>Feature sequence001 1524 325 gene locus_tag LOCUS_00010 1524 325 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669535.1 protein_id gnl|my_center|LOCUS_00010 4084 2012 gene locus_tag LOCUS_00020 gene metG 4084 2012 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120499.1 protein_id gnl|my_center|LOCUS_00020 4287 5276 gene locus_tag LOCUS_00030 4287 5276 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 protein_id gnl|my_center|LOCUS_00030 5364 6833 gene locus_tag LOCUS_00040 gene bioA 5364 6833 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939829.1 protein_id gnl|my_center|LOCUS_00040 9385 7070 gene locus_tag LOCUS_00050 9385 7070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 10330 9482 gene locus_tag LOCUS_00060 10330 9482 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815329.1 protein_id gnl|my_center|LOCUS_00060 11097 10492 gene locus_tag LOCUS_00070 gene fae 11097 10492 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122249.1 protein_id gnl|my_center|LOCUS_00070 12001 11264 gene locus_tag LOCUS_00080 12001 11264 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263747.1 protein_id gnl|my_center|LOCUS_00080 13235 12141 gene locus_tag LOCUS_00090 13235 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 protein_id gnl|my_center|LOCUS_00090 14835 13378 gene locus_tag LOCUS_00100 14835 13378 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_00100 15220 15882 gene locus_tag LOCUS_00110 15220 15882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 16115 16957 gene locus_tag LOCUS_00120 16115 16957 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328056.1 protein_id gnl|my_center|LOCUS_00120 17317 19863 gene locus_tag LOCUS_00130 17317 19863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 19867 20913 gene locus_tag LOCUS_00140 19867 20913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_00140 20906 22561 gene locus_tag LOCUS_00150 20906 22561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 22820 22572 gene locus_tag LOCUS_00160 22820 22572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 22809 24608 gene locus_tag LOCUS_00170 22809 24608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 26060 24615 gene locus_tag LOCUS_00180 gene murD 26060 24615 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256652.1 protein_id gnl|my_center|LOCUS_00180 27000 26386 gene locus_tag LOCUS_00190 27000 26386 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073754.1 protein_id gnl|my_center|LOCUS_00190 27761 27093 gene locus_tag LOCUS_00200 gene cobC 27761 27093 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_00200 29232 28024 gene locus_tag LOCUS_00210 29232 28024 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082320.1 protein_id gnl|my_center|LOCUS_00210 29566 30837 gene locus_tag LOCUS_00220 29566 30837 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_00220 32018 30918 gene locus_tag LOCUS_00230 32018 30918 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035273.1 protein_id gnl|my_center|LOCUS_00230 33651 32167 gene locus_tag LOCUS_00240 gene rpoN 33651 32167 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435015.1 protein_id gnl|my_center|LOCUS_00240 34444 33821 gene locus_tag LOCUS_00250 gene recR 34444 33821 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327785.1 protein_id gnl|my_center|LOCUS_00250 34909 34553 gene locus_tag LOCUS_00260 34909 34553 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948445.1 protein_id gnl|my_center|LOCUS_00260 36801 34915 gene locus_tag LOCUS_00270 gene dnaX 36801 34915 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921981.1 protein_id gnl|my_center|LOCUS_00270 39365 38370 gene locus_tag LOCUS_00280 39365 38370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 39795 40289 gene locus_tag LOCUS_00290 39795 40289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 40538 41449 gene locus_tag LOCUS_00300 40538 41449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 41575 41784 gene locus_tag LOCUS_00310 41575 41784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 41771 41977 gene locus_tag LOCUS_00320 41771 41977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 41974 43545 gene locus_tag LOCUS_00330 41974 43545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 43839 45182 gene locus_tag LOCUS_00340 43839 45182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 45177 45100 gene locus_tag LOCUS_t00010 45177 45100 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 45696 45445 gene locus_tag LOCUS_00350 45696 45445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 46899 45769 gene locus_tag LOCUS_00360 46899 45769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 47318 46896 gene locus_tag LOCUS_00370 47318 46896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 48705 47302 gene locus_tag LOCUS_00380 gene mtaB 48705 47302 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123590.1 protein_id gnl|my_center|LOCUS_00380 49417 48710 gene locus_tag LOCUS_00390 49417 48710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 50196 49486 gene locus_tag LOCUS_00400 50196 49486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 51174 50686 gene locus_tag LOCUS_00410 51174 50686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 53158 51512 gene locus_tag LOCUS_00420 gene pgm 53158 51512 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 protein_id gnl|my_center|LOCUS_00420 53572 56010 gene locus_tag LOCUS_00430 53572 56010 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815631.1 protein_id gnl|my_center|LOCUS_00430 56433 56041 gene locus_tag LOCUS_00440 56433 56041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 56895 56506 gene locus_tag LOCUS_00450 56895 56506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 59551 57671 gene locus_tag LOCUS_00460 59551 57671 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671072.1 protein_id gnl|my_center|LOCUS_00460 61250 59745 gene locus_tag LOCUS_00470 61250 59745 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_00470 62114 64234 gene locus_tag LOCUS_00480 gene yagF 62114 64234 CDS product xylonate dehydratase YagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095374.1 protein_id gnl|my_center|LOCUS_00480 64446 65042 gene locus_tag LOCUS_00490 64446 65042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 66302 65127 gene locus_tag LOCUS_00500 gene nagA 66302 65127 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922541.1 protein_id gnl|my_center|LOCUS_00500 66615 67028 gene locus_tag LOCUS_00510 66615 67028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 67877 67239 gene locus_tag LOCUS_00520 67877 67239 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 protein_id gnl|my_center|LOCUS_00520 68216 69385 gene locus_tag LOCUS_00530 68216 69385 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142095.1 protein_id gnl|my_center|LOCUS_00530 69535 70050 gene locus_tag LOCUS_00540 69535 70050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 70496 71035 gene locus_tag LOCUS_00550 70496 71035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 71355 72023 gene locus_tag LOCUS_00560 71355 72023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 72124 72420 gene locus_tag LOCUS_00570 72124 72420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 72640 75459 gene locus_tag LOCUS_00580 72640 75459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 75465 77498 gene locus_tag LOCUS_00590 75465 77498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 77630 78061 gene locus_tag LOCUS_00600 77630 78061 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941051.1 protein_id gnl|my_center|LOCUS_00600 78434 80065 gene locus_tag LOCUS_00610 78434 80065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 80303 81826 gene locus_tag LOCUS_00620 80303 81826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 82314 82018 gene locus_tag LOCUS_00630 82314 82018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 82852 83850 gene locus_tag LOCUS_00640 82852 83850 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326204.1 protein_id gnl|my_center|LOCUS_00640 83939 84859 gene locus_tag LOCUS_00650 83939 84859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 85049 86104 gene locus_tag LOCUS_00660 85049 86104 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014496845.1 protein_id gnl|my_center|LOCUS_00660 86234 87484 gene locus_tag LOCUS_00670 86234 87484 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921859.1 protein_id gnl|my_center|LOCUS_00670 87631 90456 gene locus_tag LOCUS_00680 87631 90456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 91361 92638 gene locus_tag LOCUS_00690 91361 92638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 94068 92821 gene locus_tag LOCUS_00700 gene ribA 94068 92821 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123761.1 protein_id gnl|my_center|LOCUS_00700 94422 95450 gene locus_tag LOCUS_00710 gene rfbB 94422 95450 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_00710 95603 96928 gene locus_tag LOCUS_00720 95603 96928 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_00720 98899 97106 gene locus_tag LOCUS_00730 98899 97106 CDS product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816830.1 protein_id gnl|my_center|LOCUS_00730 100245 98911 gene locus_tag LOCUS_00740 100245 98911 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_00740 102629 100374 gene locus_tag LOCUS_00750 102629 100374 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816832.1 protein_id gnl|my_center|LOCUS_00750 104268 103210 gene locus_tag LOCUS_00760 104268 103210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 105209 104550 gene locus_tag LOCUS_00770 105209 104550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 105743 106942 gene locus_tag LOCUS_00780 105743 106942 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122791.1 protein_id gnl|my_center|LOCUS_00780 107064 107981 gene locus_tag LOCUS_00790 107064 107981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 108183 108674 gene locus_tag LOCUS_00800 108183 108674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 109388 109050 gene locus_tag LOCUS_00810 109388 109050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 111382 110873 gene locus_tag LOCUS_00820 111382 110873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 112189 111887 gene locus_tag LOCUS_00830 112189 111887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 112593 113582 gene locus_tag LOCUS_00840 112593 113582 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_00840 113868 114908 gene locus_tag LOCUS_00850 113868 114908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 115057 117738 gene locus_tag LOCUS_00860 115057 117738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 117852 120323 gene locus_tag LOCUS_00870 117852 120323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922195.1 protein_id gnl|my_center|LOCUS_00870 120548 120925 gene locus_tag LOCUS_00880 120548 120925 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_00880 121122 122837 gene locus_tag LOCUS_00890 121122 122837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 123045 127031 gene locus_tag LOCUS_00900 123045 127031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 127324 128352 gene locus_tag LOCUS_00910 127324 128352 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_00910 128445 129353 gene locus_tag LOCUS_00920 128445 129353 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_00920 130883 129615 gene locus_tag LOCUS_00930 130883 129615 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 protein_id gnl|my_center|LOCUS_00930 131217 131558 gene locus_tag LOCUS_00940 131217 131558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 132246 133370 gene locus_tag LOCUS_00950 132246 133370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 133922 134296 gene locus_tag LOCUS_00960 133922 134296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00960 134194 134415 gene locus_tag LOCUS_00970 134194 134415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00970 135338 136624 gene locus_tag LOCUS_00980 135338 136624 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165448192.1 protein_id gnl|my_center|LOCUS_00980 136821 138272 gene locus_tag LOCUS_00990 136821 138272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 138601 139371 gene locus_tag LOCUS_01000 138601 139371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 139664 139960 gene locus_tag LOCUS_01010 gene rpmA 139664 139960 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 protein_id gnl|my_center|LOCUS_01010 141026 140181 gene locus_tag LOCUS_01020 141026 140181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 142002 141166 gene locus_tag LOCUS_01030 142002 141166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 >Feature sequence002 1358 2122 gene locus_tag LOCUS_01040 gene ispD 1358 2122 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122160.1 protein_id gnl|my_center|LOCUS_01040 3309 2155 gene locus_tag LOCUS_01050 3309 2155 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403492.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01050 4584 3718 gene locus_tag LOCUS_01060 4584 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 5403 5071 gene locus_tag LOCUS_01070 5403 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 5291 6661 gene locus_tag LOCUS_01080 5291 6661 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_01080 6711 7424 gene locus_tag LOCUS_01090 6711 7424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 7760 9094 gene locus_tag LOCUS_01100 7760 9094 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121268.1 protein_id gnl|my_center|LOCUS_01100 9392 10897 gene locus_tag LOCUS_01110 9392 10897 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257998.1 protein_id gnl|my_center|LOCUS_01110 11042 12274 gene locus_tag LOCUS_01120 11042 12274 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_01120 12344 12796 gene locus_tag LOCUS_01130 12344 12796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 12870 14291 gene locus_tag LOCUS_01140 12870 14291 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_01140 14542 15207 gene locus_tag LOCUS_01150 14542 15207 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922323.1 protein_id gnl|my_center|LOCUS_01150 15241 16017 gene locus_tag LOCUS_01160 15241 16017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 17059 16361 gene locus_tag LOCUS_01170 17059 16361 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118951.1 protein_id gnl|my_center|LOCUS_01170 17901 17194 gene locus_tag LOCUS_01180 gene phoU 17901 17194 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_01180 18862 18020 gene locus_tag LOCUS_01190 gene pstB 18862 18020 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962535.1 protein_id gnl|my_center|LOCUS_01190 20028 19030 gene locus_tag LOCUS_01200 gene pstA 20028 19030 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831209.1 protein_id gnl|my_center|LOCUS_01200 20966 20025 gene locus_tag LOCUS_01210 gene pstC 20966 20025 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405018.1 protein_id gnl|my_center|LOCUS_01210 22470 21418 gene locus_tag LOCUS_01220 22470 21418 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227811.1 protein_id gnl|my_center|LOCUS_01220 22814 23686 gene locus_tag LOCUS_01230 22814 23686 CDS product hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706669.1 protein_id gnl|my_center|LOCUS_01230 23933 24532 gene locus_tag LOCUS_01240 23933 24532 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_01240 24551 24937 gene locus_tag LOCUS_01250 24551 24937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 25079 25948 gene locus_tag LOCUS_01260 25079 25948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 27659 26175 gene locus_tag LOCUS_01270 gene hisS 27659 26175 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117814.1 protein_id gnl|my_center|LOCUS_01270 28361 27921 gene locus_tag LOCUS_01280 28361 27921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 28788 29891 gene locus_tag LOCUS_01290 gene ftsW 28788 29891 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_01290 31867 30161 gene locus_tag LOCUS_01300 31867 30161 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929181.1 protein_id gnl|my_center|LOCUS_01300 32596 31910 gene locus_tag LOCUS_01310 32596 31910 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325327.1 protein_id gnl|my_center|LOCUS_01310 33162 34577 gene locus_tag LOCUS_01320 33162 34577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 34808 36088 gene locus_tag LOCUS_01330 34808 36088 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_01330 36522 36130 gene locus_tag LOCUS_01340 36522 36130 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008656695.1 protein_id gnl|my_center|LOCUS_01340 38330 36570 gene locus_tag LOCUS_01350 38330 36570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 40317 38653 gene locus_tag LOCUS_01360 40317 38653 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174683.1 protein_id gnl|my_center|LOCUS_01360 40620 43982 gene locus_tag LOCUS_01370 40620 43982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 44132 47650 gene locus_tag LOCUS_01380 44132 47650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 48216 49280 gene locus_tag LOCUS_01390 48216 49280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 49431 50174 gene locus_tag LOCUS_01400 49431 50174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 50349 51008 gene locus_tag LOCUS_01410 50349 51008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 51561 51965 gene locus_tag LOCUS_01420 51561 51965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 52109 54355 gene locus_tag LOCUS_01430 gene pilQ 52109 54355 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162473472.1 protein_id gnl|my_center|LOCUS_01430 54470 55585 gene locus_tag LOCUS_01440 gene murG 54470 55585 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_01440 55894 56250 gene locus_tag LOCUS_01450 55894 56250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 56325 56741 gene locus_tag LOCUS_01460 56325 56741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 57884 56961 gene locus_tag LOCUS_01470 57884 56961 CDS product lactate/malate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118931.1 protein_id gnl|my_center|LOCUS_01470 58970 58029 gene locus_tag LOCUS_01480 58970 58029 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324364.1 protein_id gnl|my_center|LOCUS_01480 59394 59113 gene locus_tag LOCUS_01490 59394 59113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 60326 59607 gene locus_tag LOCUS_01500 60326 59607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 60681 60427 gene locus_tag LOCUS_01510 60681 60427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 62365 60944 gene locus_tag LOCUS_01520 62365 60944 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333579.1 protein_id gnl|my_center|LOCUS_01520 63085 62609 gene locus_tag LOCUS_01530 63085 62609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 63414 63082 gene locus_tag LOCUS_01540 63414 63082 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324359.1 protein_id gnl|my_center|LOCUS_01540 64754 63561 gene locus_tag LOCUS_01550 64754 63561 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118936.1 protein_id gnl|my_center|LOCUS_01550 65472 64906 gene locus_tag LOCUS_01560 65472 64906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 65804 65505 gene locus_tag LOCUS_01570 65804 65505 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324356.1 protein_id gnl|my_center|LOCUS_01570 66696 65977 gene locus_tag LOCUS_01580 66696 65977 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333582.1 protein_id gnl|my_center|LOCUS_01580 67579 66821 gene locus_tag LOCUS_01590 67579 66821 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 protein_id gnl|my_center|LOCUS_01590 68116 69627 gene locus_tag LOCUS_01600 68116 69627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 69764 70756 gene locus_tag LOCUS_01610 gene tsaD 69764 70756 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338414.1 protein_id gnl|my_center|LOCUS_01610 71136 72986 gene locus_tag LOCUS_01620 71136 72986 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324371.1 protein_id gnl|my_center|LOCUS_01620 73274 74116 gene locus_tag LOCUS_01630 73274 74116 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328629.1 protein_id gnl|my_center|LOCUS_01630 75682 74249 gene locus_tag LOCUS_01640 75682 74249 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_01640 77060 75780 gene locus_tag LOCUS_01650 gene purD 77060 75780 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334006.1 protein_id gnl|my_center|LOCUS_01650 77417 78424 gene locus_tag LOCUS_01660 77417 78424 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122477.1 protein_id gnl|my_center|LOCUS_01660 78606 79880 gene locus_tag LOCUS_01670 gene lysA 78606 79880 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_01670 80389 82578 gene locus_tag LOCUS_01680 80389 82578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 85914 82669 gene locus_tag LOCUS_01690 85914 82669 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615995.1 protein_id gnl|my_center|LOCUS_01690 86359 86556 gene locus_tag LOCUS_01700 86359 86556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 86879 88165 gene locus_tag LOCUS_01710 86879 88165 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615779.1 protein_id gnl|my_center|LOCUS_01710 88220 88828 gene locus_tag LOCUS_01720 gene rdgB 88220 88828 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921833.1 protein_id gnl|my_center|LOCUS_01720 88926 91364 gene locus_tag LOCUS_01730 88926 91364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922195.1 protein_id gnl|my_center|LOCUS_01730 92618 91386 gene locus_tag LOCUS_01740 gene xseA 92618 91386 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119437.1 protein_id gnl|my_center|LOCUS_01740 93670 92879 gene locus_tag LOCUS_01750 93670 92879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 94608 93793 gene locus_tag LOCUS_01760 94608 93793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 95647 95210 gene locus_tag LOCUS_01770 95647 95210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 96099 95875 gene locus_tag LOCUS_01780 96099 95875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 96665 96324 gene locus_tag LOCUS_01790 96665 96324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 97234 96587 gene locus_tag LOCUS_01800 97234 96587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 97633 97244 gene locus_tag LOCUS_01810 97633 97244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 98048 97878 gene locus_tag LOCUS_01820 98048 97878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 98664 98269 gene locus_tag LOCUS_01830 98664 98269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 99575 99003 gene locus_tag LOCUS_01840 99575 99003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01840 100954 99485 gene locus_tag LOCUS_01850 100954 99485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 102103 101465 gene locus_tag LOCUS_01860 102103 101465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 103572 102382 gene locus_tag LOCUS_01870 103572 102382 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118292.1 protein_id gnl|my_center|LOCUS_01870 103612 104559 gene locus_tag LOCUS_01880 103612 104559 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325730.1 protein_id gnl|my_center|LOCUS_01880 104645 108415 gene locus_tag LOCUS_01890 104645 108415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 108669 110051 gene locus_tag LOCUS_01900 108669 110051 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_01900 110409 111713 gene locus_tag LOCUS_01910 gene aroA 110409 111713 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332883.1 protein_id gnl|my_center|LOCUS_01910 111975 113264 gene locus_tag LOCUS_01920 111975 113264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 114804 113437 gene locus_tag LOCUS_01930 114804 113437 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_01930 116270 114846 gene locus_tag LOCUS_01940 116270 114846 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_01940 116983 116666 gene locus_tag LOCUS_01950 116983 116666 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326696.1 protein_id gnl|my_center|LOCUS_01950 117257 117967 gene locus_tag LOCUS_01960 117257 117967 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106127.1 protein_id gnl|my_center|LOCUS_01960 118925 118011 gene locus_tag LOCUS_01970 gene speB 118925 118011 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224492.1 protein_id gnl|my_center|LOCUS_01970 120526 118946 gene locus_tag LOCUS_01980 120526 118946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 121680 120700 gene locus_tag LOCUS_01990 121680 120700 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256857.1 protein_id gnl|my_center|LOCUS_01990 >Feature sequence003 324 1286 gene locus_tag LOCUS_02000 gene ilvE 324 1286 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878433.1 protein_id gnl|my_center|LOCUS_02000 1512 2654 gene locus_tag LOCUS_02010 1512 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 2844 4349 gene locus_tag LOCUS_02020 2844 4349 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243597.1 protein_id gnl|my_center|LOCUS_02020 4510 6048 gene locus_tag LOCUS_02030 4510 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 6154 6966 gene locus_tag LOCUS_02040 6154 6966 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102969.1 protein_id gnl|my_center|LOCUS_02040 8281 7061 gene locus_tag LOCUS_02050 8281 7061 CDS product ISL3-like element IS1001 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927279.1 protein_id gnl|my_center|LOCUS_02050 8476 9513 gene locus_tag LOCUS_02060 gene tcmP 8476 9513 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102968.1 protein_id gnl|my_center|LOCUS_02060 10433 9561 gene locus_tag LOCUS_02070 10433 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 12143 10479 gene locus_tag LOCUS_02080 12143 10479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 13813 12248 gene locus_tag LOCUS_02090 13813 12248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 15065 13920 gene locus_tag LOCUS_02100 15065 13920 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_02100 16701 15106 gene locus_tag LOCUS_02110 16701 15106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 18507 16792 gene locus_tag LOCUS_02120 18507 16792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 20269 18734 gene locus_tag LOCUS_02130 20269 18734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 21662 20427 gene locus_tag LOCUS_02140 21662 20427 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_02140 23446 22022 gene locus_tag LOCUS_02150 23446 22022 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_02150 24177 23443 gene locus_tag LOCUS_02160 24177 23443 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243745.1 protein_id gnl|my_center|LOCUS_02160 26683 24320 gene locus_tag LOCUS_02170 26683 24320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 27643 26816 gene locus_tag LOCUS_02180 27643 26816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 27990 28742 gene locus_tag LOCUS_02190 27990 28742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 28755 29828 gene locus_tag LOCUS_02200 28755 29828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 31190 29847 gene locus_tag LOCUS_02210 31190 29847 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_02210 32754 31522 gene locus_tag LOCUS_02220 32754 31522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 32990 34744 gene locus_tag LOCUS_02230 32990 34744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 35456 34764 gene locus_tag LOCUS_02240 35456 34764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 38530 35573 gene locus_tag LOCUS_02250 38530 35573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 40560 38527 gene locus_tag LOCUS_02260 40560 38527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 42988 41117 gene locus_tag LOCUS_02270 42988 41117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 44153 43050 gene locus_tag LOCUS_02280 44153 43050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407616.1 protein_id gnl|my_center|LOCUS_02280 45262 44186 gene locus_tag LOCUS_02290 45262 44186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911545.1 protein_id gnl|my_center|LOCUS_02290 46791 45259 gene locus_tag LOCUS_02300 46791 45259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 48187 46973 gene locus_tag LOCUS_02310 48187 46973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 50658 48247 gene locus_tag LOCUS_02320 50658 48247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 51515 50757 gene locus_tag LOCUS_02330 51515 50757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 52977 51547 gene locus_tag LOCUS_02340 52977 51547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 54695 53199 gene locus_tag LOCUS_02350 54695 53199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 57149 54738 gene locus_tag LOCUS_02360 57149 54738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 58969 57290 gene locus_tag LOCUS_02370 58969 57290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 59791 59114 gene locus_tag LOCUS_02380 59791 59114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 60076 59846 gene locus_tag LOCUS_02390 60076 59846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 61216 60110 gene locus_tag LOCUS_02400 61216 60110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 62946 61387 gene locus_tag LOCUS_02410 62946 61387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 63313 64359 gene locus_tag LOCUS_02420 63313 64359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 64465 65955 gene locus_tag LOCUS_02430 64465 65955 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530716.1 protein_id gnl|my_center|LOCUS_02430 65952 67238 gene locus_tag LOCUS_02440 65952 67238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 67319 68245 gene locus_tag LOCUS_02450 67319 68245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 68268 69077 gene locus_tag LOCUS_02460 68268 69077 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_02460 70721 69117 gene locus_tag LOCUS_02470 70721 69117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 72508 70847 gene locus_tag LOCUS_02480 72508 70847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 73968 72505 gene locus_tag LOCUS_02490 73968 72505 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145033984.1 protein_id gnl|my_center|LOCUS_02490 77263 73958 gene locus_tag LOCUS_02500 77263 73958 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921574.1 protein_id gnl|my_center|LOCUS_02500 78781 77414 gene locus_tag LOCUS_02510 78781 77414 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_02510 81365 78909 gene locus_tag LOCUS_02520 81365 78909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 84043 81686 gene locus_tag LOCUS_02530 84043 81686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 >Feature sequence004 2200 791 gene locus_tag LOCUS_02540 gene gabT 2200 791 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296353.1 protein_id gnl|my_center|LOCUS_02540 2531 2244 gene locus_tag LOCUS_02550 2531 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 2803 2531 gene locus_tag LOCUS_02560 2803 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 4143 2863 gene locus_tag LOCUS_02570 4143 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 4094 4333 gene locus_tag LOCUS_02580 4094 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 4330 5349 gene locus_tag LOCUS_02590 4330 5349 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922725.1 protein_id gnl|my_center|LOCUS_02590 5402 6220 gene locus_tag LOCUS_02600 5402 6220 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_02600 6986 7639 gene locus_tag LOCUS_02610 6986 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 8896 7829 gene locus_tag LOCUS_02620 gene dmlA 8896 7829 CDS product multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978495.1 protein_id gnl|my_center|LOCUS_02620 9219 8905 gene locus_tag LOCUS_02630 9219 8905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 11248 9770 gene locus_tag LOCUS_02640 11248 9770 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922280.1 protein_id gnl|my_center|LOCUS_02640 11418 13658 gene locus_tag LOCUS_02650 11418 13658 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122735.1 protein_id gnl|my_center|LOCUS_02650 14641 13838 gene locus_tag LOCUS_02660 14641 13838 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120018.1 protein_id gnl|my_center|LOCUS_02660 16002 14983 gene locus_tag LOCUS_02670 16002 14983 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020474717.1 protein_id gnl|my_center|LOCUS_02670 16752 16282 gene locus_tag LOCUS_02680 16752 16282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 18414 16783 gene locus_tag LOCUS_02690 18414 16783 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328924.1 protein_id gnl|my_center|LOCUS_02690 20811 19114 gene locus_tag LOCUS_02700 gene ptsP 20811 19114 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328922.1 protein_id gnl|my_center|LOCUS_02700 21233 20991 gene locus_tag LOCUS_02710 21233 20991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 22009 21539 gene locus_tag LOCUS_02720 22009 21539 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_02720 22497 22228 gene locus_tag LOCUS_02730 22497 22228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 22623 22793 gene locus_tag LOCUS_02740 22623 22793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 23311 22895 gene locus_tag LOCUS_02750 23311 22895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 23835 23506 gene locus_tag LOCUS_02760 23835 23506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 24306 23848 gene locus_tag LOCUS_02770 24306 23848 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326238.1 protein_id gnl|my_center|LOCUS_02770 25229 24438 gene locus_tag LOCUS_02780 25229 24438 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123491.1 protein_id gnl|my_center|LOCUS_02780 26871 25927 gene locus_tag LOCUS_02790 26871 25927 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123495.1 protein_id gnl|my_center|LOCUS_02790 27860 26868 gene locus_tag LOCUS_02800 27860 26868 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405088.1 protein_id gnl|my_center|LOCUS_02800 28441 28022 gene locus_tag LOCUS_02810 28441 28022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 29651 28620 gene locus_tag LOCUS_02820 29651 28620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 30681 29722 gene locus_tag LOCUS_02830 gene cyoE 30681 29722 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_02830 31637 30678 gene locus_tag LOCUS_02840 31637 30678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 33659 31776 gene locus_tag LOCUS_02850 33659 31776 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_02850 34702 33869 gene locus_tag LOCUS_02860 gene coxB 34702 33869 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928955.1 protein_id gnl|my_center|LOCUS_02860 36325 34769 gene locus_tag LOCUS_02870 36325 34769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 37272 36385 gene locus_tag LOCUS_02880 37272 36385 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_02880 41390 37272 gene locus_tag LOCUS_02890 41390 37272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 42896 41508 gene locus_tag LOCUS_02900 42896 41508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 43749 42976 gene locus_tag LOCUS_02910 43749 42976 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625442.1 protein_id gnl|my_center|LOCUS_02910 44873 43860 gene locus_tag LOCUS_02920 44873 43860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 45267 46304 gene locus_tag LOCUS_02930 45267 46304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 47038 46424 gene locus_tag LOCUS_02940 47038 46424 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335404.1 protein_id gnl|my_center|LOCUS_02940 47441 47731 gene locus_tag LOCUS_02950 47441 47731 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333249.1 protein_id gnl|my_center|LOCUS_02950 48510 48178 gene locus_tag LOCUS_02960 48510 48178 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329766.1 protein_id gnl|my_center|LOCUS_02960 49605 48658 gene locus_tag LOCUS_02970 49605 48658 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921398.1 protein_id gnl|my_center|LOCUS_02970 50232 49834 gene locus_tag LOCUS_02980 50232 49834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 50468 50232 gene locus_tag LOCUS_02990 50468 50232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 51365 50757 gene locus_tag LOCUS_03000 51365 50757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 53906 51399 gene locus_tag LOCUS_03010 53906 51399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 55078 54122 gene locus_tag LOCUS_03020 55078 54122 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118555.1 protein_id gnl|my_center|LOCUS_03020 55650 55234 gene locus_tag LOCUS_03030 55650 55234 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 protein_id gnl|my_center|LOCUS_03030 55910 55761 gene locus_tag LOCUS_03040 55910 55761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 58002 55918 gene locus_tag LOCUS_03050 58002 55918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 61310 58215 gene locus_tag LOCUS_03060 gene polA 61310 58215 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398238.1 protein_id gnl|my_center|LOCUS_03060 61744 61484 gene locus_tag LOCUS_03070 61744 61484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 61960 63489 gene locus_tag LOCUS_03080 61960 63489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 64508 63702 gene locus_tag LOCUS_03090 64508 63702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 68071 64973 gene locus_tag LOCUS_03100 68071 64973 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120107.1 protein_id gnl|my_center|LOCUS_03100 70110 68200 gene locus_tag LOCUS_03110 70110 68200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 71039 70107 gene locus_tag LOCUS_03120 71039 70107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330018.1 protein_id gnl|my_center|LOCUS_03120 72215 71421 gene locus_tag LOCUS_03130 72215 71421 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_03130 73736 72612 gene locus_tag LOCUS_03140 gene hpnH 73736 72612 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_03140 74012 73794 gene locus_tag LOCUS_03150 74012 73794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 73981 76311 gene locus_tag LOCUS_03160 73981 76311 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120924.1 protein_id gnl|my_center|LOCUS_03160 76580 77476 gene locus_tag LOCUS_03170 76580 77476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 78863 77832 gene locus_tag LOCUS_03180 78863 77832 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_03180 >Feature sequence005 <1 1317 gene locus_tag LOCUS_03190 <1 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922492.1:DUF1501 domain-containing protein 2770 1382 gene locus_tag LOCUS_03200 2770 1382 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_03200 3356 2793 gene locus_tag LOCUS_03210 3356 2793 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144066.1 protein_id gnl|my_center|LOCUS_03210 4183 3434 gene locus_tag LOCUS_03220 4183 3434 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922086.1 protein_id gnl|my_center|LOCUS_03220 4362 4784 gene locus_tag LOCUS_03230 4362 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 5196 6545 gene locus_tag LOCUS_03240 5196 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 6796 7449 gene locus_tag LOCUS_03250 6796 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 7615 8649 gene locus_tag LOCUS_03260 gene floA 7615 8649 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327694.1 protein_id gnl|my_center|LOCUS_03260 8869 9486 gene locus_tag LOCUS_03270 8869 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 9624 10715 gene locus_tag LOCUS_03280 9624 10715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 11583 10804 gene locus_tag LOCUS_03290 11583 10804 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817082.1 protein_id gnl|my_center|LOCUS_03290 11893 11705 gene locus_tag LOCUS_03300 11893 11705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 13186 12212 gene locus_tag LOCUS_03310 13186 12212 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460747.1 protein_id gnl|my_center|LOCUS_03310 14641 13193 gene locus_tag LOCUS_03320 14641 13193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 16983 14830 gene locus_tag LOCUS_03330 gene flhA 16983 14830 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121805.1 protein_id gnl|my_center|LOCUS_03330 16904 17101 gene locus_tag LOCUS_03340 16904 17101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 17633 19786 gene locus_tag LOCUS_03350 17633 19786 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_03350 19835 21103 gene locus_tag LOCUS_03360 gene rsgA 19835 21103 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119119.1 protein_id gnl|my_center|LOCUS_03360 22470 21472 gene locus_tag LOCUS_03370 22470 21472 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324646.1 protein_id gnl|my_center|LOCUS_03370 23163 22621 gene locus_tag LOCUS_03380 23163 22621 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_03380 24622 23282 gene locus_tag LOCUS_03390 24622 23282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 25511 26497 gene locus_tag LOCUS_03400 25511 26497 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922223.1 protein_id gnl|my_center|LOCUS_03400 26587 27642 gene locus_tag LOCUS_03410 26587 27642 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339548.1 protein_id gnl|my_center|LOCUS_03410 29306 27654 gene locus_tag LOCUS_03420 gene murJ 29306 27654 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403539.1 protein_id gnl|my_center|LOCUS_03420 29940 29440 gene locus_tag LOCUS_03430 29940 29440 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_03430 30106 32082 gene locus_tag LOCUS_03440 30106 32082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 32131 33219 gene locus_tag LOCUS_03450 32131 33219 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212090561.1 protein_id gnl|my_center|LOCUS_03450 33415 33272 gene locus_tag LOCUS_03460 33415 33272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 34259 33396 gene locus_tag LOCUS_03470 34259 33396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 35064 34393 gene locus_tag LOCUS_03480 35064 34393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 36340 35720 gene locus_tag LOCUS_03490 36340 35720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 36269 36460 gene locus_tag LOCUS_03500 36269 36460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 36704 37681 gene locus_tag LOCUS_03510 36704 37681 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 protein_id gnl|my_center|LOCUS_03510 37957 39420 gene locus_tag LOCUS_03520 gene lysS 37957 39420 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672011.1 protein_id gnl|my_center|LOCUS_03520 39651 41204 gene locus_tag LOCUS_03530 39651 41204 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121144.1 protein_id gnl|my_center|LOCUS_03530 41456 42154 gene locus_tag LOCUS_03540 41456 42154 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331945.1 protein_id gnl|my_center|LOCUS_03540 42414 43277 gene locus_tag LOCUS_03550 gene ilvE 42414 43277 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_03550 43439 44350 gene locus_tag LOCUS_03560 43439 44350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 46435 44471 gene locus_tag LOCUS_03570 46435 44471 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928481.1 protein_id gnl|my_center|LOCUS_03570 48056 46512 gene locus_tag LOCUS_03580 48056 46512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 49811 48585 gene locus_tag LOCUS_03590 49811 48585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 50334 52091 gene locus_tag LOCUS_03600 50334 52091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 52417 52193 gene locus_tag LOCUS_03610 52417 52193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 52851 52414 gene locus_tag LOCUS_03620 52851 52414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929475.1 protein_id gnl|my_center|LOCUS_03620 54339 52963 gene locus_tag LOCUS_03630 54339 52963 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_03630 55903 54590 gene locus_tag LOCUS_03640 gene xylA 55903 54590 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118969.1 protein_id gnl|my_center|LOCUS_03640 57599 56220 gene locus_tag LOCUS_03650 57599 56220 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_03650 57877 60198 gene locus_tag LOCUS_03660 57877 60198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 60329 61735 gene locus_tag LOCUS_03670 60329 61735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 61989 62750 gene locus_tag LOCUS_03680 61989 62750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 63019 63483 gene locus_tag LOCUS_03690 63019 63483 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383325.1 protein_id gnl|my_center|LOCUS_03690 63561 64580 gene locus_tag LOCUS_03700 63561 64580 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965384.1 protein_id gnl|my_center|LOCUS_03700 64834 65991 gene locus_tag LOCUS_03710 64834 65991 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_03710 66236 68053 gene locus_tag LOCUS_03720 66236 68053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 68175 69005 gene locus_tag LOCUS_03730 gene cysT 68175 69005 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_03730 69121 70056 gene locus_tag LOCUS_03740 gene cysW 69121 70056 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142072.1 protein_id gnl|my_center|LOCUS_03740 70162 71262 gene locus_tag LOCUS_03750 70162 71262 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027092.1 protein_id gnl|my_center|LOCUS_03750 72472 71309 gene locus_tag LOCUS_03760 72472 71309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 74094 72556 gene locus_tag LOCUS_03770 74094 72556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_03770 76947 74107 gene locus_tag LOCUS_03780 76947 74107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 >Feature sequence006 1989 1309 gene locus_tag LOCUS_03790 gene hypB 1989 1309 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 protein_id gnl|my_center|LOCUS_03790 2357 1986 gene locus_tag LOCUS_03800 gene hypA 2357 1986 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072153.1 protein_id gnl|my_center|LOCUS_03800 2796 2350 gene locus_tag LOCUS_03810 2796 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 4112 2793 gene locus_tag LOCUS_03820 4112 2793 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142660068.1 protein_id gnl|my_center|LOCUS_03820 4912 4109 gene locus_tag LOCUS_03830 4912 4109 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_03830 5787 4912 gene locus_tag LOCUS_03840 5787 4912 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948171.1 protein_id gnl|my_center|LOCUS_03840 6983 5784 gene locus_tag LOCUS_03850 6983 5784 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027268647.1 protein_id gnl|my_center|LOCUS_03850 7480 6977 gene locus_tag LOCUS_03860 7480 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 8454 7975 gene locus_tag LOCUS_03870 8454 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 9003 8521 gene locus_tag LOCUS_03880 9003 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 9575 9123 gene locus_tag LOCUS_03890 9575 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 10052 11071 gene locus_tag LOCUS_03900 10052 11071 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946219.1 protein_id gnl|my_center|LOCUS_03900 11290 11075 gene locus_tag LOCUS_03910 11290 11075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 13003 11420 gene locus_tag LOCUS_03920 13003 11420 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095088.1 protein_id gnl|my_center|LOCUS_03920 13687 13094 gene locus_tag LOCUS_03930 13687 13094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 15481 14252 gene locus_tag LOCUS_03940 15481 14252 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_03940 16427 16621 gene locus_tag LOCUS_03950 16427 16621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 16905 17762 gene locus_tag LOCUS_03960 16905 17762 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812797.1 protein_id gnl|my_center|LOCUS_03960 17955 19175 gene locus_tag LOCUS_03970 17955 19175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 20582 19164 gene locus_tag LOCUS_03980 20582 19164 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145033984.1 protein_id gnl|my_center|LOCUS_03980 20872 22335 gene locus_tag LOCUS_03990 20872 22335 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_03990 23078 23440 gene locus_tag LOCUS_04000 23078 23440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 23570 24529 gene locus_tag LOCUS_04010 23570 24529 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444469.1 protein_id gnl|my_center|LOCUS_04010 26032 24704 gene locus_tag LOCUS_04020 26032 24704 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_04020 26256 26047 gene locus_tag LOCUS_04030 26256 26047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 26710 26240 gene locus_tag LOCUS_04040 26710 26240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 28933 26795 gene locus_tag LOCUS_04050 28933 26795 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_04050 30584 29268 gene locus_tag LOCUS_04060 30584 29268 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008662935.1 protein_id gnl|my_center|LOCUS_04060 32533 30800 gene locus_tag LOCUS_04070 32533 30800 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122444.1 protein_id gnl|my_center|LOCUS_04070 32760 33176 gene locus_tag LOCUS_04080 32760 33176 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256843.1 protein_id gnl|my_center|LOCUS_04080 33555 34151 gene locus_tag LOCUS_04090 33555 34151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 35302 35922 gene locus_tag LOCUS_04100 35302 35922 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325064.1 protein_id gnl|my_center|LOCUS_04100 36035 37366 gene locus_tag LOCUS_04110 36035 37366 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921544.1 protein_id gnl|my_center|LOCUS_04110 37766 38275 gene locus_tag LOCUS_04120 37766 38275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 39111 38317 gene locus_tag LOCUS_04130 39111 38317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 39577 39209 gene locus_tag LOCUS_04140 39577 39209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 40734 39958 gene locus_tag LOCUS_04150 40734 39958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 40733 40960 gene locus_tag LOCUS_04160 40733 40960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 44912 41004 gene locus_tag LOCUS_04170 44912 41004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 45575 46180 gene locus_tag LOCUS_04180 45575 46180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 46177 47073 gene locus_tag LOCUS_04190 46177 47073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 47225 47596 gene locus_tag LOCUS_04200 47225 47596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 47629 48192 gene locus_tag LOCUS_04210 47629 48192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 48449 49129 gene locus_tag LOCUS_04220 48449 49129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 49298 49567 gene locus_tag LOCUS_04230 gene fliQ 49298 49567 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_04230 49596 50366 gene locus_tag LOCUS_04240 gene fliR 49596 50366 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244363.1 protein_id gnl|my_center|LOCUS_04240 50370 51437 gene locus_tag LOCUS_04250 50370 51437 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329631.1 protein_id gnl|my_center|LOCUS_04250 51682 53778 gene locus_tag LOCUS_04260 gene flhA 51682 53778 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392311.1 protein_id gnl|my_center|LOCUS_04260 53807 54637 gene locus_tag LOCUS_04270 53807 54637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971058.1 protein_id gnl|my_center|LOCUS_04270 54637 54900 gene locus_tag LOCUS_04280 54637 54900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 55546 55737 gene locus_tag LOCUS_04290 55546 55737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 56644 56081 gene locus_tag LOCUS_04300 56644 56081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 56981 58387 gene locus_tag LOCUS_04310 56981 58387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 58443 60887 gene locus_tag LOCUS_04320 58443 60887 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_04320 61103 62017 gene locus_tag LOCUS_04330 61103 62017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 62471 64111 gene locus_tag LOCUS_04340 62471 64111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 64283 65065 gene locus_tag LOCUS_04350 64283 65065 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083016.1 protein_id gnl|my_center|LOCUS_04350 65074 66282 gene locus_tag LOCUS_04360 65074 66282 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532032.1 protein_id gnl|my_center|LOCUS_04360 66845 68317 gene locus_tag LOCUS_04370 66845 68317 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816828.1 protein_id gnl|my_center|LOCUS_04370 68677 68366 gene locus_tag LOCUS_04380 68677 68366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 68754 69908 gene locus_tag LOCUS_04390 gene proB 68754 69908 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331575.1 protein_id gnl|my_center|LOCUS_04390 70133 70411 gene locus_tag LOCUS_04400 70133 70411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 70607 71263 gene locus_tag LOCUS_04410 70607 71263 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207615.1 protein_id gnl|my_center|LOCUS_04410 72107 71244 gene locus_tag LOCUS_04420 72107 71244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 72682 73578 gene locus_tag LOCUS_04430 72682 73578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 >Feature sequence007 756 2135 gene locus_tag LOCUS_04440 756 2135 CDS product DUF1598 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435082.1 protein_id gnl|my_center|LOCUS_04440 2510 3313 gene locus_tag LOCUS_04450 gene trxA 2510 3313 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522640.1 protein_id gnl|my_center|LOCUS_04450 3673 6843 gene locus_tag LOCUS_04460 3673 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 7609 7001 gene locus_tag LOCUS_04470 7609 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 7866 7651 gene locus_tag LOCUS_04480 7866 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 8425 8024 gene locus_tag LOCUS_04490 8425 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04490 9772 8546 gene locus_tag LOCUS_04500 gene pyrB 9772 8546 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024378.1 protein_id gnl|my_center|LOCUS_04500 11271 9970 gene locus_tag LOCUS_04510 11271 9970 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 protein_id gnl|my_center|LOCUS_04510 13692 11581 gene locus_tag LOCUS_04520 gene fusA 13692 11581 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583197.1 protein_id gnl|my_center|LOCUS_04520 14919 13999 gene locus_tag LOCUS_04530 14919 13999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 16162 15020 gene locus_tag LOCUS_04540 16162 15020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 16796 20167 gene locus_tag LOCUS_04550 16796 20167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 20294 21376 gene locus_tag LOCUS_04560 gene prfB 20294 21376 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100097357.1 protein_id gnl|my_center|LOCUS_04560 22532 22849 gene locus_tag LOCUS_04570 22532 22849 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_04570 22916 23119 gene locus_tag LOCUS_04580 gene csrA 22916 23119 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327053.1 protein_id gnl|my_center|LOCUS_04580 23207 23281 gene locus_tag LOCUS_t00020 23207 23281 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 24615 23521 gene locus_tag LOCUS_04590 gene mraY 24615 23521 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313553.1 protein_id gnl|my_center|LOCUS_04590 24783 24977 gene locus_tag LOCUS_04600 24783 24977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 26395 24974 gene locus_tag LOCUS_04610 26395 24974 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256654.1 protein_id gnl|my_center|LOCUS_04610 27930 26398 gene locus_tag LOCUS_04620 27930 26398 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939779.1 protein_id gnl|my_center|LOCUS_04620 29440 29114 gene locus_tag LOCUS_04630 29440 29114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 30642 30364 gene locus_tag LOCUS_04640 30642 30364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 31875 30850 gene locus_tag LOCUS_04650 31875 30850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 31969 32190 gene locus_tag LOCUS_04660 31969 32190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 32266 32976 gene locus_tag LOCUS_04670 gene tsaB 32266 32976 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122994.1 protein_id gnl|my_center|LOCUS_04670 33322 34629 gene locus_tag LOCUS_04680 33322 34629 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_04680 34726 34920 gene locus_tag LOCUS_04690 34726 34920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 35055 35246 gene locus_tag LOCUS_04700 35055 35246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 35266 35571 gene locus_tag LOCUS_04710 35266 35571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 37494 35578 gene locus_tag LOCUS_04720 37494 35578 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330711.1 protein_id gnl|my_center|LOCUS_04720 40041 37639 gene locus_tag LOCUS_04730 40041 37639 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404233.1 protein_id gnl|my_center|LOCUS_04730 40442 41065 gene locus_tag LOCUS_04740 40442 41065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 41213 41500 gene locus_tag LOCUS_04750 41213 41500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 41695 42372 gene locus_tag LOCUS_04760 41695 42372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 42592 43362 gene locus_tag LOCUS_04770 42592 43362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 43554 45161 gene locus_tag LOCUS_04780 43554 45161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 45640 45434 gene locus_tag LOCUS_04790 45640 45434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 45892 47520 gene locus_tag LOCUS_04800 45892 47520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 48133 48942 gene locus_tag LOCUS_04810 48133 48942 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941678.1 protein_id gnl|my_center|LOCUS_04810 49471 49079 gene locus_tag LOCUS_04820 49471 49079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 51004 49598 gene locus_tag LOCUS_04830 51004 49598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 51983 51255 gene locus_tag LOCUS_04840 51983 51255 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120779.1 protein_id gnl|my_center|LOCUS_04840 52204 53682 gene locus_tag LOCUS_04850 gene ffh 52204 53682 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329358.1 protein_id gnl|my_center|LOCUS_04850 53793 54149 gene locus_tag LOCUS_04860 53793 54149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 54230 54931 gene locus_tag LOCUS_04870 gene trmD 54230 54931 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123923.1 protein_id gnl|my_center|LOCUS_04870 55049 55456 gene locus_tag LOCUS_04880 gene rplS 55049 55456 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814465.1 protein_id gnl|my_center|LOCUS_04880 55628 56050 gene locus_tag LOCUS_04890 55628 56050 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_04890 57035 56094 gene locus_tag LOCUS_04900 gene hemC 57035 56094 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606154.1 protein_id gnl|my_center|LOCUS_04900 57878 57144 gene locus_tag LOCUS_04910 57878 57144 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099097343.1 protein_id gnl|my_center|LOCUS_04910 58137 59642 gene locus_tag LOCUS_04920 gene hpnE 58137 59642 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122224.1 protein_id gnl|my_center|LOCUS_04920 60215 61495 gene locus_tag LOCUS_04930 60215 61495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 61652 62533 gene locus_tag LOCUS_04940 61652 62533 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_04940 63285 62716 gene locus_tag LOCUS_04950 63285 62716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 64434 65633 gene locus_tag LOCUS_04960 64434 65633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 66337 65837 gene locus_tag LOCUS_04970 66337 65837 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330217.1 protein_id gnl|my_center|LOCUS_04970 67366 66419 gene locus_tag LOCUS_04980 67366 66419 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876382.1 protein_id gnl|my_center|LOCUS_04980 68106 67414 gene locus_tag LOCUS_04990 68106 67414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 69140 68157 gene locus_tag LOCUS_05000 69140 68157 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728439.1 protein_id gnl|my_center|LOCUS_05000 71563 69422 gene locus_tag LOCUS_05010 gene fusA 71563 69422 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120445.1 protein_id gnl|my_center|LOCUS_05010 71663 71965 gene locus_tag LOCUS_05020 71663 71965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 72350 72423 gene locus_tag LOCUS_t00030 72350 72423 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence008 343 918 gene locus_tag LOCUS_05030 343 918 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817289.1 protein_id gnl|my_center|LOCUS_05030 1698 1111 gene locus_tag LOCUS_05040 1698 1111 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214810.1 protein_id gnl|my_center|LOCUS_05040 3146 1719 gene locus_tag LOCUS_05050 3146 1719 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_05050 6874 3341 gene locus_tag LOCUS_05060 6874 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 7074 8219 gene locus_tag LOCUS_05070 7074 8219 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327198.1 protein_id gnl|my_center|LOCUS_05070 9501 8458 gene locus_tag LOCUS_05080 9501 8458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 10119 9742 gene locus_tag LOCUS_05090 gene crcB 10119 9742 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104506.1 protein_id gnl|my_center|LOCUS_05090 11391 10159 gene locus_tag LOCUS_05100 11391 10159 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120898.1 protein_id gnl|my_center|LOCUS_05100 12762 11575 gene locus_tag LOCUS_05110 12762 11575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921966.1 protein_id gnl|my_center|LOCUS_05110 14165 13233 gene locus_tag LOCUS_05120 14165 13233 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921278.1 protein_id gnl|my_center|LOCUS_05120 14156 14347 gene locus_tag LOCUS_05130 14156 14347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 14806 15438 gene locus_tag LOCUS_05140 14806 15438 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532679.1 protein_id gnl|my_center|LOCUS_05140 15543 16814 gene locus_tag LOCUS_05150 15543 16814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 