS_20830 4703 2910 gene locus_tag LOCUS_20840 4703 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 >Feature sequence64 2992 3309 gene locus_tag LOCUS_20850 2992 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence65 659 48 gene locus_tag LOCUS_20860 659 48 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817405.1 protein_id gnl|my_center|LOCUS_20860 1600 653 gene locus_tag LOCUS_20870 1600 653 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261888.1 protein_id gnl|my_center|LOCUS_20870 1902 2267 gene locus_tag LOCUS_20880 1902 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2270 4315 gene locus_tag LOCUS_20890 2270 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence66 <1 1895 gene locus_tag LOCUS_20900 <1 1895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002285916.1:leucine--tRNA ligase 2112 2294 gene locus_tag LOCUS_20910 gene rpsU 2112 2294 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_20910 3127 2318 gene locus_tag LOCUS_20920 3127 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 3218 3721 gene locus_tag LOCUS_20930 3218 3721 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393068.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence67 274 62 gene locus_tag LOCUS_20940 274 62 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_20940 592 957 gene locus_tag LOCUS_20950 592 957 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_20950 3233 1068 gene locus_tag LOCUS_20960 3233 1068 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_20960 3958 3653 gene locus_tag LOCUS_20970 3958 3653 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_20970 4145 4233 gene locus_tag LOCUS_t00440 4145 4233 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence68 471 2093 gene locus_tag LOCUS_20980 471 2093 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031132.1 protein_id gnl|my_center|LOCUS_20980 2093 2740 gene locus_tag LOCUS_20990 2093 2740 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026996.1 protein_id gnl|my_center|LOCUS_20990 >Feature sequence69 <1 958 gene locus_tag LOCUS_21000 <1 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_084053047.1:S-layer homology domain-containing protein 2188 1040 gene locus_tag LOCUS_21010 2188 1040 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386999.1 protein_id gnl|my_center|LOCUS_21010 3517 2399 gene locus_tag LOCUS_21020 3517 2399 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392916.1 protein_id gnl|my_center|LOCUS_21020 3765 3514 gene locus_tag LOCUS_21030 3765 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 >Feature sequence70 2552 2109 gene locus_tag LOCUS_21040 2552 2109 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 protein_id gnl|my_center|LOCUS_21040 3437 2571 gene locus_tag LOCUS_21050 3437 2571 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610323.1 protein_id gnl|my_center|LOCUS_21050 >Feature sequence71 1060 29 gene locus_tag LOCUS_21060 1060 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 1536 1057 gene locus_tag LOCUS_21070 1536 1057 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_21070 2094 1594 gene locus_tag LOCUS_21080 2094 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 3050 2148 gene locus_tag LOCUS_21090 3050 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 >Feature sequence72 1224 427 gene locus_tag LOCUS_21100 1224 427 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015842.1 protein_id gnl|my_center|LOCUS_21100 2195 1221 gene locus_tag LOCUS_21110 2195 1221 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_21110 3215 2328 gene locus_tag LOCUS_21120 3215 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence73 1275 202 gene locus_tag LOCUS_21130 1275 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 1533 2546 gene locus_tag LOCUS_21140 gene gap 1533 2546 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_21140 >Feature sequence74 469 155 gene locus_tag LOCUS_21150 469 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 3005 777 gene locus_tag LOCUS_21160 3005 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 >Feature sequence75 872 102 gene locus_tag LOCUS_21170 872 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21170 2578 869 gene locus_tag LOCUS_21180 2578 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21180 >Feature sequence76 55 1266 gene locus_tag LOCUS_21190 55 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 >Feature sequence77 183 617 gene locus_tag LOCUS_21200 183 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428343.1 protein_id gnl|my_center|LOCUS_21200 1317 994 gene locus_tag LOCUS_21210 1317 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 1549 1878 gene locus_tag LOCUS_21220 1549 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence78 978 1838 gene locus_tag LOCUS_21230 978 1838 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816742.1 protein_id gnl|my_center|LOCUS_21230