17123 18892 gene locus_tag LOCUS_05160 17123 18892 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332180.1 protein_id gnl|my_center|LOCUS_05160 19041 18889 gene locus_tag LOCUS_05170 19041 18889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 19000 20907 gene locus_tag LOCUS_05180 19000 20907 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_05180 20882 21103 gene locus_tag LOCUS_05190 20882 21103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 21124 21211 gene locus_tag LOCUS_t00040 21124 21211 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 21704 23512 gene locus_tag LOCUS_05200 21704 23512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 24764 23835 gene locus_tag LOCUS_05210 24764 23835 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921963.1 protein_id gnl|my_center|LOCUS_05210 25820 24957 gene locus_tag LOCUS_05220 25820 24957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 26251 27696 gene locus_tag LOCUS_05230 26251 27696 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_05230 27821 29068 gene locus_tag LOCUS_05240 27821 29068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 29332 30219 gene locus_tag LOCUS_05250 29332 30219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 31731 30391 gene locus_tag LOCUS_05260 31731 30391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 31952 33418 gene locus_tag LOCUS_05270 31952 33418 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_05270 33640 34428 gene locus_tag LOCUS_05280 gene ubiE 33640 34428 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328112.1 protein_id gnl|my_center|LOCUS_05280 34674 35369 gene locus_tag LOCUS_05290 34674 35369 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119018.1 protein_id gnl|my_center|LOCUS_05290 35651 36628 gene locus_tag LOCUS_05300 35651 36628 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259515.1 protein_id gnl|my_center|LOCUS_05300 36621 37283 gene locus_tag LOCUS_05310 36621 37283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 37311 38066 gene locus_tag LOCUS_05320 37311 38066 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_05320 38894 38355 gene locus_tag LOCUS_05330 38894 38355 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888916.1 protein_id gnl|my_center|LOCUS_05330 39419 39724 gene locus_tag LOCUS_05340 39419 39724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 39870 40184 gene locus_tag LOCUS_05350 39870 40184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 43533 40453 gene locus_tag LOCUS_05360 43533 40453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 44286 44032 gene locus_tag LOCUS_05370 44286 44032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 44417 44950 gene locus_tag LOCUS_05380 44417 44950 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404000.1 protein_id gnl|my_center|LOCUS_05380 45086 46033 gene locus_tag LOCUS_05390 45086 46033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 47149 46154 gene locus_tag LOCUS_05400 47149 46154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 48859 47456 gene locus_tag LOCUS_05410 48859 47456 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922286.1 protein_id gnl|my_center|LOCUS_05410 49539 48988 gene locus_tag LOCUS_05420 gene pyrE 49539 48988 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846080.1 protein_id gnl|my_center|LOCUS_05420 51364 49796 gene locus_tag LOCUS_05430 51364 49796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 51441 51665 gene locus_tag LOCUS_05440 51441 51665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 51973 52563 gene locus_tag LOCUS_05450 51973 52563 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944032.1 protein_id gnl|my_center|LOCUS_05450 52888 53631 gene locus_tag LOCUS_05460 52888 53631 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921820.1 protein_id gnl|my_center|LOCUS_05460 55161 53764 gene locus_tag LOCUS_05470 55161 53764 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228658.1 protein_id gnl|my_center|LOCUS_05470 56918 55332 gene locus_tag LOCUS_05480 56918 55332 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921563.1 protein_id gnl|my_center|LOCUS_05480 57101 57970 gene locus_tag LOCUS_05490 gene kdsA 57101 57970 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120986.1 protein_id gnl|my_center|LOCUS_05490 58330 59892 gene locus_tag LOCUS_05500 58330 59892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 60505 60071 gene locus_tag LOCUS_05510 60505 60071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 61485 60787 gene locus_tag LOCUS_05520 61485 60787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 63289 61613 gene locus_tag LOCUS_05530 63289 61613 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333284.1 protein_id gnl|my_center|LOCUS_05530 65390 63468 gene locus_tag LOCUS_05540 65390 63468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 67862 65838 gene locus_tag LOCUS_05550 67862 65838 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122938.1 protein_id gnl|my_center|LOCUS_05550 68826 68203 gene locus_tag LOCUS_05560 68826 68203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 69085 70218 gene locus_tag LOCUS_05570 69085 70218 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228739.1 protein_id gnl|my_center|LOCUS_05570 >Feature sequence009 3577 3026 gene locus_tag LOCUS_05580 3577 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 4146 3826 gene locus_tag LOCUS_05590 4146 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 4064 4252 gene locus_tag LOCUS_05600 4064 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 4914 4510 gene locus_tag LOCUS_05610 4914 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 5527 5078 gene locus_tag LOCUS_05620 5527 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 6251 7939 gene locus_tag LOCUS_05630 6251 7939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 8610 8828 gene locus_tag LOCUS_05640 8610 8828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 8806 9054 gene locus_tag LOCUS_05650 8806 9054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 9051 9239 gene locus_tag LOCUS_05660 9051 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 11213 9492 gene locus_tag LOCUS_05670 11213 9492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 12019 11345 gene locus_tag LOCUS_05680 12019 11345 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123040.1 protein_id gnl|my_center|LOCUS_05680 12919 12122 gene locus_tag LOCUS_05690 12919 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 13456 15123 gene locus_tag LOCUS_05700 gene ettA 13456 15123 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_05700 17025 15304 gene locus_tag LOCUS_05710 17025 15304 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667792.1 protein_id gnl|my_center|LOCUS_05710 18425 17025 gene locus_tag LOCUS_05720 18425 17025 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328443.1 protein_id gnl|my_center|LOCUS_05720 20731 18560 gene locus_tag LOCUS_05730 20731 18560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 21790 20807 gene locus_tag LOCUS_05740 21790 20807 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_05740 22779 22087 gene locus_tag LOCUS_05750 22779 22087 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331623.1 protein_id gnl|my_center|LOCUS_05750 23426 23082 gene locus_tag LOCUS_05760 23426 23082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 23621 23442 gene locus_tag LOCUS_05770 23621 23442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 24407 24105 gene locus_tag LOCUS_05780 24407 24105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227996.1 protein_id gnl|my_center|LOCUS_05780 25399 24404 gene locus_tag LOCUS_05790 25399 24404 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_05790 25622 26536 gene locus_tag LOCUS_05800 gene nhaR 25622 26536 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_05800 26944 27162 gene locus_tag LOCUS_05810 26944 27162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 27326 28678 gene locus_tag LOCUS_05820 27326 28678 CDS product DUF4147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922364.1 protein_id gnl|my_center|LOCUS_05820 28809 30410 gene locus_tag LOCUS_05830 28809 30410 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_05830 33662 30612 gene locus_tag LOCUS_05840 33662 30612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 34145 33780 gene locus_tag LOCUS_05850 gene yajC 34145 33780 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_05850 35320 34202 gene locus_tag LOCUS_05860 gene tgt 35320 34202 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778950.1 protein_id gnl|my_center|LOCUS_05860 37102 35561 gene locus_tag LOCUS_05870 37102 35561 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_05870 38565 37282 gene locus_tag LOCUS_05880 38565 37282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 39302 40588 gene locus_tag LOCUS_05890 39302 40588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 40811 41185 gene locus_tag LOCUS_05900 40811 41185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 42499 41432 gene locus_tag LOCUS_05910 gene bioB 42499 41432 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398967.1 protein_id gnl|my_center|LOCUS_05910 42903 44873 gene locus_tag LOCUS_05920 42903 44873 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325434.1 protein_id gnl|my_center|LOCUS_05920 45115 45396 gene locus_tag LOCUS_05930 45115 45396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 45393 45707 gene locus_tag LOCUS_05940 45393 45707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 47777 45972 gene locus_tag LOCUS_05950 gene lepA 47777 45972 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118463.1 protein_id gnl|my_center|LOCUS_05950 48768 48001 gene locus_tag LOCUS_05960 48768 48001 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_05960 50370 48889 gene locus_tag LOCUS_05970 50370 48889 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_05970 50677 51588 gene locus_tag LOCUS_05980 50677 51588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 51884 52507 gene locus_tag LOCUS_05990 51884 52507 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324221.1 protein_id gnl|my_center|LOCUS_05990 52623 53108 gene locus_tag LOCUS_06000 52623 53108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 53115 53756 gene locus_tag LOCUS_06010 53115 53756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 53898 57461 gene locus_tag LOCUS_06020 53898 57461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 57647 60682 gene locus_tag LOCUS_06030 57647 60682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 60891 62351 gene locus_tag LOCUS_06040 60891 62351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 63203 62544 gene locus_tag LOCUS_06050 63203 62544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 64379 63432 gene locus_tag LOCUS_06060 64379 63432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 64767 66116 gene locus_tag LOCUS_06070 64767 66116 CDS product DNA-directed RNA polymerase subunit alpha C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332711.1 protein_id gnl|my_center|LOCUS_06070 66229 67659 gene locus_tag LOCUS_06080 66229 67659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 68755 68117 gene locus_tag LOCUS_06090 68755 68117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 >Feature sequence010 122 1030 gene locus_tag LOCUS_06100 122 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 1274 1065 gene locus_tag LOCUS_06110 1274 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 2542 1742 gene locus_tag LOCUS_06120 2542 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 4246 2951 gene locus_tag LOCUS_06130 4246 2951 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_06130 4200 4391 gene locus_tag LOCUS_06140 4200 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 4984 4424 gene locus_tag LOCUS_06150 4984 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 7941 5083 gene locus_tag LOCUS_06160 7941 5083 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120107.1 protein_id gnl|my_center|LOCUS_06160 8646 8864 gene locus_tag LOCUS_06170 8646 8864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 10841 9099 gene locus_tag LOCUS_06180 10841 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 11164 12252 gene locus_tag LOCUS_06190 11164 12252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 12288 13835 gene locus_tag LOCUS_06200 12288 13835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 14882 14028 gene locus_tag LOCUS_06210 14882 14028 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_06210 19826 15057 gene locus_tag LOCUS_06220 19826 15057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 20394 21044 gene locus_tag LOCUS_06230 20394 21044 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229968.1 protein_id gnl|my_center|LOCUS_06230 21118 21717 gene locus_tag LOCUS_06240 gene pth 21118 21717 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122535.1 protein_id gnl|my_center|LOCUS_06240 21995 22432 gene locus_tag LOCUS_06250 21995 22432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 22509 23030 gene locus_tag LOCUS_06260 22509 23030 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339883.1 protein_id gnl|my_center|LOCUS_06260 23177 23680 gene locus_tag LOCUS_06270 gene rplI 23177 23680 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122533.1 protein_id gnl|my_center|LOCUS_06270 23795 25183 gene locus_tag LOCUS_06280 gene dnaB 23795 25183 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_06280 27612 25468 gene locus_tag LOCUS_06290 27612 25468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 28904 27831 gene locus_tag LOCUS_06300 28904 27831 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978063.1 protein_id gnl|my_center|LOCUS_06300 30013 28904 gene locus_tag LOCUS_06310 30013 28904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 30953 30027 gene locus_tag LOCUS_06320 30953 30027 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081610978.1 protein_id gnl|my_center|LOCUS_06320 33507 32611 gene locus_tag LOCUS_06330 33507 32611 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325399.1 protein_id gnl|my_center|LOCUS_06330 34443 34685 gene locus_tag LOCUS_06340 34443 34685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 34802 35770 gene locus_tag LOCUS_06350 34802 35770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 36227 36802 gene locus_tag LOCUS_06360 36227 36802 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812894.1 protein_id gnl|my_center|LOCUS_06360 37170 38738 gene locus_tag LOCUS_06370 37170 38738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 38992 41919 gene locus_tag LOCUS_06380 38992 41919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 41963 42997 gene locus_tag LOCUS_06390 41963 42997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 43153 44877 gene locus_tag LOCUS_06400 43153 44877 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669321.1 protein_id gnl|my_center|LOCUS_06400 45073 46467 gene locus_tag LOCUS_06410 45073 46467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 46821 50306 gene locus_tag LOCUS_06420 46821 50306 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205417.1 protein_id gnl|my_center|LOCUS_06420 50689 53226 gene locus_tag LOCUS_06430 50689 53226 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008668559.1 protein_id gnl|my_center|LOCUS_06430 53223 54107 gene locus_tag LOCUS_06440 53223 54107 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390313.1 protein_id gnl|my_center|LOCUS_06440 55264 54272 gene locus_tag LOCUS_06450 55264 54272 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_06450 57176 55674 gene locus_tag LOCUS_06460 57176 55674 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 protein_id gnl|my_center|LOCUS_06460 59264 57612 gene locus_tag LOCUS_06470 59264 57612 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706764.1 protein_id gnl|my_center|LOCUS_06470 59769 59401 gene locus_tag LOCUS_06480 59769 59401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 60115 59774 gene locus_tag LOCUS_06490 60115 59774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 60246 61040 gene locus_tag LOCUS_06500 60246 61040 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_06500 62511 61162 gene locus_tag LOCUS_06510 62511 61162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_06510 62752 63504 gene locus_tag LOCUS_06520 62752 63504 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_06520 63583 64209 gene locus_tag LOCUS_06530 63583 64209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 64206 65156 gene locus_tag LOCUS_06540 gene mch 64206 65156 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145084390.1 protein_id gnl|my_center|LOCUS_06540 65165 66058 gene locus_tag LOCUS_06550 65165 66058 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922006.1 protein_id gnl|my_center|LOCUS_06550 66153 67082 gene locus_tag LOCUS_06560 66153 67082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 >Feature sequence011 464 2116 gene locus_tag LOCUS_06570 464 2116 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921618.1 protein_id gnl|my_center|LOCUS_06570 2127 3026 gene locus_tag LOCUS_06580 2127 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 3405 4736 gene locus_tag LOCUS_06590 3405 4736 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_06590 4876 5799 gene locus_tag LOCUS_06600 4876 5799 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121000.1 protein_id gnl|my_center|LOCUS_06600 6089 8221 gene locus_tag LOCUS_06610 gene shc 6089 8221 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_06610 8987 8466 gene locus_tag LOCUS_06620 8987 8466 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338731.1 protein_id gnl|my_center|LOCUS_06620 9238 10173 gene locus_tag LOCUS_06630 9238 10173 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086138.1 protein_id gnl|my_center|LOCUS_06630 10988 10302 gene locus_tag LOCUS_06640 10988 10302 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057788.1 protein_id gnl|my_center|LOCUS_06640 11198 12331 gene locus_tag LOCUS_06650 11198 12331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 12468 13121 gene locus_tag LOCUS_06660 12468 13121 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083177.1 protein_id gnl|my_center|LOCUS_06660 13332 14015 gene locus_tag LOCUS_06670 13332 14015 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019283.1 protein_id gnl|my_center|LOCUS_06670 14087 14785 gene locus_tag LOCUS_06680 14087 14785 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873009.1 protein_id gnl|my_center|LOCUS_06680 14970 15245 gene locus_tag LOCUS_06690 14970 15245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 16951 15509 gene locus_tag LOCUS_06700 16951 15509 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_06700 17815 17216 gene locus_tag LOCUS_06710 17815 17216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 17901 18425 gene locus_tag LOCUS_06720 17901 18425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 20079 18649 gene locus_tag LOCUS_06730 20079 18649 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141651.1 protein_id gnl|my_center|LOCUS_06730 20429 20076 gene locus_tag LOCUS_06740 20429 20076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 21871 20507 gene locus_tag LOCUS_06750 21871 20507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 22296 23678 gene locus_tag LOCUS_06760 22296 23678 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967232.1 protein_id gnl|my_center|LOCUS_06760 24023 25231 gene locus_tag LOCUS_06770 24023 25231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 28661 25662 gene locus_tag LOCUS_06780 28661 25662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 29421 30785 gene locus_tag LOCUS_06790 29421 30785 CDS product ATPase with chaperone activity inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615735.1 protein_id gnl|my_center|LOCUS_06790 31259 30828 gene locus_tag LOCUS_06800 31259 30828 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921283.1 protein_id gnl|my_center|LOCUS_06800 32308 31340 gene locus_tag LOCUS_06810 32308 31340 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_06810 33372 32998 gene locus_tag LOCUS_06820 33372 32998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 34687 33641 gene locus_tag LOCUS_06830 34687 33641 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922172.1 protein_id gnl|my_center|LOCUS_06830 34922 36580 gene locus_tag LOCUS_06840 34922 36580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 37556 36627 gene locus_tag LOCUS_06850 37556 36627 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120550.1 protein_id gnl|my_center|LOCUS_06850 37805 38035 gene locus_tag LOCUS_06860 37805 38035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 40416 38083 gene locus_tag LOCUS_06870 40416 38083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 40599 40432 gene locus_tag LOCUS_06880 40599 40432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06880 40875 40615 gene locus_tag LOCUS_06890 40875 40615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06890 41540 41238 gene locus_tag LOCUS_06900 41540 41238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 41964 43460 gene locus_tag LOCUS_06910 41964 43460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 44268 43639 gene locus_tag LOCUS_06920 44268 43639 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114385.1 protein_id gnl|my_center|LOCUS_06920 45174 44563 gene locus_tag LOCUS_06930 gene rpsD 45174 44563 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846140.1 protein_id gnl|my_center|LOCUS_06930 45871 45302 gene locus_tag LOCUS_06940 45871 45302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615849.1 protein_id gnl|my_center|LOCUS_06940 47241 46021 gene locus_tag LOCUS_06950 47241 46021 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_06950 50254 47399 gene locus_tag LOCUS_06960 50254 47399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 50546 51109 gene locus_tag LOCUS_06970 50546 51109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 51724 51236 gene locus_tag LOCUS_06980 gene smpB 51724 51236 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615559.1 protein_id gnl|my_center|LOCUS_06980 52164 53720 gene locus_tag LOCUS_06990 52164 53720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 53754 54188 gene locus_tag LOCUS_07000 53754 54188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 54245 54580 gene locus_tag LOCUS_07010 54245 54580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 54742 56526 gene locus_tag LOCUS_07020 54742 56526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 56799 60266 gene locus_tag LOCUS_07030 56799 60266 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122837.1 protein_id gnl|my_center|LOCUS_07030 61939 60704 gene locus_tag LOCUS_07040 61939 60704 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616218.1 protein_id gnl|my_center|LOCUS_07040 62169 64244 gene locus_tag LOCUS_07050 62169 64244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 64313 64633 gene locus_tag LOCUS_07060 64313 64633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 65317 64670 gene locus_tag LOCUS_07070 65317 64670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 66303 65380 gene locus_tag LOCUS_07080 66303 65380 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228198.1 protein_id gnl|my_center|LOCUS_07080 67076 67149 gene locus_tag LOCUS_t00050 67076 67149 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence012 190 2403 gene locus_tag LOCUS_07090 190 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 3308 2562 gene locus_tag LOCUS_07100 3308 2562 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957298.1 protein_id gnl|my_center|LOCUS_07100 3946 3347 gene locus_tag LOCUS_07110 3946 3347 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_07110 5535 4033 gene locus_tag LOCUS_07120 5535 4033 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_07120 6405 5767 gene locus_tag LOCUS_07130 6405 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 8576 6492 gene locus_tag LOCUS_07140 8576 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 11861 8790 gene locus_tag LOCUS_07150 11861 8790 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121858.1 protein_id gnl|my_center|LOCUS_07150 12643 12149 gene locus_tag LOCUS_07160 12643 12149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 12788 13318 gene locus_tag LOCUS_07170 12788 13318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 13329 13880 gene locus_tag LOCUS_07180 13329 13880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 13979 17005 gene locus_tag LOCUS_07190 13979 17005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 17202 19409 gene locus_tag LOCUS_07200 17202 19409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 19552 20553 gene locus_tag LOCUS_07210 gene galT 19552 20553 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_07210 21004 23211 gene locus_tag LOCUS_07220 21004 23211 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118691.1 protein_id gnl|my_center|LOCUS_07220 24013 23345 gene locus_tag LOCUS_07230 24013 23345 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_07230 24535 26265 gene locus_tag LOCUS_07240 24535 26265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 26501 27328 gene locus_tag LOCUS_07250 26501 27328 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870684.1 protein_id gnl|my_center|LOCUS_07250 28029 27505 gene locus_tag LOCUS_07260 28029 27505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 28638 29708 gene locus_tag LOCUS_07270 28638 29708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 30194 31291 gene locus_tag LOCUS_07280 30194 31291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922161.1 protein_id gnl|my_center|LOCUS_07280 31530 35441 gene locus_tag LOCUS_07290 gene ccsA 31530 35441 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922162.1 protein_id gnl|my_center|LOCUS_07290 36943 35714 gene locus_tag LOCUS_07300 36943 35714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 38390 37023 gene locus_tag LOCUS_07310 38390 37023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 38874 38482 gene locus_tag LOCUS_07320 38874 38482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 39938 39027 gene locus_tag LOCUS_07330 39938 39027 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123048.1 protein_id gnl|my_center|LOCUS_07330 41474 41253 gene locus_tag LOCUS_07340 41474 41253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 42869 41670 gene locus_tag LOCUS_07350 42869 41670 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_07350 43821 43045 gene locus_tag LOCUS_07360 43821 43045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 44766 44047 gene locus_tag LOCUS_07370 44766 44047 CDS product DUF4190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326835.1 protein_id gnl|my_center|LOCUS_07370 45671 50563 gene locus_tag LOCUS_07380 45671 50563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 50913 51596 gene locus_tag LOCUS_07390 50913 51596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 51773 53608 gene locus_tag LOCUS_07400 51773 53608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 53734 55026 gene locus_tag LOCUS_07410 53734 55026 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920707.1 protein_id gnl|my_center|LOCUS_07410 55330 58890 gene locus_tag LOCUS_07420 55330 58890 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_07420 59232 59146 gene locus_tag LOCUS_t00060 59232 59146 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 59676 59515 gene locus_tag LOCUS_07430 59676 59515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 59675 61525 gene locus_tag LOCUS_07440 59675 61525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 62039 61716 gene locus_tag LOCUS_07450 62039 61716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 62343 64724 gene locus_tag LOCUS_07460 62343 64724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence013 2481 139 gene locus_tag LOCUS_07470 2481 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 2510 2689 gene locus_tag LOCUS_07480 2510 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 3133 2852 gene locus_tag LOCUS_07490 3133 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 4418 3240 gene locus_tag LOCUS_07500 4418 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 5685 4450 gene locus_tag LOCUS_07510 5685 4450 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922363.1 protein_id gnl|my_center|LOCUS_07510 5878 5803 gene locus_tag LOCUS_t00070 5878 5803 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7620 6187 gene locus_tag LOCUS_07520 7620 6187 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145033984.1 protein_id gnl|my_center|LOCUS_07520 10899 8023 gene locus_tag LOCUS_07530 10899 8023 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120839.1 protein_id gnl|my_center|LOCUS_07530 11175 12194 gene locus_tag LOCUS_07540 gene fba 11175 12194 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333980.1 protein_id gnl|my_center|LOCUS_07540 12489 12890 gene locus_tag LOCUS_07550 12489 12890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 14743 13226 gene locus_tag LOCUS_07560 14743 13226 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118989.1 protein_id gnl|my_center|LOCUS_07560 16946 14889 gene locus_tag LOCUS_07570 16946 14889 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122606.1 protein_id gnl|my_center|LOCUS_07570 17926 17030 gene locus_tag LOCUS_07580 17926 17030 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324200.1 protein_id gnl|my_center|LOCUS_07580 19135 18089 gene locus_tag LOCUS_07590 19135 18089 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_07590 20949 19942 gene locus_tag LOCUS_07600 20949 19942 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117759.1 protein_id gnl|my_center|LOCUS_07600 24376 21206 gene locus_tag LOCUS_07610 24376 21206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 25609 24581 gene locus_tag LOCUS_07620 25609 24581 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922273.1 protein_id gnl|my_center|LOCUS_07620 27036 25756 gene locus_tag LOCUS_07630 27036 25756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 27415 28638 gene locus_tag LOCUS_07640 gene trpB 27415 28638 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324127.1 protein_id gnl|my_center|LOCUS_07640 28777 29607 gene locus_tag LOCUS_07650 gene trpA 28777 29607 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921878.1 protein_id gnl|my_center|LOCUS_07650 30131 29592 gene locus_tag LOCUS_07660 30131 29592 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545109.1 protein_id gnl|my_center|LOCUS_07660 30258 31226 gene locus_tag LOCUS_07670 30258 31226 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119033.1 protein_id gnl|my_center|LOCUS_07670 31449 33086 gene locus_tag LOCUS_07680 31449 33086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 34656 33247 gene locus_tag LOCUS_07690 34656 33247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 36063 34858 gene locus_tag LOCUS_07700 gene aroB 36063 34858 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_07700 38137 36452 gene locus_tag LOCUS_07710 38137 36452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 38542 40971 gene locus_tag LOCUS_07720 38542 40971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 41254 42078 gene locus_tag LOCUS_07730 41254 42078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 42231 42686 gene locus_tag LOCUS_07740 42231 42686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 42883 43395 gene locus_tag LOCUS_07750 42883 43395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 43560 44453 gene locus_tag LOCUS_07760 43560 44453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 44533 46158 gene locus_tag LOCUS_07770 44533 46158 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921382.1 protein_id gnl|my_center|LOCUS_07770 46515 49349 gene locus_tag LOCUS_07780 46515 49349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 50949 49672 gene locus_tag LOCUS_07790 50949 49672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 52387 51161 gene locus_tag LOCUS_07800 52387 51161 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122163.1 protein_id gnl|my_center|LOCUS_07800 53759 52554 gene locus_tag LOCUS_07810 gene rlmI 53759 52554 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704914.1 protein_id gnl|my_center|LOCUS_07810 54473 54012 gene locus_tag LOCUS_07820 54473 54012 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_07820 56117 54603 gene locus_tag LOCUS_07830 56117 54603 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392222.1 protein_id gnl|my_center|LOCUS_07830 56464 56114 gene locus_tag LOCUS_07840 56464 56114 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142949.1 protein_id gnl|my_center|LOCUS_07840 56786 56466 gene locus_tag LOCUS_07850 56786 56466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 58015 56951 gene locus_tag LOCUS_07860 58015 56951 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007610940.1 protein_id gnl|my_center|LOCUS_07860 59181 58225 gene locus_tag LOCUS_07870 59181 58225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 60056 59178 gene locus_tag LOCUS_07880 60056 59178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 60760 60053 gene locus_tag LOCUS_07890 60760 60053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 62316 60967 gene locus_tag LOCUS_07900 62316 60967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence014 <1 688 gene locus_tag LOCUS_07910 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008660073.1:tRNA (cytidine(34)-2'-O)-methyltransferase 805 1272 gene locus_tag LOCUS_07920 805 1272 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419733.1 protein_id gnl|my_center|LOCUS_07920 1644 1850 gene locus_tag LOCUS_07930 1644 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 2853 2131 gene locus_tag LOCUS_07940 2853 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 3602 2958 gene locus_tag LOCUS_07950 3602 2958 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922130.1 protein_id gnl|my_center|LOCUS_07950 3969 5546 gene locus_tag LOCUS_07960 3969 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 5850 5566 gene locus_tag LOCUS_07970 5850 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 6250 7125 gene locus_tag LOCUS_07980 gene map 6250 7125 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328287.1 protein_id gnl|my_center|LOCUS_07980 7282 8298 gene locus_tag LOCUS_07990 7282 8298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 8437 9789 gene locus_tag LOCUS_08000 8437 9789 CDS product tRNA adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262485.1 protein_id gnl|my_center|LOCUS_08000 9991 10551 gene locus_tag LOCUS_08010 9991 10551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 10803 11627 gene locus_tag LOCUS_08020 10803 11627 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120550.1 protein_id gnl|my_center|LOCUS_08020 11728 13194 gene locus_tag LOCUS_08030 11728 13194 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_08030 13708 14379 gene locus_tag LOCUS_08040 13708 14379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 14558 15595 gene locus_tag LOCUS_08050 14558 15595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 20730 15613 gene locus_tag LOCUS_08060 20730 15613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 21941 20859 gene locus_tag LOCUS_08070 21941 20859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 22393 24831 gene locus_tag LOCUS_08080 22393 24831 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123700.1 protein_id gnl|my_center|LOCUS_08080 25333 24938 gene locus_tag LOCUS_08090 25333 24938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 29803 25637 gene locus_tag LOCUS_08100 29803 25637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 32306 30108 gene locus_tag LOCUS_08110 32306 30108 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 protein_id gnl|my_center|LOCUS_08110 32676 33863 gene locus_tag LOCUS_08120 32676 33863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 33914 36352 gene locus_tag LOCUS_08130 33914 36352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 38470 36407 gene locus_tag LOCUS_08140 38470 36407 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085096.1 protein_id gnl|my_center|LOCUS_08140 40523 38829 gene locus_tag LOCUS_08150 gene dnaA 40523 38829 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402792.1 protein_id gnl|my_center|LOCUS_08150 41619 40942 gene locus_tag LOCUS_08160 41619 40942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 41506 41952 gene locus_tag LOCUS_08170 41506 41952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 43359 42181 gene locus_tag LOCUS_08180 43359 42181 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173891.1 protein_id gnl|my_center|LOCUS_08180 43679 43356 gene locus_tag LOCUS_08190 43679 43356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 43859 46411 gene locus_tag LOCUS_08200 43859 46411 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_08200 48126 46507 gene locus_tag LOCUS_08210 48126 46507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 49868 48570 gene locus_tag LOCUS_08220 49868 48570 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_08220 51867 50035 gene locus_tag LOCUS_08230 51867 50035 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122500.1 protein_id gnl|my_center|LOCUS_08230 52707 52060 gene locus_tag LOCUS_08240 52707 52060 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922279.1 protein_id gnl|my_center|LOCUS_08240 53254 52898 gene locus_tag LOCUS_08250 53254 52898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119559.1 protein_id gnl|my_center|LOCUS_08250 54711 53326 gene locus_tag LOCUS_08260 54711 53326 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259655.1 protein_id gnl|my_center|LOCUS_08260 54956 56044 gene locus_tag LOCUS_08270 54956 56044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 56258 57781 gene locus_tag LOCUS_08280 gene hemG 56258 57781 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122777.1 protein_id gnl|my_center|LOCUS_08280 58926 57877 gene locus_tag LOCUS_08290 58926 57877 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057531.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence015 3267 1567 gene locus_tag LOCUS_08300 gene pfaD 3267 1567 CDS product eicosapentaenoate synthase subunit PfaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071756.1 protein_id gnl|my_center|LOCUS_08300 3610 4584 gene locus_tag LOCUS_08310 3610 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 4651 4875 gene locus_tag LOCUS_08320 4651 4875 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940734.1 protein_id gnl|my_center|LOCUS_08320 4836 5168 gene locus_tag LOCUS_08330 4836 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 5220 5690 gene locus_tag LOCUS_08340 5220 5690 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_08340 5953 8901 gene locus_tag LOCUS_08350 5953 8901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 9497 9081 gene locus_tag LOCUS_08360 9497 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 9836 11188 gene locus_tag LOCUS_08370 9836 11188 CDS product PhoPQ-activated pathogenicity-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921868.1 protein_id gnl|my_center|LOCUS_08370 12626 11361 gene locus_tag LOCUS_08380 12626 11361 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921312.1 protein_id gnl|my_center|LOCUS_08380 13457 12822 gene locus_tag LOCUS_08390 13457 12822 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_08390 13675 14025 gene locus_tag LOCUS_08400 13675 14025 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036517.1 protein_id gnl|my_center|LOCUS_08400 14619 14107 gene locus_tag LOCUS_08410 14619 14107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 15095 16195 gene locus_tag LOCUS_08420 15095 16195 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328620.1 protein_id gnl|my_center|LOCUS_08420 16209 17213 gene locus_tag LOCUS_08430 gene miaA 16209 17213 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118401.1 protein_id gnl|my_center|LOCUS_08430 17369 17656 gene locus_tag LOCUS_08440 17369 17656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 17653 17925 gene locus_tag LOCUS_08450 17653 17925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 17922 18278 gene locus_tag LOCUS_08460 17922 18278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 18330 19853 gene locus_tag LOCUS_08470 18330 19853 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 protein_id gnl|my_center|LOCUS_08470 19883 20251 gene locus_tag LOCUS_08480 19883 20251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 21228 20275 gene locus_tag LOCUS_08490 gene galM 21228 20275 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399304.1 protein_id gnl|my_center|LOCUS_08490 21719 22054 gene locus_tag LOCUS_08500 21719 22054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 22471 22286 gene locus_tag LOCUS_08510 22471 22286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 22772 22416 gene locus_tag LOCUS_08520 22772 22416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 23124 23840 gene locus_tag LOCUS_08530 23124 23840 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932386.1 protein_id gnl|my_center|LOCUS_08530 25265 24030 gene locus_tag LOCUS_08540 25265 24030 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383637.1 protein_id gnl|my_center|LOCUS_08540 25264 25491 gene locus_tag LOCUS_08550 25264 25491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 25815 27176 gene locus_tag LOCUS_08560 25815 27176 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_08560 27666 28877 gene locus_tag LOCUS_08570 27666 28877 CDS product 23S rRNA (cytosine(2499)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886697.1 protein_id gnl|my_center|LOCUS_08570 29302 31875 gene locus_tag LOCUS_08580 29302 31875 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083225.1 protein_id gnl|my_center|LOCUS_08580 31998 32432 gene locus_tag LOCUS_08590 31998 32432 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_08590 33588 32716 gene locus_tag LOCUS_08600 33588 32716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08600 33771 33598 gene locus_tag LOCUS_08610 33771 33598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 34348 34527 gene locus_tag LOCUS_08620 34348 34527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 34699 36927 gene locus_tag LOCUS_08630 34699 36927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 37069 37473 gene locus_tag LOCUS_08640 37069 37473 CDS product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704615.1 protein_id gnl|my_center|LOCUS_08640 38426 38737 gene locus_tag LOCUS_08650 38426 38737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 39075 40187 gene locus_tag LOCUS_08660 39075 40187 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545234.1 protein_id gnl|my_center|LOCUS_08660 40184 40483 gene locus_tag LOCUS_08670 40184 40483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 40555 41376 gene locus_tag LOCUS_08680 40555 41376 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084985.1 protein_id gnl|my_center|LOCUS_08680 41396 41767 gene locus_tag LOCUS_08690 41396 41767 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002866134.1 protein_id gnl|my_center|LOCUS_08690 41833 42750 gene locus_tag LOCUS_08700 41833 42750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 42951 43352 gene locus_tag LOCUS_08710 42951 43352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 44576 43890 gene locus_tag LOCUS_08720 44576 43890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 45159 44641 gene locus_tag LOCUS_08730 45159 44641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 45819 45319 gene locus_tag LOCUS_08740 gene cheY 45819 45319 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164479.1 protein_id gnl|my_center|LOCUS_08740 46596 46111 gene locus_tag LOCUS_08750 46596 46111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 47160 48290 gene locus_tag LOCUS_08760 47160 48290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 48497 49468 gene locus_tag LOCUS_08770 48497 49468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 50037 51743 gene locus_tag LOCUS_08780 50037 51743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 51885 53207 gene locus_tag LOCUS_08790 51885 53207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 53576 55624 gene locus_tag LOCUS_08800 53576 55624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence016 730 128 gene locus_tag LOCUS_08810 730 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 1202 1522 gene locus_tag LOCUS_08820 1202 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 2701 1532 gene locus_tag LOCUS_08830 2701 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 2888 3157 gene locus_tag LOCUS_08840 2888 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 3353 3748 gene locus_tag LOCUS_08850 3353 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 3902 4744 gene locus_tag LOCUS_08860 3902 4744 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121331.1 protein_id gnl|my_center|LOCUS_08860 4913 5869 gene locus_tag LOCUS_08870 4913 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 5911 6192 gene locus_tag LOCUS_08880 5911 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 6317 6535 gene locus_tag LOCUS_08890 6317 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 8416 7025 gene locus_tag LOCUS_08900 8416 7025 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_08900 10141 8723 gene locus_tag LOCUS_08910 10141 8723 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_08910 10616 13720 gene locus_tag LOCUS_08920 10616 13720 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146849598.1 protein_id gnl|my_center|LOCUS_08920 13989 15443 gene locus_tag LOCUS_08930 13989 15443 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124063.1 protein_id gnl|my_center|LOCUS_08930 15712 17010 gene locus_tag LOCUS_08940 15712 17010 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265852.1 protein_id gnl|my_center|LOCUS_08940 18559 17039 gene locus_tag LOCUS_08950 18559 17039 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_08950 18971 19423 gene locus_tag LOCUS_08960 18971 19423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 20416 19568 gene locus_tag LOCUS_08970 gene lpxI 20416 19568 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922990.1 protein_id gnl|my_center|LOCUS_08970 21657 20569 gene locus_tag LOCUS_08980 gene lpxD 21657 20569 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922341.1 protein_id gnl|my_center|LOCUS_08980 21933 22307 gene locus_tag LOCUS_08990 gene aroH 21933 22307 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172959.1 protein_id gnl|my_center|LOCUS_08990 24084 22411 gene locus_tag LOCUS_09000 24084 22411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 27044 24351 gene locus_tag LOCUS_09010 27044 24351 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840071.1 protein_id gnl|my_center|LOCUS_09010 28096 27362 gene locus_tag LOCUS_09020 28096 27362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 29032 28298 gene locus_tag LOCUS_09030 29032 28298 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325025.1 protein_id gnl|my_center|LOCUS_09030 29815 29048 gene locus_tag LOCUS_09040 29815 29048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 30982 30278 gene locus_tag LOCUS_09050 30982 30278 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329973.1 protein_id gnl|my_center|LOCUS_09050 32248 31439 gene locus_tag LOCUS_09060 32248 31439 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333052.1 protein_id gnl|my_center|LOCUS_09060 34280 32880 gene locus_tag LOCUS_09070 34280 32880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 36954 35146 gene locus_tag LOCUS_09080 36954 35146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 37859 37215 gene locus_tag LOCUS_09090 37859 37215 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123567.1 protein_id gnl|my_center|LOCUS_09090 38196 39602 gene locus_tag LOCUS_09100 38196 39602 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120117.1 protein_id gnl|my_center|LOCUS_09100 39667 40416 gene locus_tag LOCUS_09110 39667 40416 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457207.1 protein_id gnl|my_center|LOCUS_09110 41077 40604 gene locus_tag LOCUS_09120 41077 40604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 41974 41198 gene locus_tag LOCUS_09130 41974 41198 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145123293.1 protein_id gnl|my_center|LOCUS_09130 42266 43156 gene locus_tag LOCUS_09140 42266 43156 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258883.1 protein_id gnl|my_center|LOCUS_09140 43153 44289 gene locus_tag LOCUS_09150 43153 44289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 44612 46990 gene locus_tag LOCUS_09160 44612 46990 CDS product PA14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122548.1 protein_id gnl|my_center|LOCUS_09160 47016 48332 gene locus_tag LOCUS_09170 47016 48332 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922962.1 protein_id gnl|my_center|LOCUS_09170 48569 49600 gene locus_tag LOCUS_09180 48569 49600 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337669.1 protein_id gnl|my_center|LOCUS_09180 49712 50038 gene locus_tag LOCUS_09190 49712 50038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 50794 50282 gene locus_tag LOCUS_09200 gene tpx 50794 50282 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263295.1 protein_id gnl|my_center|LOCUS_09200 51728 52012 gene locus_tag LOCUS_09210 51728 52012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 52766 52494 gene locus_tag LOCUS_09220 52766 52494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 53829 56879 gene locus_tag LOCUS_09230 53829 56879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 57067 56873 gene locus_tag LOCUS_09240 57067 56873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence017 770 240 gene locus_tag LOCUS_09250 770 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 853 1071 gene locus_tag LOCUS_09260 853 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 2908 1325 gene locus_tag LOCUS_09270 2908 1325 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327245.1 protein_id gnl|my_center|LOCUS_09270 4375 3332 gene locus_tag LOCUS_09280 4375 3332 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427765.1 protein_id gnl|my_center|LOCUS_09280 4537 5805 gene locus_tag LOCUS_09290 4537 5805 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876500.1 protein_id gnl|my_center|LOCUS_09290 6391 6519 gene locus_tag LOCUS_09300 6391 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 7321 6767 gene locus_tag LOCUS_09310 7321 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 7607 8263 gene locus_tag LOCUS_09320 gene purN 7607 8263 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326621.1 protein_id gnl|my_center|LOCUS_09320 9769 8285 gene locus_tag LOCUS_09330 9769 8285 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615932.1 protein_id gnl|my_center|LOCUS_09330 11944 9932 gene locus_tag LOCUS_09340 11944 9932 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120539.1 protein_id gnl|my_center|LOCUS_09340 12724 12017 gene locus_tag LOCUS_09350 12724 12017 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171830.1 protein_id gnl|my_center|LOCUS_09350 14520 12784 gene locus_tag LOCUS_09360 14520 12784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 16058 14913 gene locus_tag LOCUS_09370 gene mnmE 16058 14913 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393996.1 protein_id gnl|my_center|LOCUS_09370 16449 17657 gene locus_tag LOCUS_09380 16449 17657 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411661.1 protein_id gnl|my_center|LOCUS_09380 17991 18251 gene locus_tag LOCUS_09390 17991 18251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 18658 18272 gene locus_tag LOCUS_09400 18658 18272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 19428 18841 gene locus_tag LOCUS_09410 19428 18841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 19911 23555 gene locus_tag LOCUS_09420 19911 23555 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943656.1 protein_id gnl|my_center|LOCUS_09420 23679 25307 gene locus_tag LOCUS_09430 23679 25307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 27256 25544 gene locus_tag LOCUS_09440 gene ggt 27256 25544 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 protein_id gnl|my_center|LOCUS_09440 29033 27546 gene locus_tag LOCUS_09450 29033 27546 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123393.1 protein_id gnl|my_center|LOCUS_09450 32773 29168 gene locus_tag LOCUS_09460 32773 29168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 33157 32990 gene locus_tag LOCUS_09470 33157 32990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 33282 33977 gene locus_tag LOCUS_09480 33282 33977 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969827.1 protein_id gnl|my_center|LOCUS_09480 34095 34502 gene locus_tag LOCUS_09490 34095 34502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 34775 36160 gene locus_tag LOCUS_09500 34775 36160 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887075.1 protein_id gnl|my_center|LOCUS_09500 37735 36299 gene locus_tag LOCUS_09510 37735 36299 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_09510 40947 37789 gene locus_tag LOCUS_09520 40947 37789 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_09520 42171 41248 gene locus_tag LOCUS_09530 42171 41248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 42251 43009 gene locus_tag LOCUS_09540 42251 43009 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970254.1 protein_id gnl|my_center|LOCUS_09540 43214 44476 gene locus_tag LOCUS_09550 43214 44476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 44622 44843 gene locus_tag LOCUS_09560 44622 44843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 45105 47630 gene locus_tag LOCUS_09570 45105 47630 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816832.1 protein_id gnl|my_center|LOCUS_09570 47754 51101 gene locus_tag LOCUS_09580 47754 51101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 51198 54092 gene locus_tag LOCUS_09590 51198 54092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 54616 55104 gene locus_tag LOCUS_09600 54616 55104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 55374 56126 gene locus_tag LOCUS_09610 55374 56126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 57019 56063 gene locus_tag LOCUS_09620 57019 56063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence018 726 2030 gene locus_tag LOCUS_09630 726 2030 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_09630 2090 2323 gene locus_tag LOCUS_09640 2090 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 2317 2727 gene locus_tag LOCUS_09650 2317 2727 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679941.1 protein_id gnl|my_center|LOCUS_09650 2724 4385 gene locus_tag LOCUS_09660 2724 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 4501 5592 gene locus_tag LOCUS_09670 4501 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 5900 7150 gene locus_tag LOCUS_09680 5900 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922040.1 protein_id gnl|my_center|LOCUS_09680 8292 7276 gene locus_tag LOCUS_09690 8292 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795545.1 protein_id gnl|my_center|LOCUS_09690 9134 8364 gene locus_tag LOCUS_09700 9134 8364 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909158.1 protein_id gnl|my_center|LOCUS_09700 10326 9616 gene locus_tag LOCUS_09710 10326 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 11636 10482 gene locus_tag LOCUS_09720 11636 10482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 12145 14115 gene locus_tag LOCUS_09730 12145 14115 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_09730 14293 15684 gene locus_tag LOCUS_09740 14293 15684 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_09740 15910 15698 gene locus_tag LOCUS_09750 15910 15698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 16126 16785 gene locus_tag LOCUS_09760 16126 16785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 16848 17426 gene locus_tag LOCUS_09770 16848 17426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 18771 17521 gene locus_tag LOCUS_09780 18771 17521 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921296.1 protein_id gnl|my_center|LOCUS_09780 19333 18830 gene locus_tag LOCUS_09790 19333 18830 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202877.1 protein_id gnl|my_center|LOCUS_09790 19590 20057 gene locus_tag LOCUS_09800 19590 20057 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_09800 20425 21924 gene locus_tag LOCUS_09810 20425 21924 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259285.1 protein_id gnl|my_center|LOCUS_09810 23281 22031 gene locus_tag LOCUS_09820 23281 22031 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878430.1 protein_id gnl|my_center|LOCUS_09820 24332 23322 gene locus_tag LOCUS_09830 24332 23322 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922054.1 protein_id gnl|my_center|LOCUS_09830 25301 24504 gene locus_tag LOCUS_09840 25301 24504 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121328.1 protein_id gnl|my_center|LOCUS_09840 25987 25298 gene locus_tag LOCUS_09850 25987 25298 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_09850 26237 26788 gene locus_tag LOCUS_09860 26237 26788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 27783 27229 gene locus_tag LOCUS_09870 27783 27229 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122524.1 protein_id gnl|my_center|LOCUS_09870 28237 29214 gene locus_tag LOCUS_09880 28237 29214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 29459 30925 gene locus_tag LOCUS_09890 29459 30925 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_09890 31870 31031 gene locus_tag LOCUS_09900 31870 31031 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121456.1 protein_id gnl|my_center|LOCUS_09900 32336 34090 gene locus_tag LOCUS_09910 32336 34090 CDS product DUF1598 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435082.1 protein_id gnl|my_center|LOCUS_09910 34549 35970 gene locus_tag LOCUS_09920 34549 35970 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_09920 36203 37090 gene locus_tag LOCUS_09930 36203 37090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 38081 37128 gene locus_tag LOCUS_09940 gene fmt 38081 37128 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114642.1 protein_id gnl|my_center|LOCUS_09940 39140 38313 gene locus_tag LOCUS_09950 39140 38313 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921011.1 protein_id gnl|my_center|LOCUS_09950 40250 39291 gene locus_tag LOCUS_09960 40250 39291 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986893.1 protein_id gnl|my_center|LOCUS_09960 42010 40472 gene locus_tag LOCUS_09970 gene xylB 42010 40472 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123533.1 protein_id gnl|my_center|LOCUS_09970 43097 42585 gene locus_tag LOCUS_09980 43097 42585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 43426 43238 gene locus_tag LOCUS_09990 43426 43238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 44114 43368 gene locus_tag LOCUS_10000 44114 43368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 44471 44202 gene locus_tag LOCUS_10010 44471 44202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 45081 44644 gene locus_tag LOCUS_10020 45081 44644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 45943 45359 gene locus_tag LOCUS_10030 45943 45359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 46561 47478 gene locus_tag LOCUS_10040 46561 47478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 48517 47795 gene locus_tag LOCUS_10050 48517 47795 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053541.1 protein_id gnl|my_center|LOCUS_10050 49830 48688 gene locus_tag LOCUS_10060 49830 48688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 51542 50124 gene locus_tag LOCUS_10070 51542 50124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 52238 53005 gene locus_tag LOCUS_10080 52238 53005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 53331 54338 gene locus_tag LOCUS_10090 53331 54338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120449.1 protein_id gnl|my_center|LOCUS_10090 54385 54954 gene locus_tag LOCUS_10100 54385 54954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 55069 55491 gene locus_tag LOCUS_10110 55069 55491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 55588 56214 gene locus_tag LOCUS_10120 55588 56214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence019 715 119 gene locus_tag LOCUS_10130 715 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 961 1638 gene locus_tag LOCUS_10140 961 1638 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039926.1 protein_id gnl|my_center|LOCUS_10140 1948 5235 gene locus_tag LOCUS_10150 1948 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 5353 6615 gene locus_tag LOCUS_10160 5353 6615 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123538.1 protein_id gnl|my_center|LOCUS_10160 6620 9004 gene locus_tag LOCUS_10170 6620 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 9165 11405 gene locus_tag LOCUS_10180 9165 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 11716 13074 gene locus_tag LOCUS_10190 11716 13074 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_10190 13139 13402 gene locus_tag LOCUS_10200 13139 13402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 13487 14944 gene locus_tag LOCUS_10210 13487 14944 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_10210 15592 17709 gene locus_tag LOCUS_10220 15592 17709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 17781 18947 gene locus_tag LOCUS_10230 17781 18947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 19107 20375 gene locus_tag LOCUS_10240 19107 20375 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817206.1 protein_id gnl|my_center|LOCUS_10240 20555 21916 gene locus_tag LOCUS_10250 20555 21916 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_10250 22063 23382 gene locus_tag LOCUS_10260 22063 23382 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_10260 23454 24842 gene locus_tag LOCUS_10270 23454 24842 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_10270 24906 25886 gene locus_tag LOCUS_10280 24906 25886 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615657.1 protein_id gnl|my_center|LOCUS_10280 26027 28288 gene locus_tag LOCUS_10290 26027 28288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 28501 28319 gene locus_tag LOCUS_10300 28501 28319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 28548 29768 gene locus_tag LOCUS_10310 28548 29768 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_10310 31188 29779 gene locus_tag LOCUS_10320 31188 29779 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921791.1 protein_id gnl|my_center|LOCUS_10320 33987 31318 gene locus_tag LOCUS_10330 33987 31318 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120107.1 protein_id gnl|my_center|LOCUS_10330 34172 35611 gene locus_tag LOCUS_10340 34172 35611 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_10340 35616 37013 gene locus_tag LOCUS_10350 35616 37013 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_10350 37149 38441 gene locus_tag LOCUS_10360 37149 38441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 38588 39865 gene locus_tag LOCUS_10370 38588 39865 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_10370 40981 42939 gene locus_tag LOCUS_10380 40981 42939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 43204 43422 gene locus_tag LOCUS_10390 43204 43422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 43498 43719 gene locus_tag LOCUS_10400 43498 43719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 43785 44843 gene locus_tag LOCUS_10410 43785 44843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 44785 45447 gene locus_tag LOCUS_10420 44785 45447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 45434 46090 gene locus_tag LOCUS_10430 45434 46090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 46230 46787 gene locus_tag LOCUS_10440 46230 46787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 46952 47809 gene locus_tag LOCUS_10450 46952 47809 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974026.1 protein_id gnl|my_center|LOCUS_10450 47838 48686 gene locus_tag LOCUS_10460 47838 48686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 49427 50704 gene locus_tag LOCUS_10470 49427 50704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 50757 51815 gene locus_tag LOCUS_10480 50757 51815 CDS product TniB family NTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463118.1 protein_id gnl|my_center|LOCUS_10480 53086 52685 gene locus_tag LOCUS_10490 53086 52685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 53279 53740 gene locus_tag LOCUS_10500 53279 53740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 53913 54461 gene locus_tag LOCUS_10510 53913 54461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 54524 54958 gene locus_tag LOCUS_10520 54524 54958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence020 1463 2626 gene locus_tag LOCUS_10530 1463 2626 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142249.1 protein_id gnl|my_center|LOCUS_10530 2614 4641 gene locus_tag LOCUS_10540 2614 4641 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435048.1 protein_id gnl|my_center|LOCUS_10540 4736 5374 gene locus_tag LOCUS_10550 gene coaE 4736 5374 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816768.1 protein_id gnl|my_center|LOCUS_10550 5684 7174 gene locus_tag LOCUS_10560 gene rho 5684 7174 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813585.1 protein_id gnl|my_center|LOCUS_10560 7281 7763 gene locus_tag LOCUS_10570 gene ribH 7281 7763 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403828.1 protein_id gnl|my_center|LOCUS_10570 7844 8299 gene locus_tag LOCUS_10580 gene nusB 7844 8299 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326965.1 protein_id gnl|my_center|LOCUS_10580 10222 8363 gene locus_tag LOCUS_10590 gene glgB 10222 8363 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257047.1 protein_id gnl|my_center|LOCUS_10590 10658 11446 gene locus_tag LOCUS_10600 10658 11446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 12479 11529 gene locus_tag LOCUS_10610 12479 11529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 12885 12523 gene locus_tag LOCUS_10620 12885 12523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 13802 12882 gene locus_tag LOCUS_10630 13802 12882 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816586.1 protein_id gnl|my_center|LOCUS_10630 17423 14103 gene locus_tag LOCUS_10640 17423 14103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 17945 19069 gene locus_tag LOCUS_10650 17945 19069 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892129.1 protein_id gnl|my_center|LOCUS_10650 19183 20577 gene locus_tag LOCUS_10660 gene thrC 19183 20577 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_10660 21868 20798 gene locus_tag LOCUS_10670 21868 20798 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382491.1 protein_id gnl|my_center|LOCUS_10670 22056 22355 gene locus_tag LOCUS_10680 22056 22355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 22502 22585 gene locus_tag LOCUS_t00080 22502 22585 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 23499 22618 gene locus_tag LOCUS_10690 23499 22618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 24591 23806 gene locus_tag LOCUS_10700 gene uppS 24591 23806 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328291.1 protein_id gnl|my_center|LOCUS_10700 24929 24708 gene locus_tag LOCUS_10710 24929 24708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 25473 26474 gene locus_tag LOCUS_10720 25473 26474 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070921.1 protein_id gnl|my_center|LOCUS_10720 26694 29846 gene locus_tag LOCUS_10730 26694 29846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 30085 29861 gene locus_tag LOCUS_10740 30085 29861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 30775 30158 gene locus_tag LOCUS_10750 30775 30158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10750 31159 30797 gene locus_tag LOCUS_10760 31159 30797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10760 31840 31301 gene locus_tag LOCUS_10770 31840 31301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 34835 32010 gene locus_tag LOCUS_10780 gene leuS 34835 32010 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122073.1 protein_id gnl|my_center|LOCUS_10780 36940 34979 gene locus_tag LOCUS_10790 36940 34979 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921992.1 protein_id gnl|my_center|LOCUS_10790 37448 37197 gene locus_tag LOCUS_10800 37448 37197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 38344 37445 gene locus_tag LOCUS_10810 gene nadC 38344 37445 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920753.1 protein_id gnl|my_center|LOCUS_10810 39543 38455 gene locus_tag LOCUS_10820 39543 38455 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327669.1 protein_id gnl|my_center|LOCUS_10820 40722 39727 gene locus_tag LOCUS_10830 40722 39727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 41226 42590 gene locus_tag LOCUS_10840 41226 42590 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_10840 43631 42654 gene locus_tag LOCUS_10850 gene trpS 43631 42654 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120916.1 protein_id gnl|my_center|LOCUS_10850 44822 44007 gene locus_tag LOCUS_10860 44822 44007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 45417 44983 gene locus_tag LOCUS_10870 45417 44983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 49418 45738 gene locus_tag LOCUS_10880 49418 45738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 51072 49633 gene locus_tag LOCUS_10890 51072 49633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 51399 51989 gene locus_tag LOCUS_10900 51399 51989 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_10900 <54709 52115 gene locus_tag LOCUS_10910 <54709 52115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence021 963 766 gene locus_tag LOCUS_10920 963 766 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_10920 1243 1527 gene locus_tag LOCUS_10930 1243 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1597 1776 gene locus_tag LOCUS_10940 1597 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 2269 1790 gene locus_tag LOCUS_10950 2269 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 2899 2294 gene locus_tag LOCUS_10960 2899 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 3078 3338 gene locus_tag LOCUS_10970 3078 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 3335 3517 gene locus_tag LOCUS_10980 3335 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 3517 3798 gene locus_tag LOCUS_10990 3517 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 3817 4071 gene locus_tag LOCUS_11000 3817 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 5535 4915 gene locus_tag LOCUS_11010 5535 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 5815 5522 gene locus_tag LOCUS_11020 5815 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 6497 6333 gene locus_tag LOCUS_11030 6497 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 7181 6597 gene locus_tag LOCUS_11040 7181 6597 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406500.1 protein_id gnl|my_center|LOCUS_11040 8530 7265 gene locus_tag LOCUS_11050 8530 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 9512 8592 gene locus_tag LOCUS_11060 9512 8592 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 protein_id gnl|my_center|LOCUS_11060 9661 9509 gene locus_tag LOCUS_11070 9661 9509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 11829 9721 gene locus_tag LOCUS_11080 11829 9721 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031066.1 protein_id gnl|my_center|LOCUS_11080 13145 11823 gene locus_tag LOCUS_11090 13145 11823 CDS product DUF2791 family P-loop domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875950.1 protein_id gnl|my_center|LOCUS_11090 16018 13142 gene locus_tag LOCUS_11100 16018 13142 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942750.1 protein_id gnl|my_center|LOCUS_11100 20466 16015 gene locus_tag LOCUS_11110 20466 16015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 24350 20727 gene locus_tag LOCUS_11120 gene brxC 24350 20727 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942753.1 protein_id gnl|my_center|LOCUS_11120 25059 24415 gene locus_tag LOCUS_11130 25059 24415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 25844 25056 gene locus_tag LOCUS_11140 25844 25056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 26404 25841 gene locus_tag LOCUS_11150 26404 25841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 26799 29237 gene locus_tag LOCUS_11160 26799 29237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 29312 30349 gene locus_tag LOCUS_11170 gene mcrC 29312 30349 CDS product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922381.1 protein_id gnl|my_center|LOCUS_11170 30768 30475 gene locus_tag LOCUS_11180 30768 30475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 31000 33129 gene locus_tag LOCUS_11190 31000 33129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 33159 33956 gene locus_tag LOCUS_11200 33159 33956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 34027 35718 gene locus_tag LOCUS_11210 34027 35718 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963794.1 protein_id gnl|my_center|LOCUS_11210 35781 37868 gene locus_tag LOCUS_11220 35781 37868 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963795.1 protein_id gnl|my_center|LOCUS_11220 37870 41100 gene locus_tag LOCUS_11230 37870 41100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 41122 43482 gene locus_tag LOCUS_11240 41122 43482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 43517 45706 gene locus_tag LOCUS_11250 43517 45706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 45790 47175 gene locus_tag LOCUS_11260 45790 47175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 47172 49748 gene locus_tag LOCUS_11270 47172 49748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 50674 51777 gene locus_tag LOCUS_11280 50674 51777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 51823 52158 gene locus_tag LOCUS_11290 51823 52158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 >Feature sequence022 1756 1505 gene locus_tag LOCUS_11300 1756 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1833 2318 gene locus_tag LOCUS_11310 1833 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 2639 4015 gene locus_tag LOCUS_11320 2639 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 4156 4584 gene locus_tag LOCUS_11330 4156 4584 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338041.1 protein_id gnl|my_center|LOCUS_11330 6052 4724 gene locus_tag LOCUS_11340 6052 4724 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919501.1 protein_id gnl|my_center|LOCUS_11340 6619 6546 gene locus_tag LOCUS_t00090 6619 6546 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6967 7503 gene locus_tag LOCUS_11350 gene ilvN 6967 7503 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339870.1 protein_id gnl|my_center|LOCUS_11350 7609 8613 gene locus_tag LOCUS_11360 gene ilvC 7609 8613 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339869.1 protein_id gnl|my_center|LOCUS_11360 8832 10001 gene locus_tag LOCUS_11370 gene nagA 8832 10001 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230828.1 protein_id gnl|my_center|LOCUS_11370 12526 10346 gene locus_tag LOCUS_11380 12526 10346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 13480 12752 gene locus_tag LOCUS_11390 13480 12752 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481692.1 protein_id gnl|my_center|LOCUS_11390 13852 13544 gene locus_tag LOCUS_11400 13852 13544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 15000 13849 gene locus_tag LOCUS_11410 15000 13849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664354.1 protein_id gnl|my_center|LOCUS_11410 15262 15981 gene locus_tag LOCUS_11420 15262 15981 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387954.1 protein_id gnl|my_center|LOCUS_11420 16555 16343 gene locus_tag LOCUS_11430 gene csrA 16555 16343 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327053.1 protein_id gnl|my_center|LOCUS_11430 17061 17993 gene locus_tag LOCUS_11440 17061 17993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 18598 18158 gene locus_tag LOCUS_11450 18598 18158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 19751 18606 gene locus_tag LOCUS_11460 19751 18606 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039292.1 protein_id gnl|my_center|LOCUS_11460 19704 20000 gene locus_tag LOCUS_11470 19704 20000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 20436 23528 gene locus_tag LOCUS_11480 20436 23528 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615526.1 protein_id gnl|my_center|LOCUS_11480 25531 23825 gene locus_tag LOCUS_11490 25531 23825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 26766 25528 gene locus_tag LOCUS_11500 26766 25528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 27705 27409 gene locus_tag LOCUS_11510 27705 27409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 28889 27816 gene locus_tag LOCUS_11520 28889 27816 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922020.1 protein_id gnl|my_center|LOCUS_11520 31334 29571 gene locus_tag LOCUS_11530 31334 29571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 32886 31342 gene locus_tag LOCUS_11540 32886 31342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 33347 33045 gene locus_tag LOCUS_11550 33347 33045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 33526 33344 gene locus_tag LOCUS_11560 33526 33344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 33733 33542 gene locus_tag LOCUS_11570 33733 33542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 34021 34263 gene locus_tag LOCUS_11580 34021 34263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 34595 34978 gene locus_tag LOCUS_11590 34595 34978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 35127 36626 gene locus_tag LOCUS_11600 35127 36626 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119613.1 protein_id gnl|my_center|LOCUS_11600 36638 37360 gene locus_tag LOCUS_11610 36638 37360 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122200.1 protein_id gnl|my_center|LOCUS_11610 38249 37317 gene locus_tag LOCUS_11620 38249 37317 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_11620 38322 38522 gene locus_tag LOCUS_11630 38322 38522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 38728 39564 gene locus_tag LOCUS_11640 38728 39564 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837919.1 protein_id gnl|my_center|LOCUS_11640 39859 41277 gene locus_tag LOCUS_11650 39859 41277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 41436 42089 gene locus_tag LOCUS_11660 41436 42089 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970963.1 protein_id gnl|my_center|LOCUS_11660 42687 42082 gene locus_tag LOCUS_11670 42687 42082 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922484.1 protein_id gnl|my_center|LOCUS_11670 42842 43348 gene locus_tag LOCUS_11680 42842 43348 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327088.1 protein_id gnl|my_center|LOCUS_11680 43585 43953 gene locus_tag LOCUS_11690 43585 43953 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442716.1 protein_id gnl|my_center|LOCUS_11690 44289 45119 gene locus_tag LOCUS_11700 44289 45119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 45116 45409 gene locus_tag LOCUS_11710 45116 45409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 45406 46881 gene locus_tag LOCUS_11720 45406 46881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 49229 47082 gene locus_tag LOCUS_11730 49229 47082 CDS product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328585.1 protein_id gnl|my_center|LOCUS_11730 50990 49494 gene locus_tag LOCUS_11740 50990 49494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 51401 52300 gene locus_tag LOCUS_11750 51401 52300 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922494.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence023 318 10 gene locus_tag LOCUS_11760 318 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 2052 382 gene locus_tag LOCUS_11770 2052 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 3105 2206 gene locus_tag LOCUS_11780 gene rsmH 3105 2206 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_11780 3464 6061 gene locus_tag LOCUS_11790 3464 6061 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615806.1 protein_id gnl|my_center|LOCUS_11790 6252 8501 gene locus_tag LOCUS_11800 6252 8501 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615483.1 protein_id gnl|my_center|LOCUS_11800 8494 10266 gene locus_tag LOCUS_11810 8494 10266 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120593.1 protein_id gnl|my_center|LOCUS_11810 11542 10397 gene locus_tag LOCUS_11820 11542 10397 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836210.1 protein_id gnl|my_center|LOCUS_11820 11669 12967 gene locus_tag LOCUS_11830 gene gudP 11669 12967 CDS product glucarate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234818.1 protein_id gnl|my_center|LOCUS_11830 13260 13925 gene locus_tag LOCUS_11840 13260 13925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 13951 14304 gene locus_tag LOCUS_11850 13951 14304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 14428 15945 gene locus_tag LOCUS_11860 14428 15945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 16150 16701 gene locus_tag LOCUS_11870 16150 16701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 18247 16904 gene locus_tag LOCUS_11880 18247 16904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 19626 18343 gene locus_tag LOCUS_11890 19626 18343 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_11890 19998 20216 gene locus_tag LOCUS_11900 gene infA 19998 20216 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668257.1 protein_id gnl|my_center|LOCUS_11900 20444 20935 gene locus_tag LOCUS_11910 gene rnhA 20444 20935 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326294.1 protein_id gnl|my_center|LOCUS_11910 21043 22464 gene locus_tag LOCUS_11920 gene rimO 21043 22464 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922374.1 protein_id gnl|my_center|LOCUS_11920 22570 22815 gene locus_tag LOCUS_11930 22570 22815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 22882 23475 gene locus_tag LOCUS_11940 22882 23475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 23712 24491 gene locus_tag LOCUS_11950 23712 24491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 26382 24583 gene locus_tag LOCUS_11960 26382 24583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 26785 27921 gene locus_tag LOCUS_11970 gene solA 26785 27921 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_11970 28274 29224 gene locus_tag LOCUS_11980 28274 29224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 29327 29881 gene locus_tag LOCUS_11990 29327 29881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 30007 31155 gene locus_tag LOCUS_12000 gene lipE 30007 31155 CDS product lipase LipE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907540.1 protein_id gnl|my_center|LOCUS_12000 31678 31181 gene locus_tag LOCUS_12010 31678 31181 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327407.1 protein_id gnl|my_center|LOCUS_12010 31845 32858 gene locus_tag LOCUS_12020 31845 32858 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334803.1 protein_id gnl|my_center|LOCUS_12020 33016 32929 gene locus_tag LOCUS_t00100 33016 32929 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 34470 33262 gene locus_tag LOCUS_12030 34470 33262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 34866 35627 gene locus_tag LOCUS_12040 gene kduD 34866 35627 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_12040 36995 35799 gene locus_tag LOCUS_12050 36995 35799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 39233 41542 gene locus_tag LOCUS_12060 39233 41542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 42567 41590 gene locus_tag LOCUS_12070 42567 41590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 44064 42661 gene locus_tag LOCUS_12080 44064 42661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 45823 44108 gene locus_tag LOCUS_12090 45823 44108 CDS product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921874.1 protein_id gnl|my_center|LOCUS_12090 46662 45820 gene locus_tag LOCUS_12100 46662 45820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 47105 46764 gene locus_tag LOCUS_12110 47105 46764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 47689 47162 gene locus_tag LOCUS_12120 47689 47162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 48401 47976 gene locus_tag LOCUS_12130 gene exeG 48401 47976 CDS product GspG family T2SS major pseudopilin variant ExeG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308483.1 protein_id gnl|my_center|LOCUS_12130 49618 48416 gene locus_tag LOCUS_12140 49618 48416 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328284.1 protein_id gnl|my_center|LOCUS_12140 51295 49625 gene locus_tag LOCUS_12150 51295 49625 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence024 1999 539 gene locus_tag LOCUS_12160 1999 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 4324 2327 gene locus_tag LOCUS_12170 gene nadE 4324 2327 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_12170 5480 4653 gene locus_tag LOCUS_12180 5480 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 5901 6269 gene locus_tag LOCUS_12190 5901 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 7753 6374 gene locus_tag LOCUS_12200 gene argH 7753 6374 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037227775.1 protein_id gnl|my_center|LOCUS_12200 8940 7912 gene locus_tag LOCUS_12210 8940 7912 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119735.1 protein_id gnl|my_center|LOCUS_12210 9560 9348 gene locus_tag LOCUS_12220 9560 9348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 9442 11652 gene locus_tag LOCUS_12230 9442 11652 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_12230 13964 11688 gene locus_tag LOCUS_12240 13964 11688 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117947.1 protein_id gnl|my_center|LOCUS_12240 15386 14238 gene locus_tag LOCUS_12250 gene dprA 15386 14238 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922340.1 protein_id gnl|my_center|LOCUS_12250 16594 15566 gene locus_tag LOCUS_12260 gene hemB 16594 15566 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921457.1 protein_id gnl|my_center|LOCUS_12260 17692 16970 gene locus_tag LOCUS_12270 17692 16970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 17852 18373 gene locus_tag LOCUS_12280 gene hpt 17852 18373 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327769.1 protein_id gnl|my_center|LOCUS_12280 19541 21745 gene locus_tag LOCUS_12290 19541 21745 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_12290 22078 22599 gene locus_tag LOCUS_12300 22078 22599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 22490 22699 gene locus_tag LOCUS_12310 22490 22699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 22705 25242 gene locus_tag LOCUS_12320 22705 25242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 25368 26465 gene locus_tag LOCUS_12330 25368 26465 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121913.1 protein_id gnl|my_center|LOCUS_12330 26553 27041 gene locus_tag LOCUS_12340 gene accB 26553 27041 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328900.1 protein_id gnl|my_center|LOCUS_12340 27166 28515 gene locus_tag LOCUS_12350 gene accC 27166 28515 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332220.1 protein_id gnl|my_center|LOCUS_12350 29792 28737 gene locus_tag LOCUS_12360 29792 28737 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085740.1 protein_id gnl|my_center|LOCUS_12360 30407 30907 gene locus_tag LOCUS_12370 gene ispF 30407 30907 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951155.1 protein_id gnl|my_center|LOCUS_12370 30958 32535 gene locus_tag LOCUS_12380 gene cysS 30958 32535 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921769.1 protein_id gnl|my_center|LOCUS_12380 32885 36043 gene locus_tag LOCUS_12390 32885 36043 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146849598.1 protein_id gnl|my_center|LOCUS_12390 37642 36335 gene locus_tag LOCUS_12400 37642 36335 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 protein_id gnl|my_center|LOCUS_12400 37970 38488 gene locus_tag LOCUS_12410 37970 38488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615841.1 protein_id gnl|my_center|LOCUS_12410 38608 40614 gene locus_tag LOCUS_12420 38608 40614 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123401.1 protein_id gnl|my_center|LOCUS_12420 46381 40661 gene locus_tag LOCUS_12430 46381 40661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 46748 48274 gene locus_tag LOCUS_12440 46748 48274 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121615.1 protein_id gnl|my_center|LOCUS_12440 49325 48594 gene locus_tag LOCUS_12450 49325 48594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 49593 49712 gene locus_tag LOCUS_12460 49593 49712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 49715 50056 gene locus_tag LOCUS_12470 49715 50056 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928563.1 protein_id gnl|my_center|LOCUS_12470 50150 51001 gene locus_tag LOCUS_12480 50150 51001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 51149 51076 gene locus_tag LOCUS_t00110 51149 51076 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 51361 51288 gene locus_tag LOCUS_t00120 51361 51288 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence025 451 1440 gene locus_tag LOCUS_12490 451 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1805 3070 gene locus_tag LOCUS_12500 1805 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_12500 3184 4212 gene locus_tag LOCUS_12510 3184 4212 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_12510 4290 5426 gene locus_tag LOCUS_12520 4290 5426 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_12520 5571 6053 gene locus_tag LOCUS_12530 gene greA 5571 6053 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339475.1 protein_id gnl|my_center|LOCUS_12530 6341 7597 gene locus_tag LOCUS_12540 6341 7597 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121351.1 protein_id gnl|my_center|LOCUS_12540 9076 9513 gene locus_tag LOCUS_12550 gene infC 9076 9513 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329878.1 protein_id gnl|my_center|LOCUS_12550 9771 9971 gene locus_tag LOCUS_12560 gene rpmI 9771 9971 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297539.1 protein_id gnl|my_center|LOCUS_12560 10215 10475 gene locus_tag LOCUS_12570 10215 10475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 10614 11615 gene locus_tag LOCUS_12580 gene pheS 10614 11615 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121253.1 protein_id gnl|my_center|LOCUS_12580 13119 11722 gene locus_tag LOCUS_12590 13119 11722 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120139.1 protein_id gnl|my_center|LOCUS_12590 13548 13739 gene locus_tag LOCUS_12600 13548 13739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 13781 15169 gene locus_tag LOCUS_12610 gene noeA 13781 15169 CDS product nodulation protein NoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967406.1 protein_id gnl|my_center|LOCUS_12610 15166 17346 gene locus_tag LOCUS_12620 15166 17346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 17622 18836 gene locus_tag LOCUS_12630 17622 18836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 19004 20554 gene locus_tag LOCUS_12640 19004 20554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 20852 21313 gene locus_tag LOCUS_12650 20852 21313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 21446 22378 gene locus_tag LOCUS_12660 21446 22378 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_12660 23896 22616 gene locus_tag LOCUS_12670 23896 22616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 25574 23967 gene locus_tag LOCUS_12680 25574 23967 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12680 27206 26094 gene locus_tag LOCUS_12690 27206 26094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 29171 27261 gene locus_tag LOCUS_12700 gene lnt 29171 27261 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921835.1 protein_id gnl|my_center|LOCUS_12700 30798 29515 gene locus_tag LOCUS_12710 30798 29515 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_12710 32522 31176 gene locus_tag LOCUS_12720 32522 31176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 33157 33369 gene locus_tag LOCUS_12730 33157 33369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 33366 34655 gene locus_tag LOCUS_12740 33366 34655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 36363 34963 gene locus_tag LOCUS_12750 36363 34963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 36483 38471 gene locus_tag LOCUS_12760 36483 38471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 39243 38710 gene locus_tag LOCUS_12770 39243 38710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 39907 39233 gene locus_tag LOCUS_12780 39907 39233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 40164 40970 gene locus_tag LOCUS_12790 40164 40970 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113172.1 protein_id gnl|my_center|LOCUS_12790 41079 42029 gene locus_tag LOCUS_12800 gene xerD 41079 42029 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921953.1 protein_id gnl|my_center|LOCUS_12800 42698 43903 gene locus_tag LOCUS_12810 42698 43903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 44632 45198 gene locus_tag LOCUS_12820 44632 45198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329453.1 protein_id gnl|my_center|LOCUS_12820 45382 46560 gene locus_tag LOCUS_12830 45382 46560 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_12830 46738 47247 gene locus_tag LOCUS_12840 46738 47247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 47819 47319 gene locus_tag LOCUS_12850 47819 47319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 48874 47912 gene locus_tag LOCUS_12860 48874 47912 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_12860 50487 49066 gene locus_tag LOCUS_12870 50487 49066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532098.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence026 321 1598 gene locus_tag LOCUS_12880 321 1598 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970459.1 protein_id gnl|my_center|LOCUS_12880 2918 1998 gene locus_tag LOCUS_12890 2918 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 3162 2893 gene locus_tag LOCUS_12900 3162 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 4233 6329 gene locus_tag LOCUS_12910 4233 6329 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922336.1 protein_id gnl|my_center|LOCUS_12910 6511 8721 gene locus_tag LOCUS_12920 6511 8721 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_12920 8283 8199 gene locus_tag LOCUS_t00130 8283 8199 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 10154 9021 gene locus_tag LOCUS_12930 10154 9021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 11150 10908 gene locus_tag LOCUS_12940 11150 10908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 11298 11483 gene locus_tag LOCUS_12950 11298 11483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12950 12911 11976 gene locus_tag LOCUS_12960 12911 11976 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_12960 13289 14938 gene locus_tag LOCUS_12970 13289 14938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 15092 15895 gene locus_tag LOCUS_12980 15092 15895 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259458.1 protein_id gnl|my_center|LOCUS_12980 15945 19553 gene locus_tag LOCUS_12990 15945 19553 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669069.1 protein_id gnl|my_center|LOCUS_12990 19567 20181 gene locus_tag LOCUS_13000 19567 20181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 20552 20277 gene locus_tag LOCUS_13010 20552 20277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 20865 21575 gene locus_tag LOCUS_13020 gene bshB1 20865 21575 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333027.1 protein_id gnl|my_center|LOCUS_13020 21688 23382 gene locus_tag LOCUS_13030 21688 23382 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877166.1 protein_id gnl|my_center|LOCUS_13030 24300 23656 gene locus_tag LOCUS_13040 gene eda 24300 23656 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_13040 24818 24333 gene locus_tag LOCUS_13050 24818 24333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324288.1 protein_id gnl|my_center|LOCUS_13050 25469 25954 gene locus_tag LOCUS_13060 25469 25954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 26167 27453 gene locus_tag LOCUS_13070 gene clpX 26167 27453 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324828.1 protein_id gnl|my_center|LOCUS_13070 27434 27748 gene locus_tag LOCUS_13080 27434 27748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 27831 28919 gene locus_tag LOCUS_13090 27831 28919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 29871 29260 gene locus_tag LOCUS_13100 gene sodA 29871 29260 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_13100 31212 30118 gene locus_tag LOCUS_13110 31212 30118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 32558 31446 gene locus_tag LOCUS_13120 32558 31446 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_13120 33667 32558 gene locus_tag LOCUS_13130 33667 32558 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_13130 38609 34671 gene locus_tag LOCUS_13140 38609 34671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 38993 39271 gene locus_tag LOCUS_13150 38993 39271 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003504852.1 protein_id gnl|my_center|LOCUS_13150 39537 40736 gene locus_tag LOCUS_13160 39537 40736 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972410.1 protein_id gnl|my_center|LOCUS_13160 40739 41665 gene locus_tag LOCUS_13170 40739 41665 CDS product amino acid--[acyl-carrier-protein] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189723.1 protein_id gnl|my_center|LOCUS_13170 41962 42936 gene locus_tag LOCUS_13180 41962 42936 CDS product DUF1839 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196302.1 protein_id gnl|my_center|LOCUS_13180 43043 45583 gene locus_tag LOCUS_13190 43043 45583 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196300.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence027 226 1071 gene locus_tag LOCUS_13200 226 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 2413 1217 gene locus_tag LOCUS_13210 2413 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 2788 4857 gene locus_tag LOCUS_13220 gene lepB 2788 4857 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442624.1 protein_id gnl|my_center|LOCUS_13220 5030 5836 gene locus_tag LOCUS_13230 5030 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 6637 5963 gene locus_tag LOCUS_13240 6637 5963 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328113.1 protein_id gnl|my_center|LOCUS_13240 6860 7801 gene locus_tag LOCUS_13250 6860 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 8802 7969 gene locus_tag LOCUS_13260 8802 7969 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132696218.1 protein_id gnl|my_center|LOCUS_13260 10146 9058 gene locus_tag LOCUS_13270 10146 9058 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922840.1 protein_id gnl|my_center|LOCUS_13270 10658 11167 gene locus_tag LOCUS_13280 10658 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 12653 11298 gene locus_tag LOCUS_13290 12653 11298 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921498.1 protein_id gnl|my_center|LOCUS_13290 12896 14179 gene locus_tag LOCUS_13300 12896 14179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 14232 15011 gene locus_tag LOCUS_13310 14232 15011 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029038.1 protein_id gnl|my_center|LOCUS_13310 15229 15504 gene locus_tag LOCUS_13320 15229 15504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 16676 15594 gene locus_tag LOCUS_13330 16676 15594 CDS product peptidylglycine monooxygenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663621.1 protein_id gnl|my_center|LOCUS_13330 17147 16791 gene locus_tag LOCUS_13340 17147 16791 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_13340 18337 17273 gene locus_tag LOCUS_13350 18337 17273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 19634 18339 gene locus_tag LOCUS_13360 19634 18339 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118167.1 protein_id gnl|my_center|LOCUS_13360 20405 19749 gene locus_tag LOCUS_13370 20405 19749 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_13370 21987 20563 gene locus_tag LOCUS_13380 21987 20563 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921791.1 protein_id gnl|my_center|LOCUS_13380 25145 22134 gene locus_tag LOCUS_13390 25145 22134 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120107.1 protein_id gnl|my_center|LOCUS_13390 27023 25602 gene locus_tag LOCUS_13400 27023 25602 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_13400 28299 27343 gene locus_tag LOCUS_13410 28299 27343 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332287.1 protein_id gnl|my_center|LOCUS_13410 28686 28465 gene locus_tag LOCUS_13420 28686 28465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672712.1 protein_id gnl|my_center|LOCUS_13420 29168 28779 gene locus_tag LOCUS_13430 29168 28779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 30135 29719 gene locus_tag LOCUS_13440 30135 29719 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_13440 30299 31363 gene locus_tag LOCUS_13450 gene purM 30299 31363 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922559.1 protein_id gnl|my_center|LOCUS_13450 31403 32218 gene locus_tag LOCUS_13460 31403 32218 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333289.1 protein_id gnl|my_center|LOCUS_13460 32786 32364 gene locus_tag LOCUS_13470 32786 32364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 33866 33186 gene locus_tag LOCUS_13480 33866 33186 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921555.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13480 35529 34039 gene locus_tag LOCUS_13490 35529 34039 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_13490 35901 37103 gene locus_tag LOCUS_13500 35901 37103 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119222.1 protein_id gnl|my_center|LOCUS_13500 37292 38620 gene locus_tag LOCUS_13510 37292 38620 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_13510 38553 38927 gene locus_tag LOCUS_13520 38553 38927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 38947 40185 gene locus_tag LOCUS_13530 38947 40185 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 protein_id gnl|my_center|LOCUS_13530 40364 41260 gene locus_tag LOCUS_13540 40364 41260 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275434.1 protein_id gnl|my_center|LOCUS_13540 41364 41804 gene locus_tag LOCUS_13550 41364 41804 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197479.1 protein_id gnl|my_center|LOCUS_13550 41949 42797 gene locus_tag LOCUS_13560 41949 42797 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256749.1 protein_id gnl|my_center|LOCUS_13560 43832 42897 gene locus_tag LOCUS_13570 43832 42897 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972698.1 protein_id gnl|my_center|LOCUS_13570 44333 43863 gene locus_tag LOCUS_13580 44333 43863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 45861 44536 gene locus_tag LOCUS_13590 45861 44536 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence028 3373 2183 gene locus_tag LOCUS_13600 3373 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 4680 3370 gene locus_tag LOCUS_13610 4680 3370 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_13610 7258 4685 gene locus_tag LOCUS_13620 7258 4685 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_13620 7586 7383 gene locus_tag LOCUS_13630 7586 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 9152 7782 gene locus_tag LOCUS_13640 9152 7782 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121673.1 protein_id gnl|my_center|LOCUS_13640 10394 9234 gene locus_tag LOCUS_13650 10394 9234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 12904 10451 gene locus_tag LOCUS_13660 12904 10451 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008668005.1 protein_id gnl|my_center|LOCUS_13660 14801 12915 gene locus_tag LOCUS_13670 14801 12915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 15250 15032 gene locus_tag LOCUS_13680 15250 15032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 15503 16372 gene locus_tag LOCUS_13690 gene ubiA 15503 16372 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119017.1 protein_id gnl|my_center|LOCUS_13690 16420 17367 gene locus_tag LOCUS_13700 16420 17367 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879220.1 protein_id gnl|my_center|LOCUS_13700 19779 17401 gene locus_tag LOCUS_13710 19779 17401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 20171 21163 gene locus_tag LOCUS_13720 20171 21163 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814616.1 protein_id gnl|my_center|LOCUS_13720 21306 22370 gene locus_tag LOCUS_13730 21306 22370 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120960.1 protein_id gnl|my_center|LOCUS_13730 22864 22382 gene locus_tag LOCUS_13740 22864 22382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 24567 22963 gene locus_tag LOCUS_13750 24567 22963 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551866.1 protein_id gnl|my_center|LOCUS_13750 28341 24793 gene locus_tag LOCUS_13760 28341 24793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 30779 28497 gene locus_tag LOCUS_13770 30779 28497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 31176 31952 gene locus_tag LOCUS_13780 gene hisF 31176 31952 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325161.1 protein_id gnl|my_center|LOCUS_13780 33430 32012 gene locus_tag LOCUS_13790 33430 32012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 35020 33458 gene locus_tag LOCUS_13800 35020 33458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 36351 35188 gene locus_tag LOCUS_13810 36351 35188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 37631 36495 gene locus_tag LOCUS_13820 37631 36495 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037252469.1 protein_id gnl|my_center|LOCUS_13820 38026 38466 gene locus_tag LOCUS_13830 38026 38466 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615711.1 protein_id gnl|my_center|LOCUS_13830 38735 39367 gene locus_tag LOCUS_13840 38735 39367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 39642 40274 gene locus_tag LOCUS_13850 39642 40274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 44231 40362 gene locus_tag LOCUS_13860 44231 40362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 44112 44390 gene locus_tag LOCUS_13870 44112 44390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 45248 44493 gene locus_tag LOCUS_13880 45248 44493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence029 46 576 gene locus_tag LOCUS_13890 46 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1633 680 gene locus_tag LOCUS_13900 1633 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 2752 1760 gene locus_tag LOCUS_13910 2752 1760 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140301.1 protein_id gnl|my_center|LOCUS_13910 3774 2875 gene locus_tag LOCUS_13920 3774 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 4791 3913 gene locus_tag LOCUS_13930 gene murB 4791 3913 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905790.1 protein_id gnl|my_center|LOCUS_13930 6568 4955 gene locus_tag LOCUS_13940 gene murC 6568 4955 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018214193.1 protein_id gnl|my_center|LOCUS_13940 8760 6568 gene locus_tag LOCUS_13950 8760 6568 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121743.1 protein_id gnl|my_center|LOCUS_13950 9626 8757 gene locus_tag LOCUS_13960 9626 8757 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922127.1 protein_id gnl|my_center|LOCUS_13960 9901 9707 gene locus_tag LOCUS_13970 9901 9707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 10368 9967 gene locus_tag LOCUS_13980 10368 9967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 10634 10356 gene locus_tag LOCUS_13990 10634 10356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 11717 10704 gene locus_tag LOCUS_14000 11717 10704 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327063.1 protein_id gnl|my_center|LOCUS_14000 12617 12393 gene locus_tag LOCUS_14010 12617 12393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 12582 14117 gene locus_tag LOCUS_14020 12582 14117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 14214 14849 gene locus_tag LOCUS_14030 14214 14849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 15108 15665 gene locus_tag LOCUS_14040 15108 15665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 15994 16440 gene locus_tag LOCUS_14050 15994 16440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 16615 17595 gene locus_tag LOCUS_14060 16615 17595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 18979 17771 gene locus_tag LOCUS_14070 18979 17771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 23182 19136 gene locus_tag LOCUS_14080 23182 19136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 24651 23581 gene locus_tag LOCUS_14090 24651 23581 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122045.1 protein_id gnl|my_center|LOCUS_14090 25149 24886 gene locus_tag LOCUS_14100 25149 24886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 25144 25296 gene locus_tag LOCUS_14110 25144 25296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 25515 25961 gene locus_tag LOCUS_14120 25515 25961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 26083 26472 gene locus_tag LOCUS_14130 26083 26472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 26469 26717 gene locus_tag LOCUS_14140 gene moaD 26469 26717 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257741.1 protein_id gnl|my_center|LOCUS_14140 26860 27282 gene locus_tag LOCUS_14150 gene moaE 26860 27282 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531878.1 protein_id gnl|my_center|LOCUS_14150 27279 28319 gene locus_tag LOCUS_14160 gene moaA 27279 28319 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_14160 31063 28490 gene locus_tag LOCUS_14170 31063 28490 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_14170 31619 32626 gene locus_tag LOCUS_14180 31619 32626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 32928 36269 gene locus_tag LOCUS_14190 32928 36269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 36790 38448 gene locus_tag LOCUS_14200 36790 38448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 40061 38907 gene locus_tag LOCUS_14210 40061 38907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 40939 41148 gene locus_tag LOCUS_14220 40939 41148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence030 115 1764 gene locus_tag LOCUS_14230 115 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1770 3089 gene locus_tag LOCUS_14240 1770 3089 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_14240 4283 3141 gene locus_tag LOCUS_14250 4283 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 7493 4674 gene locus_tag LOCUS_14260 7493 4674 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325625.1 protein_id gnl|my_center|LOCUS_14260 8798 7740 gene locus_tag LOCUS_14270 gene mtnA 8798 7740 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_14270 9338 8895 gene locus_tag LOCUS_14280 9338 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 10395 9679 gene locus_tag LOCUS_14290 10395 9679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 11459 10965 gene locus_tag LOCUS_14300 11459 10965 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893498.1 protein_id gnl|my_center|LOCUS_14300 11506 11634 gene locus_tag LOCUS_14310 11506 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 11674 13326 gene locus_tag LOCUS_14320 11674 13326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 13531 14739 gene locus_tag LOCUS_14330 13531 14739 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858471.1 protein_id gnl|my_center|LOCUS_14330 14736 15578 gene locus_tag LOCUS_14340 14736 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 17279 15699 gene locus_tag LOCUS_14350 17279 15699 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_14350 17733 18776 gene locus_tag LOCUS_14360 17733 18776 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324413.1 protein_id gnl|my_center|LOCUS_14360 19004 19198 gene locus_tag LOCUS_14370 19004 19198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 19435 19980 gene locus_tag LOCUS_14380 19435 19980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 21530 20178 gene locus_tag LOCUS_14390 21530 20178 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_14390 23604 21649 gene locus_tag LOCUS_14400 23604 21649 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816805.1 protein_id gnl|my_center|LOCUS_14400 24010 24336 gene locus_tag LOCUS_14410 24010 24336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 25523 24456 gene locus_tag LOCUS_14420 25523 24456 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531370.1 protein_id gnl|my_center|LOCUS_14420 26800 25754 gene locus_tag LOCUS_14430 gene rfaE1 26800 25754 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_14430 28001 26988 gene locus_tag LOCUS_14440 28001 26988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_14440 28655 28152 gene locus_tag LOCUS_14450 gene moaC 28655 28152 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341741.1 protein_id gnl|my_center|LOCUS_14450 30010 30591 gene locus_tag LOCUS_14460 30010 30591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 30860 31099 gene locus_tag LOCUS_14470 30860 31099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 33084 31492 gene locus_tag LOCUS_14480 33084 31492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 34646 33861 gene locus_tag LOCUS_14490 34646 33861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 36154 35192 gene locus_tag LOCUS_14500 36154 35192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 36832 36293 gene locus_tag LOCUS_14510 36832 36293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 37286 36834 gene locus_tag LOCUS_14520 37286 36834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 38253 37426 gene locus_tag LOCUS_14530 38253 37426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 38704 39552 gene locus_tag LOCUS_14540 38704 39552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 39666 40382 gene locus_tag LOCUS_14550 39666 40382 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326130.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence031 <1 672 gene locus_tag LOCUS_14560 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141821.1:pirin family protein 1111 863 gene locus_tag LOCUS_14570 1111 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1953 2228 gene locus_tag LOCUS_14580 1953 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2291 2539 gene locus_tag LOCUS_14590 2291 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 3929 2580 gene locus_tag LOCUS_14600 3929 2580 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_14600 5759 4038 gene locus_tag LOCUS_14610 5759 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 6052 8313 gene locus_tag LOCUS_14620 6052 8313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 8521 9477 gene locus_tag LOCUS_14630 8521 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 9810 11987 gene locus_tag LOCUS_14640 gene recG 9810 11987 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921377.1 protein_id gnl|my_center|LOCUS_14640 12251 12688 gene locus_tag LOCUS_14650 12251 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 13592 12783 gene locus_tag LOCUS_14660 13592 12783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 14058 14375 gene locus_tag LOCUS_14670 14058 14375 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325910.1 protein_id gnl|my_center|LOCUS_14670 14459 16072 gene locus_tag LOCUS_14680 gene groL 14459 16072 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325911.1 protein_id gnl|my_center|LOCUS_14680 16315 17313 gene locus_tag LOCUS_14690 gene nadA 16315 17313 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802044.1 protein_id gnl|my_center|LOCUS_14690 17809 17423 gene locus_tag LOCUS_14700 17809 17423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 19248 17947 gene locus_tag LOCUS_14710 19248 17947 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257973.1 protein_id gnl|my_center|LOCUS_14710 20067 19252 gene locus_tag LOCUS_14720 20067 19252 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_14720 21822 20254 gene locus_tag LOCUS_14730 21822 20254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 21854 22111 gene locus_tag LOCUS_14740 21854 22111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 22630 22157 gene locus_tag LOCUS_14750 22630 22157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 23313 24842 gene locus_tag LOCUS_14760 23313 24842 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158257889.1 protein_id gnl|my_center|LOCUS_14760 25161 24946 gene locus_tag LOCUS_14770 25161 24946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 25170 26267 gene locus_tag LOCUS_14780 25170 26267 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121149.1 protein_id gnl|my_center|LOCUS_14780 26780 29122 gene locus_tag LOCUS_14790 26780 29122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 29326 30480 gene locus_tag LOCUS_14800 29326 30480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 30751 32415 gene locus_tag LOCUS_14810 30751 32415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 32518 32847 gene locus_tag LOCUS_14820 32518 32847 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531698.1 protein_id gnl|my_center|LOCUS_14820 32847 33524 gene locus_tag LOCUS_14830 32847 33524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 33793 34515 gene locus_tag LOCUS_14840 33793 34515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 35599 34709 gene locus_tag LOCUS_14850 35599 34709 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121957.1 protein_id gnl|my_center|LOCUS_14850 35825 35643 gene locus_tag LOCUS_14860 35825 35643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 36061 35855 gene locus_tag LOCUS_14870 36061 35855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 37265 36150 gene locus_tag LOCUS_14880 37265 36150 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_14880 38104 37349 gene locus_tag LOCUS_14890 38104 37349 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121230.1 protein_id gnl|my_center|LOCUS_14890 39499 38117 gene locus_tag LOCUS_14900 gene lpdA 39499 38117 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119002.1 protein_id gnl|my_center|LOCUS_14900 40727 39696 gene locus_tag LOCUS_14910 40727 39696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence032 1043 1210 gene locus_tag LOCUS_14920 1043 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 2305 1688 gene locus_tag LOCUS_14930 2305 1688 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338439.1 protein_id gnl|my_center|LOCUS_14930 2669 3583 gene locus_tag LOCUS_14940 gene gmd 2669 3583 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_14940 4294 3698 gene locus_tag LOCUS_14950 gene nadD 4294 3698 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228912.1 protein_id gnl|my_center|LOCUS_14950 5045 4413 gene locus_tag LOCUS_14960 gene upp 5045 4413 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122661.1 protein_id gnl|my_center|LOCUS_14960 5922 5401 gene locus_tag LOCUS_14970 5922 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 6806 6030 gene locus_tag LOCUS_14980 6806 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123690.1 protein_id gnl|my_center|LOCUS_14980 7453 6803 gene locus_tag LOCUS_14990 7453 6803 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123691.1 protein_id gnl|my_center|LOCUS_14990 7790 10558 gene locus_tag LOCUS_15000 7790 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 11049 10690 gene locus_tag LOCUS_15010 11049 10690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 11343 11918 gene locus_tag LOCUS_15020 11343 11918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 12187 13266 gene locus_tag LOCUS_15030 gene ricT 12187 13266 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615890.1 protein_id gnl|my_center|LOCUS_15030 13498 15846 gene locus_tag LOCUS_15040 13498 15846 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144106.1 protein_id gnl|my_center|LOCUS_15040 17458 16091 gene locus_tag LOCUS_15050 17458 16091 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_15050 19439 17739 gene locus_tag LOCUS_15060 19439 17739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 20145 19852 gene locus_tag LOCUS_15070 20145 19852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15070 20038 20310 gene locus_tag LOCUS_15080 20038 20310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 20531 20899 gene locus_tag LOCUS_15090 20531 20899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 20909 22285 gene locus_tag LOCUS_15100 20909 22285 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071802696.1 protein_id gnl|my_center|LOCUS_15100 23342 22221 gene locus_tag LOCUS_15110 23342 22221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 23631 23332 gene locus_tag LOCUS_15120 23631 23332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15120 24468 23707 gene locus_tag LOCUS_15130 24468 23707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15130 25481 24465 gene locus_tag LOCUS_15140 25481 24465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 25632 25498 gene locus_tag LOCUS_15150 25632 25498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 26038 25892 gene locus_tag LOCUS_15160 26038 25892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15160 26371 26201 gene locus_tag LOCUS_15170 26371 26201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15170 27025 26396 gene locus_tag LOCUS_15180 27025 26396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15180 27259 27047 gene locus_tag LOCUS_15190 27259 27047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 27362 27640 gene locus_tag LOCUS_15200 27362 27640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 27881 28093 gene locus_tag LOCUS_15210 27881 28093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 28346 29545 gene locus_tag LOCUS_15220 28346 29545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 32429 29802 gene locus_tag LOCUS_15230 32429 29802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 32880 32458 gene locus_tag LOCUS_15240 32880 32458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 33033 33251 gene locus_tag LOCUS_15250 33033 33251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 34411 33497 gene locus_tag LOCUS_15260 34411 33497 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058043.1 protein_id gnl|my_center|LOCUS_15260 36509 34977 gene locus_tag LOCUS_15270 36509 34977 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065096.1 protein_id gnl|my_center|LOCUS_15270 37857 36805 gene locus_tag LOCUS_15280 gene recA 37857 36805 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813294.1 protein_id gnl|my_center|LOCUS_15280 38798 38184 gene locus_tag LOCUS_15290 38798 38184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 40178 38838 gene locus_tag LOCUS_15300 40178 38838 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence033 445 203 gene locus_tag LOCUS_15310 445 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 2170 806 gene locus_tag LOCUS_15320 2170 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 2647 5022 gene locus_tag LOCUS_15330 2647 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 6219 5131 gene locus_tag LOCUS_15340 6219 5131 CDS product DUF1570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616071.1 protein_id gnl|my_center|LOCUS_15340 6521 7891 gene locus_tag LOCUS_15350 6521 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 8345 10354 gene locus_tag LOCUS_15360 8345 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 11625 10465 gene locus_tag LOCUS_15370 11625 10465 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_15370 12839 11865 gene locus_tag LOCUS_15380 gene pyrF 12839 11865 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922551.1 protein_id gnl|my_center|LOCUS_15380 13357 12827 gene locus_tag LOCUS_15390 13357 12827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 15009 13540 gene locus_tag LOCUS_15400 15009 13540 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_15400 15914 15081 gene locus_tag LOCUS_15410 15914 15081 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_15410 19113 15928 gene locus_tag LOCUS_15420 19113 15928 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122517.1 protein_id gnl|my_center|LOCUS_15420 19371 19775 gene locus_tag LOCUS_15430 gene queD 19371 19775 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264135.1 protein_id gnl|my_center|LOCUS_15430 19928 21097 gene locus_tag LOCUS_15440 19928 21097 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615452.1 protein_id gnl|my_center|LOCUS_15440 21612 22292 gene locus_tag LOCUS_15450 21612 22292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 22516 23394 gene locus_tag LOCUS_15460 gene lpxC 22516 23394 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615542.1 protein_id gnl|my_center|LOCUS_15460 23587 24432 gene locus_tag LOCUS_15470 gene lpxA 23587 24432 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328498.1 protein_id gnl|my_center|LOCUS_15470 24684 25760 gene locus_tag LOCUS_15480 24684 25760 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_15480 27460 25919 gene locus_tag LOCUS_15490 27460 25919 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 protein_id gnl|my_center|LOCUS_15490 27784 28653 gene locus_tag LOCUS_15500 27784 28653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 30181 28694 gene locus_tag LOCUS_15510 30181 28694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 30727 30257 gene locus_tag LOCUS_15520 gene rpiB 30727 30257 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615468.1 protein_id gnl|my_center|LOCUS_15520 31027 30731 gene locus_tag LOCUS_15530 31027 30731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 31215 31012 gene locus_tag LOCUS_15540 31215 31012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 32703 31237 gene locus_tag LOCUS_15550 32703 31237 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_15550 33144 32899 gene locus_tag LOCUS_15560 33144 32899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15560 37958 33354 gene locus_tag LOCUS_15570 gene gltB 37958 33354 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120560.1 protein_id gnl|my_center|LOCUS_15570 39341 38364 gene locus_tag LOCUS_15580 39341 38364 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence034 540 1484 gene locus_tag LOCUS_15590 540 1484 CDS product DUF1571 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 protein_id gnl|my_center|LOCUS_15590 1782 2948 gene locus_tag LOCUS_15600 1782 2948 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782251.1 protein_id gnl|my_center|LOCUS_15600 4905 3112 gene locus_tag LOCUS_15610 4905 3112 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_15610 5600 5064 gene locus_tag LOCUS_15620 5600 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921915.1 protein_id gnl|my_center|LOCUS_15620 6974 5664 gene locus_tag LOCUS_15630 6974 5664 CDS product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334059.1 protein_id gnl|my_center|LOCUS_15630 8399 7251 gene locus_tag LOCUS_15640 8399 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 8317 8532 gene locus_tag LOCUS_15650 8317 8532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 10045 8741 gene locus_tag LOCUS_15660 10045 8741 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_15660 12055 10178 gene locus_tag LOCUS_15670 12055 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 13569 12304 gene locus_tag LOCUS_15680 13569 12304 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_15680 14242 14066 gene locus_tag LOCUS_15690 14242 14066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 14232 15839 gene locus_tag LOCUS_15700 14232 15839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 16652 17521 gene locus_tag LOCUS_15710 gene folP 16652 17521 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120943.1 protein_id gnl|my_center|LOCUS_15710 18536 17754 gene locus_tag LOCUS_15720 18536 17754 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121332.1 protein_id gnl|my_center|LOCUS_15720 19051 18719 gene locus_tag LOCUS_15730 19051 18719 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326964.1 protein_id gnl|my_center|LOCUS_15730 20177 19356 gene locus_tag LOCUS_15740 20177 19356 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_15740 20412 21038 gene locus_tag LOCUS_15750 gene lexA 20412 21038 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615546.1 protein_id gnl|my_center|LOCUS_15750 22141 21149 gene locus_tag LOCUS_15760 22141 21149 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_15760 24234 22474 gene locus_tag LOCUS_15770 24234 22474 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331356.1 protein_id gnl|my_center|LOCUS_15770 24447 25481 gene locus_tag LOCUS_15780 24447 25481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 26052 25489 gene locus_tag LOCUS_15790 26052 25489 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404273.1 protein_id gnl|my_center|LOCUS_15790 27186 26125 gene locus_tag LOCUS_15800 27186 26125 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002661162.1 protein_id gnl|my_center|LOCUS_15800 28486 27632 gene locus_tag LOCUS_15810 28486 27632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 28899 31052 gene locus_tag LOCUS_15820 28899 31052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 31164 32756 gene locus_tag LOCUS_15830 31164 32756 CDS product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393517.1 protein_id gnl|my_center|LOCUS_15830 33751 33071 gene locus_tag LOCUS_15840 33751 33071 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_15840 37743 33748 gene locus_tag LOCUS_15850 37743 33748 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143551.1 protein_id gnl|my_center|LOCUS_15850 38240 38575 gene locus_tag LOCUS_15860 38240 38575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence035 945 25 gene locus_tag LOCUS_15870 945 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 1457 1759 gene locus_tag LOCUS_15880 1457 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 3372 1822 gene locus_tag LOCUS_15890 3372 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 4348 3542 gene locus_tag LOCUS_15900 4348 3542 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241910.1 protein_id gnl|my_center|LOCUS_15900 5310 4345 gene locus_tag LOCUS_15910 5310 4345 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228777.1 protein_id gnl|my_center|LOCUS_15910 6676 5780 gene locus_tag LOCUS_15920 6676 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 8099 6957 gene locus_tag LOCUS_15930 8099 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 11740 8576 gene locus_tag LOCUS_15940 11740 8576 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666716.1 protein_id gnl|my_center|LOCUS_15940 12044 12580 gene locus_tag LOCUS_15950 12044 12580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 12555 12905 gene locus_tag LOCUS_15960 12555 12905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 13251 16871 gene locus_tag LOCUS_15970 13251 16871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 17008 17787 gene locus_tag LOCUS_15980 17008 17787 CDS product DUF3050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219159941.1 protein_id gnl|my_center|LOCUS_15980 18752 17805 gene locus_tag LOCUS_15990 18752 17805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 20202 19009 gene locus_tag LOCUS_16000 gene eboE 20202 19009 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_16000 20750 21325 gene locus_tag LOCUS_16010 20750 21325 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_16010 21473 21973 gene locus_tag LOCUS_16020 21473 21973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 21977 23209 gene locus_tag LOCUS_16030 21977 23209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 23347 24066 gene locus_tag LOCUS_16040 23347 24066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333116.1 protein_id gnl|my_center|LOCUS_16040 24169 24543 gene locus_tag LOCUS_16050 24169 24543 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888724.1 protein_id gnl|my_center|LOCUS_16050 26887 25079 gene locus_tag LOCUS_16060 26887 25079 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869365.1 protein_id gnl|my_center|LOCUS_16060 28047 27220 gene locus_tag LOCUS_16070 28047 27220 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922156.1 protein_id gnl|my_center|LOCUS_16070 28752 28306 gene locus_tag LOCUS_16080 28752 28306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 29445 28840 gene locus_tag LOCUS_16090 gene clpP 29445 28840 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327157.1 protein_id gnl|my_center|LOCUS_16090 30160 29537 gene locus_tag LOCUS_16100 30160 29537 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327156.1 protein_id gnl|my_center|LOCUS_16100 31846 30374 gene locus_tag LOCUS_16110 gene tig 31846 30374 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_16110 32081 32009 gene locus_tag LOCUS_t00140 32081 32009 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 32939 32253 gene locus_tag LOCUS_16120 32939 32253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 33257 32940 gene locus_tag LOCUS_16130 33257 32940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 33569 33318 gene locus_tag LOCUS_16140 33569 33318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 34163 33648 gene locus_tag LOCUS_16150 34163 33648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16150 34398 34261 gene locus_tag LOCUS_16160 34398 34261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 35116 34685 gene locus_tag LOCUS_16170 35116 34685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 36170 35103 gene locus_tag LOCUS_16180 36170 35103 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328432.1 protein_id gnl|my_center|LOCUS_16180 36871 36365 gene locus_tag LOCUS_16190 36871 36365 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334154.1 protein_id gnl|my_center|LOCUS_16190 37311 38540 gene locus_tag LOCUS_16200 gene pepT 37311 38540 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121359.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence036 409 1200 gene locus_tag LOCUS_16210 409 1200 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667138.1 protein_id gnl|my_center|LOCUS_16210 1568 2434 gene locus_tag LOCUS_16220 1568 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 2675 4726 gene locus_tag LOCUS_16230 2675 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 4931 5887 gene locus_tag LOCUS_16240 4931 5887 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_16240 7760 5898 gene locus_tag LOCUS_16250 7760 5898 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272023.1 protein_id gnl|my_center|LOCUS_16250 9249 8158 gene locus_tag LOCUS_16260 9249 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 10719 11855 gene locus_tag LOCUS_16270 10719 11855 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228554.1 protein_id gnl|my_center|LOCUS_16270 12024 13244 gene locus_tag LOCUS_16280 12024 13244 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122283.1 protein_id gnl|my_center|LOCUS_16280 14728 13379 gene locus_tag LOCUS_16290 14728 13379 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583125.1 protein_id gnl|my_center|LOCUS_16290 16118 14868 gene locus_tag LOCUS_16300 16118 14868 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926925.1 protein_id gnl|my_center|LOCUS_16300 16801 16274 gene locus_tag LOCUS_16310 16801 16274 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932450.1 protein_id gnl|my_center|LOCUS_16310 17542 16964 gene locus_tag LOCUS_16320 gene ndhC 17542 16964 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_16320 18020 17577 gene locus_tag LOCUS_16330 18020 17577 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227790.1 protein_id gnl|my_center|LOCUS_16330 18654 18085 gene locus_tag LOCUS_16340 18654 18085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 22675 18845 gene locus_tag LOCUS_16350 22675 18845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 24256 22811 gene locus_tag LOCUS_16360 24256 22811 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_16360 25100 24459 gene locus_tag LOCUS_16370 25100 24459 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_16370 25425 25694 gene locus_tag LOCUS_16380 gene rpsO 25425 25694 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721510.1 protein_id gnl|my_center|LOCUS_16380 25908 28049 gene locus_tag LOCUS_16390 gene pnp 25908 28049 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037246149.1 protein_id gnl|my_center|LOCUS_16390 28355 29086 gene locus_tag LOCUS_16400 28355 29086 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008656119.1 protein_id gnl|my_center|LOCUS_16400 30576 29110 gene locus_tag LOCUS_16410 30576 29110 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922839.1 protein_id gnl|my_center|LOCUS_16410 30853 34413 gene locus_tag LOCUS_16420 30853 34413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 34634 35704 gene locus_tag LOCUS_16430 34634 35704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 35973 36887 gene locus_tag LOCUS_16440 35973 36887 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228130.1 protein_id gnl|my_center|LOCUS_16440 36988 37503 gene locus_tag LOCUS_16450 36988 37503 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327446.1 protein_id gnl|my_center|LOCUS_16450 37535 38035 gene locus_tag LOCUS_16460 37535 38035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 38210 38659 gene locus_tag LOCUS_16470 38210 38659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 >Feature sequence037 791 1033 gene locus_tag LOCUS_16480 791 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1035 2963 gene locus_tag LOCUS_16490 1035 2963 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197532628.1 protein_id gnl|my_center|LOCUS_16490 2834 2761 gene locus_tag LOCUS_t00150 2834 2761 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3385 5586 gene locus_tag LOCUS_16500 3385 5586 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_16500 5869 6561 gene locus_tag LOCUS_16510 5869 6561 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921820.1 protein_id gnl|my_center|LOCUS_16510 8266 6788 gene locus_tag LOCUS_16520 8266 6788 CDS product deoxyribodipyrimidine photolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_16520 10149 8266 gene locus_tag LOCUS_16530 10149 8266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 11359 10337 gene locus_tag LOCUS_16540 11359 10337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 11864 12619 gene locus_tag LOCUS_16550 11864 12619 CDS product excisionase family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335835.1 protein_id gnl|my_center|LOCUS_16550 12702 13943 gene locus_tag LOCUS_16560 12702 13943 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921947.1 protein_id gnl|my_center|LOCUS_16560 13958 15244 gene locus_tag LOCUS_16570 13958 15244 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684174.1 protein_id gnl|my_center|LOCUS_16570 15241 16089 gene locus_tag LOCUS_16580 15241 16089 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942965.1 protein_id gnl|my_center|LOCUS_16580 16197 17405 gene locus_tag LOCUS_16590 16197 17405 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942966.1 protein_id gnl|my_center|LOCUS_16590 17402 18451 gene locus_tag LOCUS_16600 17402 18451 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044885.1 protein_id gnl|my_center|LOCUS_16600 18456 19274 gene locus_tag LOCUS_16610 18456 19274 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920946.1 protein_id gnl|my_center|LOCUS_16610 20478 19516 gene locus_tag LOCUS_16620 20478 19516 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_16620 21145 23364 gene locus_tag LOCUS_16630 21145 23364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 23836 23681 gene locus_tag LOCUS_16640 23836 23681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 24190 23840 gene locus_tag LOCUS_16650 24190 23840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 24414 26195 gene locus_tag LOCUS_16660 24414 26195 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162471698.1 protein_id gnl|my_center|LOCUS_16660 26416 26892 gene locus_tag LOCUS_16670 26416 26892 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326693.1 protein_id gnl|my_center|LOCUS_16670 26982 27755 gene locus_tag LOCUS_16680 gene fabG 26982 27755 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_16680 28053 28451 gene locus_tag LOCUS_16690 28053 28451 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326692.1 protein_id gnl|my_center|LOCUS_16690 28542 29036 gene locus_tag LOCUS_16700 28542 29036 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326691.1 protein_id gnl|my_center|LOCUS_16700 29090 30358 gene locus_tag LOCUS_16710 29090 30358 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326690.1 protein_id gnl|my_center|LOCUS_16710 30385 31500 gene locus_tag LOCUS_16720 gene ribD 30385 31500 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_16720 31460 31762 gene locus_tag LOCUS_16730 31460 31762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 32913 31705 gene locus_tag LOCUS_16740 32913 31705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 33559 34395 gene locus_tag LOCUS_16750 33559 34395 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_16750 35289 35465 gene locus_tag LOCUS_16760 35289 35465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 35688 35476 gene locus_tag LOCUS_16770 35688 35476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 36520 35651 gene locus_tag LOCUS_16780 gene rnc 36520 35651 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120177.1 protein_id gnl|my_center|LOCUS_16780 37695 36652 gene locus_tag LOCUS_16790 37695 36652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117899.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence038 878 1099 gene locus_tag LOCUS_16800 878 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 1178 2998 gene locus_tag LOCUS_16810 gene sppA 1178 2998 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_16810 3201 4685 gene locus_tag LOCUS_16820 3201 4685 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334705.1 protein_id gnl|my_center|LOCUS_16820 4856 7645 gene locus_tag LOCUS_16830 4856 7645 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117969.1 protein_id gnl|my_center|LOCUS_16830 8119 7670 gene locus_tag LOCUS_16840 8119 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 9425 8160 gene locus_tag LOCUS_16850 9425 8160 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_16850 10535 9525 gene locus_tag LOCUS_16860 10535 9525 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062822608.1 protein_id gnl|my_center|LOCUS_16860 11299 10556 gene locus_tag LOCUS_16870 11299 10556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123337.1 protein_id gnl|my_center|LOCUS_16870 11609 12181 gene locus_tag LOCUS_16880 11609 12181 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530095.1 protein_id gnl|my_center|LOCUS_16880 12244 12495 gene locus_tag LOCUS_16890 12244 12495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 12705 12923 gene locus_tag LOCUS_16900 12705 12923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 14500 13178 gene locus_tag LOCUS_16910 14500 13178 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616105.1 protein_id gnl|my_center|LOCUS_16910 14919 16778 gene locus_tag LOCUS_16920 14919 16778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 17074 18420 gene locus_tag LOCUS_16930 gene glnA 17074 18420 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_16930 22654 18608 gene locus_tag LOCUS_16940 22654 18608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 23564 23178 gene locus_tag LOCUS_16950 23564 23178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 24265 25200 gene locus_tag LOCUS_16960 24265 25200 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260201.1 protein_id gnl|my_center|LOCUS_16960 26030 25341 gene locus_tag LOCUS_16970 26030 25341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 26095 28617 gene locus_tag LOCUS_16980 26095 28617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 30485 28752 gene locus_tag LOCUS_16990 30485 28752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 30990 33017 gene locus_tag LOCUS_17000 gene ftsH 30990 33017 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120515.1 protein_id gnl|my_center|LOCUS_17000 34364 33195 gene locus_tag LOCUS_17010 34364 33195 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337450.1 protein_id gnl|my_center|LOCUS_17010 35015 34536 gene locus_tag LOCUS_17020 35015 34536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334707.1 protein_id gnl|my_center|LOCUS_17020 35682 35212 gene locus_tag LOCUS_17030 gene metW 35682 35212 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_17030 36007 36837 gene locus_tag LOCUS_17040 36007 36837 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_17040 37038 37826 gene locus_tag LOCUS_17050 37038 37826 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence039 4946 3747 gene locus_tag LOCUS_17060 gene lhgO 4946 3747 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839995.1 protein_id gnl|my_center|LOCUS_17060 5318 5911 gene locus_tag LOCUS_17070 5318 5911 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_17070 6185 7072 gene locus_tag LOCUS_17080 6185 7072 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_17080 7244 8203 gene locus_tag LOCUS_17090 7244 8203 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922059.1 protein_id gnl|my_center|LOCUS_17090 9092 8214 gene locus_tag LOCUS_17100 9092 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 9321 9629 gene locus_tag LOCUS_17110 9321 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 9595 10020 gene locus_tag LOCUS_17120 9595 10020 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_17120 10102 11721 gene locus_tag LOCUS_17130 gene pckA 10102 11721 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405091.1 protein_id gnl|my_center|LOCUS_17130 15262 11954 gene locus_tag LOCUS_17140 15262 11954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 16526 15600 gene locus_tag LOCUS_17150 16526 15600 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_17150 18926 16701 gene locus_tag LOCUS_17160 18926 16701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 19896 22439 gene locus_tag LOCUS_17170 19896 22439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 23781 22762 gene locus_tag LOCUS_17180 23781 22762 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118345.1 protein_id gnl|my_center|LOCUS_17180 26814 23971 gene locus_tag LOCUS_17190 26814 23971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 27656 27033 gene locus_tag LOCUS_17200 27656 27033 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121244.1 protein_id gnl|my_center|LOCUS_17200 28078 29019 gene locus_tag LOCUS_17210 28078 29019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 29225 29698 gene locus_tag LOCUS_17220 29225 29698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 30383 29724 gene locus_tag LOCUS_17230 30383 29724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 30983 30636 gene locus_tag LOCUS_17240 30983 30636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 31511 31014 gene locus_tag LOCUS_17250 31511 31014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 31878 31483 gene locus_tag LOCUS_17260 31878 31483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 37208 32838 gene locus_tag LOCUS_17270 37208 32838 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197446784.1 protein_id gnl|my_center|LOCUS_17270 37588 37421 gene locus_tag LOCUS_17280 37588 37421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence040 3454 3834 gene locus_tag LOCUS_17290 3454 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 4456 3884 gene locus_tag LOCUS_17300 4456 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 4732 5931 gene locus_tag LOCUS_17310 4732 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 6693 6133 gene locus_tag LOCUS_17320 gene frr 6693 6133 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339966.1 protein_id gnl|my_center|LOCUS_17320 7582 6836 gene locus_tag LOCUS_17330 gene pyrH 7582 6836 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261659.1 protein_id gnl|my_center|LOCUS_17330 8562 7726 gene locus_tag LOCUS_17340 gene tsf 8562 7726 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926570.1 protein_id gnl|my_center|LOCUS_17340 9483 8734 gene locus_tag LOCUS_17350 gene rpsB 9483 8734 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122857.1 protein_id gnl|my_center|LOCUS_17350 10511 9783 gene locus_tag LOCUS_17360 10511 9783 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_17360 11799 10813 gene locus_tag LOCUS_17370 11799 10813 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615678.1 protein_id gnl|my_center|LOCUS_17370 12235 12765 gene locus_tag LOCUS_17380 12235 12765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 12925 13662 gene locus_tag LOCUS_17390 12925 13662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_17390 13763 13554 gene locus_tag LOCUS_17400 13763 13554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 13781 15712 gene locus_tag LOCUS_17410 13781 15712 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_17410 14347 14427 gene locus_tag LOCUS_t00160 14347 14427 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 15910 16683 gene locus_tag LOCUS_17420 15910 16683 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_17420 16844 17971 gene locus_tag LOCUS_17430 gene gcvT 16844 17971 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_17430 18024 18335 gene locus_tag LOCUS_17440 18024 18335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 21494 18366 gene locus_tag LOCUS_17450 21494 18366 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_17450 23019 21715 gene locus_tag LOCUS_17460 23019 21715 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524840.1 protein_id gnl|my_center|LOCUS_17460 23458 24306 gene locus_tag LOCUS_17470 23458 24306 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_17470 24311 25873 gene locus_tag LOCUS_17480 24311 25873 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922220.1 protein_id gnl|my_center|LOCUS_17480 26061 27557 gene locus_tag LOCUS_17490 26061 27557 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921496.1 protein_id gnl|my_center|LOCUS_17490 27782 28690 gene locus_tag LOCUS_17500 27782 28690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 28886 32386 gene locus_tag LOCUS_17510 28886 32386 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121181.1 protein_id gnl|my_center|LOCUS_17510 32053 31973 gene locus_tag LOCUS_t00170 32053 31973 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 32518 33372 gene locus_tag LOCUS_17520 32518 33372 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028851.1 protein_id gnl|my_center|LOCUS_17520 33659 34729 gene locus_tag LOCUS_17530 33659 34729 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_17530 36239 34806 gene locus_tag LOCUS_17540 36239 34806 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence041 <1 1261 gene locus_tag LOCUS_17550 <1 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003230128.1:rhomboid protease YqgP 2364 1432 gene locus_tag LOCUS_17560 2364 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 2736 3404 gene locus_tag LOCUS_17570 2736 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 5477 3801 gene locus_tag LOCUS_17580 5477 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 5948 7945 gene locus_tag LOCUS_17590 5948 7945 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615540.1 protein_id gnl|my_center|LOCUS_17590 8407 9324 gene locus_tag LOCUS_17600 8407 9324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 9408 9935 gene locus_tag LOCUS_17610 9408 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 10010 11290 gene locus_tag LOCUS_17620 10010 11290 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211917.1 protein_id gnl|my_center|LOCUS_17620 11435 13642 gene locus_tag LOCUS_17630 11435 13642 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121932.1 protein_id gnl|my_center|LOCUS_17630 14958 13789 gene locus_tag LOCUS_17640 14958 13789 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335445.1 protein_id gnl|my_center|LOCUS_17640 15455 14955 gene locus_tag LOCUS_17650 gene purE 15455 14955 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_17650 15850 17412 gene locus_tag LOCUS_17660 15850 17412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 17697 18146 gene locus_tag LOCUS_17670 gene mscL 17697 18146 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785250.1 protein_id gnl|my_center|LOCUS_17670 18318 18899 gene locus_tag LOCUS_17680 18318 18899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 18912 19487 gene locus_tag LOCUS_17690 18912 19487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 19490 20269 gene locus_tag LOCUS_17700 19490 20269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 20475 23246 gene locus_tag LOCUS_17710 20475 23246 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146524746.1 protein_id gnl|my_center|LOCUS_17710 23393 24694 gene locus_tag LOCUS_17720 23393 24694 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_17720 24984 25484 gene locus_tag LOCUS_17730 24984 25484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 27037 25712 gene locus_tag LOCUS_17740 27037 25712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 28705 27230 gene locus_tag LOCUS_17750 28705 27230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 30696 28948 gene locus_tag LOCUS_17760 gene recJ 30696 28948 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338790.1 protein_id gnl|my_center|LOCUS_17760 30768 31628 gene locus_tag LOCUS_17770 30768 31628 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_17770 31660 33138 gene locus_tag LOCUS_17780 31660 33138 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_17780 33478 34602 gene locus_tag LOCUS_17790 33478 34602 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 protein_id gnl|my_center|LOCUS_17790 35844 34795 gene locus_tag LOCUS_17800 35844 34795 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326673.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence042 5139 3529 gene locus_tag LOCUS_17810 5139 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 5460 6197 gene locus_tag LOCUS_17820 5460 6197 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191981.1 protein_id gnl|my_center|LOCUS_17820 6523 7335 gene locus_tag LOCUS_17830 6523 7335 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121390.1 protein_id gnl|my_center|LOCUS_17830 14153 7344 gene locus_tag LOCUS_17840 14153 7344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 17791 14318 gene locus_tag LOCUS_17850 17791 14318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 20276 18210 gene locus_tag LOCUS_17860 gene pheT 20276 18210 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663007.1 protein_id gnl|my_center|LOCUS_17860 22297 20960 gene locus_tag LOCUS_17870 22297 20960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 23387 22500 gene locus_tag LOCUS_17880 gene dapA 23387 22500 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921565.1 protein_id gnl|my_center|LOCUS_17880 24402 23485 gene locus_tag LOCUS_17890 24402 23485 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 protein_id gnl|my_center|LOCUS_17890 24687 25076 gene locus_tag LOCUS_17900 24687 25076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 25170 27278 gene locus_tag LOCUS_17910 25170 27278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 27625 30945 gene locus_tag LOCUS_17920 27625 30945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 31342 30962 gene locus_tag LOCUS_17930 31342 30962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 32943 31354 gene locus_tag LOCUS_17940 32943 31354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 33256 33684 gene locus_tag LOCUS_17950 33256 33684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260968.1 protein_id gnl|my_center|LOCUS_17950 34418 33936 gene locus_tag LOCUS_17960 34418 33936 CDS product DUF1854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930535.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence043 694 140 gene locus_tag LOCUS_17970 694 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 941 684 gene locus_tag LOCUS_17980 941 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1158 1006 gene locus_tag LOCUS_17990 1158 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2136 3884 gene locus_tag LOCUS_18000 2136 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 3969 4583 gene locus_tag LOCUS_18010 3969 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 6055 4649 gene locus_tag LOCUS_18020 6055 4649 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145033984.1 protein_id gnl|my_center|LOCUS_18020 9659 6327 gene locus_tag LOCUS_18030 9659 6327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 9845 10864 gene locus_tag LOCUS_18040 9845 10864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 11180 11926 gene locus_tag LOCUS_18050 11180 11926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975431.1 protein_id gnl|my_center|LOCUS_18050 12248 12520 gene locus_tag LOCUS_18060 12248 12520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 14024 12741 gene locus_tag LOCUS_18070 14024 12741 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922668.1 protein_id gnl|my_center|LOCUS_18070 14265 15515 gene locus_tag LOCUS_18080 14265 15515 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120806.1 protein_id gnl|my_center|LOCUS_18080 15948 17726 gene locus_tag LOCUS_18090 15948 17726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 18727 17867 gene locus_tag LOCUS_18100 gene larE 18727 17867 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_18100 18986 20875 gene locus_tag LOCUS_18110 18986 20875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 21037 22131 gene locus_tag LOCUS_18120 21037 22131 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122080.1 protein_id gnl|my_center|LOCUS_18120 22273 22722 gene locus_tag LOCUS_18130 gene dtd 22273 22722 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393181.1 protein_id gnl|my_center|LOCUS_18130 24372 23362 gene locus_tag LOCUS_18140 24372 23362 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338657.1 protein_id gnl|my_center|LOCUS_18140 26243 24543 gene locus_tag LOCUS_18150 26243 24543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 27506 26379 gene locus_tag LOCUS_18160 27506 26379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 27937 29286 gene locus_tag LOCUS_18170 27937 29286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 29821 31356 gene locus_tag LOCUS_18180 29821 31356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 31446 32306 gene locus_tag LOCUS_18190 31446 32306 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090078.1 protein_id gnl|my_center|LOCUS_18190 33318 32497 gene locus_tag LOCUS_18200 33318 32497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 34266 33469 gene locus_tag LOCUS_18210 34266 33469 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120403.1 protein_id gnl|my_center|LOCUS_18210 34401 35288 gene locus_tag LOCUS_18220 34401 35288 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017617.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence044 449 877 gene locus_tag LOCUS_18230 449 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1913 879 gene locus_tag LOCUS_18240 1913 879 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268709.1 protein_id gnl|my_center|LOCUS_18240 2950 1952 gene locus_tag LOCUS_18250 2950 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 3186 4397 gene locus_tag LOCUS_18260 3186 4397 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_18260 5177 4425 gene locus_tag LOCUS_18270 5177 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 5520 6506 gene locus_tag LOCUS_18280 5520 6506 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921881.1 protein_id gnl|my_center|LOCUS_18280 8156 6690 gene locus_tag LOCUS_18290 8156 6690 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671603.1 protein_id gnl|my_center|LOCUS_18290 8678 8217 gene locus_tag LOCUS_18300 8678 8217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 9050 9901 gene locus_tag LOCUS_18310 9050 9901 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891044.1 protein_id gnl|my_center|LOCUS_18310 10223 10420 gene locus_tag LOCUS_18320 10223 10420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 11778 10561 gene locus_tag LOCUS_18330 11778 10561 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_18330 12172 13173 gene locus_tag LOCUS_18340 gene mutY 12172 13173 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117840.1 protein_id gnl|my_center|LOCUS_18340 13348 14373 gene locus_tag LOCUS_18350 13348 14373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 15193 14582 gene locus_tag LOCUS_18360 15193 14582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 16910 15447 gene locus_tag LOCUS_18370 16910 15447 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921673.1 protein_id gnl|my_center|LOCUS_18370 19528 17033 gene locus_tag LOCUS_18380 19528 17033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 21035 19734 gene locus_tag LOCUS_18390 21035 19734 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_18390 21423 21115 gene locus_tag LOCUS_18400 21423 21115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 21736 21999 gene locus_tag LOCUS_18410 21736 21999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 22148 22897 gene locus_tag LOCUS_18420 22148 22897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 23062 24831 gene locus_tag LOCUS_18430 23062 24831 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840152.1 protein_id gnl|my_center|LOCUS_18430 24967 25269 gene locus_tag LOCUS_18440 24967 25269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 25367 27124 gene locus_tag LOCUS_18450 25367 27124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 27207 28163 gene locus_tag LOCUS_18460 gene tauC 27207 28163 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704532.1 protein_id gnl|my_center|LOCUS_18460 28160 29062 gene locus_tag LOCUS_18470 28160 29062 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_18470 29059 29934 gene locus_tag LOCUS_18480 29059 29934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 30861 30712 gene locus_tag LOCUS_18490 30861 30712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 31437 33710 gene locus_tag LOCUS_18500 31437 33710 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120839.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence045 79 1074 gene locus_tag LOCUS_18510 gene tilS 79 1074 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615481.1 protein_id gnl|my_center|LOCUS_18510 4382 1575 gene locus_tag LOCUS_18520 4382 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921842.1 protein_id gnl|my_center|LOCUS_18520 5386 4631 gene locus_tag LOCUS_18530 5386 4631 CDS product DUF695 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836738.1 protein_id gnl|my_center|LOCUS_18530 5781 6956 gene locus_tag LOCUS_18540 gene lpxB 5781 6956 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921562.1 protein_id gnl|my_center|LOCUS_18540 8235 7138 gene locus_tag LOCUS_18550 8235 7138 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_18550 8911 14409 gene locus_tag LOCUS_18560 8911 14409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 15568 15257 gene locus_tag LOCUS_18570 15568 15257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 15452 15859 gene locus_tag LOCUS_18580 15452 15859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 16046 16465 gene locus_tag LOCUS_18590 16046 16465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 16471 16761 gene locus_tag LOCUS_18600 16471 16761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 17463 16831 gene locus_tag LOCUS_18610 17463 16831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 17993 17460 gene locus_tag LOCUS_18620 17993 17460 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250569.1 protein_id gnl|my_center|LOCUS_18620 18214 19338 gene locus_tag LOCUS_18630 18214 19338 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434952.1 protein_id gnl|my_center|LOCUS_18630 19340 21307 gene locus_tag LOCUS_18640 19340 21307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 21505 23448 gene locus_tag LOCUS_18650 21505 23448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 23544 24551 gene locus_tag LOCUS_18660 23544 24551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 28659 24691 gene locus_tag LOCUS_18670 28659 24691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334944.1 protein_id gnl|my_center|LOCUS_18670 29185 31335 gene locus_tag LOCUS_18680 29185 31335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 31442 32638 gene locus_tag LOCUS_18690 31442 32638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324693.1 protein_id gnl|my_center|LOCUS_18690 >Feature sequence046 <1 2930 gene locus_tag LOCUS_18700 <1 2930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146849598.1:PSD1 and planctomycete cytochrome C domain-containing protein 2953 4380 gene locus_tag LOCUS_18710 2953 4380 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120961.1 protein_id gnl|my_center|LOCUS_18710 5295 4855 gene locus_tag LOCUS_18720 5295 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 6827 5370 gene locus_tag LOCUS_18730 6827 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 7118 8422 gene locus_tag LOCUS_18740 7118 8422 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_18740 9576 8551 gene locus_tag LOCUS_18750 9576 8551 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615947.1 protein_id gnl|my_center|LOCUS_18750 10874 9855 gene locus_tag LOCUS_18760 10874 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 12287 11076 gene locus_tag LOCUS_18770 12287 11076 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_18770 13199 12444 gene locus_tag LOCUS_18780 13199 12444 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066512.1 protein_id gnl|my_center|LOCUS_18780 14347 13316 gene locus_tag LOCUS_18790 14347 13316 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_18790 15441 14533 gene locus_tag LOCUS_18800 15441 14533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 15991 17715 gene locus_tag LOCUS_18810 15991 17715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615466.1 protein_id gnl|my_center|LOCUS_18810 17776 19362 gene locus_tag LOCUS_18820 17776 19362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 19697 20629 gene locus_tag LOCUS_18830 19697 20629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 20962 21390 gene locus_tag LOCUS_18840 20962 21390 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 protein_id gnl|my_center|LOCUS_18840 21579 22451 gene locus_tag LOCUS_18850 21579 22451 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119041.1 protein_id gnl|my_center|LOCUS_18850 22744 23553 gene locus_tag LOCUS_18860 22744 23553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 23750 24094 gene locus_tag LOCUS_18870 23750 24094 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193399.1 protein_id gnl|my_center|LOCUS_18870 24164 26203 gene locus_tag LOCUS_18880 24164 26203 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667550.1 protein_id gnl|my_center|LOCUS_18880 26585 27211 gene locus_tag LOCUS_18890 26585 27211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 27491 27198 gene locus_tag LOCUS_18900 27491 27198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 27672 30536 gene locus_tag LOCUS_18910 27672 30536 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120107.1 protein_id gnl|my_center|LOCUS_18910 30608 32014 gene locus_tag LOCUS_18920 30608 32014 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_18920 32744 33607 gene locus_tag LOCUS_18930 32744 33607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence047 2803 1331 gene locus_tag LOCUS_18940 gene der 2803 1331 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330049.1 protein_id gnl|my_center|LOCUS_18940 3167 4084 gene locus_tag LOCUS_18950 gene hpnC 3167 4084 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061007.1 protein_id gnl|my_center|LOCUS_18950 4306 4974 gene locus_tag LOCUS_18960 4306 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 5476 5243 gene locus_tag LOCUS_18970 5476 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 7122 5473 gene locus_tag LOCUS_18980 7122 5473 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112533.1 protein_id gnl|my_center|LOCUS_18980 8410 7487 gene locus_tag LOCUS_18990 8410 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 10338 9034 gene locus_tag LOCUS_19000 10338 9034 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_19000 10722 11135 gene locus_tag LOCUS_19010 10722 11135 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902525.1 protein_id gnl|my_center|LOCUS_19010 11141 13366 gene locus_tag LOCUS_19020 11141 13366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 13582 14202 gene locus_tag LOCUS_19030 13582 14202 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405272.1 protein_id gnl|my_center|LOCUS_19030 14264 15766 gene locus_tag LOCUS_19040 14264 15766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 16841 16053 gene locus_tag LOCUS_19050 16841 16053 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333441.1 protein_id gnl|my_center|LOCUS_19050 17333 19117 gene locus_tag LOCUS_19060 17333 19117 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_19060 19173 20246 gene locus_tag LOCUS_19070 19173 20246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 20588 21262 gene locus_tag LOCUS_19080 20588 21262 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803728.1 protein_id gnl|my_center|LOCUS_19080 21334 25176 gene locus_tag LOCUS_19090 21334 25176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 25317 26618 gene locus_tag LOCUS_19100 25317 26618 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123538.1 protein_id gnl|my_center|LOCUS_19100 26848 27060 gene locus_tag LOCUS_19110 26848 27060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 27614 27057 gene locus_tag LOCUS_19120 27614 27057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 28036 28392 gene locus_tag LOCUS_19130 28036 28392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 28641 29843 gene locus_tag LOCUS_19140 28641 29843 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123514.1 protein_id gnl|my_center|LOCUS_19140 31229 29916 gene locus_tag LOCUS_19150 31229 29916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 31764 31387 gene locus_tag LOCUS_19160 31764 31387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 32242 31766 gene locus_tag LOCUS_19170 32242 31766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 32586 33443 gene locus_tag LOCUS_19180 32586 33443 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence048 493 1590 gene locus_tag LOCUS_19190 493 1590 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942690.1 protein_id gnl|my_center|LOCUS_19190 3162 1807 gene locus_tag LOCUS_19200 3162 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 3453 3277 gene locus_tag LOCUS_19210 3453 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 3859 5055 gene locus_tag LOCUS_19220 3859 5055 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119223.1 protein_id gnl|my_center|LOCUS_19220 9072 5170 gene locus_tag LOCUS_19230 9072 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 9714 11210 gene locus_tag LOCUS_19240 9714 11210 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_19240 11706 11389 gene locus_tag LOCUS_19250 11706 11389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 12338 12114 gene locus_tag LOCUS_19260 12338 12114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 14473 12611 gene locus_tag LOCUS_19270 gene glmS 14473 12611 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328387.1 protein_id gnl|my_center|LOCUS_19270 15742 14639 gene locus_tag LOCUS_19280 15742 14639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019249399.1 protein_id gnl|my_center|LOCUS_19280 17178 16021 gene locus_tag LOCUS_19290 17178 16021 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028897.1 protein_id gnl|my_center|LOCUS_19290 18373 17327 gene locus_tag LOCUS_19300 18373 17327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 19767 18721 gene locus_tag LOCUS_19310 gene corA 19767 18721 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_19310 21184 20321 gene locus_tag LOCUS_19320 21184 20321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 22257 21526 gene locus_tag LOCUS_19330 22257 21526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 22400 22251 gene locus_tag LOCUS_19340 22400 22251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 22789 23676 gene locus_tag LOCUS_19350 gene galU 22789 23676 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937189.1 protein_id gnl|my_center|LOCUS_19350 23940 24968 gene locus_tag LOCUS_19360 23940 24968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 25190 26593 gene locus_tag LOCUS_19370 25190 26593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 26735 27262 gene locus_tag LOCUS_19380 gene tsaE 26735 27262 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 protein_id gnl|my_center|LOCUS_19380 27495 28808 gene locus_tag LOCUS_19390 27495 28808 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_19390 30583 28979 gene locus_tag LOCUS_19400 30583 28979 CDS product DUF4340 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118285.1 protein_id gnl|my_center|LOCUS_19400 33389 30771 gene locus_tag LOCUS_19410 33389 30771 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921396.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence049 4456 3773 gene locus_tag LOCUS_19420 4456 3773 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803728.1 protein_id gnl|my_center|LOCUS_19420 4615 5580 gene locus_tag LOCUS_19430 4615 5580 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208809.1 protein_id gnl|my_center|LOCUS_19430 5665 6606 gene locus_tag LOCUS_19440 5665 6606 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086447.1 protein_id gnl|my_center|LOCUS_19440 6603 7649 gene locus_tag LOCUS_19450 6603 7649 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970710.1 protein_id gnl|my_center|LOCUS_19450 7792 9507 gene locus_tag LOCUS_19460 7792 9507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 9662 11230 gene locus_tag LOCUS_19470 9662 11230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 11260 12087 gene locus_tag LOCUS_19480 11260 12087 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878702.1 protein_id gnl|my_center|LOCUS_19480 12023 12250 gene locus_tag LOCUS_19490 12023 12250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 12240 14246 gene locus_tag LOCUS_19500 12240 14246 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228884.1 protein_id gnl|my_center|LOCUS_19500 14249 15616 gene locus_tag LOCUS_19510 14249 15616 CDS product dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309917.1 protein_id gnl|my_center|LOCUS_19510 17154 15745 gene locus_tag LOCUS_19520 17154 15745 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_19520 17900 17535 gene locus_tag LOCUS_19530 17900 17535 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391352.1 protein_id gnl|my_center|LOCUS_19530 18627 17950 gene locus_tag LOCUS_19540 18627 17950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 19376 19023 gene locus_tag LOCUS_19550 19376 19023 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140130.1 protein_id gnl|my_center|LOCUS_19550 19609 19373 gene locus_tag LOCUS_19560 19609 19373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 20193 19852 gene locus_tag LOCUS_19570 20193 19852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 21054 20752 gene locus_tag LOCUS_19580 21054 20752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 21669 21097 gene locus_tag LOCUS_19590 21669 21097 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_19590 23966 22482 gene locus_tag LOCUS_19600 23966 22482 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121030.1 protein_id gnl|my_center|LOCUS_19600 24577 24134 gene locus_tag LOCUS_19610 24577 24134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 25246 25533 gene locus_tag LOCUS_19620 25246 25533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 25808 26632 gene locus_tag LOCUS_19630 25808 26632 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121000.1 protein_id gnl|my_center|LOCUS_19630 26773 27024 gene locus_tag LOCUS_19640 26773 27024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 27420 28619 gene locus_tag LOCUS_19650 27420 28619 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667343.1 protein_id gnl|my_center|LOCUS_19650 32040 28708 gene locus_tag LOCUS_19660 32040 28708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 <33419 32157 gene locus_tag LOCUS_19670 <33419 32157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122381.1:DUF1501 domain-containing protein >Feature sequence050 291 1274 gene locus_tag LOCUS_19680 291 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1569 3896 gene locus_tag LOCUS_19690 1569 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 4315 3911 gene locus_tag LOCUS_19700 4315 3911 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911313.1 protein_id gnl|my_center|LOCUS_19700 4743 7205 gene locus_tag LOCUS_19710 4743 7205 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_19710 8023 7556 gene locus_tag LOCUS_19720 8023 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19720 8055 8588 gene locus_tag LOCUS_19730 8055 8588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 9488 9841 gene locus_tag LOCUS_19740 9488 9841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 9822 10343 gene locus_tag LOCUS_19750 9822 10343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 13153 10526 gene locus_tag LOCUS_19760 gene cphA 13153 10526 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928938.1 protein_id gnl|my_center|LOCUS_19760 16111 13481 gene locus_tag LOCUS_19770 gene cphA 16111 13481 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447960.1 protein_id gnl|my_center|LOCUS_19770 17043 17540 gene locus_tag LOCUS_19780 gene fae 17043 17540 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326305.1 protein_id gnl|my_center|LOCUS_19780 17821 18681 gene locus_tag LOCUS_19790 17821 18681 CDS product NADP-dependent methylenetetrahydromethanopterin/methylenetetrahydrofolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 protein_id gnl|my_center|LOCUS_19790 20201 18909 gene locus_tag LOCUS_19800 20201 18909 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123538.1 protein_id gnl|my_center|LOCUS_19800 20769 23882 gene locus_tag LOCUS_19810 20769 23882 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666716.1 protein_id gnl|my_center|LOCUS_19810 24096 23932 gene locus_tag LOCUS_19820 24096 23932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 25257 25898 gene locus_tag LOCUS_19830 25257 25898 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_19830 26142 26918 gene locus_tag LOCUS_19840 26142 26918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 28709 27372 gene locus_tag LOCUS_19850 28709 27372 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_19850 33193 28895 gene locus_tag LOCUS_19860 33193 28895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 >Feature sequence051 247 1497 gene locus_tag LOCUS_19870 247 1497 CDS product tagaturonate epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_19870 1905 3641 gene locus_tag LOCUS_19880 1905 3641 CDS product NADPH-dependent assimilatory sulfite reductase hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327402.1 protein_id gnl|my_center|LOCUS_19880 5107 3797 gene locus_tag LOCUS_19890 5107 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 5568 6617 gene locus_tag LOCUS_19900 gene gap 5568 6617 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143315.1 protein_id gnl|my_center|LOCUS_19900 6756 7379 gene locus_tag LOCUS_19910 6756 7379 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064390.1 protein_id gnl|my_center|LOCUS_19910 7640 8275 gene locus_tag LOCUS_19920 7640 8275 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_19920 8358 9035 gene locus_tag LOCUS_19930 gene rpe 8358 9035 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971904.1 protein_id gnl|my_center|LOCUS_19930 9032 9898 gene locus_tag LOCUS_19940 gene accD 9032 9898 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327662.1 protein_id gnl|my_center|LOCUS_19940 10087 10971 gene locus_tag LOCUS_19950 10087 10971 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327663.1 protein_id gnl|my_center|LOCUS_19950 10972 11586 gene locus_tag LOCUS_19960 gene hisH 10972 11586 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817212.1 protein_id gnl|my_center|LOCUS_19960 11819 12559 gene locus_tag LOCUS_19970 gene hisA 11819 12559 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327023.1 protein_id gnl|my_center|LOCUS_19970 13117 12671 gene locus_tag LOCUS_19980 13117 12671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 13358 14707 gene locus_tag LOCUS_19990 13358 14707 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_19990 14707 15618 gene locus_tag LOCUS_20000 14707 15618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 15822 16553 gene locus_tag LOCUS_20010 15822 16553 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157334022.1 protein_id gnl|my_center|LOCUS_20010 17133 16717 gene locus_tag LOCUS_20020 17133 16717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 18713 17796 gene locus_tag LOCUS_20030 18713 17796 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335393.1 protein_id gnl|my_center|LOCUS_20030 19880 18900 gene locus_tag LOCUS_20040 19880 18900 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324233.1 protein_id gnl|my_center|LOCUS_20040 21377 20055 gene locus_tag LOCUS_20050 21377 20055 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324232.1 protein_id gnl|my_center|LOCUS_20050 21803 22012 gene locus_tag LOCUS_20060 21803 22012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 22248 22009 gene locus_tag LOCUS_20070 22248 22009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 25289 22908 gene locus_tag LOCUS_20080 25289 22908 CDS product M66 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704913.1 protein_id gnl|my_center|LOCUS_20080 26456 25428 gene locus_tag LOCUS_20090 gene tdh 26456 25428 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074264.1 protein_id gnl|my_center|LOCUS_20090 26832 27431 gene locus_tag LOCUS_20100 26832 27431 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 protein_id gnl|my_center|LOCUS_20100 27865 29796 gene locus_tag LOCUS_20110 gene htpG 27865 29796 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460040.1 protein_id gnl|my_center|LOCUS_20110 32035 29933 gene locus_tag LOCUS_20120 gene uvrB 32035 29933 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329492.1 protein_id gnl|my_center|LOCUS_20120 33073 32168 gene locus_tag LOCUS_20130 gene lipA 33073 32168 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665013.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence052 468 298 gene locus_tag LOCUS_20140 468 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 1565 810 gene locus_tag LOCUS_20150 1565 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20150 2562 1717 gene locus_tag LOCUS_20160 2562 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20160 4066 2912 gene locus_tag LOCUS_20170 gene devC 4066 2912 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056491.1 protein_id gnl|my_center|LOCUS_20170 5229 4066 gene locus_tag LOCUS_20180 5229 4066 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141428.1 protein_id gnl|my_center|LOCUS_20180 5787 6242 gene locus_tag LOCUS_20190 5787 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 6550 9864 gene locus_tag LOCUS_20200 6550 9864 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_20200 9971 10447 gene locus_tag LOCUS_20210 9971 10447 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921290.1 protein_id gnl|my_center|LOCUS_20210 12306 10606 gene locus_tag LOCUS_20220 12306 10606 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332180.1 protein_id gnl|my_center|LOCUS_20220 14026 12440 gene locus_tag LOCUS_20230 gene malQ 14026 12440 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_20230 15950 14283 gene locus_tag LOCUS_20240 15950 14283 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_20240 17319 16102 gene locus_tag LOCUS_20250 17319 16102 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_20250 17649 17326 gene locus_tag LOCUS_20260 17649 17326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 17795 19246 gene locus_tag LOCUS_20270 17795 19246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 19367 20713 gene locus_tag LOCUS_20280 19367 20713 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796447.1 protein_id gnl|my_center|LOCUS_20280 20896 21723 gene locus_tag LOCUS_20290 20896 21723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 21893 23056 gene locus_tag LOCUS_20300 21893 23056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 23313 24302 gene locus_tag LOCUS_20310 23313 24302 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275150.1 protein_id gnl|my_center|LOCUS_20310 26263 24425 gene locus_tag LOCUS_20320 26263 24425 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189810.1 protein_id gnl|my_center|LOCUS_20320 27042 26620 gene locus_tag LOCUS_20330 27042 26620 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921681.1 protein_id gnl|my_center|LOCUS_20330 28536 27409 gene locus_tag LOCUS_20340 gene aroC 28536 27409 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_20340 28969 28718 gene locus_tag LOCUS_20350 28969 28718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 32480 28887 gene locus_tag LOCUS_20360 gene dnaE 32480 28887 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119187.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence053 471 1811 gene locus_tag LOCUS_20370 471 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2258 2061 gene locus_tag LOCUS_20380 2258 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 2698 2498 gene locus_tag LOCUS_20390 2698 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 6122 2724 gene locus_tag LOCUS_20400 6122 2724 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922491.1 protein_id gnl|my_center|LOCUS_20400 6442 6230 gene locus_tag LOCUS_20410 6442 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 6567 6890 gene locus_tag LOCUS_20420 6567 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 6899 7174 gene locus_tag LOCUS_20430 6899 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 7331 8239 gene locus_tag LOCUS_20440 gene thyX 7331 8239 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_20440 8799 8455 gene locus_tag LOCUS_20450 8799 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 9184 10125 gene locus_tag LOCUS_20460 gene sppA 9184 10125 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989751.1 protein_id gnl|my_center|LOCUS_20460 10213 11481 gene locus_tag LOCUS_20470 10213 11481 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921673.1 protein_id gnl|my_center|LOCUS_20470 11523 11855 gene locus_tag LOCUS_20480 11523 11855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 13215 11875 gene locus_tag LOCUS_20490 13215 11875 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_20490 15117 13426 gene locus_tag LOCUS_20500 15117 13426 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333284.1 protein_id gnl|my_center|LOCUS_20500 15464 15276 gene locus_tag LOCUS_20510 15464 15276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 15903 17066 gene locus_tag LOCUS_20520 gene citZ 15903 17066 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_20520 18766 17171 gene locus_tag LOCUS_20530 18766 17171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 19281 21227 gene locus_tag LOCUS_20540 gene acs 19281 21227 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140163.1 protein_id gnl|my_center|LOCUS_20540 21413 22714 gene locus_tag LOCUS_20550 21413 22714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 23553 22762 gene locus_tag LOCUS_20560 23553 22762 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957443.1 protein_id gnl|my_center|LOCUS_20560 24663 24001 gene locus_tag LOCUS_20570 24663 24001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 25406 25702 gene locus_tag LOCUS_20580 25406 25702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 26003 27931 gene locus_tag LOCUS_20590 26003 27931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 28366 28677 gene locus_tag LOCUS_20600 gene nirD 28366 28677 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327329.1 protein_id gnl|my_center|LOCUS_20600 29814 28708 gene locus_tag LOCUS_20610 29814 28708 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 protein_id gnl|my_center|LOCUS_20610 30408 29839 gene locus_tag LOCUS_20620 30408 29839 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_20620 32562 30514 gene locus_tag LOCUS_20630 32562 30514 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence054 132 1373 gene locus_tag LOCUS_20640 132 1373 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225440.1 protein_id gnl|my_center|LOCUS_20640 1860 2261 gene locus_tag LOCUS_20650 1860 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 2428 3402 gene locus_tag LOCUS_20660 2428 3402 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030183075.1 protein_id gnl|my_center|LOCUS_20660 3610 4872 gene locus_tag LOCUS_20670 3610 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 6073 4889 gene locus_tag LOCUS_20680 6073 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 6485 8197 gene locus_tag LOCUS_20690 6485 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 9332 8376 gene locus_tag LOCUS_20700 9332 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682355.1 protein_id gnl|my_center|LOCUS_20700 9745 10683 gene locus_tag LOCUS_20710 9745 10683 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122799.1 protein_id gnl|my_center|LOCUS_20710 12336 10882 gene locus_tag LOCUS_20720 12336 10882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 13624 12617 gene locus_tag LOCUS_20730 gene obgE 13624 12617 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_20730 14750 13680 gene locus_tag LOCUS_20740 14750 13680 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546785.1 protein_id gnl|my_center|LOCUS_20740 15085 16278 gene locus_tag LOCUS_20750 15085 16278 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176146113.1 protein_id gnl|my_center|LOCUS_20750 17307 16354 gene locus_tag LOCUS_20760 17307 16354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 17760 19448 gene locus_tag LOCUS_20770 gene groL 17760 19448 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615436.1 protein_id gnl|my_center|LOCUS_20770 19632 19922 gene locus_tag LOCUS_20780 gene groES 19632 19922 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330007.1 protein_id gnl|my_center|LOCUS_20780 20036 21652 gene locus_tag LOCUS_20790 gene groL 20036 21652 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330146.1 protein_id gnl|my_center|LOCUS_20790 21778 21930 gene locus_tag LOCUS_20800 21778 21930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20800 22377 23525 gene locus_tag LOCUS_20810 gene dnaJ 22377 23525 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122091.1 protein_id gnl|my_center|LOCUS_20810 23571 24119 gene locus_tag LOCUS_20820 gene grpE 23571 24119 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_20820 24362 24655 gene locus_tag LOCUS_20830 24362 24655 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143646.1 protein_id gnl|my_center|LOCUS_20830 24657 24875 gene locus_tag LOCUS_20840 24657 24875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 24990 26033 gene locus_tag LOCUS_20850 24990 26033 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_20850 26794 26015 gene locus_tag LOCUS_20860 26794 26015 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_20860 26993 28099 gene locus_tag LOCUS_20870 gene serC 26993 28099 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_20870 28273 29040 gene locus_tag LOCUS_20880 28273 29040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 29195 30004 gene locus_tag LOCUS_20890 29195 30004 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903881.1 protein_id gnl|my_center|LOCUS_20890 30858 32507 gene locus_tag LOCUS_20900 30858 32507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence055 4722 5231 gene locus_tag LOCUS_20910 gene rplM 4722 5231 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_20910 5362 5886 gene locus_tag LOCUS_20920 gene rpsI 5362 5886 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004624294.1 protein_id gnl|my_center|LOCUS_20920 6085 7479 gene locus_tag LOCUS_20930 gene mgtE 6085 7479 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118267.1 protein_id gnl|my_center|LOCUS_20930 7684 8598 gene locus_tag LOCUS_20940 7684 8598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 9679 8741 gene locus_tag LOCUS_20950 9679 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 13559 10185 gene locus_tag LOCUS_20960 13559 10185 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 protein_id gnl|my_center|LOCUS_20960 14054 17404 gene locus_tag LOCUS_20970 14054 17404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 17615 18637 gene locus_tag LOCUS_20980 17615 18637 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327113.1 protein_id gnl|my_center|LOCUS_20980 18888 19487 gene locus_tag LOCUS_20990 18888 19487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 19586 21508 gene locus_tag LOCUS_21000 19586 21508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 21808 23619 gene locus_tag LOCUS_21010 21808 23619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 23721 24455 gene locus_tag LOCUS_21020 23721 24455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 24601 26616 gene locus_tag LOCUS_21030 24601 26616 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921992.1 protein_id gnl|my_center|LOCUS_21030 26646 28046 gene locus_tag LOCUS_21040 26646 28046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384883.1 protein_id gnl|my_center|LOCUS_21040 28165 28536 gene locus_tag LOCUS_21050 gene rpsL 28165 28536 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670535.1 protein_id gnl|my_center|LOCUS_21050 28663 29136 gene locus_tag LOCUS_21060 gene rpsG 28663 29136 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326864.1 protein_id gnl|my_center|LOCUS_21060 30188 30000 gene locus_tag LOCUS_21070 30188 30000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 30371 30219 gene locus_tag LOCUS_21080 30371 30219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 30697 30365 gene locus_tag LOCUS_21090 30697 30365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21090 32078 30735 gene locus_tag LOCUS_21100 32078 30735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 <32700 32158 gene locus_tag LOCUS_21110 <32700 32158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173442613.1:PQQ-binding-like beta-propeller repeat protein >Feature sequence056 2182 3990 gene locus_tag LOCUS_21120 2182 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 4216 4713 gene locus_tag LOCUS_21130 4216 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 5907 4903 gene locus_tag LOCUS_21140 5907 4903 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064714.1 protein_id gnl|my_center|LOCUS_21140 7142 5907 gene locus_tag LOCUS_21150 7142 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 7607 7918 gene locus_tag LOCUS_21160 7607 7918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 8094 8522 gene locus_tag LOCUS_21170 8094 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 9479 8655 gene locus_tag LOCUS_21180 9479 8655 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875780.1 protein_id gnl|my_center|LOCUS_21180 11215 9779 gene locus_tag LOCUS_21190 11215 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 11815 12747 gene locus_tag LOCUS_21200 11815 12747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 13109 15499 gene locus_tag LOCUS_21210 13109 15499 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922871.1 protein_id gnl|my_center|LOCUS_21210 16939 15707 gene locus_tag LOCUS_21220 gene truD 16939 15707 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545670.1 protein_id gnl|my_center|LOCUS_21220 17085 17954 gene locus_tag LOCUS_21230 17085 17954 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117816.1 protein_id gnl|my_center|LOCUS_21230 20296 18053 gene locus_tag LOCUS_21240 20296 18053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 20295 20552 gene locus_tag LOCUS_21250 20295 20552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 21493 20495 gene locus_tag LOCUS_21260 21493 20495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 22023 22352 gene locus_tag LOCUS_21270 22023 22352 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336823.1 protein_id gnl|my_center|LOCUS_21270 22404 22718 gene locus_tag LOCUS_21280 22404 22718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 23288 24070 gene locus_tag LOCUS_21290 gene panB 23288 24070 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_21290 24461 24817 gene locus_tag LOCUS_21300 24461 24817 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338472.1 protein_id gnl|my_center|LOCUS_21300 25042 26796 gene locus_tag LOCUS_21310 25042 26796 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616258.1 protein_id gnl|my_center|LOCUS_21310 27187 28491 gene locus_tag LOCUS_21320 gene pepP 27187 28491 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703431.1 protein_id gnl|my_center|LOCUS_21320 28706 29377 gene locus_tag LOCUS_21330 28706 29377 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777093.1 protein_id gnl|my_center|LOCUS_21330 30012 30677 gene locus_tag LOCUS_21340 gene plsY 30012 30677 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_21340 31114 30884 gene locus_tag LOCUS_21350 31114 30884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 31581 32639 gene locus_tag LOCUS_21360 31581 32639 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922921.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence057 652 377 gene locus_tag LOCUS_21370 652 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 808 4674 gene locus_tag LOCUS_21380 808 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 5280 4924 gene locus_tag LOCUS_21390 5280 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 6908 5535 gene locus_tag LOCUS_21400 6908 5535 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921346.1 protein_id gnl|my_center|LOCUS_21400 7910 7299 gene locus_tag LOCUS_21410 gene cysC 7910 7299 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468764.1 protein_id gnl|my_center|LOCUS_21410 8192 9901 gene locus_tag LOCUS_21420 8192 9901 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922444.1 protein_id gnl|my_center|LOCUS_21420 10298 10371 gene locus_tag LOCUS_t00180 10298 10371 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 10727 11191 gene locus_tag LOCUS_21430 10727 11191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 11773 12909 gene locus_tag LOCUS_21440 gene dusB 11773 12909 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_21440 13208 14518 gene locus_tag LOCUS_21450 13208 14518 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774548.1 protein_id gnl|my_center|LOCUS_21450 15372 14620 gene locus_tag LOCUS_21460 gene flgG 15372 14620 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_21460 15695 15934 gene locus_tag LOCUS_21470 15695 15934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 16075 16773 gene locus_tag LOCUS_21480 gene flgF 16075 16773 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869895.1 protein_id gnl|my_center|LOCUS_21480 16781 17569 gene locus_tag LOCUS_21490 gene flgG 16781 17569 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_21490 17706 18704 gene locus_tag LOCUS_21500 17706 18704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 18717 19343 gene locus_tag LOCUS_21510 18717 19343 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545249.1 protein_id gnl|my_center|LOCUS_21510 19486 20703 gene locus_tag LOCUS_21520 19486 20703 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_21520 21000 21368 gene locus_tag LOCUS_21530 21000 21368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 21662 22201 gene locus_tag LOCUS_21540 21662 22201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 22189 24177 gene locus_tag LOCUS_21550 gene flgK 22189 24177 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203463.1 protein_id gnl|my_center|LOCUS_21550 24258 25715 gene locus_tag LOCUS_21560 24258 25715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 26968 25727 gene locus_tag LOCUS_21570 26968 25727 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055994.1 protein_id gnl|my_center|LOCUS_21570 29049 27463 gene locus_tag LOCUS_21580 29049 27463 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326639.1 protein_id gnl|my_center|LOCUS_21580 30485 29172 gene locus_tag LOCUS_21590 30485 29172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 31687 30608 gene locus_tag LOCUS_21600 31687 30608 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615834.1 protein_id gnl|my_center|LOCUS_21600 <32634 31693 gene locus_tag LOCUS_21610 <32634 31693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929319.1:tetratricopeptide repeat protein >Feature sequence058 3909 907 gene locus_tag LOCUS_21620 3909 907 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922518.1 protein_id gnl|my_center|LOCUS_21620 5879 4035 gene locus_tag LOCUS_21630 5879 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 7690 6074 gene locus_tag LOCUS_21640 7690 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 8868 7687 gene locus_tag LOCUS_21650 8868 7687 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_21650 9341 8958 gene locus_tag LOCUS_21660 9341 8958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 11142 9427 gene locus_tag LOCUS_21670 11142 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 12028 11135 gene locus_tag LOCUS_21680 12028 11135 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003105.1 protein_id gnl|my_center|LOCUS_21680 12436 12038 gene locus_tag LOCUS_21690 12436 12038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 12967 13941 gene locus_tag LOCUS_21700 12967 13941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 15089 13998 gene locus_tag LOCUS_21710 15089 13998 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766215.1 protein_id gnl|my_center|LOCUS_21710 15593 15165 gene locus_tag LOCUS_21720 15593 15165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 16487 15714 gene locus_tag LOCUS_21730 16487 15714 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117867.1 protein_id gnl|my_center|LOCUS_21730 16863 16552 gene locus_tag LOCUS_21740 16863 16552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 17033 16848 gene locus_tag LOCUS_21750 17033 16848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 18525 17062 gene locus_tag LOCUS_21760 18525 17062 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122652.1 protein_id gnl|my_center|LOCUS_21760 19253 18744 gene locus_tag LOCUS_21770 19253 18744 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227724.1 protein_id gnl|my_center|LOCUS_21770 22961 19272 gene locus_tag LOCUS_21780 22961 19272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037251825.1 protein_id gnl|my_center|LOCUS_21780 24413 23214 gene locus_tag LOCUS_21790 24413 23214 CDS product BtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117868.1 protein_id gnl|my_center|LOCUS_21790 25075 25710 gene locus_tag LOCUS_21800 25075 25710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 25789 25932 gene locus_tag LOCUS_21810 25789 25932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 26323 27486 gene locus_tag LOCUS_21820 26323 27486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 32194 27695 gene locus_tag LOCUS_21830 32194 27695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence059 2126 915 gene locus_tag LOCUS_21840 2126 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 5104 2660 gene locus_tag LOCUS_21850 5104 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 5306 5578 gene locus_tag LOCUS_21860 5306 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 5656 6282 gene locus_tag LOCUS_21870 5656 6282 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326966.1 protein_id gnl|my_center|LOCUS_21870 7014 7757 gene locus_tag LOCUS_21880 7014 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 9073 7904 gene locus_tag LOCUS_21890 9073 7904 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118352.1 protein_id gnl|my_center|LOCUS_21890 9278 10141 gene locus_tag LOCUS_21900 9278 10141 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922163.1 protein_id gnl|my_center|LOCUS_21900 10916 10278 gene locus_tag LOCUS_21910 10916 10278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 11983 11042 gene locus_tag LOCUS_21920 gene ispE 11983 11042 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722719.1 protein_id gnl|my_center|LOCUS_21920 12828 15626 gene locus_tag LOCUS_21930 gene gyrA 12828 15626 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922184.1 protein_id gnl|my_center|LOCUS_21930 18068 15765 gene locus_tag LOCUS_21940 gene recQ 18068 15765 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921919.1 protein_id gnl|my_center|LOCUS_21940 19276 18233 gene locus_tag LOCUS_21950 19276 18233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 19758 22178 gene locus_tag LOCUS_21960 19758 22178 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816832.1 protein_id gnl|my_center|LOCUS_21960 22241 23641 gene locus_tag LOCUS_21970 22241 23641 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_21970 24028 30225 gene locus_tag LOCUS_21980 24028 30225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 30453 31547 gene locus_tag LOCUS_21990 gene coxFIC1 30453 31547 CDS product Dot/Icm type IV secretion system effector CoxFIC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769896.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence060 312 875 gene locus_tag LOCUS_22000 312 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 879 1367 gene locus_tag LOCUS_22010 879 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 1399 3189 gene locus_tag LOCUS_22020 1399 3189 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921899.1 protein_id gnl|my_center|LOCUS_22020 4606 3377 gene locus_tag LOCUS_22030 4606 3377 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923038.1 protein_id gnl|my_center|LOCUS_22030 4957 5625 gene locus_tag LOCUS_22040 4957 5625 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256153.1 protein_id gnl|my_center|LOCUS_22040 6168 5599 gene locus_tag LOCUS_22050 6168 5599 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722447.1 protein_id gnl|my_center|LOCUS_22050 7783 6458 gene locus_tag LOCUS_22060 7783 6458 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669743.1 protein_id gnl|my_center|LOCUS_22060 9031 7952 gene locus_tag LOCUS_22070 gene dusB 9031 7952 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_22070 10538 9114 gene locus_tag LOCUS_22080 10538 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 11590 10709 gene locus_tag LOCUS_22090 11590 10709 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332819.1 protein_id gnl|my_center|LOCUS_22090 12296 11727 gene locus_tag LOCUS_22100 12296 11727 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143802.1 protein_id gnl|my_center|LOCUS_22100 13523 12390 gene locus_tag LOCUS_22110 13523 12390 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836210.1 protein_id gnl|my_center|LOCUS_22110 15993 13780 gene locus_tag LOCUS_22120 gene feoB 15993 13780 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939841.1 protein_id gnl|my_center|LOCUS_22120 16383 16156 gene locus_tag LOCUS_22130 16383 16156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 16607 16380 gene locus_tag LOCUS_22140 16607 16380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 16797 17789 gene locus_tag LOCUS_22150 16797 17789 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_22150 18207 18986 gene locus_tag LOCUS_22160 18207 18986 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122726.1 protein_id gnl|my_center|LOCUS_22160 19366 19127 gene locus_tag LOCUS_22170 19366 19127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 21247 19415 gene locus_tag LOCUS_22180 21247 19415 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143571.1 protein_id gnl|my_center|LOCUS_22180 21469 21663 gene locus_tag LOCUS_22190 21469 21663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 21697 22107 gene locus_tag LOCUS_22200 21697 22107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 22211 22900 gene locus_tag LOCUS_22210 22211 22900 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327679.1 protein_id gnl|my_center|LOCUS_22210 23268 25226 gene locus_tag LOCUS_22220 23268 25226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 25334 26911 gene locus_tag LOCUS_22230 25334 26911 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088384.1 protein_id gnl|my_center|LOCUS_22230 27773 26847 gene locus_tag LOCUS_22240 gene rbsK 27773 26847 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113483.1 protein_id gnl|my_center|LOCUS_22240 29199 28168 gene locus_tag LOCUS_22250 29199 28168 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525324.1 protein_id gnl|my_center|LOCUS_22250 30450 29440 gene locus_tag LOCUS_22260 30450 29440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 31131 31520 gene locus_tag LOCUS_22270 31131 31520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 >Feature sequence061 453 1307 gene locus_tag LOCUS_22280 453 1307 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427752.1 protein_id gnl|my_center|LOCUS_22280 1427 2194 gene locus_tag LOCUS_22290 1427 2194 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325374.1 protein_id gnl|my_center|LOCUS_22290 2191 3543 gene locus_tag LOCUS_22300 2191 3543 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123736.1 protein_id gnl|my_center|LOCUS_22300 3732 5159 gene locus_tag LOCUS_22310 3732 5159 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123735.1 protein_id gnl|my_center|LOCUS_22310 5309 6886 gene locus_tag LOCUS_22320 gene phoD 5309 6886 CDS product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 protein_id gnl|my_center|LOCUS_22320 7269 7024 gene locus_tag LOCUS_22330 7269 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 7262 7441 gene locus_tag LOCUS_22340 7262 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 7493 8170 gene locus_tag LOCUS_22350 7493 8170 CDS product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921987.1 protein_id gnl|my_center|LOCUS_22350 9118 8204 gene locus_tag LOCUS_22360 9118 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 11183 9432 gene locus_tag LOCUS_22370 gene serA 11183 9432 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326392.1 protein_id gnl|my_center|LOCUS_22370 11444 13027 gene locus_tag LOCUS_22380 11444 13027 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922192.1 protein_id gnl|my_center|LOCUS_22380 13686 13444 gene locus_tag LOCUS_22390 13686 13444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 15903 13720 gene locus_tag LOCUS_22400 15903 13720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 16506 15940 gene locus_tag LOCUS_22410 16506 15940 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105333325.1 protein_id gnl|my_center|LOCUS_22410 18013 16706 gene locus_tag LOCUS_22420 18013 16706 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_22420 19692 18094 gene locus_tag LOCUS_22430 19692 18094 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123879.1 protein_id gnl|my_center|LOCUS_22430 20424 22187 gene locus_tag LOCUS_22440 20424 22187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 22292 23596 gene locus_tag LOCUS_22450 22292 23596 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_22450 24931 23771 gene locus_tag LOCUS_22460 24931 23771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 25313 25537 gene locus_tag LOCUS_22470 25313 25537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 26211 27302 gene locus_tag LOCUS_22480 26211 27302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 27534 28802 gene locus_tag LOCUS_22490 27534 28802 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944494.1 protein_id gnl|my_center|LOCUS_22490 30067 28943 gene locus_tag LOCUS_22500 30067 28943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 30490 30996 gene locus_tag LOCUS_22510 30490 30996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence062 1681 44 gene locus_tag LOCUS_22520 1681 44 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123879.1 protein_id gnl|my_center|LOCUS_22520 2201 2947 gene locus_tag LOCUS_22530 2201 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 3086 4048 gene locus_tag LOCUS_22540 3086 4048 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143461.1 protein_id gnl|my_center|LOCUS_22540 4054 5271 gene locus_tag LOCUS_22550 4054 5271 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143462.1 protein_id gnl|my_center|LOCUS_22550 6693 6442 gene locus_tag LOCUS_22560 6693 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 6574 7872 gene locus_tag LOCUS_22570 6574 7872 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922315.1 protein_id gnl|my_center|LOCUS_22570 8024 9505 gene locus_tag LOCUS_22580 8024 9505 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039027.1 protein_id gnl|my_center|LOCUS_22580 9765 10874 gene locus_tag LOCUS_22590 gene thrC 9765 10874 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392819.1 protein_id gnl|my_center|LOCUS_22590 13350 11059 gene locus_tag LOCUS_22600 13350 11059 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037253001.1 protein_id gnl|my_center|LOCUS_22600 14408 13506 gene locus_tag LOCUS_22610 14408 13506 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921669.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22610 16119 15070 gene locus_tag LOCUS_22620 16119 15070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 17441 16245 gene locus_tag LOCUS_22630 17441 16245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 18675 17527 gene locus_tag LOCUS_22640 18675 17527 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_22640 20315 18867 gene locus_tag LOCUS_22650 20315 18867 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038479.1 protein_id gnl|my_center|LOCUS_22650 21221 20523 gene locus_tag LOCUS_22660 21221 20523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 22935 21451 gene locus_tag LOCUS_22670 22935 21451 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_22670 24255 22984 gene locus_tag LOCUS_22680 24255 22984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 25773 24427 gene locus_tag LOCUS_22690 25773 24427 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_22690 27052 25922 gene locus_tag LOCUS_22700 27052 25922 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_22700 28358 27207 gene locus_tag LOCUS_22710 28358 27207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 29731 28397 gene locus_tag LOCUS_22720 29731 28397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence063 190 1068 gene locus_tag LOCUS_22730 190 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 1636 1169 gene locus_tag LOCUS_22740 gene ndk 1636 1169 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123449.1 protein_id gnl|my_center|LOCUS_22740 2928 1801 gene locus_tag LOCUS_22750 gene carA 2928 1801 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921837.1 protein_id gnl|my_center|LOCUS_22750 3524 3102 gene locus_tag LOCUS_22760 3524 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 4375 4974 gene locus_tag LOCUS_22770 4375 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 5086 6495 gene locus_tag LOCUS_22780 5086 6495 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118487.1 protein_id gnl|my_center|LOCUS_22780 6492 8108 gene locus_tag LOCUS_22790 gene pabB 6492 8108 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393598.1 protein_id gnl|my_center|LOCUS_22790 8128 8787 gene locus_tag LOCUS_22800 8128 8787 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_22800 9141 10085 gene locus_tag LOCUS_22810 9141 10085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 10253 11992 gene locus_tag LOCUS_22820 10253 11992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 12129 12872 gene locus_tag LOCUS_22830 12129 12872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 13102 13947 gene locus_tag LOCUS_22840 13102 13947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 14185 14517 gene locus_tag LOCUS_22850 14185 14517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 15171 16634 gene locus_tag LOCUS_22860 15171 16634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 16621 17091 gene locus_tag LOCUS_22870 16621 17091 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_22870 17084 18748 gene locus_tag LOCUS_22880 17084 18748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 19368 19051 gene locus_tag LOCUS_22890 19368 19051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 19295 20239 gene locus_tag LOCUS_22900 19295 20239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 20490 21860 gene locus_tag LOCUS_22910 20490 21860 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_22910 22587 22129 gene locus_tag LOCUS_22920 22587 22129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 23134 22499 gene locus_tag LOCUS_22930 23134 22499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 24955 23222 gene locus_tag LOCUS_22940 24955 23222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 25682 25182 gene locus_tag LOCUS_22950 25682 25182 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034855332.1 protein_id gnl|my_center|LOCUS_22950 26323 25790 gene locus_tag LOCUS_22960 26323 25790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 26772 26569 gene locus_tag LOCUS_22970 26772 26569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 26995 28932 gene locus_tag LOCUS_22980 26995 28932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence064 132 293 gene locus_tag LOCUS_22990 132 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 763 1812 gene locus_tag LOCUS_23000 763 1812 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246281.1 protein_id gnl|my_center|LOCUS_23000 1999 5364 gene locus_tag LOCUS_23010 1999 5364 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972354.1 protein_id gnl|my_center|LOCUS_23010 5593 9948 gene locus_tag LOCUS_23020 5593 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 9993 10229 gene locus_tag LOCUS_23030 9993 10229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 10657 11910 gene locus_tag LOCUS_23040 10657 11910 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123538.1 protein_id gnl|my_center|LOCUS_23040 12542 12129 gene locus_tag LOCUS_23050 12542 12129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 12571 13938 gene locus_tag LOCUS_23060 gene nusA 12571 13938 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120487.1 protein_id gnl|my_center|LOCUS_23060 14230 17040 gene locus_tag LOCUS_23070 14230 17040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 17040 17240 gene locus_tag LOCUS_23080 17040 17240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 17212 17724 gene locus_tag LOCUS_23090 17212 17724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 17739 18680 gene locus_tag LOCUS_23100 17739 18680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 18794 21094 gene locus_tag LOCUS_23110 18794 21094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 21180 21935 gene locus_tag LOCUS_23120 21180 21935 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_23120 22154 23236 gene locus_tag LOCUS_23130 gene ruvB 22154 23236 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331968.1 protein_id gnl|my_center|LOCUS_23130 24248 23532 gene locus_tag LOCUS_23140 24248 23532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 25102 25175 gene locus_tag LOCUS_t00190 25102 25175 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 25289 26419 gene locus_tag LOCUS_23150 25289 26419 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922445.1 protein_id gnl|my_center|LOCUS_23150 26835 28274 gene locus_tag LOCUS_23160 26835 28274 CDS product IS66-like element ISRhru2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389933.1 protein_id gnl|my_center|LOCUS_23160 >Feature sequence065 107 1312 gene locus_tag LOCUS_23170 107 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 1258 1518 gene locus_tag LOCUS_23180 1258 1518 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_23180 1583 2725 gene locus_tag LOCUS_23190 gene hypD 1583 2725 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893645.1 protein_id gnl|my_center|LOCUS_23190 2908 3972 gene locus_tag LOCUS_23200 gene hypE 2908 3972 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077175158.1 protein_id gnl|my_center|LOCUS_23200 4173 4673 gene locus_tag LOCUS_23210 4173 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 7169 4734 gene locus_tag LOCUS_23220 gene ppsA 7169 4734 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_23220 8491 7514 gene locus_tag LOCUS_23230 8491 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 10124 11788 gene locus_tag LOCUS_23240 10124 11788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 11931 12641 gene locus_tag LOCUS_23250 11931 12641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 13357 15858 gene locus_tag LOCUS_23260 13357 15858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 15855 17309 gene locus_tag LOCUS_23270 15855 17309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 18252 17329 gene locus_tag LOCUS_23280 18252 17329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 18402 19250 gene locus_tag LOCUS_23290 18402 19250 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_23290 19392 19802 gene locus_tag LOCUS_23300 19392 19802 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330765.1 protein_id gnl|my_center|LOCUS_23300 20084 21337 gene locus_tag LOCUS_23310 20084 21337 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_23310 21613 22896 gene locus_tag LOCUS_23320 21613 22896 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_23320 23950 22946 gene locus_tag LOCUS_23330 23950 22946 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041466227.1 protein_id gnl|my_center|LOCUS_23330 25336 24470 gene locus_tag LOCUS_23340 25336 24470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 26026 25406 gene locus_tag LOCUS_23350 26026 25406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 27292 28566 gene locus_tag LOCUS_23360 27292 28566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 >Feature sequence066 3 440 gene locus_tag LOCUS_23370 3 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 3739 578 gene locus_tag LOCUS_23380 3739 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 5161 3905 gene locus_tag LOCUS_23390 5161 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 5915 5583 gene locus_tag LOCUS_23400 5915 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 6296 7240 gene locus_tag LOCUS_23410 6296 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 7348 8304 gene locus_tag LOCUS_23420 7348 8304 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033982.1 protein_id gnl|my_center|LOCUS_23420 8388 9260 gene locus_tag LOCUS_23430 8388 9260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 9296 10414 gene locus_tag LOCUS_23440 9296 10414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 10423 12054 gene locus_tag LOCUS_23450 10423 12054 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921646.1 protein_id gnl|my_center|LOCUS_23450 12496 12158 gene locus_tag LOCUS_23460 12496 12158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 13696 12704 gene locus_tag LOCUS_23470 13696 12704 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119121.1 protein_id gnl|my_center|LOCUS_23470 13948 14658 gene locus_tag LOCUS_23480 13948 14658 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118407.1 protein_id gnl|my_center|LOCUS_23480 15149 14847 gene locus_tag LOCUS_23490 15149 14847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 15683 16522 gene locus_tag LOCUS_23500 15683 16522 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546285.1 protein_id gnl|my_center|LOCUS_23500 16749 17708 gene locus_tag LOCUS_23510 16749 17708 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932485.1 protein_id gnl|my_center|LOCUS_23510 17771 18736 gene locus_tag LOCUS_23520 17771 18736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 22055 18786 gene locus_tag LOCUS_23530 gene carB 22055 18786 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123580.1 protein_id gnl|my_center|LOCUS_23530 25082 22341 gene locus_tag LOCUS_23540 25082 22341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 26531 25230 gene locus_tag LOCUS_23550 26531 25230 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669743.1 protein_id gnl|my_center|LOCUS_23550 28170 26767 gene locus_tag LOCUS_23560 28170 26767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence067 3538 2090 gene locus_tag LOCUS_23570 3538 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 4448 3765 gene locus_tag LOCUS_23580 4448 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326821.1 protein_id gnl|my_center|LOCUS_23580 4608 4823 gene locus_tag LOCUS_23590 4608 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 4932 6509 gene locus_tag LOCUS_23600 4932 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 7086 8441 gene locus_tag LOCUS_23610 gene hflX 7086 8441 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121200.1 protein_id gnl|my_center|LOCUS_23610 8590 10284 gene locus_tag LOCUS_23620 8590 10284 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_23620 10658 11773 gene locus_tag LOCUS_23630 10658 11773 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_23630 11847 13547 gene locus_tag LOCUS_23640 11847 13547 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_23640 13955 15241 gene locus_tag LOCUS_23650 13955 15241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 15519 15710 gene locus_tag LOCUS_23660 15519 15710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 15707 15892 gene locus_tag LOCUS_23670 15707 15892 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061317.1 protein_id gnl|my_center|LOCUS_23670 16028 16981 gene locus_tag LOCUS_23680 16028 16981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 17048 18349 gene locus_tag LOCUS_23690 17048 18349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 18352 19470 gene locus_tag LOCUS_23700 18352 19470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 19467 20861 gene locus_tag LOCUS_23710 19467 20861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 20858 22681 gene locus_tag LOCUS_23720 20858 22681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 23159 28318 gene locus_tag LOCUS_23730 23159 28318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence068 3085 401 gene locus_tag LOCUS_23740 3085 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 4390 3365 gene locus_tag LOCUS_23750 4390 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 7347 4705 gene locus_tag LOCUS_23760 7347 4705 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123442.1 protein_id gnl|my_center|LOCUS_23760 8388 7762 gene locus_tag LOCUS_23770 8388 7762 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121990.1 protein_id gnl|my_center|LOCUS_23770 8965 8396 gene locus_tag LOCUS_23780 8965 8396 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121238.1 protein_id gnl|my_center|LOCUS_23780 9296 9030 gene locus_tag LOCUS_23790 9296 9030 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326729.1 protein_id gnl|my_center|LOCUS_23790 10013 9420 gene locus_tag LOCUS_23800 gene gmk 10013 9420 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326728.1 protein_id gnl|my_center|LOCUS_23800 10901 10020 gene locus_tag LOCUS_23810 10901 10020 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615387.1 protein_id gnl|my_center|LOCUS_23810 11612 11022 gene locus_tag LOCUS_23820 11612 11022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 12460 11687 gene locus_tag LOCUS_23830 gene tpiA 12460 11687 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121241.1 protein_id gnl|my_center|LOCUS_23830 13760 12606 gene locus_tag LOCUS_23840 gene pheA 13760 12606 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122147.1 protein_id gnl|my_center|LOCUS_23840 14262 16163 gene locus_tag LOCUS_23850 gene dnaK 14262 16163 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326035.1 protein_id gnl|my_center|LOCUS_23850 16529 16903 gene locus_tag LOCUS_23860 16529 16903 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146729243.1 protein_id gnl|my_center|LOCUS_23860 17030 19642 gene locus_tag LOCUS_23870 gene clpB 17030 19642 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922205.1 protein_id gnl|my_center|LOCUS_23870 20196 20639 gene locus_tag LOCUS_23880 20196 20639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23880 21802 21395 gene locus_tag LOCUS_23890 21802 21395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 22494 21799 gene locus_tag LOCUS_23900 22494 21799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 23052 24470 gene locus_tag LOCUS_23910 23052 24470 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123577.1 protein_id gnl|my_center|LOCUS_23910 24470 25345 gene locus_tag LOCUS_23920 24470 25345 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204774.1 protein_id gnl|my_center|LOCUS_23920 25553 26317 gene locus_tag LOCUS_23930 gene larB 25553 26317 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335257.1 protein_id gnl|my_center|LOCUS_23930 26883 26272 gene locus_tag LOCUS_23940 26883 26272 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence069 1454 45 gene locus_tag LOCUS_23950 1454 45 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_23950 1680 4004 gene locus_tag LOCUS_23960 1680 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 4145 6652 gene locus_tag LOCUS_23970 4145 6652 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_23970 8368 6695 gene locus_tag LOCUS_23980 8368 6695 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_23980 8821 8690 gene locus_tag LOCUS_23990 8821 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 9283 8822 gene locus_tag LOCUS_24000 9283 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 10719 9295 gene locus_tag LOCUS_24010 10719 9295 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_24010 13857 10747 gene locus_tag LOCUS_24020 13857 10747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 14443 14240 gene locus_tag LOCUS_24030 14443 14240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 15807 14440 gene locus_tag LOCUS_24040 15807 14440 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_24040 18216 15820 gene locus_tag LOCUS_24050 18216 15820 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921574.1 protein_id gnl|my_center|LOCUS_24050 18426 19514 gene locus_tag LOCUS_24060 18426 19514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 20095 20280 gene locus_tag LOCUS_24070 20095 20280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 21786 20353 gene locus_tag LOCUS_24080 21786 20353 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_24080 24824 21795 gene locus_tag LOCUS_24090 24824 21795 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922491.1 protein_id gnl|my_center|LOCUS_24090 26156 24897 gene locus_tag LOCUS_24100 26156 24897 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048639.1 protein_id gnl|my_center|LOCUS_24100 26523 26131 gene locus_tag LOCUS_24110 26523 26131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 27909 26899 gene locus_tag LOCUS_24120 27909 26899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence070 <1 723 gene locus_tag LOCUS_24130 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_102017617.1:DUF1559 domain-containing protein 811 1290 gene locus_tag LOCUS_24140 811 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 3529 1313 gene locus_tag LOCUS_24150 3529 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 5211 3883 gene locus_tag LOCUS_24160 5211 3883 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152045320.1 protein_id gnl|my_center|LOCUS_24160 5719 6861 gene locus_tag LOCUS_24170 5719 6861 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393485.1 protein_id gnl|my_center|LOCUS_24170 8292 6997 gene locus_tag LOCUS_24180 8292 6997 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921586.1 protein_id gnl|my_center|LOCUS_24180 8688 9200 gene locus_tag LOCUS_24190 8688 9200 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328025.1 protein_id gnl|my_center|LOCUS_24190 9261 9881 gene locus_tag LOCUS_24200 gene trmB 9261 9881 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334207.1 protein_id gnl|my_center|LOCUS_24200 10659 10027 gene locus_tag LOCUS_24210 10659 10027 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812379.1 protein_id gnl|my_center|LOCUS_24210 11554 10718 gene locus_tag LOCUS_24220 11554 10718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 11646 11900 gene locus_tag LOCUS_24230 11646 11900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 12606 12040 gene locus_tag LOCUS_24240 12606 12040 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392363.1 protein_id gnl|my_center|LOCUS_24240 12989 14125 gene locus_tag LOCUS_24250 12989 14125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 14235 15155 gene locus_tag LOCUS_24260 14235 15155 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919889.1 protein_id gnl|my_center|LOCUS_24260 16684 15308 gene locus_tag LOCUS_24270 16684 15308 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_24270 18726 17155 gene locus_tag LOCUS_24280 18726 17155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120360.1 protein_id gnl|my_center|LOCUS_24280 18981 20105 gene locus_tag LOCUS_24290 gene rodA 18981 20105 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888916.1 protein_id gnl|my_center|LOCUS_24290 21232 20219 gene locus_tag LOCUS_24300 21232 20219 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_24300 22119 21379 gene locus_tag LOCUS_24310 22119 21379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 22661 22116 gene locus_tag LOCUS_24320 22661 22116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 24190 23075 gene locus_tag LOCUS_24330 24190 23075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 24428 25372 gene locus_tag LOCUS_24340 gene ftsY 24428 25372 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331084.1 protein_id gnl|my_center|LOCUS_24340 26443 25532 gene locus_tag LOCUS_24350 26443 25532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 27666 26692 gene locus_tag LOCUS_24360 27666 26692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 >Feature sequence071 1991 90 gene locus_tag LOCUS_24370 gene speA 1991 90 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480160.1 protein_id gnl|my_center|LOCUS_24370 2253 3524 gene locus_tag LOCUS_24380 2253 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 3772 4464 gene locus_tag LOCUS_24390 3772 4464 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 protein_id gnl|my_center|LOCUS_24390 4612 5877 gene locus_tag LOCUS_24400 4612 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 6012 7541 gene locus_tag LOCUS_24410 6012 7541 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941825.1 protein_id gnl|my_center|LOCUS_24410 7843 9096 gene locus_tag LOCUS_24420 7843 9096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 9292 10560 gene locus_tag LOCUS_24430 9292 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 10848 11666 gene locus_tag LOCUS_24440 10848 11666 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315679.1 protein_id gnl|my_center|LOCUS_24440 12241 12948 gene locus_tag LOCUS_24450 12241 12948 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943678.1 protein_id gnl|my_center|LOCUS_24450 12963 13214 gene locus_tag LOCUS_24460 12963 13214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 13425 14357 gene locus_tag LOCUS_24470 13425 14357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 14361 15125 gene locus_tag LOCUS_24480 14361 15125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 15399 16169 gene locus_tag LOCUS_24490 15399 16169 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326458.1 protein_id gnl|my_center|LOCUS_24490 16397 17173 gene locus_tag LOCUS_24500 16397 17173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 17177 18073 gene locus_tag LOCUS_24510 17177 18073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 19743 18184 gene locus_tag LOCUS_24520 19743 18184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 22050 19951 gene locus_tag LOCUS_24530 22050 19951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 22695 22324 gene locus_tag LOCUS_24540 22695 22324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 23994 22924 gene locus_tag LOCUS_24550 23994 22924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 24557 25255 gene locus_tag LOCUS_24560 24557 25255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 25236 26552 gene locus_tag LOCUS_24570 gene fliI 25236 26552 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_24570 >Feature sequence072 749 291 gene locus_tag LOCUS_24580 749 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 1856 2254 gene locus_tag LOCUS_24590 1856 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 2404 5172 gene locus_tag LOCUS_24600 2404 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 5407 5949 gene locus_tag LOCUS_24610 5407 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 6031 7341 gene locus_tag LOCUS_24620 6031 7341 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921859.1 protein_id gnl|my_center|LOCUS_24620 7442 8491 gene locus_tag LOCUS_24630 7442 8491 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121174.1 protein_id gnl|my_center|LOCUS_24630 8879 9307 gene locus_tag LOCUS_24640 8879 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 13507 9935 gene locus_tag LOCUS_24650 13507 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 14045 13767 gene locus_tag LOCUS_24660 14045 13767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 14720 16141 gene locus_tag LOCUS_24670 14720 16141 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922459.1 protein_id gnl|my_center|LOCUS_24670 16797 16228 gene locus_tag LOCUS_24680 gene msrA 16797 16228 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_24680 17749 16817 gene locus_tag LOCUS_24690 17749 16817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 17785 18111 gene locus_tag LOCUS_24700 17785 18111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 18149 20626 gene locus_tag LOCUS_24710 18149 20626 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921574.1 protein_id gnl|my_center|LOCUS_24710 20757 22139 gene locus_tag LOCUS_24720 20757 22139 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_24720 22290 22484 gene locus_tag LOCUS_24730 22290 22484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 22528 24948 gene locus_tag LOCUS_24740 22528 24948 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_24740 26483 25149 gene locus_tag LOCUS_24750 26483 25149 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_24750 >Feature sequence073 796 422 gene locus_tag LOCUS_24760 796 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 1841 825 gene locus_tag LOCUS_24770 1841 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 2409 1870 gene locus_tag LOCUS_24780 2409 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 3562 2501 gene locus_tag LOCUS_24790 3562 2501 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922391.1 protein_id gnl|my_center|LOCUS_24790 5728 3725 gene locus_tag LOCUS_24800 5728 3725 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_24800 8221 5762 gene locus_tag LOCUS_24810 8221 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 8348 8920 gene locus_tag LOCUS_24820 8348 8920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 9337 8957 gene locus_tag LOCUS_24830 9337 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 9324 9509 gene locus_tag LOCUS_24840 9324 9509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 10651 9605 gene locus_tag LOCUS_24850 10651 9605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 12236 10734 gene locus_tag LOCUS_24860 gene guaB 12236 10734 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325011.1 protein_id gnl|my_center|LOCUS_24860 13306 12323 gene locus_tag LOCUS_24870 gene rsmA 13306 12323 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922514.1 protein_id gnl|my_center|LOCUS_24870 13710 13898 gene locus_tag LOCUS_24880 13710 13898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 14918 14094 gene locus_tag LOCUS_24890 14918 14094 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289375.1 protein_id gnl|my_center|LOCUS_24890 16344 15049 gene locus_tag LOCUS_24900 gene gudP 16344 15049 CDS product glucarate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234818.1 protein_id gnl|my_center|LOCUS_24900 16835 16464 gene locus_tag LOCUS_24910 gene mazF 16835 16464 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_24910 17074 16829 gene locus_tag LOCUS_24920 17074 16829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 18186 17155 gene locus_tag LOCUS_24930 18186 17155 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530437.1 protein_id gnl|my_center|LOCUS_24930 18473 19906 gene locus_tag LOCUS_24940 18473 19906 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_24940 24280 20000 gene locus_tag LOCUS_24950 24280 20000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 26320 24998 gene locus_tag LOCUS_24960 26320 24998 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence074 1324 758 gene locus_tag LOCUS_24970 1324 758 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 protein_id gnl|my_center|LOCUS_24970 1405 1614 gene locus_tag LOCUS_24980 1405 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 1852 2106 gene locus_tag LOCUS_24990 1852 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 2217 2699 gene locus_tag LOCUS_25000 2217 2699 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124116.1 protein_id gnl|my_center|LOCUS_25000 2716 3321 gene locus_tag LOCUS_25010 2716 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 4210 3422 gene locus_tag LOCUS_25020 4210 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 6734 4656 gene locus_tag LOCUS_25030 6734 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 7230 8351 gene locus_tag LOCUS_25040 7230 8351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 8718 8966 gene locus_tag LOCUS_25050 8718 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812685.1 protein_id gnl|my_center|LOCUS_25050 9110 12643 gene locus_tag LOCUS_25060 9110 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 12999 13451 gene locus_tag LOCUS_25070 12999 13451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 13444 14376 gene locus_tag LOCUS_25080 gene fliP 13444 14376 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118329.1 protein_id gnl|my_center|LOCUS_25080 14562 14828 gene locus_tag LOCUS_25090 gene fliQ 14562 14828 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811859.1 protein_id gnl|my_center|LOCUS_25090 14828 15757 gene locus_tag LOCUS_25100 14828 15757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 15754 16524 gene locus_tag LOCUS_25110 15754 16524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 17477 16893 gene locus_tag LOCUS_25120 17477 16893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 18719 17610 gene locus_tag LOCUS_25130 18719 17610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 19127 20104 gene locus_tag LOCUS_25140 19127 20104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 20612 22183 gene locus_tag LOCUS_25150 20612 22183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 22375 22782 gene locus_tag LOCUS_25160 22375 22782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 22775 23257 gene locus_tag LOCUS_25170 22775 23257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 23306 23803 gene locus_tag LOCUS_25180 23306 23803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 23829 24218 gene locus_tag LOCUS_25190 23829 24218 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_25190 24222 24479 gene locus_tag LOCUS_25200 24222 24479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 25019 24759 gene locus_tag LOCUS_25210 25019 24759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 25353 25108 gene locus_tag LOCUS_25220 25353 25108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 25854 25423 gene locus_tag LOCUS_25230 25854 25423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 26370 25927 gene locus_tag LOCUS_25240 26370 25927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 >Feature sequence075 128 2860 gene locus_tag LOCUS_25250 128 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 3215 3667 gene locus_tag LOCUS_25260 gene tnpA 3215 3667 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_25260 3856 4098 gene locus_tag LOCUS_25270 3856 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 4478 6103 gene locus_tag LOCUS_25280 4478 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 6634 7746 gene locus_tag LOCUS_25290 6634 7746 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_25290 8290 8781 gene locus_tag LOCUS_25300 8290 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 8931 9752 gene locus_tag LOCUS_25310 8931 9752 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_25310 10538 9858 gene locus_tag LOCUS_25320 10538 9858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 11235 10714 gene locus_tag LOCUS_25330 11235 10714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 11769 12914 gene locus_tag LOCUS_25340 gene metK 11769 12914 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331112.1 protein_id gnl|my_center|LOCUS_25340 13132 14058 gene locus_tag LOCUS_25350 13132 14058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 14486 14064 gene locus_tag LOCUS_25360 14486 14064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 14724 14500 gene locus_tag LOCUS_25370 14724 14500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 14865 15884 gene locus_tag LOCUS_25380 14865 15884 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921954.1 protein_id gnl|my_center|LOCUS_25380 16354 17484 gene locus_tag LOCUS_25390 16354 17484 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_25390 17992 17543 gene locus_tag LOCUS_25400 17992 17543 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442707.1 protein_id gnl|my_center|LOCUS_25400 18093 19271 gene locus_tag LOCUS_25410 18093 19271 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_25410 19431 20654 gene locus_tag LOCUS_25420 gene earP 19431 20654 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203004.1 protein_id gnl|my_center|LOCUS_25420 20745 21317 gene locus_tag LOCUS_25430 gene efp 20745 21317 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707002.1 protein_id gnl|my_center|LOCUS_25430 22605 21535 gene locus_tag LOCUS_25440 22605 21535 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123141.1 protein_id gnl|my_center|LOCUS_25440 23643 24719 gene locus_tag LOCUS_25450 23643 24719 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_25450 24773 25189 gene locus_tag LOCUS_25460 24773 25189 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 protein_id gnl|my_center|LOCUS_25460 25217 25438 gene locus_tag LOCUS_25470 25217 25438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 >Feature sequence076 305 42 gene locus_tag LOCUS_25480 305 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 1088 1438 gene locus_tag LOCUS_25490 1088 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 1590 1435 gene locus_tag LOCUS_25500 1590 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 2150 4903 gene locus_tag LOCUS_25510 gene aceE 2150 4903 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_25510 5112 6383 gene locus_tag LOCUS_25520 5112 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 6637 7971 gene locus_tag LOCUS_25530 gene lpdA 6637 7971 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_25530 7981 8334 gene locus_tag LOCUS_25540 7981 8334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 8541 9332 gene locus_tag LOCUS_25550 8541 9332 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937402.1 protein_id gnl|my_center|LOCUS_25550 9647 9420 gene locus_tag LOCUS_25560 9647 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 9674 14362 gene locus_tag LOCUS_25570 9674 14362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 14631 16118 gene locus_tag LOCUS_25580 14631 16118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 16327 16974 gene locus_tag LOCUS_25590 16327 16974 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545727.1 protein_id gnl|my_center|LOCUS_25590 18756 17101 gene locus_tag LOCUS_25600 18756 17101 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922314.1 protein_id gnl|my_center|LOCUS_25600 19803 18766 gene locus_tag LOCUS_25610 19803 18766 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615404.1 protein_id gnl|my_center|LOCUS_25610 20307 19936 gene locus_tag LOCUS_25620 20307 19936 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140042.1 protein_id gnl|my_center|LOCUS_25620 21035 21991 gene locus_tag LOCUS_25630 21035 21991 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_25630 22169 22579 gene locus_tag LOCUS_25640 22169 22579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 22827 22615 gene locus_tag LOCUS_25650 22827 22615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 22814 23734 gene locus_tag LOCUS_25660 22814 23734 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_25660 23818 24303 gene locus_tag LOCUS_25670 23818 24303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 25678 24443 gene locus_tag LOCUS_25680 25678 24443 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_25680 >Feature sequence077 2816 93 gene locus_tag LOCUS_25690 2816 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 4031 2931 gene locus_tag LOCUS_25700 gene wecB 4031 2931 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_25700 6131 4167 gene locus_tag LOCUS_25710 6131 4167 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_25710 7507 6281 gene locus_tag LOCUS_25720 7507 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 8804 7635 gene locus_tag LOCUS_25730 8804 7635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 8752 8982 gene locus_tag LOCUS_25740 8752 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 10580 9114 gene locus_tag LOCUS_25750 10580 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 11342 11172 gene locus_tag LOCUS_25760 11342 11172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 12415 11522 gene locus_tag LOCUS_25770 12415 11522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 13493 12600 gene locus_tag LOCUS_25780 13493 12600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 14608 13712 gene locus_tag LOCUS_25790 14608 13712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 16996 14837 gene locus_tag LOCUS_25800 16996 14837 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089039.1 protein_id gnl|my_center|LOCUS_25800 18555 17293 gene locus_tag LOCUS_25810 18555 17293 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222986.1 protein_id gnl|my_center|LOCUS_25810 20039 18738 gene locus_tag LOCUS_25820 20039 18738 CDS product NeuD/PglB/VioB family sugar acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704933.1 protein_id gnl|my_center|LOCUS_25820 21282 20041 gene locus_tag LOCUS_25830 21282 20041 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_25830 22468 21374 gene locus_tag LOCUS_25840 22468 21374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 23993 22749 gene locus_tag LOCUS_25850 23993 22749 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014841181.1 protein_id gnl|my_center|LOCUS_25850 24693 23983 gene locus_tag LOCUS_25860 gene hisH 24693 23983 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333911.1 protein_id gnl|my_center|LOCUS_25860 <25656 24855 gene locus_tag LOCUS_25870 <25656 24855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011213307.1:glycosyl amidation-associated protein WbuZ >Feature sequence078 1769 39 gene locus_tag LOCUS_25880 1769 39 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_25880 3303 2356 gene locus_tag LOCUS_25890 3303 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 4486 3368 gene locus_tag LOCUS_25900 4486 3368 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_25900 5487 5305 gene locus_tag LOCUS_25910 5487 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 6250 5813 gene locus_tag LOCUS_25920 6250 5813 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_25920 6630 6247 gene locus_tag LOCUS_25930 6630 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142930.1 protein_id gnl|my_center|LOCUS_25930 7457 6765 gene locus_tag LOCUS_25940 7457 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 7849 8931 gene locus_tag LOCUS_25950 7849 8931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 9016 10641 gene locus_tag LOCUS_25960 9016 10641 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366535.1 protein_id gnl|my_center|LOCUS_25960 11816 10764 gene locus_tag LOCUS_25970 11816 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 12559 14394 gene locus_tag LOCUS_25980 12559 14394 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120612.1 protein_id gnl|my_center|LOCUS_25980 14701 15633 gene locus_tag LOCUS_25990 gene cysK 14701 15633 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245803.1 protein_id gnl|my_center|LOCUS_25990 15681 16067 gene locus_tag LOCUS_26000 15681 16067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 16240 17421 gene locus_tag LOCUS_26010 16240 17421 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_26010 17508 17699 gene locus_tag LOCUS_26020 17508 17699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 17968 18258 gene locus_tag LOCUS_26030 17968 18258 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_26030 18263 18559 gene locus_tag LOCUS_26040 18263 18559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 18661 19785 gene locus_tag LOCUS_26050 gene lpxK 18661 19785 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121336.1 protein_id gnl|my_center|LOCUS_26050 21902 19899 gene locus_tag LOCUS_26060 21902 19899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 22501 22070 gene locus_tag LOCUS_26070 22501 22070 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912113.1 protein_id gnl|my_center|LOCUS_26070 22670 23440 gene locus_tag LOCUS_26080 gene fabG 22670 23440 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383937.1 protein_id gnl|my_center|LOCUS_26080 25204 23624 gene locus_tag LOCUS_26090 25204 23624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 25643 25461 gene locus_tag LOCUS_26100 25643 25461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 >Feature sequence079 1098 376 gene locus_tag LOCUS_26110 1098 376 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_26110 2143 3093 gene locus_tag LOCUS_26120 2143 3093 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027042.1 protein_id gnl|my_center|LOCUS_26120 4950 3187 gene locus_tag LOCUS_26130 4950 3187 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120416.1 protein_id gnl|my_center|LOCUS_26130 6526 5084 gene locus_tag LOCUS_26140 6526 5084 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121615.1 protein_id gnl|my_center|LOCUS_26140 8187 6838 gene locus_tag LOCUS_26150 8187 6838 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_26150 8758 9897 gene locus_tag LOCUS_26160 8758 9897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 10067 11035 gene locus_tag LOCUS_26170 10067 11035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 12188 11280 gene locus_tag LOCUS_26180 12188 11280 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_26180 13486 12488 gene locus_tag LOCUS_26190 13486 12488 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922313.1 protein_id gnl|my_center|LOCUS_26190 13981 13538 gene locus_tag LOCUS_26200 13981 13538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 14825 14163 gene locus_tag LOCUS_26210 14825 14163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 15278 17284 gene locus_tag LOCUS_26220 15278 17284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 18059 17586 gene locus_tag LOCUS_26230 18059 17586 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943199.1 protein_id gnl|my_center|LOCUS_26230 >Feature sequence080 1 3915 gene locus_tag LOCUS_26240 1 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121744.1 protein_id gnl|my_center|LOCUS_26240 4731 7073 gene locus_tag LOCUS_26250 4731 7073 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_26250 7250 8155 gene locus_tag LOCUS_26260 7250 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061227.1 protein_id gnl|my_center|LOCUS_26260 10908 8266 gene locus_tag LOCUS_26270 10908 8266 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 protein_id gnl|my_center|LOCUS_26270 11209 12858 gene locus_tag LOCUS_26280 11209 12858 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118026.1 protein_id gnl|my_center|LOCUS_26280 14571 12943 gene locus_tag LOCUS_26290 gene cobA 14571 12943 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_26290 14752 15576 gene locus_tag LOCUS_26300 14752 15576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 16658 15690 gene locus_tag LOCUS_26310 16658 15690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 17074 17826 gene locus_tag LOCUS_26320 gene bioD 17074 17826 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_26320 17837 19648 gene locus_tag LOCUS_26330 17837 19648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 19752 20495 gene locus_tag LOCUS_26340 gene recO 19752 20495 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119985.1 protein_id gnl|my_center|LOCUS_26340 20646 22214 gene locus_tag LOCUS_26350 20646 22214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 22399 22938 gene locus_tag LOCUS_26360 22399 22938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 23333 24124 gene locus_tag LOCUS_26370 23333 24124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence081 1026 1319 gene locus_tag LOCUS_26380 1026 1319 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548978.1 protein_id gnl|my_center|LOCUS_26380 1487 2557 gene locus_tag LOCUS_26390 gene prfA 1487 2557 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328933.1 protein_id gnl|my_center|LOCUS_26390 2613 3554 gene locus_tag LOCUS_26400 gene prmC 2613 3554 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122233.1 protein_id gnl|my_center|LOCUS_26400 5455 3743 gene locus_tag LOCUS_26410 5455 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 8177 5607 gene locus_tag LOCUS_26420 8177 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 8814 9719 gene locus_tag LOCUS_26430 gene hemW 8814 9719 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122512.1 protein_id gnl|my_center|LOCUS_26430 9808 11412 gene locus_tag LOCUS_26440 9808 11412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 13981 11729 gene locus_tag LOCUS_26450 13981 11729 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117877.1 protein_id gnl|my_center|LOCUS_26450 16042 14195 gene locus_tag LOCUS_26460 16042 14195 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921294.1 protein_id gnl|my_center|LOCUS_26460 19835 16290 gene locus_tag LOCUS_26470 19835 16290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 20458 21099 gene locus_tag LOCUS_26480 20458 21099 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033468060.1 protein_id gnl|my_center|LOCUS_26480 22077 23210 gene locus_tag LOCUS_26490 22077 23210 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882726.1 protein_id gnl|my_center|LOCUS_26490 23563 24339 gene locus_tag LOCUS_26500 gene ntrB 23563 24339 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705090.1 protein_id gnl|my_center|LOCUS_26500 24479 25123 gene locus_tag LOCUS_26510 24479 25123 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141166.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence082 432 1007 gene locus_tag LOCUS_26520 432 1007 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_26520 1650 1297 gene locus_tag LOCUS_26530 1650 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 3511 1739 gene locus_tag LOCUS_26540 3511 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 4692 3508 gene locus_tag LOCUS_26550 4692 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 5505 4843 gene locus_tag LOCUS_26560 5505 4843 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325064.1 protein_id gnl|my_center|LOCUS_26560 5964 5743 gene locus_tag LOCUS_26570 5964 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 5882 6880 gene locus_tag LOCUS_26580 5882 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 10091 7017 gene locus_tag LOCUS_26590 10091 7017 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615874.1 protein_id gnl|my_center|LOCUS_26590 11653 10205 gene locus_tag LOCUS_26600 11653 10205 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008668680.1 protein_id gnl|my_center|LOCUS_26600 12512 12033 gene locus_tag LOCUS_26610 12512 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 12841 13881 gene locus_tag LOCUS_26620 12841 13881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 14163 15872 gene locus_tag LOCUS_26630 14163 15872 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121786.1 protein_id gnl|my_center|LOCUS_26630 16300 20886 gene locus_tag LOCUS_26640 16300 20886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 21260 23722 gene locus_tag LOCUS_26650 21260 23722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 24582 24046 gene locus_tag LOCUS_26660 24582 24046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 >Feature sequence083 379 98 gene locus_tag LOCUS_26670 379 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 1382 552 gene locus_tag LOCUS_26680 1382 552 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922402.1 protein_id gnl|my_center|LOCUS_26680 2124 1417 gene locus_tag LOCUS_26690 2124 1417 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_26690 3339 2128 gene locus_tag LOCUS_26700 3339 2128 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_26700 4496 3336 gene locus_tag LOCUS_26710 4496 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 4974 4615 gene locus_tag LOCUS_26720 4974 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 5240 4992 gene locus_tag LOCUS_26730 5240 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 5600 5352 gene locus_tag LOCUS_26740 5600 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 7238 5820 gene locus_tag LOCUS_26750 7238 5820 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123146.1 protein_id gnl|my_center|LOCUS_26750 7676 7326 gene locus_tag LOCUS_26760 gene trxA 7676 7326 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067446.1 protein_id gnl|my_center|LOCUS_26760 8335 7730 gene locus_tag LOCUS_26770 8335 7730 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 protein_id gnl|my_center|LOCUS_26770 8826 8569 gene locus_tag LOCUS_26780 8826 8569 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909527.1 protein_id gnl|my_center|LOCUS_26780 9607 8945 gene locus_tag LOCUS_26790 9607 8945 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_26790 11495 9726 gene locus_tag LOCUS_26800 gene arsA 11495 9726 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122358.1 protein_id gnl|my_center|LOCUS_26800 12047 11580 gene locus_tag LOCUS_26810 12047 11580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 12572 12081 gene locus_tag LOCUS_26820 12572 12081 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061381.1 protein_id gnl|my_center|LOCUS_26820 13677 12604 gene locus_tag LOCUS_26830 13677 12604 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874921.1 protein_id gnl|my_center|LOCUS_26830 14349 13756 gene locus_tag LOCUS_26840 14349 13756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 14442 14777 gene locus_tag LOCUS_26850 14442 14777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 17423 15267 gene locus_tag LOCUS_26860 17423 15267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 18873 17575 gene locus_tag LOCUS_26870 18873 17575 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_26870 19585 19037 gene locus_tag LOCUS_26880 gene cyaB 19585 19037 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877237.1 protein_id gnl|my_center|LOCUS_26880 19735 21222 gene locus_tag LOCUS_26890 19735 21222 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261293.1 protein_id gnl|my_center|LOCUS_26890 23229 23780 gene locus_tag LOCUS_26900 23229 23780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence084 589 1029 gene locus_tag LOCUS_26910 589 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 1538 1467 gene locus_tag LOCUS_t00200 1538 1467 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2033 3262 gene locus_tag LOCUS_26920 2033 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 3710 6088 gene locus_tag LOCUS_26930 3710 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 7348 6338 gene locus_tag LOCUS_26940 7348 6338 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_26940 8610 7543 gene locus_tag LOCUS_26950 8610 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 9739 8750 gene locus_tag LOCUS_26960 gene nadE 9739 8750 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061276.1 protein_id gnl|my_center|LOCUS_26960 11446 9890 gene locus_tag LOCUS_26970 11446 9890 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061275.1 protein_id gnl|my_center|LOCUS_26970 11928 11671 gene locus_tag LOCUS_26980 11928 11671 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976177.1 protein_id gnl|my_center|LOCUS_26980 14038 12137 gene locus_tag LOCUS_26990 gene asnB 14038 12137 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392336.1 protein_id gnl|my_center|LOCUS_26990 14795 15820 gene locus_tag LOCUS_27000 14795 15820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 16721 16002 gene locus_tag LOCUS_27010 16721 16002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 18591 17302 gene locus_tag LOCUS_27020 gene fabF 18591 17302 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_27020 18916 18647 gene locus_tag LOCUS_27030 18916 18647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 19472 19095 gene locus_tag LOCUS_27040 gene acpS 19472 19095 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882961.1 protein_id gnl|my_center|LOCUS_27040 20095 19469 gene locus_tag LOCUS_27050 20095 19469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 21122 20160 gene locus_tag LOCUS_27060 21122 20160 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_27060 23684 21354 gene locus_tag LOCUS_27070 23684 21354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 23829 23659 gene locus_tag LOCUS_27080 23829 23659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 >Feature sequence085 555 76 gene locus_tag LOCUS_27090 555 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 778 1977 gene locus_tag LOCUS_27100 778 1977 CDS product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665238.1 protein_id gnl|my_center|LOCUS_27100 2298 2975 gene locus_tag LOCUS_27110 2298 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340960.1 protein_id gnl|my_center|LOCUS_27110 3160 4518 gene locus_tag LOCUS_27120 3160 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921376.1 protein_id gnl|my_center|LOCUS_27120 4799 7357 gene locus_tag LOCUS_27130 4799 7357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 8207 7383 gene locus_tag LOCUS_27140 8207 7383 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270512.1 protein_id gnl|my_center|LOCUS_27140 8481 9128 gene locus_tag LOCUS_27150 8481 9128 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_27150 10704 9295 gene locus_tag LOCUS_27160 10704 9295 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_27160 12272 10971 gene locus_tag LOCUS_27170 12272 10971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 13219 12581 gene locus_tag LOCUS_27180 13219 12581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 13434 14027 gene locus_tag LOCUS_27190 13434 14027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 14212 15570 gene locus_tag LOCUS_27200 14212 15570 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021695.1 protein_id gnl|my_center|LOCUS_27200 17182 15656 gene locus_tag LOCUS_27210 17182 15656 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810537.1 protein_id gnl|my_center|LOCUS_27210 19656 17254 gene locus_tag LOCUS_27220 19656 17254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 21893 19998 gene locus_tag LOCUS_27230 21893 19998 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615739.1 protein_id gnl|my_center|LOCUS_27230 22917 22021 gene locus_tag LOCUS_27240 22917 22021 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427744.1 protein_id gnl|my_center|LOCUS_27240 24117 22984 gene locus_tag LOCUS_27250 24117 22984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530033.1 protein_id gnl|my_center|LOCUS_27250 >Feature sequence086 2106 49 gene locus_tag LOCUS_27260 2106 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 3297 2176 gene locus_tag LOCUS_27270 3297 2176 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674115.1 protein_id gnl|my_center|LOCUS_27270 3538 4905 gene locus_tag LOCUS_27280 3538 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_27280 5163 5585 gene locus_tag LOCUS_27290 5163 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 6726 5644 gene locus_tag LOCUS_27300 6726 5644 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922132.1 protein_id gnl|my_center|LOCUS_27300 8412 6973 gene locus_tag LOCUS_27310 8412 6973 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_27310 8807 10015 gene locus_tag LOCUS_27320 8807 10015 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328284.1 protein_id gnl|my_center|LOCUS_27320 10347 10841 gene locus_tag LOCUS_27330 gene gspG 10347 10841 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880232.1 protein_id gnl|my_center|LOCUS_27330 11092 12567 gene locus_tag LOCUS_27340 11092 12567 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122652.1 protein_id gnl|my_center|LOCUS_27340 13059 14081 gene locus_tag LOCUS_27350 13059 14081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 14089 14487 gene locus_tag LOCUS_27360 14089 14487 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_27360 14839 15876 gene locus_tag LOCUS_27370 14839 15876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 15902 17230 gene locus_tag LOCUS_27380 15902 17230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 18129 17452 gene locus_tag LOCUS_27390 18129 17452 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_27390 18553 19629 gene locus_tag LOCUS_27400 18553 19629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 19772 22024 gene locus_tag LOCUS_27410 19772 22024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 22368 23849 gene locus_tag LOCUS_27420 22368 23849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 >Feature sequence087 <1 1053 gene locus_tag LOCUS_27430 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121802.1:glycosyltransferase family 4 protein 2801 1179 gene locus_tag LOCUS_27440 2801 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 5274 3760 gene locus_tag LOCUS_27450 5274 3760 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_27450 7076 5271 gene locus_tag LOCUS_27460 7076 5271 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061939.1 protein_id gnl|my_center|LOCUS_27460 7445 7185 gene locus_tag LOCUS_27470 7445 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_27470 7642 7442 gene locus_tag LOCUS_27480 7642 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 9702 7696 gene locus_tag LOCUS_27490 gene nuoL 9702 7696 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546379.1 protein_id gnl|my_center|LOCUS_27490 10326 9889 gene locus_tag LOCUS_27500 10326 9889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 11057 10323 gene locus_tag LOCUS_27510 11057 10323 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061937.1 protein_id gnl|my_center|LOCUS_27510 11921 11271 gene locus_tag LOCUS_27520 11921 11271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 13364 12111 gene locus_tag LOCUS_27530 gene nuoH 13364 12111 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104353.1 protein_id gnl|my_center|LOCUS_27530 15160 13481 gene locus_tag LOCUS_27540 15160 13481 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238899.1 protein_id gnl|my_center|LOCUS_27540 16646 15315 gene locus_tag LOCUS_27550 gene nuoF 16646 15315 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967797.1 protein_id gnl|my_center|LOCUS_27550 16891 16655 gene locus_tag LOCUS_27560 16891 16655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 17463 16888 gene locus_tag LOCUS_27570 17463 16888 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_27570 17964 17491 gene locus_tag LOCUS_27580 gene nuoE 17964 17491 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_27580 19395 18175 gene locus_tag LOCUS_27590 gene nuoD 19395 18175 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969257.1 protein_id gnl|my_center|LOCUS_27590 19900 19406 gene locus_tag LOCUS_27600 19900 19406 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546766.1 protein_id gnl|my_center|LOCUS_27600 20672 20097 gene locus_tag LOCUS_27610 20672 20097 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941007.1 protein_id gnl|my_center|LOCUS_27610 21043 20663 gene locus_tag LOCUS_27620 21043 20663 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_27620 22597 21350 gene locus_tag LOCUS_27630 22597 21350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 23926 23117 gene locus_tag LOCUS_27640 23926 23117 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122369.1 protein_id gnl|my_center|LOCUS_27640 >Feature sequence088 11294 7857 gene locus_tag LOCUS_27650 11294 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 11569 12387 gene locus_tag LOCUS_27660 11569 12387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 12745 12398 gene locus_tag LOCUS_27670 12745 12398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 14110 12890 gene locus_tag LOCUS_27680 14110 12890 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228417.1 protein_id gnl|my_center|LOCUS_27680 14545 14186 gene locus_tag LOCUS_27690 14545 14186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 14935 16494 gene locus_tag LOCUS_27700 14935 16494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 16501 17496 gene locus_tag LOCUS_27710 16501 17496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 18478 17516 gene locus_tag LOCUS_27720 18478 17516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 19051 21942 gene locus_tag LOCUS_27730 19051 21942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 22269 23324 gene locus_tag LOCUS_27740 22269 23324 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259330.1 protein_id gnl|my_center|LOCUS_27740 24045 23491 gene locus_tag LOCUS_27750 24045 23491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 >Feature sequence089 829 224 gene locus_tag LOCUS_27760 829 224 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_27760 1048 2298 gene locus_tag LOCUS_27770 1048 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 2449 3246 gene locus_tag LOCUS_27780 2449 3246 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119307.1 protein_id gnl|my_center|LOCUS_27780 5309 3789 gene locus_tag LOCUS_27790 5309 3789 CDS product thermostable carboxypeptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174078.1 protein_id gnl|my_center|LOCUS_27790 6062 5412 gene locus_tag LOCUS_27800 gene cmk 6062 5412 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122796.1 protein_id gnl|my_center|LOCUS_27800 7205 6192 gene locus_tag LOCUS_27810 7205 6192 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838396.1 protein_id gnl|my_center|LOCUS_27810 7849 7646 gene locus_tag LOCUS_27820 7849 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 8315 7887 gene locus_tag LOCUS_27830 gene mraZ 8315 7887 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856549.1 protein_id gnl|my_center|LOCUS_27830 9623 8499 gene locus_tag LOCUS_27840 9623 8499 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122846.1 protein_id gnl|my_center|LOCUS_27840 9704 10756 gene locus_tag LOCUS_27850 gene queA 9704 10756 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120320.1 protein_id gnl|my_center|LOCUS_27850 11618 10857 gene locus_tag LOCUS_27860 11618 10857 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404405.1 protein_id gnl|my_center|LOCUS_27860 11945 11625 gene locus_tag LOCUS_27870 11945 11625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 12467 12012 gene locus_tag LOCUS_27880 12467 12012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 14010 12484 gene locus_tag LOCUS_27890 14010 12484 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922407.1 protein_id gnl|my_center|LOCUS_27890 17423 14124 gene locus_tag LOCUS_27900 17423 14124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 18856 17810 gene locus_tag LOCUS_27910 gene pdxA 18856 17810 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_27910 19395 18853 gene locus_tag LOCUS_27920 gene rfbC 19395 18853 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_27920 21602 19530 gene locus_tag LOCUS_27930 gene fusA 21602 19530 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121593.1 protein_id gnl|my_center|LOCUS_27930 22339 21728 gene locus_tag LOCUS_27940 22339 21728 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_27940 23598 22456 gene locus_tag LOCUS_27950 gene ispG 23598 22456 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118672.1 protein_id gnl|my_center|LOCUS_27950 >Feature sequence090 1394 288 gene locus_tag LOCUS_27960 1394 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 1645 2361 gene locus_tag LOCUS_27970 1645 2361 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188202.1 protein_id gnl|my_center|LOCUS_27970 4613 2451 gene locus_tag LOCUS_27980 4613 2451 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921395.1 protein_id gnl|my_center|LOCUS_27980 5353 5060 gene locus_tag LOCUS_27990 5353 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 6779 5781 gene locus_tag LOCUS_28000 6779 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 7619 6978 gene locus_tag LOCUS_28010 7619 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 8563 8138 gene locus_tag LOCUS_28020 8563 8138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 9475 8639 gene locus_tag LOCUS_28030 gene uvsE 9475 8639 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227599.1 protein_id gnl|my_center|LOCUS_28030 10037 9711 gene locus_tag LOCUS_28040 10037 9711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28040 11012 10476 gene locus_tag LOCUS_28050 11012 10476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 11803 11144 gene locus_tag LOCUS_28060 gene folE 11803 11144 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336701.1 protein_id gnl|my_center|LOCUS_28060 12236 12409 gene locus_tag LOCUS_28070 12236 12409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 12406 12909 gene locus_tag LOCUS_28080 gene tadA 12406 12909 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001934843.1 protein_id gnl|my_center|LOCUS_28080 12906 13487 gene locus_tag LOCUS_28090 12906 13487 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123297.1 protein_id gnl|my_center|LOCUS_28090 14979 13594 gene locus_tag LOCUS_28100 14979 13594 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_28100 17625 15118 gene locus_tag LOCUS_28110 17625 15118 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921574.1 protein_id gnl|my_center|LOCUS_28110 19046 17781 gene locus_tag LOCUS_28120 19046 17781 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_28120 19309 19947 gene locus_tag LOCUS_28130 19309 19947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 19966 20253 gene locus_tag LOCUS_28140 19966 20253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 23611 20750 gene locus_tag LOCUS_28150 23611 20750 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615881.1 protein_id gnl|my_center|LOCUS_28150 >Feature sequence091 2916 1105 gene locus_tag LOCUS_28160 2916 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 4400 2913 gene locus_tag LOCUS_28170 4400 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 5100 4606 gene locus_tag LOCUS_28180 5100 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 5561 5160 gene locus_tag LOCUS_28190 5561 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 6082 5645 gene locus_tag LOCUS_28200 6082 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 7093 6185 gene locus_tag LOCUS_28210 7093 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 14949 7255 gene locus_tag LOCUS_28220 14949 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 17463 15067 gene locus_tag LOCUS_28230 17463 15067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 19043 17784 gene locus_tag LOCUS_28240 19043 17784 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331975.1 protein_id gnl|my_center|LOCUS_28240 21217 19193 gene locus_tag LOCUS_28250 21217 19193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 22678 22391 gene locus_tag LOCUS_28260 22678 22391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 >Feature sequence092 199 948 gene locus_tag LOCUS_28270 199 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 1204 2484 gene locus_tag LOCUS_28280 1204 2484 CDS product putative sugar nucleotidyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256908.1 protein_id gnl|my_center|LOCUS_28280 3234 2569 gene locus_tag LOCUS_28290 3234 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 5368 3620 gene locus_tag LOCUS_28300 5368 3620 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_28300 5601 6566 gene locus_tag LOCUS_28310 5601 6566 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_28310 6876 7823 gene locus_tag LOCUS_28320 gene floA 6876 7823 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327752.1 protein_id gnl|my_center|LOCUS_28320 7945 8859 gene locus_tag LOCUS_28330 7945 8859 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705854.1 protein_id gnl|my_center|LOCUS_28330 10544 9012 gene locus_tag LOCUS_28340 10544 9012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 11452 10652 gene locus_tag LOCUS_28350 11452 10652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340214.1 protein_id gnl|my_center|LOCUS_28350 12817 11615 gene locus_tag LOCUS_28360 12817 11615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 13107 14198 gene locus_tag LOCUS_28370 13107 14198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 14241 15281 gene locus_tag LOCUS_28380 14241 15281 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121766.1 protein_id gnl|my_center|LOCUS_28380 15787 15410 gene locus_tag LOCUS_28390 15787 15410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 15947 16273 gene locus_tag LOCUS_28400 gene trxA 15947 16273 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_28400 16736 18559 gene locus_tag LOCUS_28410 16736 18559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 20198 18708 gene locus_tag LOCUS_28420 20198 18708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 21747 21004 gene locus_tag LOCUS_28430 21747 21004 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340410.1 protein_id gnl|my_center|LOCUS_28430 22162 22725 gene locus_tag LOCUS_28440 22162 22725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 >Feature sequence093 1176 364 gene locus_tag LOCUS_28450 1176 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 2174 4753 gene locus_tag LOCUS_28460 2174 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 5113 4838 gene locus_tag LOCUS_28470 5113 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 6460 5198 gene locus_tag LOCUS_28480 6460 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 6917 8299 gene locus_tag LOCUS_28490 6917 8299 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_28490 9752 10696 gene locus_tag LOCUS_28500 9752 10696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 10876 12174 gene locus_tag LOCUS_28510 10876 12174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 12613 14166 gene locus_tag LOCUS_28520 12613 14166 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922561.1 protein_id gnl|my_center|LOCUS_28520 14333 14932 gene locus_tag LOCUS_28530 14333 14932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 15108 15809 gene locus_tag LOCUS_28540 15108 15809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 16082 15870 gene locus_tag LOCUS_28550 16082 15870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 15982 16887 gene locus_tag LOCUS_28560 15982 16887 CDS product DUF1571 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 protein_id gnl|my_center|LOCUS_28560 17031 17903 gene locus_tag LOCUS_28570 gene panC 17031 17903 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_28570 17933 19078 gene locus_tag LOCUS_28580 17933 19078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 19407 19991 gene locus_tag LOCUS_28590 19407 19991 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329277.1 protein_id gnl|my_center|LOCUS_28590 20146 22002 gene locus_tag LOCUS_28600 20146 22002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 >Feature sequence094 922 257 gene locus_tag LOCUS_28610 922 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 1900 1388 gene locus_tag LOCUS_28620 1900 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 3175 2543 gene locus_tag LOCUS_28630 3175 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 3440 3168 gene locus_tag LOCUS_28640 3440 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 3994 3563 gene locus_tag LOCUS_28650 3994 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 4482 3913 gene locus_tag LOCUS_28660 4482 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 5524 4466 gene locus_tag LOCUS_28670 5524 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 5839 5621 gene locus_tag LOCUS_28680 5839 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 6271 5990 gene locus_tag LOCUS_28690 6271 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 7252 6602 gene locus_tag LOCUS_28700 7252 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 7733 7551 gene locus_tag LOCUS_28710 7733 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 9777 7831 gene locus_tag LOCUS_28720 9777 7831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 10224 10670 gene locus_tag LOCUS_28730 10224 10670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 10667 10915 gene locus_tag LOCUS_28740 10667 10915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 11639 11457 gene locus_tag LOCUS_28750 11639 11457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 11562 12236 gene locus_tag LOCUS_28760 11562 12236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 13760 12552 gene locus_tag LOCUS_28770 13760 12552 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122076.1 protein_id gnl|my_center|LOCUS_28770 17377 14147 gene locus_tag LOCUS_28780 17377 14147 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263823.1 protein_id gnl|my_center|LOCUS_28780 17733 20147 gene locus_tag LOCUS_28790 17733 20147 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_28790 20348 21787 gene locus_tag LOCUS_28800 20348 21787 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_28800 22260 22024 gene locus_tag LOCUS_28810 22260 22024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 >Feature sequence095 737 1774 gene locus_tag LOCUS_28820 737 1774 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921799.1 protein_id gnl|my_center|LOCUS_28820 4332 2140 gene locus_tag LOCUS_28830 4332 2140 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120937.1 protein_id gnl|my_center|LOCUS_28830 5119 4322 gene locus_tag LOCUS_28840 5119 4322 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327800.1 protein_id gnl|my_center|LOCUS_28840 5645 7228 gene locus_tag LOCUS_28850 gene purH 5645 7228 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122619.1 protein_id gnl|my_center|LOCUS_28850 7476 7985 gene locus_tag LOCUS_28860 7476 7985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 7982 8509 gene locus_tag LOCUS_28870 gene mog 7982 8509 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879970.1 protein_id gnl|my_center|LOCUS_28870 8954 8730 gene locus_tag LOCUS_28880 8954 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 9108 9872 gene locus_tag LOCUS_28890 9108 9872 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329364.1 protein_id gnl|my_center|LOCUS_28890 11666 9984 gene locus_tag LOCUS_28900 gene ilvD 11666 9984 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922486.1 protein_id gnl|my_center|LOCUS_28900 12114 11827 gene locus_tag LOCUS_28910 12114 11827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 12510 13397 gene locus_tag LOCUS_28920 12510 13397 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_28920 14377 13583 gene locus_tag LOCUS_28930 14377 13583 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_28930 15201 16151 gene locus_tag LOCUS_28940 15201 16151 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 protein_id gnl|my_center|LOCUS_28940 17361 16495 gene locus_tag LOCUS_28950 17361 16495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 18356 18841 gene locus_tag LOCUS_28960 18356 18841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 21259 18965 gene locus_tag LOCUS_28970 21259 18965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 >Feature sequence096 925 161 gene locus_tag LOCUS_28980 925 161 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_28980 2373 1309 gene locus_tag LOCUS_28990 2373 1309 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_28990 2720 3421 gene locus_tag LOCUS_29000 2720 3421 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120970.1 protein_id gnl|my_center|LOCUS_29000 3734 4594 gene locus_tag LOCUS_29010 3734 4594 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_29010 4764 6608 gene locus_tag LOCUS_29020 4764 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 6952 6725 gene locus_tag LOCUS_29030 6952 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 7087 8367 gene locus_tag LOCUS_29040 7087 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 8735 10576 gene locus_tag LOCUS_29050 8735 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 11517 10702 gene locus_tag LOCUS_29060 11517 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 12100 11585 gene locus_tag LOCUS_29070 12100 11585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 14412 12466 gene locus_tag LOCUS_29080 14412 12466 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120669.1 protein_id gnl|my_center|LOCUS_29080 16701 14788 gene locus_tag LOCUS_29090 16701 14788 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120669.1 protein_id gnl|my_center|LOCUS_29090 17082 17972 gene locus_tag LOCUS_29100 17082 17972 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081546.1 protein_id gnl|my_center|LOCUS_29100 18179 19714 gene locus_tag LOCUS_29110 18179 19714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 19904 22324 gene locus_tag LOCUS_29120 19904 22324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 >Feature sequence097 356 168 gene locus_tag LOCUS_29130 356 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 486 650 gene locus_tag LOCUS_29140 486 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 1587 1060 gene locus_tag LOCUS_29150 1587 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 2176 3606 gene locus_tag LOCUS_29160 2176 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29160 3519 3890 gene locus_tag LOCUS_29170 3519 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 5511 4639 gene locus_tag LOCUS_29180 5511 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 5863 5525 gene locus_tag LOCUS_29190 5863 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 6438 5860 gene locus_tag LOCUS_29200 6438 5860 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092923.1 protein_id gnl|my_center|LOCUS_29200 7707 6532 gene locus_tag LOCUS_29210 7707 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 8114 7797 gene locus_tag LOCUS_29220 8114 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 8389 8111 gene locus_tag LOCUS_29230 8389 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 9247 8423 gene locus_tag LOCUS_29240 9247 8423 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333288.1 protein_id gnl|my_center|LOCUS_29240 10317 9322 gene locus_tag LOCUS_29250 10317 9322 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327241.1 protein_id gnl|my_center|LOCUS_29250 12479 10428 gene locus_tag LOCUS_29260 12479 10428 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_29260 13227 13697 gene locus_tag LOCUS_29270 13227 13697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 13994 15196 gene locus_tag LOCUS_29280 13994 15196 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965859.1 protein_id gnl|my_center|LOCUS_29280 15725 15399 gene locus_tag LOCUS_29290 15725 15399 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258441.1 protein_id gnl|my_center|LOCUS_29290 16837 15722 gene locus_tag LOCUS_29300 16837 15722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_29300 17227 18570 gene locus_tag LOCUS_29310 17227 18570 CDS product IS4-like element ISRba3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117812.1 protein_id gnl|my_center|LOCUS_29310 19131 20708 gene locus_tag LOCUS_29320 gene cimA 19131 20708 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332450.1 protein_id gnl|my_center|LOCUS_29320 20736 21380 gene locus_tag LOCUS_29330 20736 21380 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037712.1 protein_id gnl|my_center|LOCUS_29330 >Feature sequence098 263 24 gene locus_tag LOCUS_29340 263 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 1080 577 gene locus_tag LOCUS_29350 1080 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 1674 1177 gene locus_tag LOCUS_29360 1674 1177 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_29360 5660 2046 gene locus_tag LOCUS_29370 5660 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 7427 5748 gene locus_tag LOCUS_29380 7427 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 10249 7424 gene locus_tag LOCUS_29390 10249 7424 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_29390 12622 10445 gene locus_tag LOCUS_29400 12622 10445 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057097.1 protein_id gnl|my_center|LOCUS_29400 13098 12619 gene locus_tag LOCUS_29410 13098 12619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 14867 13113 gene locus_tag LOCUS_29420 14867 13113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 15259 14933 gene locus_tag LOCUS_29430 15259 14933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 15782 15267 gene locus_tag LOCUS_29440 15782 15267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 16574 16068 gene locus_tag LOCUS_29450 16574 16068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 18346 16871 gene locus_tag LOCUS_29460 18346 16871 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123376.1 protein_id gnl|my_center|LOCUS_29460 19571 18588 gene locus_tag LOCUS_29470 19571 18588 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 protein_id gnl|my_center|LOCUS_29470 20145 19681 gene locus_tag LOCUS_29480 20145 19681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 20440 20859 gene locus_tag LOCUS_29490 20440 20859 CDS product DUF2267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228678.1 protein_id gnl|my_center|LOCUS_29490 21700 21377 gene locus_tag LOCUS_29500 21700 21377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 21587 21889 gene locus_tag LOCUS_29510 21587 21889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 >Feature sequence099 1360 3228 gene locus_tag LOCUS_29520 gene ilvB 1360 3228 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327661.1 protein_id gnl|my_center|LOCUS_29520 4465 3311 gene locus_tag LOCUS_29530 4465 3311 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333030.1 protein_id gnl|my_center|LOCUS_29530 5308 4505 gene locus_tag LOCUS_29540 gene proC 5308 4505 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_29540 6750 5461 gene locus_tag LOCUS_29550 6750 5461 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 protein_id gnl|my_center|LOCUS_29550 9297 7402 gene locus_tag LOCUS_29560 9297 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122284.1 protein_id gnl|my_center|LOCUS_29560 10470 9502 gene locus_tag LOCUS_29570 10470 9502 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324266.1 protein_id gnl|my_center|LOCUS_29570 10755 11459 gene locus_tag LOCUS_29580 10755 11459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 13454 11571 gene locus_tag LOCUS_29590 13454 11571 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120741.1 protein_id gnl|my_center|LOCUS_29590 13962 14228 gene locus_tag LOCUS_29600 13962 14228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 14969 16093 gene locus_tag LOCUS_29610 14969 16093 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084987.1 protein_id gnl|my_center|LOCUS_29610 16812 16198 gene locus_tag LOCUS_29620 16812 16198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 18295 16907 gene locus_tag LOCUS_29630 18295 16907 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_29630 18871 18662 gene locus_tag LOCUS_29640 18871 18662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 19452 20495 gene locus_tag LOCUS_29650 19452 20495 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 protein_id gnl|my_center|LOCUS_29650 20585 21424 gene locus_tag LOCUS_29660 20585 21424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339871.1 protein_id gnl|my_center|LOCUS_29660 >Feature sequence100 177 1943 gene locus_tag LOCUS_29670 177 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 2076 3053 gene locus_tag LOCUS_29680 2076 3053 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263043.1 protein_id gnl|my_center|LOCUS_29680 3364 3852 gene locus_tag LOCUS_29690 3364 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 3867 5093 gene locus_tag LOCUS_29700 3867 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 6684 5218 gene locus_tag LOCUS_29710 6684 5218 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124063.1 protein_id gnl|my_center|LOCUS_29710 8213 6861 gene locus_tag LOCUS_29720 8213 6861 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_29720 9351 8404 gene locus_tag LOCUS_29730 9351 8404 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615376.1 protein_id gnl|my_center|LOCUS_29730 13565 9765 gene locus_tag LOCUS_29740 13565 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 14340 13741 gene locus_tag LOCUS_29750 14340 13741 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119639.1 protein_id gnl|my_center|LOCUS_29750 17425 14468 gene locus_tag LOCUS_29760 17425 14468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 21047 17694 gene locus_tag LOCUS_29770 21047 17694 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122155.1 protein_id gnl|my_center|LOCUS_29770 >Feature sequence101 <1 633 gene locus_tag LOCUS_29780 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173442682.1:ABC transporter ATP-binding protein 662 1735 gene locus_tag LOCUS_29790 662 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 2367 4043 gene locus_tag LOCUS_29800 2367 4043 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117871.1 protein_id gnl|my_center|LOCUS_29800 4271 5176 gene locus_tag LOCUS_29810 4271 5176 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816586.1 protein_id gnl|my_center|LOCUS_29810 5540 6577 gene locus_tag LOCUS_29820 5540 6577 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_29820 6987 6754 gene locus_tag LOCUS_29830 6987 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 7355 10459 gene locus_tag LOCUS_29840 7355 10459 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921983.1 protein_id gnl|my_center|LOCUS_29840 11537 10491 gene locus_tag LOCUS_29850 11537 10491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 11698 13527 gene locus_tag LOCUS_29860 11698 13527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 13628 13906 gene locus_tag LOCUS_29870 13628 13906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 13903 14253 gene locus_tag LOCUS_29880 13903 14253 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_29880 14275 15768 gene locus_tag LOCUS_29890 14275 15768 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120961.1 protein_id gnl|my_center|LOCUS_29890 16014 16523 gene locus_tag LOCUS_29900 16014 16523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 16645 18189 gene locus_tag LOCUS_29910 16645 18189 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_29910 18306 18797 gene locus_tag LOCUS_29920 18306 18797 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615935.1 protein_id gnl|my_center|LOCUS_29920 18856 19461 gene locus_tag LOCUS_29930 18856 19461 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_29930 >Feature sequence102 3542 5107 gene locus_tag LOCUS_29940 3542 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 5873 7519 gene locus_tag LOCUS_29950 5873 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 8635 7700 gene locus_tag LOCUS_29960 gene truB 8635 7700 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258869.1 protein_id gnl|my_center|LOCUS_29960 8961 8886 gene locus_tag LOCUS_t00210 8961 8886 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 8963 9145 gene locus_tag LOCUS_29970 8963 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 9291 10463 gene locus_tag LOCUS_29980 9291 10463 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392163.1 protein_id gnl|my_center|LOCUS_29980 10893 10591 gene locus_tag LOCUS_29990 10893 10591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 11734 11904 gene locus_tag LOCUS_30000 11734 11904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 11995 12333 gene locus_tag LOCUS_30010 11995 12333 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325418.1 protein_id gnl|my_center|LOCUS_30010 12408 12746 gene locus_tag LOCUS_30020 12408 12746 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205430.1 protein_id gnl|my_center|LOCUS_30020 12876 15617 gene locus_tag LOCUS_30030 12876 15617 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391286.1 protein_id gnl|my_center|LOCUS_30030 15654 16001 gene locus_tag LOCUS_30040 15654 16001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 16434 18578 gene locus_tag LOCUS_30050 16434 18578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 19245 18760 gene locus_tag LOCUS_30060 19245 18760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 >Feature sequence103 2779 3066 gene locus_tag LOCUS_30070 2779 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 4895 3534 gene locus_tag LOCUS_30080 4895 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 6690 5176 gene locus_tag LOCUS_30090 6690 5176 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_30090 9542 6819 gene locus_tag LOCUS_30100 9542 6819 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615881.1 protein_id gnl|my_center|LOCUS_30100 9959 11434 gene locus_tag LOCUS_30110 9959 11434 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922239.1 protein_id gnl|my_center|LOCUS_30110 11816 14704 gene locus_tag LOCUS_30120 11816 14704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 14800 15612 gene locus_tag LOCUS_30130 14800 15612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 15667 17136 gene locus_tag LOCUS_30140 15667 17136 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_30140 17450 18709 gene locus_tag LOCUS_30150 17450 18709 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_30150 20096 18963 gene locus_tag LOCUS_30160 20096 18963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence104 615 3047 gene locus_tag LOCUS_30170 615 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 3980 3684 gene locus_tag LOCUS_30180 3980 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 3904 5055 gene locus_tag LOCUS_30190 3904 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 5055 6311 gene locus_tag LOCUS_30200 5055 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 7806 6463 gene locus_tag LOCUS_30210 7806 6463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 9885 7960 gene locus_tag LOCUS_30220 gene dxs 9885 7960 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325559.1 protein_id gnl|my_center|LOCUS_30220 11071 10067 gene locus_tag LOCUS_30230 11071 10067 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140419.1 protein_id gnl|my_center|LOCUS_30230 11932 13848 gene locus_tag LOCUS_30240 11932 13848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 13327 13421 gene locus_tag LOCUS_t00220 13327 13421 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14284 13862 gene locus_tag LOCUS_30250 14284 13862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 14816 15385 gene locus_tag LOCUS_30260 14816 15385 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530705.1 protein_id gnl|my_center|LOCUS_30260 15385 17553 gene locus_tag LOCUS_30270 15385 17553 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037857.1 protein_id gnl|my_center|LOCUS_30270 17550 18584 gene locus_tag LOCUS_30280 17550 18584 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727119.1 protein_id gnl|my_center|LOCUS_30280 18865 19080 gene locus_tag LOCUS_30290 18865 19080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 >Feature sequence105 499 3084 gene locus_tag LOCUS_30300 499 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 4990 3245 gene locus_tag LOCUS_30310 4990 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 6482 5271 gene locus_tag LOCUS_30320 6482 5271 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028853.1 protein_id gnl|my_center|LOCUS_30320 7981 6974 gene locus_tag LOCUS_30330 7981 6974 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_30330 8847 8446 gene locus_tag LOCUS_30340 8847 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 11106 8866 gene locus_tag LOCUS_30350 11106 8866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 11448 12338 gene locus_tag LOCUS_30360 11448 12338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 13612 12548 gene locus_tag LOCUS_30370 13612 12548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 14089 14577 gene locus_tag LOCUS_30380 14089 14577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921922.1 protein_id gnl|my_center|LOCUS_30380 14944 14687 gene locus_tag LOCUS_30390 14944 14687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 15188 14919 gene locus_tag LOCUS_30400 15188 14919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 15187 16854 gene locus_tag LOCUS_30410 15187 16854 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121094.1 protein_id gnl|my_center|LOCUS_30410 18138 16969 gene locus_tag LOCUS_30420 18138 16969 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122678.1 protein_id gnl|my_center|LOCUS_30420 19662 18511 gene locus_tag LOCUS_30430 19662 18511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 20706 19873 gene locus_tag LOCUS_30440 20706 19873 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943341.1 protein_id gnl|my_center|LOCUS_30440 >Feature sequence106 219 578 gene locus_tag LOCUS_30450 219 578 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_30450 990 550 gene locus_tag LOCUS_30460 gene mutT 990 550 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140871.1 protein_id gnl|my_center|LOCUS_30460 1508 987 gene locus_tag LOCUS_30470 1508 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119419.1 protein_id gnl|my_center|LOCUS_30470 2412 1600 gene locus_tag LOCUS_30480 gene fabI 2412 1600 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383908.1 protein_id gnl|my_center|LOCUS_30480 3889 2717 gene locus_tag LOCUS_30490 3889 2717 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616070.1 protein_id gnl|my_center|LOCUS_30490 4261 4680 gene locus_tag LOCUS_30500 4261 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615996.1 protein_id gnl|my_center|LOCUS_30500 5165 4797 gene locus_tag LOCUS_30510 5165 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123450.1 protein_id gnl|my_center|LOCUS_30510 5734 5222 gene locus_tag LOCUS_30520 5734 5222 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110309.1 protein_id gnl|my_center|LOCUS_30520 8919 5956 gene locus_tag LOCUS_30530 8919 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 9475 9756 gene locus_tag LOCUS_30540 9475 9756 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329447.1 protein_id gnl|my_center|LOCUS_30540 11927 9864 gene locus_tag LOCUS_30550 11927 9864 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327900.1 protein_id gnl|my_center|LOCUS_30550 12469 12828 gene locus_tag LOCUS_30560 gene flgB 12469 12828 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_30560 12960 13403 gene locus_tag LOCUS_30570 gene flgC 12960 13403 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_30570 13406 13705 gene locus_tag LOCUS_30580 13406 13705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 13766 14548 gene locus_tag LOCUS_30590 13766 14548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 15058 14633 gene locus_tag LOCUS_30600 15058 14633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 17458 15146 gene locus_tag LOCUS_30610 17458 15146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 18505 17678 gene locus_tag LOCUS_30620 gene hag 18505 17678 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_30620 20415 18826 gene locus_tag LOCUS_30630 20415 18826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 >Feature sequence107 1095 2681 gene locus_tag LOCUS_30640 1095 2681 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030106.1 protein_id gnl|my_center|LOCUS_30640 2800 3804 gene locus_tag LOCUS_30650 2800 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 5140 3932 gene locus_tag LOCUS_30660 5140 3932 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669743.1 protein_id gnl|my_center|LOCUS_30660 7546 5282 gene locus_tag LOCUS_30670 7546 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 10070 7647 gene locus_tag LOCUS_30680 10070 7647 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_30680 12674 10263 gene locus_tag LOCUS_30690 12674 10263 CDS product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260401.1 protein_id gnl|my_center|LOCUS_30690 14788 13469 gene locus_tag LOCUS_30700 14788 13469 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_30700 16467 15286 gene locus_tag LOCUS_30710 16467 15286 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155556.1 protein_id gnl|my_center|LOCUS_30710 16847 17662 gene locus_tag LOCUS_30720 16847 17662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 17731 19302 gene locus_tag LOCUS_30730 17731 19302 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258274.1 protein_id gnl|my_center|LOCUS_30730 19493 20323 gene locus_tag LOCUS_30740 19493 20323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 >Feature sequence108 442 164 gene locus_tag LOCUS_30750 442 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 705 5243 gene locus_tag LOCUS_30760 705 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 5394 5936 gene locus_tag LOCUS_30770 5394 5936 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_30770 6082 6678 gene locus_tag LOCUS_30780 6082 6678 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928883.1 protein_id gnl|my_center|LOCUS_30780 7175 6675 gene locus_tag LOCUS_30790 7175 6675 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_30790 7301 8077 gene locus_tag LOCUS_30800 7301 8077 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816500.1 protein_id gnl|my_center|LOCUS_30800 8221 9150 gene locus_tag LOCUS_30810 8221 9150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 9181 9630 gene locus_tag LOCUS_30820 9181 9630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 11851 9737 gene locus_tag LOCUS_30830 11851 9737 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335531.1 protein_id gnl|my_center|LOCUS_30830 12310 12582 gene locus_tag LOCUS_30840 12310 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 12662 13366 gene locus_tag LOCUS_30850 12662 13366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 13401 13631 gene locus_tag LOCUS_30860 13401 13631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 13819 18453 gene locus_tag LOCUS_30870 13819 18453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 19134 18766 gene locus_tag LOCUS_30880 19134 18766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 19136 19450 gene locus_tag LOCUS_30890 19136 19450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 >Feature sequence109 2962 179 gene locus_tag LOCUS_30900 2962 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 3646 3059 gene locus_tag LOCUS_30910 3646 3059 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_30910 7264 3803 gene locus_tag LOCUS_30920 7264 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 7559 10684 gene locus_tag LOCUS_30930 7559 10684 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120353.1 protein_id gnl|my_center|LOCUS_30930 10928 11605 gene locus_tag LOCUS_30940 10928 11605 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414103.1 protein_id gnl|my_center|LOCUS_30940 11897 12790 gene locus_tag LOCUS_30950 11897 12790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 12966 13847 gene locus_tag LOCUS_30960 12966 13847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 14468 15808 gene locus_tag LOCUS_30970 14468 15808 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_30970 18928 15980 gene locus_tag LOCUS_30980 18928 15980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 <20250 19196 gene locus_tag LOCUS_30990 <20250 19196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224375.1:SWIM zinc finger family protein >Feature sequence110 1278 100 gene locus_tag LOCUS_31000 1278 100 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921425.1 protein_id gnl|my_center|LOCUS_31000 1562 2401 gene locus_tag LOCUS_31010 1562 2401 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_31010 2709 4526 gene locus_tag LOCUS_31020 gene ftsH 2709 4526 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325413.1 protein_id gnl|my_center|LOCUS_31020 5833 4664 gene locus_tag LOCUS_31030 5833 4664 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_31030 7046 5844 gene locus_tag LOCUS_31040 7046 5844 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_31040 8518 7091 gene locus_tag LOCUS_31050 8518 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 8925 10112 gene locus_tag LOCUS_31060 gene sucC 8925 10112 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327386.1 protein_id gnl|my_center|LOCUS_31060 10135 10842 gene locus_tag LOCUS_31070 10135 10842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 10899 11798 gene locus_tag LOCUS_31080 gene sucD 10899 11798 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327387.1 protein_id gnl|my_center|LOCUS_31080 11811 12407 gene locus_tag LOCUS_31090 11811 12407 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_31090 12714 13676 gene locus_tag LOCUS_31100 gene tal 12714 13676 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533671.1 protein_id gnl|my_center|LOCUS_31100 13797 14747 gene locus_tag LOCUS_31110 13797 14747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 14771 15661 gene locus_tag LOCUS_31120 14771 15661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 15984 17303 gene locus_tag LOCUS_31130 15984 17303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 18192 17410 gene locus_tag LOCUS_31140 18192 17410 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527984.1 protein_id gnl|my_center|LOCUS_31140 18252 18545 gene locus_tag LOCUS_31150 18252 18545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 18607 19500 gene locus_tag LOCUS_31160 18607 19500 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325399.1 protein_id gnl|my_center|LOCUS_31160 19751 20002 gene locus_tag LOCUS_31170 19751 20002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 >Feature sequence111 3833 687 gene locus_tag LOCUS_31180 3833 687 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666716.1 protein_id gnl|my_center|LOCUS_31180 6804 3895 gene locus_tag LOCUS_31190 6804 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 7481 9745 gene locus_tag LOCUS_31200 gene pilM 7481 9745 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119060.1 protein_id gnl|my_center|LOCUS_31200 9921 11588 gene locus_tag LOCUS_31210 9921 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 11687 13966 gene locus_tag LOCUS_31220 11687 13966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 14983 14207 gene locus_tag LOCUS_31230 14983 14207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 16022 15309 gene locus_tag LOCUS_31240 16022 15309 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937857.1 protein_id gnl|my_center|LOCUS_31240 17518 16022 gene locus_tag LOCUS_31250 17518 16022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 18848 17757 gene locus_tag LOCUS_31260 18848 17757 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530006.1 protein_id gnl|my_center|LOCUS_31260 <20042 18976 gene locus_tag LOCUS_31270 <20042 18976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937854.1:branched-chain amino acid ABC transporter permease >Feature sequence112 1082 300 gene locus_tag LOCUS_31280 1082 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 1694 4126 gene locus_tag LOCUS_31290 1694 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 6027 4354 gene locus_tag LOCUS_31300 6027 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 9009 6064 gene locus_tag LOCUS_31310 9009 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 9484 9170 gene locus_tag LOCUS_31320 9484 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 9648 10343 gene locus_tag LOCUS_31330 9648 10343 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024087.1 protein_id gnl|my_center|LOCUS_31330 10737 11135 gene locus_tag LOCUS_31340 10737 11135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 11520 14387 gene locus_tag LOCUS_31350 11520 14387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 15666 14434 gene locus_tag LOCUS_31360 15666 14434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 19488 15751 gene locus_tag LOCUS_31370 19488 15751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 >Feature sequence113 2611 1178 gene locus_tag LOCUS_31380 2611 1178 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_31380 5014 2738 gene locus_tag LOCUS_31390 5014 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 7235 5019 gene locus_tag LOCUS_31400 7235 5019 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816832.1 protein_id gnl|my_center|LOCUS_31400 8782 8069 gene locus_tag LOCUS_31410 8782 8069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 10117 8801 gene locus_tag LOCUS_31420 10117 8801 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328879.1 protein_id gnl|my_center|LOCUS_31420 10573 11430 gene locus_tag LOCUS_31430 10573 11430 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_31430 11478 11858 gene locus_tag LOCUS_31440 11478 11858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 11891 13030 gene locus_tag LOCUS_31450 gene mqnC 11891 13030 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921709.1 protein_id gnl|my_center|LOCUS_31450 13363 14121 gene locus_tag LOCUS_31460 13363 14121 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_31460 14265 16745 gene locus_tag LOCUS_31470 14265 16745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 17178 18464 gene locus_tag LOCUS_31480 17178 18464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 19812 18481 gene locus_tag LOCUS_31490 19812 18481 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_31490 >Feature sequence114 1393 146 gene locus_tag LOCUS_31500 1393 146 CDS product ISNCY-like element ISTde1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679811.1 protein_id gnl|my_center|LOCUS_31500 1608 1375 gene locus_tag LOCUS_31510 1608 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 1607 1816 gene locus_tag LOCUS_31520 1607 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 2076 1813 gene locus_tag LOCUS_31530 2076 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 3470 2472 gene locus_tag LOCUS_31540 3470 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 4756 3635 gene locus_tag LOCUS_31550 4756 3635 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921849.1 protein_id gnl|my_center|LOCUS_31550 5131 5250 gene locus_tag LOCUS_31560 5131 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 5617 6960 gene locus_tag LOCUS_31570 5617 6960 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_31570 8474 7890 gene locus_tag LOCUS_31580 8474 7890 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705502.1 protein_id gnl|my_center|LOCUS_31580 9209 8592 gene locus_tag LOCUS_31590 9209 8592 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881371.1 protein_id gnl|my_center|LOCUS_31590 9746 9516 gene locus_tag LOCUS_31600 9746 9516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 9949 9743 gene locus_tag LOCUS_31610 9949 9743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 10722 10084 gene locus_tag LOCUS_31620 10722 10084 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028140.1 protein_id gnl|my_center|LOCUS_31620 10875 11042 gene locus_tag LOCUS_31630 10875 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 11017 12120 gene locus_tag LOCUS_31640 gene mexE 11017 12120 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103549.1 protein_id gnl|my_center|LOCUS_31640 12190 15498 gene locus_tag LOCUS_31650 12190 15498 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380455.1 protein_id gnl|my_center|LOCUS_31650 15520 17361 gene locus_tag LOCUS_31660 15520 17361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31660 17362 18840 gene locus_tag LOCUS_31670 17362 18840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31670 19029 19382 gene locus_tag LOCUS_31680 19029 19382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 >Feature sequence115 23 2077 gene locus_tag LOCUS_31690 23 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 2161 3525 gene locus_tag LOCUS_31700 2161 3525 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_31700 4956 3685 gene locus_tag LOCUS_31710 4956 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 5993 5130 gene locus_tag LOCUS_31720 5993 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 7451 6114 gene locus_tag LOCUS_31730 7451 6114 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921386.1 protein_id gnl|my_center|LOCUS_31730 8788 7538 gene locus_tag LOCUS_31740 8788 7538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 10131 9001 gene locus_tag LOCUS_31750 10131 9001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 10629 10264 gene locus_tag LOCUS_31760 10629 10264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 11342 10722 gene locus_tag LOCUS_31770 11342 10722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 11962 12624 gene locus_tag LOCUS_31780 11962 12624 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_31780 14093 12714 gene locus_tag LOCUS_31790 14093 12714 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_31790 15813 14464 gene locus_tag LOCUS_31800 15813 14464 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259633.1 protein_id gnl|my_center|LOCUS_31800 16081 15839 gene locus_tag LOCUS_31810 16081 15839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 16385 16128 gene locus_tag LOCUS_31820 16385 16128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 17428 16406 gene locus_tag LOCUS_31830 17428 16406 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_31830 17818 17483 gene locus_tag LOCUS_31840 17818 17483 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_31840 18255 18707 gene locus_tag LOCUS_31850 18255 18707 CDS product TadE/TadG family type IV pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939405.1 protein_id gnl|my_center|LOCUS_31850 19286 19092 gene locus_tag LOCUS_31860 19286 19092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 19413 19225 gene locus_tag LOCUS_31870 19413 19225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 >Feature sequence116 122 3232 gene locus_tag LOCUS_31880 122 3232 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666716.1 protein_id gnl|my_center|LOCUS_31880 3454 4713 gene locus_tag LOCUS_31890 3454 4713 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121153.1 protein_id gnl|my_center|LOCUS_31890 4743 5015 gene locus_tag LOCUS_31900 4743 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 5008 5586 gene locus_tag LOCUS_31910 5008 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 5693 8302 gene locus_tag LOCUS_31920 5693 8302 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_31920 8560 9207 gene locus_tag LOCUS_31930 8560 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 9468 12617 gene locus_tag LOCUS_31940 9468 12617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 14343 12778 gene locus_tag LOCUS_31950 14343 12778 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124008.1 protein_id gnl|my_center|LOCUS_31950 15004 14504 gene locus_tag LOCUS_31960 15004 14504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 15994 15011 gene locus_tag LOCUS_31970 15994 15011 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124010.1 protein_id gnl|my_center|LOCUS_31970 18504 15991 gene locus_tag LOCUS_31980 18504 15991 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922594.1 protein_id gnl|my_center|LOCUS_31980 <19492 18494 gene locus_tag LOCUS_31990 <19492 18494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211175379.1:DUF58 domain-containing protein >Feature sequence117 6022 1664 gene locus_tag LOCUS_32000 6022 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 6725 6264 gene locus_tag LOCUS_32010 gene nrdR 6725 6264 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454958.1 protein_id gnl|my_center|LOCUS_32010 8431 7019 gene locus_tag LOCUS_32020 8431 7019 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_32020 8827 10830 gene locus_tag LOCUS_32030 gene mutL 8827 10830 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121618.1 protein_id gnl|my_center|LOCUS_32030 11120 12562 gene locus_tag LOCUS_32040 gene aroE 11120 12562 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_32040 12677 13216 gene locus_tag LOCUS_32050 gene aroK 12677 13216 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245596.1 protein_id gnl|my_center|LOCUS_32050 13213 14511 gene locus_tag LOCUS_32060 13213 14511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 14702 15562 gene locus_tag LOCUS_32070 14702 15562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 16227 15616 gene locus_tag LOCUS_32080 16227 15616 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256910.1 protein_id gnl|my_center|LOCUS_32080 >Feature sequence118 507 1283 gene locus_tag LOCUS_32090 507 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 3617 1410 gene locus_tag LOCUS_32100 3617 1410 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_32100 4697 3834 gene locus_tag LOCUS_32110 4697 3834 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117849.1 protein_id gnl|my_center|LOCUS_32110 6824 4842 gene locus_tag LOCUS_32120 6824 4842 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922336.1 protein_id gnl|my_center|LOCUS_32120 7708 6947 gene locus_tag LOCUS_32130 7708 6947 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_32130 10302 8077 gene locus_tag LOCUS_32140 10302 8077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 11568 11158 gene locus_tag LOCUS_32150 11568 11158 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086522.1 protein_id gnl|my_center|LOCUS_32150 12883 11759 gene locus_tag LOCUS_32160 gene mqnE 12883 11759 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339462.1 protein_id gnl|my_center|LOCUS_32160 14678 13146 gene locus_tag LOCUS_32170 14678 13146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921352.1 protein_id gnl|my_center|LOCUS_32170 16321 15272 gene locus_tag LOCUS_32180 16321 15272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 16900 16376 gene locus_tag LOCUS_32190 16900 16376 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401881.1 protein_id gnl|my_center|LOCUS_32190 17323 17045 gene locus_tag LOCUS_32200 17323 17045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 19264 17528 gene locus_tag LOCUS_32210 gene aspS 19264 17528 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121776.1 protein_id gnl|my_center|LOCUS_32210 >Feature sequence119 <1 2454 gene locus_tag LOCUS_32220 <1 2454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615420.1:VCBS repeat-containing protein 2598 4112 gene locus_tag LOCUS_32230 2598 4112 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_32230 4929 4258 gene locus_tag LOCUS_32240 4929 4258 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184304752.1 protein_id gnl|my_center|LOCUS_32240 8888 5106 gene locus_tag LOCUS_32250 gene metH 8888 5106 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922281.1 protein_id gnl|my_center|LOCUS_32250 9835 8966 gene locus_tag LOCUS_32260 gene dinD 9835 8966 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_32260 10733 9849 gene locus_tag LOCUS_32270 gene metF 10733 9849 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615859.1 protein_id gnl|my_center|LOCUS_32270 10973 12370 gene locus_tag LOCUS_32280 gene ahcY 10973 12370 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327756.1 protein_id gnl|my_center|LOCUS_32280 14176 12650 gene locus_tag LOCUS_32290 14176 12650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 14577 15080 gene locus_tag LOCUS_32300 14577 15080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 15148 16374 gene locus_tag LOCUS_32310 15148 16374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 18892 16694 gene locus_tag LOCUS_32320 18892 16694 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921918.1 protein_id gnl|my_center|LOCUS_32320 >Feature sequence120 160 510 gene locus_tag LOCUS_32330 160 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 2823 706 gene locus_tag LOCUS_32340 2823 706 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123067.1 protein_id gnl|my_center|LOCUS_32340 3519 3169 gene locus_tag LOCUS_32350 3519 3169 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190909147.1 protein_id gnl|my_center|LOCUS_32350 3807 3523 gene locus_tag LOCUS_32360 3807 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 5200 4031 gene locus_tag LOCUS_32370 5200 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 6149 5328 gene locus_tag LOCUS_32380 6149 5328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332037.1 protein_id gnl|my_center|LOCUS_32380 7179 6340 gene locus_tag LOCUS_32390 7179 6340 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815039.1 protein_id gnl|my_center|LOCUS_32390 7582 8208 gene locus_tag LOCUS_32400 7582 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 8323 9741 gene locus_tag LOCUS_32410 8323 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 9866 10180 gene locus_tag LOCUS_32420 9866 10180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 10366 11757 gene locus_tag LOCUS_32430 10366 11757 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143713.1 protein_id gnl|my_center|LOCUS_32430 11866 13128 gene locus_tag LOCUS_32440 11866 13128 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_32440 13447 17343 gene locus_tag LOCUS_32450 13447 17343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 17767 17606 gene locus_tag LOCUS_32460 17767 17606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 18822 17929 gene locus_tag LOCUS_32470 18822 17929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 >Feature sequence121 4758 3295 gene locus_tag LOCUS_32480 4758 3295 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525274.1 protein_id gnl|my_center|LOCUS_32480 7503 4900 gene locus_tag LOCUS_32490 7503 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 7909 10203 gene locus_tag LOCUS_32500 gene ppk1 7909 10203 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922240.1 protein_id gnl|my_center|LOCUS_32500 10543 11040 gene locus_tag LOCUS_32510 10543 11040 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532447.1 protein_id gnl|my_center|LOCUS_32510 >Feature sequence122 371 2014 gene locus_tag LOCUS_32520 371 2014 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762019.1 protein_id gnl|my_center|LOCUS_32520 4474 2084 gene locus_tag LOCUS_32530 4474 2084 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 protein_id gnl|my_center|LOCUS_32530 4783 7728 gene locus_tag LOCUS_32540 4783 7728 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119333.1 protein_id gnl|my_center|LOCUS_32540 7948 9495 gene locus_tag LOCUS_32550 7948 9495 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921354.1 protein_id gnl|my_center|LOCUS_32550 10057 9635 gene locus_tag LOCUS_32560 10057 9635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 11293 10259 gene locus_tag LOCUS_32570 11293 10259 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_32570 11930 12970 gene locus_tag LOCUS_32580 11930 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 13211 16048 gene locus_tag LOCUS_32590 13211 16048 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119333.1 protein_id gnl|my_center|LOCUS_32590 >Feature sequence123 1058 462 gene locus_tag LOCUS_32600 1058 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 4426 1412 gene locus_tag LOCUS_32610 4426 1412 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941349.1 protein_id gnl|my_center|LOCUS_32610 5976 4672 gene locus_tag LOCUS_32620 gene mnmA 5976 4672 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120981.1 protein_id gnl|my_center|LOCUS_32620 7577 6090 gene locus_tag LOCUS_32630 7577 6090 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142192546.1 protein_id gnl|my_center|LOCUS_32630 8797 7748 gene locus_tag LOCUS_32640 8797 7748 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921881.1 protein_id gnl|my_center|LOCUS_32640 10676 8868 gene locus_tag LOCUS_32650 10676 8868 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332595.1 protein_id gnl|my_center|LOCUS_32650 11804 10860 gene locus_tag LOCUS_32660 11804 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 12658 11885 gene locus_tag LOCUS_32670 12658 11885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 13752 12940 gene locus_tag LOCUS_32680 13752 12940 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856990.1 protein_id gnl|my_center|LOCUS_32680 14725 13790 gene locus_tag LOCUS_32690 14725 13790 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 protein_id gnl|my_center|LOCUS_32690 16004 14727 gene locus_tag LOCUS_32700 16004 14727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 18226 16187 gene locus_tag LOCUS_32710 18226 16187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 >Feature sequence124 529 1650 gene locus_tag LOCUS_32720 529 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 1842 4229 gene locus_tag LOCUS_32730 1842 4229 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008668005.1 protein_id gnl|my_center|LOCUS_32730 4254 5612 gene locus_tag LOCUS_32740 4254 5612 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326881.1 protein_id gnl|my_center|LOCUS_32740 5824 7023 gene locus_tag LOCUS_32750 5824 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 7220 9934 gene locus_tag LOCUS_32760 7220 9934 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_32760 9993 11276 gene locus_tag LOCUS_32770 9993 11276 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121153.1 protein_id gnl|my_center|LOCUS_32770 11314 11399 gene locus_tag LOCUS_t00230 11314 11399 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11786 11634 gene locus_tag LOCUS_32780 11786 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 12253 11996 gene locus_tag LOCUS_32790 12253 11996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 12467 12333 gene locus_tag LOCUS_32800 12467 12333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 13944 12481 gene locus_tag LOCUS_32810 13944 12481 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333818.1 protein_id gnl|my_center|LOCUS_32810 16601 13941 gene locus_tag LOCUS_32820 16601 13941 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008668648.1 protein_id gnl|my_center|LOCUS_32820 18105 16711 gene locus_tag LOCUS_32830 18105 16711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 >Feature sequence125 349 687 gene locus_tag LOCUS_32840 349 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 669 866 gene locus_tag LOCUS_32850 669 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 856 1998 gene locus_tag LOCUS_32860 gene rhuM 856 1998 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280585.1 protein_id gnl|my_center|LOCUS_32860 1995 3389 gene locus_tag LOCUS_32870 1995 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 3391 4197 gene locus_tag LOCUS_32880 3391 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 4273 7149 gene locus_tag LOCUS_32890 4273 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 7321 7584 gene locus_tag LOCUS_32900 7321 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 7762 8040 gene locus_tag LOCUS_32910 7762 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 8376 9353 gene locus_tag LOCUS_32920 8376 9353 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 protein_id gnl|my_center|LOCUS_32920 9445 10017 gene locus_tag LOCUS_32930 9445 10017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 10029 10265 gene locus_tag LOCUS_32940 10029 10265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 10267 11172 gene locus_tag LOCUS_32950 10267 11172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 11097 11870 gene locus_tag LOCUS_32960 11097 11870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 13878 12706 gene locus_tag LOCUS_32970 13878 12706 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922679.1 protein_id gnl|my_center|LOCUS_32970 14076 16553 gene locus_tag LOCUS_32980 14076 16553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 16748 16876 gene locus_tag LOCUS_32990 16748 16876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 >Feature sequence126 440 631 gene locus_tag LOCUS_33000 440 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 962 2464 gene locus_tag LOCUS_33010 962 2464 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113502.1 protein_id gnl|my_center|LOCUS_33010 2664 3482 gene locus_tag LOCUS_33020 2664 3482 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009567369.1 protein_id gnl|my_center|LOCUS_33020 3785 3438 gene locus_tag LOCUS_33030 3785 3438 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326321.1 protein_id gnl|my_center|LOCUS_33030 4048 5502 gene locus_tag LOCUS_33040 4048 5502 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_33040 5794 5973 gene locus_tag LOCUS_33050 gene rpmF 5794 5973 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883594.1 protein_id gnl|my_center|LOCUS_33050 5980 6990 gene locus_tag LOCUS_33060 gene plsX 5980 6990 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938504.1 protein_id gnl|my_center|LOCUS_33060 7084 7995 gene locus_tag LOCUS_33070 gene fabD 7084 7995 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117846.1 protein_id gnl|my_center|LOCUS_33070 8301 8543 gene locus_tag LOCUS_33080 gene acpP 8301 8543 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_33080 8547 9791 gene locus_tag LOCUS_33090 gene fabF 8547 9791 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331838.1 protein_id gnl|my_center|LOCUS_33090 10031 11347 gene locus_tag LOCUS_33100 10031 11347 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 protein_id gnl|my_center|LOCUS_33100 12982 11555 gene locus_tag LOCUS_33110 12982 11555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 14086 13118 gene locus_tag LOCUS_33120 14086 13118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 14321 15526 gene locus_tag LOCUS_33130 14321 15526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325761.1 protein_id gnl|my_center|LOCUS_33130 15597 15917 gene locus_tag LOCUS_33140 15597 15917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 16046 17437 gene locus_tag LOCUS_33150 16046 17437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 >Feature sequence127 281 353 gene locus_tag LOCUS_t00240 281 353 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2291 681 gene locus_tag LOCUS_33160 2291 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 3696 2608 gene locus_tag LOCUS_33170 3696 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 4991 4038 gene locus_tag LOCUS_33180 4991 4038 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_33180 5707 6138 gene locus_tag LOCUS_33190 5707 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 6603 6181 gene locus_tag LOCUS_33200 6603 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 7214 6600 gene locus_tag LOCUS_33210 7214 6600 CDS product methionine-R-sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921515.1 protein_id gnl|my_center|LOCUS_33210 7522 8082 gene locus_tag LOCUS_33220 7522 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 8555 8740 gene locus_tag LOCUS_33230 8555 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 8756 10060 gene locus_tag LOCUS_33240 8756 10060 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123644.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33240 10344 11348 gene locus_tag LOCUS_33250 10344 11348 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922391.1 protein_id gnl|my_center|LOCUS_33250 11348 11749 gene locus_tag LOCUS_33260 11348 11749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 13476 11773 gene locus_tag LOCUS_33270 13476 11773 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_33270 15094 13577 gene locus_tag LOCUS_33280 15094 13577 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123371.1 protein_id gnl|my_center|LOCUS_33280 15499 16173 gene locus_tag LOCUS_33290 15499 16173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 16373 18262 gene locus_tag LOCUS_33300 16373 18262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 >Feature sequence128 4058 5194 gene locus_tag LOCUS_33310 4058 5194 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261424.1 protein_id gnl|my_center|LOCUS_33310 6187 5237 gene locus_tag LOCUS_33320 6187 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 6962 6204 gene locus_tag LOCUS_33330 6962 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 7589 7182 gene locus_tag LOCUS_33340 7589 7182 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327186.1 protein_id gnl|my_center|LOCUS_33340 9096 7654 gene locus_tag LOCUS_33350 gene atpD 9096 7654 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122672.1 protein_id gnl|my_center|LOCUS_33350 10064 9174 gene locus_tag LOCUS_33360 gene atpG 10064 9174 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122671.1 protein_id gnl|my_center|LOCUS_33360 11712 10189 gene locus_tag LOCUS_33370 gene atpA 11712 10189 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334261.1 protein_id gnl|my_center|LOCUS_33370 12301 11663 gene locus_tag LOCUS_33380 gene atpH 12301 11663 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816489.1 protein_id gnl|my_center|LOCUS_33380 13029 12430 gene locus_tag LOCUS_33390 13029 12430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 13461 13141 gene locus_tag LOCUS_33400 13461 13141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 14493 13576 gene locus_tag LOCUS_33410 14493 13576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 15261 14929 gene locus_tag LOCUS_33420 15261 14929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 17191 15599 gene locus_tag LOCUS_33430 17191 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 <18540 17391 gene locus_tag LOCUS_33440 <18540 17391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615947.1:terpene cyclase/mutase family protein >Feature sequence129 339 1238 gene locus_tag LOCUS_33450 339 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 1429 1593 gene locus_tag LOCUS_33460 1429 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 1717 2679 gene locus_tag LOCUS_33470 1717 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 4043 2748 gene locus_tag LOCUS_33480 4043 2748 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922245.1 protein_id gnl|my_center|LOCUS_33480 4402 5835 gene locus_tag LOCUS_33490 4402 5835 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029264.1 protein_id gnl|my_center|LOCUS_33490 5932 6720 gene locus_tag LOCUS_33500 5932 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 6798 7586 gene locus_tag LOCUS_33510 6798 7586 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478264.1 protein_id gnl|my_center|LOCUS_33510 8487 7867 gene locus_tag LOCUS_33520 8487 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33520 8617 8372 gene locus_tag LOCUS_33530 8617 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 9341 10843 gene locus_tag LOCUS_33540 9341 10843 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334705.1 protein_id gnl|my_center|LOCUS_33540 11065 11541 gene locus_tag LOCUS_33550 11065 11541 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143422.1 protein_id gnl|my_center|LOCUS_33550 12055 12969 gene locus_tag LOCUS_33560 12055 12969 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_33560 13104 14762 gene locus_tag LOCUS_33570 13104 14762 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325469.1 protein_id gnl|my_center|LOCUS_33570 14759 16108 gene locus_tag LOCUS_33580 14759 16108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 16336 18132 gene locus_tag LOCUS_33590 16336 18132 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329990.1 protein_id gnl|my_center|LOCUS_33590 >Feature sequence130 220 564 gene locus_tag LOCUS_33600 220 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33600 611 775 gene locus_tag LOCUS_33610 611 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33610 975 2225 gene locus_tag LOCUS_33620 gene dnaB 975 2225 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869407.1 protein_id gnl|my_center|LOCUS_33620 2473 2733 gene locus_tag LOCUS_33630 2473 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 2956 6363 gene locus_tag LOCUS_33640 2956 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 6435 8753 gene locus_tag LOCUS_33650 6435 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 8805 10049 gene locus_tag LOCUS_33660 8805 10049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 10233 11132 gene locus_tag LOCUS_33670 10233 11132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760094.1 protein_id gnl|my_center|LOCUS_33670 12902 11271 gene locus_tag LOCUS_33680 12902 11271 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227162.1 protein_id gnl|my_center|LOCUS_33680 14536 13115 gene locus_tag LOCUS_33690 14536 13115 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_33690 17207 14550 gene locus_tag LOCUS_33700 17207 14550 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120107.1 protein_id gnl|my_center|LOCUS_33700 <18421 17204 gene locus_tag LOCUS_33710 <18421 17204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119052.1:DUF1501 domain-containing protein >Feature sequence131 409 669 gene locus_tag LOCUS_33720 409 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 869 2152 gene locus_tag LOCUS_33730 869 2152 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921592.1 protein_id gnl|my_center|LOCUS_33730 2370 2810 gene locus_tag LOCUS_33740 2370 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 4928 3117 gene locus_tag LOCUS_33750 4928 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 5654 5301 gene locus_tag LOCUS_33760 5654 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 9746 6006 gene locus_tag LOCUS_33770 gene ileS 9746 6006 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228416.1 protein_id gnl|my_center|LOCUS_33770 10212 11447 gene locus_tag LOCUS_33780 10212 11447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 13432 11681 gene locus_tag LOCUS_33790 13432 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 13942 13667 gene locus_tag LOCUS_33800 13942 13667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 14306 15820 gene locus_tag LOCUS_33810 14306 15820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333737.1 protein_id gnl|my_center|LOCUS_33810 17187 15769 gene locus_tag LOCUS_33820 17187 15769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118666.1 protein_id gnl|my_center|LOCUS_33820 >Feature sequence132 625 416 gene locus_tag LOCUS_33830 625 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 2040 889 gene locus_tag LOCUS_33840 2040 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 2456 3541 gene locus_tag LOCUS_33850 2456 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 3926 4963 gene locus_tag LOCUS_33860 3926 4963 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938887.1 protein_id gnl|my_center|LOCUS_33860 5078 5533 gene locus_tag LOCUS_33870 5078 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 6842 5634 gene locus_tag LOCUS_33880 6842 5634 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_33880 7541 7810 gene locus_tag LOCUS_33890 7541 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 7960 8874 gene locus_tag LOCUS_33900 gene xerC 7960 8874 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_33900 10706 9045 gene locus_tag LOCUS_33910 10706 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 11346 10864 gene locus_tag LOCUS_33920 11346 10864 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_33920 11600 13516 gene locus_tag LOCUS_33930 gene mnmG 11600 13516 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427787.1 protein_id gnl|my_center|LOCUS_33930 14245 16857 gene locus_tag LOCUS_33940 14245 16857 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922467.1 protein_id gnl|my_center|LOCUS_33940 >Feature sequence133 898 146 gene locus_tag LOCUS_33950 gene fabG 898 146 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_33950 1504 1016 gene locus_tag LOCUS_33960 1504 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 2640 1501 gene locus_tag LOCUS_33970 2640 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 3075 2752 gene locus_tag LOCUS_33980 3075 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 4727 5146 gene locus_tag LOCUS_33990 4727 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 5140 6249 gene locus_tag LOCUS_34000 gene rho 5140 6249 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330229.1 protein_id gnl|my_center|LOCUS_34000 6742 6254 gene locus_tag LOCUS_34010 6742 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 7581 6985 gene locus_tag LOCUS_34020 7581 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 9998 7788 gene locus_tag LOCUS_34030 9998 7788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 10649 10320 gene locus_tag LOCUS_34040 10649 10320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 11189 12529 gene locus_tag LOCUS_34050 11189 12529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 12888 14171 gene locus_tag LOCUS_34060 12888 14171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 14240 17590 gene locus_tag LOCUS_34070 14240 17590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 >Feature sequence134 249 971 gene locus_tag LOCUS_34080 249 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 1752 1117 gene locus_tag LOCUS_34090 1752 1117 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510731.1 protein_id gnl|my_center|LOCUS_34090 2007 1810 gene locus_tag LOCUS_34100 2007 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 2288 2121 gene locus_tag LOCUS_34110 2288 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 2930 2505 gene locus_tag LOCUS_34120 2930 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34120 3411 3085 gene locus_tag LOCUS_34130 3411 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34130 3773 5293 gene locus_tag LOCUS_34140 3773 5293 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_34140 5700 7475 gene locus_tag LOCUS_34150 5700 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 7722 10007 gene locus_tag LOCUS_34160 7722 10007 CDS product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808393.1 protein_id gnl|my_center|LOCUS_34160 10569 10132 gene locus_tag LOCUS_34170 10569 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 11139 14192 gene locus_tag LOCUS_34180 11139 14192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 14841 15503 gene locus_tag LOCUS_34190 14841 15503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 17907 15616 gene locus_tag LOCUS_34200 17907 15616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 >Feature sequence135 837 2963 gene locus_tag LOCUS_34210 837 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 3728 4420 gene locus_tag LOCUS_34220 3728 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 4424 7189 gene locus_tag LOCUS_34230 4424 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 7255 10188 gene locus_tag LOCUS_34240 7255 10188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 10388 13333 gene locus_tag LOCUS_34250 10388 13333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 13591 13382 gene locus_tag LOCUS_34260 13591 13382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 13590 13889 gene locus_tag LOCUS_34270 13590 13889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 15059 13908 gene locus_tag LOCUS_34280 15059 13908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 15867 15205 gene locus_tag LOCUS_34290 15867 15205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 17459 15885 gene locus_tag LOCUS_34300 17459 15885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 >Feature sequence136 3344 1764 gene locus_tag LOCUS_34310 3344 1764 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120298.1 protein_id gnl|my_center|LOCUS_34310 3761 3519 gene locus_tag LOCUS_34320 3761 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 5312 3885 gene locus_tag LOCUS_34330 5312 3885 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922522.1 protein_id gnl|my_center|LOCUS_34330 8568 5566 gene locus_tag LOCUS_34340 8568 5566 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203206.1 protein_id gnl|my_center|LOCUS_34340 9075 8710 gene locus_tag LOCUS_34350 9075 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 9922 9140 gene locus_tag LOCUS_34360 9922 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34360 10394 9897 gene locus_tag LOCUS_34370 10394 9897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 12450 10564 gene locus_tag LOCUS_34380 12450 10564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 13224 12598 gene locus_tag LOCUS_34390 13224 12598 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529397.1 protein_id gnl|my_center|LOCUS_34390 13817 13326 gene locus_tag LOCUS_34400 13817 13326 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089945.1 protein_id gnl|my_center|LOCUS_34400 14836 14294 gene locus_tag LOCUS_34410 14836 14294 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922248.1 protein_id gnl|my_center|LOCUS_34410 15056 16675 gene locus_tag LOCUS_34420 15056 16675 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427788.1 protein_id gnl|my_center|LOCUS_34420 >Feature sequence137 3130 395 gene locus_tag LOCUS_34430 gene ppdK 3130 395 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_34430 3558 4499 gene locus_tag LOCUS_34440 3558 4499 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334279.1 protein_id gnl|my_center|LOCUS_34440 4698 5132 gene locus_tag LOCUS_34450 4698 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 5132 5548 gene locus_tag LOCUS_34460 gene rnpA 5132 5548 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121387.1 protein_id gnl|my_center|LOCUS_34460 5545 5784 gene locus_tag LOCUS_34470 5545 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 7948 5894 gene locus_tag LOCUS_34480 7948 5894 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121893.1 protein_id gnl|my_center|LOCUS_34480 8367 8858 gene locus_tag LOCUS_34490 gene tadA 8367 8858 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325362.1 protein_id gnl|my_center|LOCUS_34490 9155 11167 gene locus_tag LOCUS_34500 9155 11167 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120669.1 protein_id gnl|my_center|LOCUS_34500 11535 12626 gene locus_tag LOCUS_34510 gene ychF 11535 12626 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037200879.1 protein_id gnl|my_center|LOCUS_34510 13176 14642 gene locus_tag LOCUS_34520 13176 14642 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089742.1 protein_id gnl|my_center|LOCUS_34520 16695 14908 gene locus_tag LOCUS_34530 16695 14908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 >Feature sequence138 10581 163 gene locus_tag LOCUS_34540 10581 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 11475 10891 gene locus_tag LOCUS_34550 11475 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 14056 13106 gene locus_tag LOCUS_34560 14056 13106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672702.1 protein_id gnl|my_center|LOCUS_34560 <17457 14455 gene locus_tag LOCUS_34570 <17457 14455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003406189.1:DEAD/DEAH box helicase family protein >Feature sequence139 2527 1577 gene locus_tag LOCUS_34580 2527 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 3633 2524 gene locus_tag LOCUS_34590 gene hflC 3633 2524 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106429.1 protein_id gnl|my_center|LOCUS_34590 4357 3725 gene locus_tag LOCUS_34600 4357 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 4727 5764 gene locus_tag LOCUS_34610 4727 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 5995 8238 gene locus_tag LOCUS_34620 5995 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 9024 8413 gene locus_tag LOCUS_34630 9024 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 9522 10529 gene locus_tag LOCUS_34640 9522 10529 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_34640 10533 11474 gene locus_tag LOCUS_34650 10533 11474 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_34650 11568 12449 gene locus_tag LOCUS_34660 gene rfbA 11568 12449 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_34660 13492 13926 gene locus_tag LOCUS_34670 13492 13926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 14094 14588 gene locus_tag LOCUS_34680 14094 14588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 14777 16168 gene locus_tag LOCUS_34690 gene asnS 14777 16168 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760798.1 protein_id gnl|my_center|LOCUS_34690 >Feature sequence140 3234 1240 gene locus_tag LOCUS_34700 3234 1240 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804729.1 protein_id gnl|my_center|LOCUS_34700 3638 3243 gene locus_tag LOCUS_34710 3638 3243 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_34710 3880 3635 gene locus_tag LOCUS_34720 3880 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 6193 4037 gene locus_tag LOCUS_34730 6193 4037 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211634420.1 protein_id gnl|my_center|LOCUS_34730 7387 6329 gene locus_tag LOCUS_34740 7387 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 7660 7445 gene locus_tag LOCUS_34750 7660 7445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 8727 7852 gene locus_tag LOCUS_34760 8727 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 10595 8724 gene locus_tag LOCUS_34770 10595 8724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 11636 10755 gene locus_tag LOCUS_34780 11636 10755 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_34780 13705 12260 gene locus_tag LOCUS_34790 13705 12260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 14176 13781 gene locus_tag LOCUS_34800 14176 13781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 14232 14435 gene locus_tag LOCUS_34810 14232 14435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 <17247 16066 gene locus_tag LOCUS_34820 <17247 16066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119260.1:bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ >Feature sequence141 1062 112 gene locus_tag LOCUS_34830 1062 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 2287 1283 gene locus_tag LOCUS_34840 2287 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 2698 4317 gene locus_tag LOCUS_34850 gene nadB 2698 4317 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119573.1 protein_id gnl|my_center|LOCUS_34850 4578 5324 gene locus_tag LOCUS_34860 gene lipB 4578 5324 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258689.1 protein_id gnl|my_center|LOCUS_34860 5513 6637 gene locus_tag LOCUS_34870 5513 6637 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_34870 6732 7943 gene locus_tag LOCUS_34880 6732 7943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 8524 8333 gene locus_tag LOCUS_34890 8524 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 9097 8903 gene locus_tag LOCUS_34900 9097 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 9333 10790 gene locus_tag LOCUS_34910 9333 10790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 10944 11843 gene locus_tag LOCUS_34920 10944 11843 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789633.1 protein_id gnl|my_center|LOCUS_34920 12716 11970 gene locus_tag LOCUS_34930 12716 11970 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229010.1 protein_id gnl|my_center|LOCUS_34930 14552 12795 gene locus_tag LOCUS_34940 gene ggt 14552 12795 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_34940 14612 15547 gene locus_tag LOCUS_34950 14612 15547 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522631.1 protein_id gnl|my_center|LOCUS_34950 >Feature sequence142 1340 477 gene locus_tag LOCUS_34960 gene uvsE 1340 477 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227599.1 protein_id gnl|my_center|LOCUS_34960 1891 1505 gene locus_tag LOCUS_34970 1891 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 2469 1888 gene locus_tag LOCUS_34980 2469 1888 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123297.1 protein_id gnl|my_center|LOCUS_34980 2870 2607 gene locus_tag LOCUS_34990 2870 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34990 3043 3447 gene locus_tag LOCUS_35000 3043 3447 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507208.1 protein_id gnl|my_center|LOCUS_35000 3733 3530 gene locus_tag LOCUS_35010 3733 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 4182 3913 gene locus_tag LOCUS_35020 4182 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 4477 4830 gene locus_tag LOCUS_35030 4477 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35030 4861 5529 gene locus_tag LOCUS_35040 4861 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35040 5642 6187 gene locus_tag LOCUS_35050 5642 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35050 6257 7312 gene locus_tag LOCUS_35060 6257 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35060 7284 7601 gene locus_tag LOCUS_35070 7284 7601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35070 8345 8019 gene locus_tag LOCUS_35080 8345 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 8763 8374 gene locus_tag LOCUS_35090 8763 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 9044 9250 gene locus_tag LOCUS_35100 9044 9250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 11547 9574 gene locus_tag LOCUS_35110 11547 9574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 12403 11900 gene locus_tag LOCUS_35120 12403 11900 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172656.1 protein_id gnl|my_center|LOCUS_35120 12922 12524 gene locus_tag LOCUS_35130 12922 12524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 13405 12956 gene locus_tag LOCUS_35140 13405 12956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 13822 14346 gene locus_tag LOCUS_35150 gene coaD 13822 14346 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122863.1 protein_id gnl|my_center|LOCUS_35150 14773 16275 gene locus_tag LOCUS_35160 14773 16275 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_35160 >Feature sequence143 2612 156 gene locus_tag LOCUS_35170 2612 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 3032 4417 gene locus_tag LOCUS_35180 3032 4417 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_35180 4707 6197 gene locus_tag LOCUS_35190 gene trpE 4707 6197 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121650.1 protein_id gnl|my_center|LOCUS_35190 6353 6577 gene locus_tag LOCUS_35200 6353 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 6791 7480 gene locus_tag LOCUS_35210 6791 7480 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249137.1 protein_id gnl|my_center|LOCUS_35210 7496 8779 gene locus_tag LOCUS_35220 7496 8779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 9404 8925 gene locus_tag LOCUS_35230 9404 8925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 10500 9670 gene locus_tag LOCUS_35240 10500 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 10895 11152 gene locus_tag LOCUS_35250 10895 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 11513 11695 gene locus_tag LOCUS_35260 11513 11695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 12044 12229 gene locus_tag LOCUS_35270 12044 12229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 13155 12193 gene locus_tag LOCUS_35280 13155 12193 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_35280 14474 13551 gene locus_tag LOCUS_35290 gene thiL 14474 13551 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121111.1 protein_id gnl|my_center|LOCUS_35290 16171 14693 gene locus_tag LOCUS_35300 16171 14693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 >Feature sequence144 425 1708 gene locus_tag LOCUS_35310 425 1708 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700902.1 protein_id gnl|my_center|LOCUS_35310 1817 2749 gene locus_tag LOCUS_35320 1817 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 2762 3001 gene locus_tag LOCUS_35330 2762 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 3029 3598 gene locus_tag LOCUS_35340 3029 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 5087 3762 gene locus_tag LOCUS_35350 5087 3762 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529437.1 protein_id gnl|my_center|LOCUS_35350 5732 5373 gene locus_tag LOCUS_35360 gene nirD 5732 5373 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327329.1 protein_id gnl|my_center|LOCUS_35360 6356 7753 gene locus_tag LOCUS_35370 6356 7753 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121461.1 protein_id gnl|my_center|LOCUS_35370 8176 9063 gene locus_tag LOCUS_35380 8176 9063 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816586.1 protein_id gnl|my_center|LOCUS_35380 9129 9896 gene locus_tag LOCUS_35390 gene surE 9129 9896 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037201557.1 protein_id gnl|my_center|LOCUS_35390 9893 10879 gene locus_tag LOCUS_35400 9893 10879 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918341.1 protein_id gnl|my_center|LOCUS_35400 11153 11926 gene locus_tag LOCUS_35410 11153 11926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 12157 12681 gene locus_tag LOCUS_35420 12157 12681 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870310.1 protein_id gnl|my_center|LOCUS_35420 13815 12919 gene locus_tag LOCUS_35430 13815 12919 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765640.1 protein_id gnl|my_center|LOCUS_35430 >Feature sequence145 1505 1200 gene locus_tag LOCUS_35440 1505 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 1634 1936 gene locus_tag LOCUS_35450 1634 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 1999 2268 gene locus_tag LOCUS_35460 1999 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 2394 4157 gene locus_tag LOCUS_35470 2394 4157 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_35470 4338 4688 gene locus_tag LOCUS_35480 4338 4688 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020879.1 protein_id gnl|my_center|LOCUS_35480 4916 6265 gene locus_tag LOCUS_35490 4916 6265 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774548.1 protein_id gnl|my_center|LOCUS_35490 6340 8004 gene locus_tag LOCUS_35500 6340 8004 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870682.1 protein_id gnl|my_center|LOCUS_35500 8049 8468 gene locus_tag LOCUS_35510 8049 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 8468 8701 gene locus_tag LOCUS_35520 8468 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 8803 9729 gene locus_tag LOCUS_35530 gene fhcD 8803 9729 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334456.1 protein_id gnl|my_center|LOCUS_35530 9955 11262 gene locus_tag LOCUS_35540 gene nuoH 9955 11262 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932452.1 protein_id gnl|my_center|LOCUS_35540 11259 11966 gene locus_tag LOCUS_35550 11259 11966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 12027 12338 gene locus_tag LOCUS_35560 gene nuoK 12027 12338 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813222.1 protein_id gnl|my_center|LOCUS_35560 12345 14951 gene locus_tag LOCUS_35570 12345 14951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 >Feature sequence146 1466 288 gene locus_tag LOCUS_35580 gene dgoD 1466 288 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_35580 2390 1605 gene locus_tag LOCUS_35590 2390 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 4264 2897 gene locus_tag LOCUS_35600 4264 2897 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_35600 4263 4475 gene locus_tag LOCUS_35610 4263 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 4645 4427 gene locus_tag LOCUS_35620 4645 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 5383 4670 gene locus_tag LOCUS_35630 5383 4670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_35630 7389 5554 gene locus_tag LOCUS_35640 7389 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 10387 7301 gene locus_tag LOCUS_35650 10387 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 11037 10384 gene locus_tag LOCUS_35660 11037 10384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 11727 11936 gene locus_tag LOCUS_35670 11727 11936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 12866 12021 gene locus_tag LOCUS_35680 12866 12021 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339510.1 protein_id gnl|my_center|LOCUS_35680 14012 13206 gene locus_tag LOCUS_35690 14012 13206 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_35690 14497 15705 gene locus_tag LOCUS_35700 14497 15705 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391014.1 protein_id gnl|my_center|LOCUS_35700 >Feature sequence147 1828 551 gene locus_tag LOCUS_35710 gene hemA 1828 551 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334460.1 protein_id gnl|my_center|LOCUS_35710 2777 1908 gene locus_tag LOCUS_35720 2777 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 4237 3173 gene locus_tag LOCUS_35730 4237 3173 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434800.1 protein_id gnl|my_center|LOCUS_35730 4570 5457 gene locus_tag LOCUS_35740 4570 5457 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118509.1 protein_id gnl|my_center|LOCUS_35740 6947 5736 gene locus_tag LOCUS_35750 6947 5736 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324545.1 protein_id gnl|my_center|LOCUS_35750 7287 9557 gene locus_tag LOCUS_35760 7287 9557 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922366.1 protein_id gnl|my_center|LOCUS_35760 9825 10919 gene locus_tag LOCUS_35770 9825 10919 CDS product peptidylglycine monooxygenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663621.1 protein_id gnl|my_center|LOCUS_35770 <16261 11228 gene locus_tag LOCUS_35780 <16261 11228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615507.1:GDSL-type esterase/lipase family protein >Feature sequence148 790 38 gene locus_tag LOCUS_35790 790 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 941 1342 gene locus_tag LOCUS_35800 941 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35800 1366 2037 gene locus_tag LOCUS_35810 1366 2037 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220818393.1 protein_id gnl|my_center|LOCUS_35810 2266 2042 gene locus_tag LOCUS_35820 2266 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 6027 2644 gene locus_tag LOCUS_35830 gene addB 6027 2644 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392018.1 protein_id gnl|my_center|LOCUS_35830 8545 6197 gene locus_tag LOCUS_35840 8545 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 10041 9025 gene locus_tag LOCUS_35850 10041 9025 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122858.1 protein_id gnl|my_center|LOCUS_35850 12060 10120 gene locus_tag LOCUS_35860 12060 10120 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_35860 14066 12234 gene locus_tag LOCUS_35870 14066 12234 CDS product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260488.1 protein_id gnl|my_center|LOCUS_35870 15391 14279 gene locus_tag LOCUS_35880 15391 14279 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121488.1 protein_id gnl|my_center|LOCUS_35880 15965 15513 gene locus_tag LOCUS_35890 15965 15513 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922010.1 protein_id gnl|my_center|LOCUS_35890 >Feature sequence149 1863 745 gene locus_tag LOCUS_35900 1863 745 CDS product muconate/chloromuconate family cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015092.1 protein_id gnl|my_center|LOCUS_35900 2655 1891 gene locus_tag LOCUS_35910 2655 1891 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031754.1 protein_id gnl|my_center|LOCUS_35910 4410 2767 gene locus_tag LOCUS_35920 4410 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 5335 4412 gene locus_tag LOCUS_35930 5335 4412 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337243.1 protein_id gnl|my_center|LOCUS_35930 6458 5391 gene locus_tag LOCUS_35940 6458 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 7416 6520 gene locus_tag LOCUS_35950 7416 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 8791 7406 gene locus_tag LOCUS_35960 8791 7406 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967746.1 protein_id gnl|my_center|LOCUS_35960 9711 8818 gene locus_tag LOCUS_35970 9711 8818 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285667.1 protein_id gnl|my_center|LOCUS_35970 9837 13379 gene locus_tag LOCUS_35980 9837 13379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 13453 14892 gene locus_tag LOCUS_35990 13453 14892 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671603.1 protein_id gnl|my_center|LOCUS_35990 >Feature sequence150 1913 312 gene locus_tag LOCUS_36000 1913 312 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_36000 2901 2353 gene locus_tag LOCUS_36010 2901 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 3109 3456 gene locus_tag LOCUS_36020 3109 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 4061 4243 gene locus_tag LOCUS_36030 4061 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 5983 4250 gene locus_tag LOCUS_36040 5983 4250 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_36040 7180 6116 gene locus_tag LOCUS_36050 7180 6116 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061017.1 protein_id gnl|my_center|LOCUS_36050 7554 7255 gene locus_tag LOCUS_36060 7554 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 9277 8075 gene locus_tag LOCUS_36070 9277 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 10961 9471 gene locus_tag LOCUS_36080 10961 9471 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921354.1 protein_id gnl|my_center|LOCUS_36080 11364 12503 gene locus_tag LOCUS_36090 11364 12503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 12971 13041 gene locus_tag LOCUS_t00250 12971 13041 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13224 14435 gene locus_tag LOCUS_36100 13224 14435 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922445.1 protein_id gnl|my_center|LOCUS_36100 <15841 14799 gene locus_tag LOCUS_36110 <15841 14799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000343760.1:ISL3-like element ISKox3 family transposase >Feature sequence151 4420 98 gene locus_tag LOCUS_36120 4420 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 4814 5647 gene locus_tag LOCUS_36130 4814 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36130 5678 6745 gene locus_tag LOCUS_36140 5678 6745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36140 9276 7135 gene locus_tag LOCUS_36150 9276 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145375047.1 protein_id gnl|my_center|LOCUS_36150 9613 10422 gene locus_tag LOCUS_36160 9613 10422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 12367 10721 gene locus_tag LOCUS_36170 12367 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 13253 12396 gene locus_tag LOCUS_36180 13253 12396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118058.1 protein_id gnl|my_center|LOCUS_36180 13962 13369 gene locus_tag LOCUS_36190 gene leuD 13962 13369 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 protein_id gnl|my_center|LOCUS_36190 15538 14099 gene locus_tag LOCUS_36200 gene leuC 15538 14099 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920779.1 protein_id gnl|my_center|LOCUS_36200 >Feature sequence152 309 88 gene locus_tag LOCUS_36210 309 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 354 1631 gene locus_tag LOCUS_36220 354 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 1741 2982 gene locus_tag LOCUS_36230 1741 2982 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324149.1 protein_id gnl|my_center|LOCUS_36230 3428 3120 gene locus_tag LOCUS_36240 3428 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 4485 3328 gene locus_tag LOCUS_36250 4485 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 4653 4495 gene locus_tag LOCUS_36260 4653 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 5316 5501 gene locus_tag LOCUS_36270 5316 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 5917 6534 gene locus_tag LOCUS_36280 5917 6534 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329801.1 protein_id gnl|my_center|LOCUS_36280 6781 7347 gene locus_tag LOCUS_36290 6781 7347 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932449.1 protein_id gnl|my_center|LOCUS_36290 7465 8295 gene locus_tag LOCUS_36300 gene sufC 7465 8295 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329802.1 protein_id gnl|my_center|LOCUS_36300 8404 9825 gene locus_tag LOCUS_36310 gene sufB 8404 9825 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_36310 10036 11286 gene locus_tag LOCUS_36320 gene sufD 10036 11286 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922298.1 protein_id gnl|my_center|LOCUS_36320 11403 12038 gene locus_tag LOCUS_36330 11403 12038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 12102 12419 gene locus_tag LOCUS_36340 12102 12419 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010050.1 protein_id gnl|my_center|LOCUS_36340 12613 13212 gene locus_tag LOCUS_36350 12613 13212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 13433 13221 gene locus_tag LOCUS_36360 13433 13221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 13698 13333 gene locus_tag LOCUS_36370 13698 13333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 13866 14654 gene locus_tag LOCUS_36380 13866 14654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36380 14623 15210 gene locus_tag LOCUS_36390 14623 15210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36390 15223 15744 gene locus_tag LOCUS_36400 15223 15744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36400 >Feature sequence153 <1 1386 gene locus_tag LOCUS_36410 <1 1386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120599.1:FG-GAP-like repeat-containing protein 1455 4367 gene locus_tag LOCUS_36420 1455 4367 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 protein_id gnl|my_center|LOCUS_36420 4455 4658 gene locus_tag LOCUS_36430 4455 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 5016 6941 gene locus_tag LOCUS_36440 5016 6941 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_36440 6984 7505 gene locus_tag LOCUS_36450 6984 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 8833 7496 gene locus_tag LOCUS_36460 gene larC 8833 7496 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122655.1 protein_id gnl|my_center|LOCUS_36460 10807 9878 gene locus_tag LOCUS_36470 10807 9878 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921630.1 protein_id gnl|my_center|LOCUS_36470 12206 10959 gene locus_tag LOCUS_36480 12206 10959 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791093.1 protein_id gnl|my_center|LOCUS_36480 13113 12367 gene locus_tag LOCUS_36490 gene rph 13113 12367 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811904.1 protein_id gnl|my_center|LOCUS_36490 13690 14268 gene locus_tag LOCUS_36500 13690 14268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 15034 14603 gene locus_tag LOCUS_36510 15034 14603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 15453 15031 gene locus_tag LOCUS_36520 15453 15031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36520 15656 15501 gene locus_tag LOCUS_36530 15656 15501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 >Feature sequence154 631 2640 gene locus_tag LOCUS_36540 631 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 2661 2864 gene locus_tag LOCUS_36550 2661 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 3090 3683 gene locus_tag LOCUS_36560 3090 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 4425 4267 gene locus_tag LOCUS_36570 4425 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 4372 6357 gene locus_tag LOCUS_36580 4372 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 6883 7881 gene locus_tag LOCUS_36590 6883 7881 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_36590 8221 9255 gene locus_tag LOCUS_36600 8221 9255 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_36600 9507 10694 gene locus_tag LOCUS_36610 9507 10694 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235632064.1 protein_id gnl|my_center|LOCUS_36610 13118 10917 gene locus_tag LOCUS_36620 gene thrS 13118 10917 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329329.1 protein_id gnl|my_center|LOCUS_36620 13383 13457 gene locus_tag LOCUS_t00260 13383 13457 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 14038 13475 gene locus_tag LOCUS_36630 14038 13475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 14666 13998 gene locus_tag LOCUS_36640 14666 13998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 >Feature sequence155 611 408 gene locus_tag LOCUS_36650 611 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 1678 806 gene locus_tag LOCUS_36660 1678 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 2025 2915 gene locus_tag LOCUS_36670 2025 2915 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767656.1 protein_id gnl|my_center|LOCUS_36670 4250 3003 gene locus_tag LOCUS_36680 4250 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 4687 4469 gene locus_tag LOCUS_36690 4687 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 5319 4903 gene locus_tag LOCUS_36700 5319 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 7169 5331 gene locus_tag LOCUS_36710 7169 5331 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122985.1 protein_id gnl|my_center|LOCUS_36710 7573 8022 gene locus_tag LOCUS_36720 7573 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 8371 8952 gene locus_tag LOCUS_36730 gene def 8371 8952 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324462.1 protein_id gnl|my_center|LOCUS_36730 9318 10721 gene locus_tag LOCUS_36740 9318 10721 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_36740 11142 10786 gene locus_tag LOCUS_36750 11142 10786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 11666 11142 gene locus_tag LOCUS_36760 11666 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 15284 11688 gene locus_tag LOCUS_36770 15284 11688 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813379.1 protein_id gnl|my_center|LOCUS_36770 >Feature sequence156 1362 433 gene locus_tag LOCUS_36780 1362 433 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145034007.1 protein_id gnl|my_center|LOCUS_36780 2930 1383 gene locus_tag LOCUS_36790 2930 1383 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 protein_id gnl|my_center|LOCUS_36790 3419 3225 gene locus_tag LOCUS_36800 3419 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 3483 4757 gene locus_tag LOCUS_36810 3483 4757 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_36810 6557 5184 gene locus_tag LOCUS_36820 6557 5184 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_36820 7874 6846 gene locus_tag LOCUS_36830 7874 6846 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119992.1 protein_id gnl|my_center|LOCUS_36830 8909 8160 gene locus_tag LOCUS_36840 8909 8160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 9580 8999 gene locus_tag LOCUS_36850 9580 8999 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 protein_id gnl|my_center|LOCUS_36850 11748 10840 gene locus_tag LOCUS_36860 11748 10840 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325399.1 protein_id gnl|my_center|LOCUS_36860 12180 12689 gene locus_tag LOCUS_36870 12180 12689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 13066 14898 gene locus_tag LOCUS_36880 gene typA 13066 14898 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324768.1 protein_id gnl|my_center|LOCUS_36880 >Feature sequence157 341 892 gene locus_tag LOCUS_36890 341 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 889 3387 gene locus_tag LOCUS_36900 889 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 3362 5680 gene locus_tag LOCUS_36910 3362 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 5731 6681 gene locus_tag LOCUS_36920 5731 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 6686 8377 gene locus_tag LOCUS_36930 6686 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 8815 10695 gene locus_tag LOCUS_36940 gene cas1 8815 10695 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_36940 12324 10891 gene locus_tag LOCUS_36950 12324 10891 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_36950 13525 12410 gene locus_tag LOCUS_36960 13525 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 13898 14209 gene locus_tag LOCUS_36970 13898 14209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 14471 15315 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttccgtgctgatgaagcacggccccattgaagc >Feature sequence158 1030 2952 gene locus_tag LOCUS_36980 1030 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 2949 3914 gene locus_tag LOCUS_36990 2949 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 7467 4033 gene locus_tag LOCUS_37000 7467 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 8018 7719 gene locus_tag LOCUS_37010 8018 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 9000 8164 gene locus_tag LOCUS_37020 gene trpC 9000 8164 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122620.1 protein_id gnl|my_center|LOCUS_37020 10617 9859 gene locus_tag LOCUS_37030 10617 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 11425 11255 gene locus_tag LOCUS_37040 11425 11255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 11866 11549 gene locus_tag LOCUS_37050 11866 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37050 13214 13414 gene locus_tag LOCUS_37060 13214 13414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 13781 14011 gene locus_tag LOCUS_37070 13781 14011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 14156 14932 gene locus_tag LOCUS_37080 14156 14932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 >Feature sequence159 423 4601 gene locus_tag LOCUS_37090 423 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 4914 6245 gene locus_tag LOCUS_37100 4914 6245 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922839.1 protein_id gnl|my_center|LOCUS_37100 7939 6437 gene locus_tag LOCUS_37110 7939 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 9361 8354 gene locus_tag LOCUS_37120 gene uxuA 9361 8354 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388613.1 protein_id gnl|my_center|LOCUS_37120 11557 9986 gene locus_tag LOCUS_37130 11557 9986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 12418 12101 gene locus_tag LOCUS_37140 12418 12101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 13917 13126 gene locus_tag LOCUS_37150 13917 13126 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260625.1 protein_id gnl|my_center|LOCUS_37150 >Feature sequence160 283 1173 gene locus_tag LOCUS_37160 283 1173 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_37160 1250 1483 gene locus_tag LOCUS_37170 1250 1483 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928916.1 protein_id gnl|my_center|LOCUS_37170 1728 3641 gene locus_tag LOCUS_37180 gene oleC 1728 3641 CDS product olefin beta-lactone synthetase OleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035474.1 protein_id gnl|my_center|LOCUS_37180 3712 3951 gene locus_tag LOCUS_37190 3712 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 3956 4966 gene locus_tag LOCUS_37200 3956 4966 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275143.1 protein_id gnl|my_center|LOCUS_37200 5401 9789 gene locus_tag LOCUS_37210 5401 9789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 11994 9898 gene locus_tag LOCUS_37220 11994 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 12731 12916 gene locus_tag LOCUS_37230 12731 12916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 13444 13019 gene locus_tag LOCUS_37240 13444 13019 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_37240 14736 13582 gene locus_tag LOCUS_37250 14736 13582 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_37250 >Feature sequence161 520 287 gene locus_tag LOCUS_37260 520 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 583 747 gene locus_tag LOCUS_37270 583 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 2089 1088 gene locus_tag LOCUS_37280 2089 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 3564 2365 gene locus_tag LOCUS_37290 3564 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 5061 3679 gene locus_tag LOCUS_37300 5061 3679 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_37300 7501 5081 gene locus_tag LOCUS_37310 7501 5081 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664503.1 protein_id gnl|my_center|LOCUS_37310 8074 8745 gene locus_tag LOCUS_37320 8074 8745 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_37320 9720 8755 gene locus_tag LOCUS_37330 9720 8755 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 protein_id gnl|my_center|LOCUS_37330 11141 9774 gene locus_tag LOCUS_37340 11141 9774 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921348.1 protein_id gnl|my_center|LOCUS_37340 11627 11941 gene locus_tag LOCUS_37350 11627 11941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 12136 13308 gene locus_tag LOCUS_37360 12136 13308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 13327 13875 gene locus_tag LOCUS_37370 13327 13875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 13882 14217 gene locus_tag LOCUS_37380 13882 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 >Feature sequence162 790 1065 gene locus_tag LOCUS_37390 790 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 1159 2523 gene locus_tag LOCUS_37400 1159 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 2714 3757 gene locus_tag LOCUS_37410 2714 3757 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_37410 3747 4634 gene locus_tag LOCUS_37420 3747 4634 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_37420 4655 5335 gene locus_tag LOCUS_37430 4655 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 5332 7677 gene locus_tag LOCUS_37440 5332 7677 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921453.1 protein_id gnl|my_center|LOCUS_37440 7674 10178 gene locus_tag LOCUS_37450 7674 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 10229 10462 gene locus_tag LOCUS_37460 10229 10462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 10479 10835 gene locus_tag LOCUS_37470 10479 10835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 11335 10904 gene locus_tag LOCUS_37480 11335 10904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 11355 11573 gene locus_tag LOCUS_37490 11355 11573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37490 11573 11710 gene locus_tag LOCUS_37500 11573 11710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37500 12508 11885 gene locus_tag LOCUS_37510 12508 11885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 13592 12930 gene locus_tag LOCUS_37520 13592 12930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 13993 13706 gene locus_tag LOCUS_37530 13993 13706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 >Feature sequence163 2520 136 gene locus_tag LOCUS_37540 2520 136 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_37540 3226 4461 gene locus_tag LOCUS_37550 3226 4461 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739890.1 protein_id gnl|my_center|LOCUS_37550 4707 5732 gene locus_tag LOCUS_37560 gene trpD 4707 5732 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_37560 5993 6568 gene locus_tag LOCUS_37570 gene dcd 5993 6568 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_37570 6692 7030 gene locus_tag LOCUS_37580 6692 7030 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245961.1 protein_id gnl|my_center|LOCUS_37580 7711 7217 gene locus_tag LOCUS_37590 7711 7217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 7939 8895 gene locus_tag LOCUS_37600 7939 8895 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121326.1 protein_id gnl|my_center|LOCUS_37600 9940 9059 gene locus_tag LOCUS_37610 9940 9059 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008670430.1 protein_id gnl|my_center|LOCUS_37610 11031 10195 gene locus_tag LOCUS_37620 11031 10195 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922172.1 protein_id gnl|my_center|LOCUS_37620 12453 11668 gene locus_tag LOCUS_37630 12453 11668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 13067 12450 gene locus_tag LOCUS_37640 13067 12450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 13393 13157 gene locus_tag LOCUS_37650 13393 13157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 13743 13504 gene locus_tag LOCUS_37660 13743 13504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 >Feature sequence164 1004 2044 gene locus_tag LOCUS_37670 1004 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 2219 2950 gene locus_tag LOCUS_37680 2219 2950 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333296.1 protein_id gnl|my_center|LOCUS_37680 2959 3939 gene locus_tag LOCUS_37690 2959 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 4298 4705 gene locus_tag LOCUS_37700 4298 4705 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967562.1 protein_id gnl|my_center|LOCUS_37700 4810 4986 gene locus_tag LOCUS_37710 4810 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 5133 4960 gene locus_tag LOCUS_37720 5133 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 5217 5426 gene locus_tag LOCUS_37730 5217 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902953.1 protein_id gnl|my_center|LOCUS_37730 5739 7253 gene locus_tag LOCUS_37740 5739 7253 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077027088.1 protein_id gnl|my_center|LOCUS_37740 7250 7417 gene locus_tag LOCUS_37750 7250 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 7490 9016 gene locus_tag LOCUS_37760 gene mqo 7490 9016 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099345.1 protein_id gnl|my_center|LOCUS_37760 9032 10000 gene locus_tag LOCUS_37770 9032 10000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 10095 11066 gene locus_tag LOCUS_37780 10095 11066 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121674.1 protein_id gnl|my_center|LOCUS_37780 11206 12447 gene locus_tag LOCUS_37790 11206 12447 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_37790 12444 12926 gene locus_tag LOCUS_37800 12444 12926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403489.1 protein_id gnl|my_center|LOCUS_37800 12929 13399 gene locus_tag LOCUS_37810 12929 13399 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_37810 >Feature sequence165 1041 775 gene locus_tag LOCUS_37820 1041 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 1808 1536 gene locus_tag LOCUS_37830 1808 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 2043 1837 gene locus_tag LOCUS_37840 2043 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 4281 2875 gene locus_tag LOCUS_37850 4281 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 4697 4278 gene locus_tag LOCUS_37860 4697 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 5083 6438 gene locus_tag LOCUS_37870 5083 6438 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616161.1 protein_id gnl|my_center|LOCUS_37870 6435 7847 gene locus_tag LOCUS_37880 6435 7847 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123058.1 protein_id gnl|my_center|LOCUS_37880 8051 9076 gene locus_tag LOCUS_37890 8051 9076 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339548.1 protein_id gnl|my_center|LOCUS_37890 9315 9482 gene locus_tag LOCUS_37900 9315 9482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 11845 9875 gene locus_tag LOCUS_37910 11845 9875 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921710.1 protein_id gnl|my_center|LOCUS_37910 12374 12165 gene locus_tag LOCUS_37920 12374 12165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 13279 12860 gene locus_tag LOCUS_37930 13279 12860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 13844 13299 gene locus_tag LOCUS_37940 13844 13299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 >Feature sequence166 394 1161 gene locus_tag LOCUS_37950 gene kdsB 394 1161 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123860.1 protein_id gnl|my_center|LOCUS_37950 1339 2958 gene locus_tag LOCUS_37960 1339 2958 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326169.1 protein_id gnl|my_center|LOCUS_37960 4435 3110 gene locus_tag LOCUS_37970 4435 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 5018 6715 gene locus_tag LOCUS_37980 5018 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 6996 8285 gene locus_tag LOCUS_37990 6996 8285 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331975.1 protein_id gnl|my_center|LOCUS_37990 8452 9234 gene locus_tag LOCUS_38000 8452 9234 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391011.1 protein_id gnl|my_center|LOCUS_38000 9359 12436 gene locus_tag LOCUS_38010 gene purL 9359 12436 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120422.1 protein_id gnl|my_center|LOCUS_38010 <14013 12577 gene locus_tag LOCUS_38020 <14013 12577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118989.1:DUF1501 domain-containing protein >Feature sequence167 1907 213 gene locus_tag LOCUS_38030 1907 213 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816066.1 protein_id gnl|my_center|LOCUS_38030 2401 4161 gene locus_tag LOCUS_38040 2401 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 4556 5932 gene locus_tag LOCUS_38050 4556 5932 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_38050 6088 7050 gene locus_tag LOCUS_38060 6088 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 7326 7171 gene locus_tag LOCUS_38070 7326 7171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 7691 8095 gene locus_tag LOCUS_38080 7691 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 8322 9116 gene locus_tag LOCUS_38090 8322 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 10817 9246 gene locus_tag LOCUS_38100 gene guaA 10817 9246 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778965.1 protein_id gnl|my_center|LOCUS_38100 11218 12336 gene locus_tag LOCUS_38110 11218 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 12631 13860 gene locus_tag LOCUS_38120 12631 13860 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667343.1 protein_id gnl|my_center|LOCUS_38120 >Feature sequence168 667 320 gene locus_tag LOCUS_38130 667 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 951 1169 gene locus_tag LOCUS_38140 951 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 1516 4281 gene locus_tag LOCUS_38150 gene ppc 1516 4281 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_38150 4387 4887 gene locus_tag LOCUS_38160 4387 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 5786 5157 gene locus_tag LOCUS_38170 5786 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38170 5976 5767 gene locus_tag LOCUS_38180 5976 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38180 6285 5989 gene locus_tag LOCUS_38190 6285 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38190 6498 6358 gene locus_tag LOCUS_38200 6498 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 7284 6529 gene locus_tag LOCUS_38210 7284 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38210 7966 7688 gene locus_tag LOCUS_38220 7966 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 8247 8642 gene locus_tag LOCUS_38230 8247 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 8783 9337 gene locus_tag LOCUS_38240 8783 9337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 10461 9385 gene locus_tag LOCUS_38250 gene tatC 10461 9385 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338730.1 protein_id gnl|my_center|LOCUS_38250 10926 11294 gene locus_tag LOCUS_38260 10926 11294 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008656289.1 protein_id gnl|my_center|LOCUS_38260 11492 12883 gene locus_tag LOCUS_38270 11492 12883 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_38270 >Feature sequence169 512 1354 gene locus_tag LOCUS_38280 512 1354 CDS product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333051.1 protein_id gnl|my_center|LOCUS_38280 2431 2754 gene locus_tag LOCUS_38290 2431 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 4978 2981 gene locus_tag LOCUS_38300 4978 2981 CDS product OPT family oligopeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768135.1 protein_id gnl|my_center|LOCUS_38300 5528 6289 gene locus_tag LOCUS_38310 5528 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 6459 7853 gene locus_tag LOCUS_38320 6459 7853 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_38320 11636 8031 gene locus_tag LOCUS_38330 11636 8031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 12251 11844 gene locus_tag LOCUS_38340 12251 11844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 12546 13394 gene locus_tag LOCUS_38350 12546 13394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 >Feature sequence170 614 1015 gene locus_tag LOCUS_38360 614 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 1078 1911 gene locus_tag LOCUS_38370 1078 1911 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086165.1 protein_id gnl|my_center|LOCUS_38370 3318 2038 gene locus_tag LOCUS_38380 3318 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 4450 3467 gene locus_tag LOCUS_38390 4450 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 5101 4463 gene locus_tag LOCUS_38400 5101 4463 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_38400 5883 5098 gene locus_tag LOCUS_38410 5883 5098 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_38410 7017 6028 gene locus_tag LOCUS_38420 gene holA 7017 6028 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258281.1 protein_id gnl|my_center|LOCUS_38420 9574 7388 gene locus_tag LOCUS_38430 9574 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 10495 9593 gene locus_tag LOCUS_38440 10495 9593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 11899 10877 gene locus_tag LOCUS_38450 11899 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 12721 11951 gene locus_tag LOCUS_38460 12721 11951 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920789.1 protein_id gnl|my_center|LOCUS_38460 13312 12794 gene locus_tag LOCUS_38470 13312 12794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 >Feature sequence171 1169 117 gene locus_tag LOCUS_38480 1169 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 3016 1325 gene locus_tag LOCUS_38490 3016 1325 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_38490 3603 3112 gene locus_tag LOCUS_38500 3603 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 4666 3689 gene locus_tag LOCUS_38510 4666 3689 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337669.1 protein_id gnl|my_center|LOCUS_38510 5135 7984 gene locus_tag LOCUS_38520 5135 7984 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615773.1 protein_id gnl|my_center|LOCUS_38520 8168 8725 gene locus_tag LOCUS_38530 8168 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328536.1 protein_id gnl|my_center|LOCUS_38530 9153 9941 gene locus_tag LOCUS_38540 9153 9941 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_38540 10072 9905 gene locus_tag LOCUS_38550 10072 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 11646 10150 gene locus_tag LOCUS_38560 11646 10150 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_38560 12323 12895 gene locus_tag LOCUS_38570 12323 12895 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329551.1 protein_id gnl|my_center|LOCUS_38570 >Feature sequence172 624 2516 gene locus_tag LOCUS_38580 624 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 3946 2528 gene locus_tag LOCUS_38590 gene murA 3946 2528 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_38590 4170 5525 gene locus_tag LOCUS_38600 4170 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 6516 5566 gene locus_tag LOCUS_38610 6516 5566 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_38610 6991 7272 gene locus_tag LOCUS_38620 6991 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 8948 7407 gene locus_tag LOCUS_38630 gene rny 8948 7407 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325643.1 protein_id gnl|my_center|LOCUS_38630 9421 9089 gene locus_tag LOCUS_38640 9421 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 9839 10927 gene locus_tag LOCUS_38650 9839 10927 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329644.1 protein_id gnl|my_center|LOCUS_38650 10939 12513 gene locus_tag LOCUS_38660 10939 12513 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_38660 12780 12634 gene locus_tag LOCUS_38670 12780 12634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 12902 13645 gene locus_tag LOCUS_38680 12902 13645 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384594.1 protein_id gnl|my_center|LOCUS_38680 >Feature sequence173 446 1459 gene locus_tag LOCUS_38690 446 1459 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615974.1 protein_id gnl|my_center|LOCUS_38690 1498 2151 gene locus_tag LOCUS_38700 1498 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 2231 3628 gene locus_tag LOCUS_38710 2231 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 3724 4410 gene locus_tag LOCUS_38720 3724 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 4445 4744 gene locus_tag LOCUS_38730 4445 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 4796 4972 gene locus_tag LOCUS_38740 4796 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 5038 7227 gene locus_tag LOCUS_38750 5038 7227 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838081.1 protein_id gnl|my_center|LOCUS_38750 7224 7988 gene locus_tag LOCUS_38760 7224 7988 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074301.1 protein_id gnl|my_center|LOCUS_38760 8029 8490 gene locus_tag LOCUS_38770 8029 8490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 9772 10770 gene locus_tag LOCUS_38780 9772 10770 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017617.1 protein_id gnl|my_center|LOCUS_38780 <13639 10862 gene locus_tag LOCUS_38790 <13639 10862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102960.1:DEAD/DEAH box helicase family protein >Feature sequence174 1016 3106 gene locus_tag LOCUS_38800 1016 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 4803 3580 gene locus_tag LOCUS_38810 4803 3580 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120312.1 protein_id gnl|my_center|LOCUS_38810 6918 5101 gene locus_tag LOCUS_38820 6918 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 7264 7103 gene locus_tag LOCUS_38830 7264 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 8544 7333 gene locus_tag LOCUS_38840 8544 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 9730 9179 gene locus_tag LOCUS_38850 9730 9179 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326626.1 protein_id gnl|my_center|LOCUS_38850 10245 10072 gene locus_tag LOCUS_38860 10245 10072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 10512 10339 gene locus_tag LOCUS_38870 10512 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 10775 10602 gene locus_tag LOCUS_38880 10775 10602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 11724 11491 gene locus_tag LOCUS_38890 11724 11491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 11824 13416 gene locus_tag LOCUS_38900 11824 13416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965503.1 protein_id gnl|my_center|LOCUS_38900 >Feature sequence175 191 925 gene locus_tag LOCUS_38910 191 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 977 1606 gene locus_tag LOCUS_38920 977 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 2168 1764 gene locus_tag LOCUS_38930 2168 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 2059 2616 gene locus_tag LOCUS_38940 2059 2616 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039237.1 protein_id gnl|my_center|LOCUS_38940 2904 5003 gene locus_tag LOCUS_38950 2904 5003 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265883.1 protein_id gnl|my_center|LOCUS_38950 5386 5255 gene locus_tag LOCUS_38960 5386 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 5692 5423 gene locus_tag LOCUS_38970 5692 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 6439 6173 gene locus_tag LOCUS_38980 6439 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 6579 7406 gene locus_tag LOCUS_38990 6579 7406 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122244.1 protein_id gnl|my_center|LOCUS_38990 7559 9439 gene locus_tag LOCUS_39000 7559 9439 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_39000 9809 10612 gene locus_tag LOCUS_39010 9809 10612 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820134.1 protein_id gnl|my_center|LOCUS_39010 10793 13306 gene locus_tag LOCUS_39020 10793 13306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 >Feature sequence176 3181 191 gene locus_tag LOCUS_39030 3181 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 3648 4121 gene locus_tag LOCUS_39040 3648 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 5267 4197 gene locus_tag LOCUS_39050 gene leuB 5267 4197 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328413.1 protein_id gnl|my_center|LOCUS_39050 5747 6952 gene locus_tag LOCUS_39060 5747 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 7463 7074 gene locus_tag LOCUS_39070 7463 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 8140 7466 gene locus_tag LOCUS_39080 8140 7466 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111910.1 protein_id gnl|my_center|LOCUS_39080 9645 8392 gene locus_tag LOCUS_39090 9645 8392 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_39090 10069 11520 gene locus_tag LOCUS_39100 10069 11520 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_39100 12201 11614 gene locus_tag LOCUS_39110 12201 11614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 12380 12766 gene locus_tag LOCUS_39120 12380 12766 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_39120 >Feature sequence177 639 145 gene locus_tag LOCUS_39130 639 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 1381 2592 gene locus_tag LOCUS_39140 1381 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327711.1 protein_id gnl|my_center|LOCUS_39140 2806 3675 gene locus_tag LOCUS_39150 2806 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 4006 4266 gene locus_tag LOCUS_39160 4006 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 4268 4861 gene locus_tag LOCUS_39170 4268 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 4858 5343 gene locus_tag LOCUS_39180 4858 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 5592 6410 gene locus_tag LOCUS_39190 5592 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 6617 8227 gene locus_tag LOCUS_39200 6617 8227 CDS product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921874.1 protein_id gnl|my_center|LOCUS_39200 10157 8604 gene locus_tag LOCUS_39210 10157 8604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 10905 12164 gene locus_tag LOCUS_39220 gene sat 10905 12164 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438012.1 protein_id gnl|my_center|LOCUS_39220 12443 13057 gene locus_tag LOCUS_39230 12443 13057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 >Feature sequence178 316 1608 gene locus_tag LOCUS_39240 316 1608 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119960.1 protein_id gnl|my_center|LOCUS_39240 2091 1939 gene locus_tag LOCUS_39250 2091 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 2522 3073 gene locus_tag LOCUS_39260 2522 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 3194 3541 gene locus_tag LOCUS_39270 3194 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 3696 5126 gene locus_tag LOCUS_39280 3696 5126 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921758.1 protein_id gnl|my_center|LOCUS_39280 5138 8605 gene locus_tag LOCUS_39290 5138 8605 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_39290 8695 9234 gene locus_tag LOCUS_39300 8695 9234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 9304 9642 gene locus_tag LOCUS_39310 9304 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 9728 11248 gene locus_tag LOCUS_39320 9728 11248 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037254759.1 protein_id gnl|my_center|LOCUS_39320 12296 11637 gene locus_tag LOCUS_39330 12296 11637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 12611 12342 gene locus_tag LOCUS_39340 12611 12342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 >Feature sequence179 211 1536 gene locus_tag LOCUS_39350 211 1536 CDS product Trx7/PDZ domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922213.1 protein_id gnl|my_center|LOCUS_39350 4063 1649 gene locus_tag LOCUS_39360 4063 1649 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084771.1 protein_id gnl|my_center|LOCUS_39360 7127 4164 gene locus_tag LOCUS_39370 7127 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 8659 7673 gene locus_tag LOCUS_39380 8659 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 8889 9671 gene locus_tag LOCUS_39390 8889 9671 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258579.1 protein_id gnl|my_center|LOCUS_39390 12319 9707 gene locus_tag LOCUS_39400 gene alaS 12319 9707 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121911.1 protein_id gnl|my_center|LOCUS_39400 >Feature sequence180 2025 484 gene locus_tag LOCUS_39410 2025 484 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119574.1 protein_id gnl|my_center|LOCUS_39410 2601 3155 gene locus_tag LOCUS_39420 2601 3155 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531897.1 protein_id gnl|my_center|LOCUS_39420 3146 3613 gene locus_tag LOCUS_39430 3146 3613 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943318.1 protein_id gnl|my_center|LOCUS_39430 3751 3990 gene locus_tag LOCUS_39440 3751 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 3924 4256 gene locus_tag LOCUS_39450 3924 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 4590 5978 gene locus_tag LOCUS_39460 4590 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 6506 6192 gene locus_tag LOCUS_39470 6506 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 6946 6587 gene locus_tag LOCUS_39480 6946 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 8637 7171 gene locus_tag LOCUS_39490 8637 7171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 9345 10856 gene locus_tag LOCUS_39500 9345 10856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 11029 12558 gene locus_tag LOCUS_39510 11029 12558 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123376.1 protein_id gnl|my_center|LOCUS_39510 >Feature sequence181 140 6544 gene locus_tag LOCUS_39520 140 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 6668 7546 gene locus_tag LOCUS_39530 6668 7546 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058043.1 protein_id gnl|my_center|LOCUS_39530 8241 7552 gene locus_tag LOCUS_39540 8241 7552 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_39540 8386 8460 gene locus_tag LOCUS_t00270 8386 8460 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10333 8909 gene locus_tag LOCUS_39550 10333 8909 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_39550 11409 10330 gene locus_tag LOCUS_39560 11409 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 11788 11534 gene locus_tag LOCUS_39570 11788 11534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 >Feature sequence182 75 1064 gene locus_tag LOCUS_39580 75 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123623.1 protein_id gnl|my_center|LOCUS_39580 1061 2020 gene locus_tag LOCUS_39590 1061 2020 CDS product DnaB-like helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123622.1 protein_id gnl|my_center|LOCUS_39590 2017 2442 gene locus_tag LOCUS_39600 2017 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 2622 2864 gene locus_tag LOCUS_39610 2622 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 2869 4674 gene locus_tag LOCUS_39620 2869 4674 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197532628.1 protein_id gnl|my_center|LOCUS_39620 4657 4582 gene locus_tag LOCUS_t00280 4657 4582 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5659 4736 gene locus_tag LOCUS_39630 5659 4736 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118761.1 protein_id gnl|my_center|LOCUS_39630 7582 5846 gene locus_tag LOCUS_39640 7582 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 8774 7932 gene locus_tag LOCUS_39650 8774 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 9022 12432 gene locus_tag LOCUS_39660 9022 12432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 >Feature sequence183 433 1833 gene locus_tag LOCUS_39670 433 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198142920.1 protein_id gnl|my_center|LOCUS_39670 1959 3014 gene locus_tag LOCUS_39680 1959 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 3029 3805 gene locus_tag LOCUS_39690 3029 3805 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967020.1 protein_id gnl|my_center|LOCUS_39690 3808 5202 gene locus_tag LOCUS_39700 3808 5202 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763469.1 protein_id gnl|my_center|LOCUS_39700 5199 6149 gene locus_tag LOCUS_39710 5199 6149 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106713570.1 protein_id gnl|my_center|LOCUS_39710 8621 6240 gene locus_tag LOCUS_39720 8621 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 9977 8631 gene locus_tag LOCUS_39730 9977 8631 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_39730 12448 9995 gene locus_tag LOCUS_39740 12448 9995 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816832.1 protein_id gnl|my_center|LOCUS_39740 >Feature sequence184 258 734 gene locus_tag LOCUS_39750 258 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 767 1789 gene locus_tag LOCUS_39760 767 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 1819 2535 gene locus_tag LOCUS_39770 1819 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 5090 2745 gene locus_tag LOCUS_39780 5090 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 5658 5428 gene locus_tag LOCUS_39790 5658 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 5657 6571 gene locus_tag LOCUS_39800 5657 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 6568 8448 gene locus_tag LOCUS_39810 6568 8448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 8619 9065 gene locus_tag LOCUS_39820 8619 9065 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229066.1 protein_id gnl|my_center|LOCUS_39820 9485 10978 gene locus_tag LOCUS_39830 9485 10978 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_39830 11706 11218 gene locus_tag LOCUS_39840 11706 11218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 12373 12446 gene locus_tag LOCUS_t00290 12373 12446 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence185 183 983 gene locus_tag LOCUS_39850 183 983 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203675.1 protein_id gnl|my_center|LOCUS_39850 1121 2251 gene locus_tag LOCUS_39860 1121 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 4793 2424 gene locus_tag LOCUS_39870 4793 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 7163 4905 gene locus_tag LOCUS_39880 7163 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 8279 7398 gene locus_tag LOCUS_39890 8279 7398 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070486.1 protein_id gnl|my_center|LOCUS_39890 8826 8386 gene locus_tag LOCUS_39900 8826 8386 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 protein_id gnl|my_center|LOCUS_39900 10076 9036 gene locus_tag LOCUS_39910 10076 9036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 11991 10213 gene locus_tag LOCUS_39920 11991 10213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 >Feature sequence186 359 1789 gene locus_tag LOCUS_39930 gene purB 359 1789 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_39930 3667 1973 gene locus_tag LOCUS_39940 3667 1973 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_39940 4592 3732 gene locus_tag LOCUS_39950 4592 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 5365 4676 gene locus_tag LOCUS_39960 5365 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 5875 7002 gene locus_tag LOCUS_39970 5875 7002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 7508 8194 gene locus_tag LOCUS_39980 7508 8194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 8293 9096 gene locus_tag LOCUS_39990 8293 9096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 9097 9918 gene locus_tag LOCUS_40000 9097 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 11971 10160 gene locus_tag LOCUS_40010 11971 10160 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530489.1 protein_id gnl|my_center|LOCUS_40010 12323 12396 gene locus_tag LOCUS_t00300 12323 12396 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence187 2047 104 gene locus_tag LOCUS_40020 2047 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 3713 2238 gene locus_tag LOCUS_40030 3713 2238 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_40030 4867 3710 gene locus_tag LOCUS_40040 4867 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 5296 6387 gene locus_tag LOCUS_40050 5296 6387 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_40050 6580 7977 gene locus_tag LOCUS_40060 6580 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 10257 8212 gene locus_tag LOCUS_40070 10257 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 <12458 10626 gene locus_tag LOCUS_40080 <12458 10626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808454.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence188 2358 1768 gene locus_tag LOCUS_40090 2358 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 3059 2826 gene locus_tag LOCUS_40100 3059 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 3540 3331 gene locus_tag LOCUS_40110 3540 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 3877 3638 gene locus_tag LOCUS_40120 3877 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 4304 4071 gene locus_tag LOCUS_40130 4304 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 4708 4457 gene locus_tag LOCUS_40140 4708 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 6589 4790 gene locus_tag LOCUS_40150 6589 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 7295 7534 gene locus_tag LOCUS_40160 7295 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 7734 8681 gene locus_tag LOCUS_40170 7734 8681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 10063 8852 gene locus_tag LOCUS_40180 10063 8852 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921846.1 protein_id gnl|my_center|LOCUS_40180 11330 10287 gene locus_tag LOCUS_40190 11330 10287 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114954.1 protein_id gnl|my_center|LOCUS_40190 <12304 11505 gene locus_tag LOCUS_40200 <12304 11505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_136348290.1:type II secretion system F family protein >Feature sequence189 36 1562 gene locus_tag LOCUS_40210 36 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_40210 1766 4147 gene locus_tag LOCUS_40220 1766 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 5340 4324 gene locus_tag LOCUS_40230 5340 4324 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922840.1 protein_id gnl|my_center|LOCUS_40230 6366 6515 gene locus_tag LOCUS_40240 6366 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 6966 8309 gene locus_tag LOCUS_40250 6966 8309 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932712.1 protein_id gnl|my_center|LOCUS_40250 8499 9809 gene locus_tag LOCUS_40260 8499 9809 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 protein_id gnl|my_center|LOCUS_40260 10098 11204 gene locus_tag LOCUS_40270 10098 11204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142695.1 protein_id gnl|my_center|LOCUS_40270 11305 11388 gene locus_tag LOCUS_t00310 11305 11388 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11602 11886 gene locus_tag LOCUS_40280 11602 11886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 >Feature sequence190 74 1423 gene locus_tag LOCUS_40290 74 1423 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_40290 1553 2494 gene locus_tag LOCUS_40300 1553 2494 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881382.1 protein_id gnl|my_center|LOCUS_40300 3701 2745 gene locus_tag LOCUS_40310 gene dusB 3701 2745 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_40310 4692 3781 gene locus_tag LOCUS_40320 4692 3781 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_40320 5115 4723 gene locus_tag LOCUS_40330 5115 4723 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_40330 5342 5112 gene locus_tag LOCUS_40340 5342 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 6600 5938 gene locus_tag LOCUS_40350 6600 5938 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_40350 8128 7019 gene locus_tag LOCUS_40360 8128 7019 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121284.1 protein_id gnl|my_center|LOCUS_40360 8568 9362 gene locus_tag LOCUS_40370 8568 9362 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074241.1 protein_id gnl|my_center|LOCUS_40370 9355 11220 gene locus_tag LOCUS_40380 9355 11220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 >Feature sequence191 1177 713 gene locus_tag LOCUS_40390 1177 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146526025.1 protein_id gnl|my_center|LOCUS_40390 2933 2490 gene locus_tag LOCUS_40400 2933 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 3668 3264 gene locus_tag LOCUS_40410 3668 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 4849 3779 gene locus_tag LOCUS_40420 4849 3779 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082266.1 protein_id gnl|my_center|LOCUS_40420 5597 4944 gene locus_tag LOCUS_40430 5597 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 6904 6581 gene locus_tag LOCUS_40440 6904 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 7835 8662 gene locus_tag LOCUS_40450 7835 8662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 8662 11805 gene locus_tag LOCUS_40460 8662 11805 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804239.1 protein_id gnl|my_center|LOCUS_40460 >Feature sequence192 2014 539 gene locus_tag LOCUS_40470 gene gcvPB 2014 539 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121465.1 protein_id gnl|my_center|LOCUS_40470 3442 2087 gene locus_tag LOCUS_40480 gene gcvPA 3442 2087 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331407.1 protein_id gnl|my_center|LOCUS_40480 3952 3566 gene locus_tag LOCUS_40490 gene gcvH 3952 3566 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259335.1 protein_id gnl|my_center|LOCUS_40490 4637 4161 gene locus_tag LOCUS_40500 gene rpiB 4637 4161 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122948.1 protein_id gnl|my_center|LOCUS_40500 5969 4812 gene locus_tag LOCUS_40510 5969 4812 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122949.1 protein_id gnl|my_center|LOCUS_40510 6255 6656 gene locus_tag LOCUS_40520 6255 6656 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943630.1 protein_id gnl|my_center|LOCUS_40520 6897 7409 gene locus_tag LOCUS_40530 6897 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 8253 7339 gene locus_tag LOCUS_40540 8253 7339 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921488.1 protein_id gnl|my_center|LOCUS_40540 8638 8312 gene locus_tag LOCUS_40550 8638 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 10025 8928 gene locus_tag LOCUS_40560 10025 8928 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807527.1 protein_id gnl|my_center|LOCUS_40560 11168 10080 gene locus_tag LOCUS_40570 11168 10080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 11654 11322 gene locus_tag LOCUS_40580 11654 11322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 >Feature sequence193 1032 160 gene locus_tag LOCUS_40590 1032 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 2103 1036 gene locus_tag LOCUS_40600 2103 1036 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922058.1 protein_id gnl|my_center|LOCUS_40600 2363 2100 gene locus_tag LOCUS_40610 2363 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 2748 2440 gene locus_tag LOCUS_40620 2748 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 4501 2750 gene locus_tag LOCUS_40630 4501 2750 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922881.1 protein_id gnl|my_center|LOCUS_40630 5764 4556 gene locus_tag LOCUS_40640 5764 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 6985 5942 gene locus_tag LOCUS_40650 6985 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615992.1 protein_id gnl|my_center|LOCUS_40650 9032 7152 gene locus_tag LOCUS_40660 9032 7152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 11865 9373 gene locus_tag LOCUS_40670 11865 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 >Feature sequence194 315 2012 gene locus_tag LOCUS_40680 315 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 2009 3343 gene locus_tag LOCUS_40690 2009 3343 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_40690 3751 4419 gene locus_tag LOCUS_40700 3751 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 4474 5151 gene locus_tag LOCUS_40710 4474 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 5638 5183 gene locus_tag LOCUS_40720 5638 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 6663 5656 gene locus_tag LOCUS_40730 6663 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 6818 7510 gene locus_tag LOCUS_40740 6818 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 7708 8646 gene locus_tag LOCUS_40750 7708 8646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 9819 8758 gene locus_tag LOCUS_40760 9819 8758 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724126.1 protein_id gnl|my_center|LOCUS_40760 10324 9959 gene locus_tag LOCUS_40770 10324 9959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 >Feature sequence195 430 122 gene locus_tag LOCUS_40780 430 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 315 830 gene locus_tag LOCUS_40790 315 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921838.1 protein_id gnl|my_center|LOCUS_40790 856 2205 gene locus_tag LOCUS_40800 856 2205 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_40800 2298 4763 gene locus_tag LOCUS_40810 2298 4763 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120349.1 protein_id gnl|my_center|LOCUS_40810 6061 7023 gene locus_tag LOCUS_40820 6061 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 7247 8911 gene locus_tag LOCUS_40830 7247 8911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 10006 10290 gene locus_tag LOCUS_40840 10006 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 10421 11149 gene locus_tag LOCUS_40850 10421 11149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 >Feature sequence196 1331 636 gene locus_tag LOCUS_40860 1331 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 1580 1353 gene locus_tag LOCUS_40870 1580 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 2717 2364 gene locus_tag LOCUS_40880 2717 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 3424 2786 gene locus_tag LOCUS_40890 3424 2786 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531660.1 protein_id gnl|my_center|LOCUS_40890 3731 3510 gene locus_tag LOCUS_40900 3731 3510 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941743.1 protein_id gnl|my_center|LOCUS_40900 3858 4439 gene locus_tag LOCUS_40910 3858 4439 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172340.1 protein_id gnl|my_center|LOCUS_40910 5461 4772 gene locus_tag LOCUS_40920 5461 4772 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_40920 5524 6012 gene locus_tag LOCUS_40930 5524 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 6662 8002 gene locus_tag LOCUS_40940 6662 8002 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_40940 8014 9462 gene locus_tag LOCUS_40950 8014 9462 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_40950 9459 11552 gene locus_tag LOCUS_40960 9459 11552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 >Feature sequence197 1019 1342 gene locus_tag LOCUS_40970 1019 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 1633 1322 gene locus_tag LOCUS_40980 1633 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 1698 2636 gene locus_tag LOCUS_40990 1698 2636 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731604.1 protein_id gnl|my_center|LOCUS_40990 3004 3246 gene locus_tag LOCUS_41000 3004 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 3312 4520 gene locus_tag LOCUS_41010 3312 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 4853 4542 gene locus_tag LOCUS_41020 4853 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 5432 6589 gene locus_tag LOCUS_41030 5432 6589 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119981.1 protein_id gnl|my_center|LOCUS_41030 6683 9037 gene locus_tag LOCUS_41040 6683 9037 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330940.1 protein_id gnl|my_center|LOCUS_41040 9034 9531 gene locus_tag LOCUS_41050 gene ybeY 9034 9531 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259163.1 protein_id gnl|my_center|LOCUS_41050 9536 10852 gene locus_tag LOCUS_41060 9536 10852 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119979.1 protein_id gnl|my_center|LOCUS_41060 11655 11251 gene locus_tag LOCUS_41070 11655 11251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 >Feature sequence198 2034 217 gene locus_tag LOCUS_41080 2034 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 3231 2350 gene locus_tag LOCUS_41090 3231 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 3656 3336 gene locus_tag LOCUS_41100 3656 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 4094 5050 gene locus_tag LOCUS_41110 4094 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 7261 5261 gene locus_tag LOCUS_41120 7261 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 10801 7421 gene locus_tag LOCUS_41130 10801 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 11542 11135 gene locus_tag LOCUS_41140 11542 11135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 >Feature sequence199 1279 1025 gene locus_tag LOCUS_41150 1279 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 1815 2990 gene locus_tag LOCUS_41160 1815 2990 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880955.1 protein_id gnl|my_center|LOCUS_41160 3244 4290 gene locus_tag LOCUS_41170 3244 4290 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957409.1 protein_id gnl|my_center|LOCUS_41170 4528 5532 gene locus_tag LOCUS_41180 4528 5532 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_41180 5860 7161 gene locus_tag LOCUS_41190 5860 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 7175 7636 gene locus_tag LOCUS_41200 7175 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 7633 8349 gene locus_tag LOCUS_41210 7633 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 8346 8783 gene locus_tag LOCUS_41220 8346 8783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 8983 10044 gene locus_tag LOCUS_41230 8983 10044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 10229 11155 gene locus_tag LOCUS_41240 10229 11155 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922172.1 protein_id gnl|my_center|LOCUS_41240 11267 11464 gene locus_tag LOCUS_41250 11267 11464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 >Feature sequence200 4307 5026 gene locus_tag LOCUS_41260 4307 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 5023 5640 gene locus_tag LOCUS_41270 5023 5640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 6027 5749 gene locus_tag LOCUS_41280 6027 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 5932 6657 gene locus_tag LOCUS_41290 5932 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 6657 7529 gene locus_tag LOCUS_41300 6657 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 8049 7633 gene locus_tag LOCUS_41310 8049 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 8513 8971 gene locus_tag LOCUS_41320 8513 8971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327803.1 protein_id gnl|my_center|LOCUS_41320 10179 9058 gene locus_tag LOCUS_41330 10179 9058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 10401 10826 gene locus_tag LOCUS_41340 10401 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 10823 11587 gene locus_tag LOCUS_41350 10823 11587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 >Feature sequence201 271 471 gene locus_tag LOCUS_41360 271 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 829 2598 gene locus_tag LOCUS_41370 829 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615709.1 protein_id gnl|my_center|LOCUS_41370 2785 3387 gene locus_tag LOCUS_41380 2785 3387 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121917.1 protein_id gnl|my_center|LOCUS_41380 3489 6614 gene locus_tag LOCUS_41390 3489 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 7465 6788 gene locus_tag LOCUS_41400 7465 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 8436 8047 gene locus_tag LOCUS_41410 8436 8047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 8326 9792 gene locus_tag LOCUS_41420 8326 9792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 >Feature sequence202 1803 118 gene locus_tag LOCUS_41430 1803 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 2449 3444 gene locus_tag LOCUS_41440 2449 3444 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_41440 4068 3679 gene locus_tag LOCUS_41450 4068 3679 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036007.1 protein_id gnl|my_center|LOCUS_41450 4512 7544 gene locus_tag LOCUS_41460 4512 7544 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123898.1 protein_id gnl|my_center|LOCUS_41460 7784 7975 gene locus_tag LOCUS_41470 7784 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 8841 8458 gene locus_tag LOCUS_41480 8841 8458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 9073 8834 gene locus_tag LOCUS_41490 9073 8834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 9702 9271 gene locus_tag LOCUS_41500 9702 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 10134 9733 gene locus_tag LOCUS_41510 10134 9733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 10819 10151 gene locus_tag LOCUS_41520 10819 10151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 >Feature sequence203 463 2376 gene locus_tag LOCUS_41530 463 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 3310 2606 gene locus_tag LOCUS_41540 gene queC 3310 2606 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_41540 3828 4778 gene locus_tag LOCUS_41550 3828 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 4872 5081 gene locus_tag LOCUS_41560 4872 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 5306 5857 gene locus_tag LOCUS_41570 5306 5857 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008652955.1 protein_id gnl|my_center|LOCUS_41570 6217 5966 gene locus_tag LOCUS_41580 6217 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 6563 6279 gene locus_tag LOCUS_41590 6563 6279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 6811 8616 gene locus_tag LOCUS_41600 6811 8616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 9057 9422 gene locus_tag LOCUS_41610 9057 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 9689 10498 gene locus_tag LOCUS_41620 9689 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 >Feature sequence204 <1 631 gene locus_tag LOCUS_41630 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041608957.1:transposase 1740 871 gene locus_tag LOCUS_41640 1740 871 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943148.1 protein_id gnl|my_center|LOCUS_41640 2097 4295 gene locus_tag LOCUS_41650 2097 4295 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_41650 5425 4331 gene locus_tag LOCUS_41660 5425 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 6552 5623 gene locus_tag LOCUS_41670 6552 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 7003 6704 gene locus_tag LOCUS_41680 7003 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 8371 7064 gene locus_tag LOCUS_41690 8371 7064 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324232.1 protein_id gnl|my_center|LOCUS_41690 9796 8798 gene locus_tag LOCUS_41700 9796 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 10948 10370 gene locus_tag LOCUS_41710 10948 10370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 >Feature sequence205 1690 587 gene locus_tag LOCUS_41720 1690 587 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 protein_id gnl|my_center|LOCUS_41720 1904 2680 gene locus_tag LOCUS_41730 1904 2680 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188202.1 protein_id gnl|my_center|LOCUS_41730 4274 2862 gene locus_tag LOCUS_41740 4274 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 4375 4536 gene locus_tag LOCUS_41750 4375 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 5148 4690 gene locus_tag LOCUS_41760 5148 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 5878 5627 gene locus_tag LOCUS_41770 5878 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41770 6571 8586 gene locus_tag LOCUS_41780 6571 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 >Feature sequence206 3 5942 gene locus_tag LOCUS_41790 3 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 6060 7184 gene locus_tag LOCUS_41800 6060 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 7491 8435 gene locus_tag LOCUS_41810 7491 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 9221 8700 gene locus_tag LOCUS_41820 9221 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 9346 10629 gene locus_tag LOCUS_41830 9346 10629 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921480.1 protein_id gnl|my_center|LOCUS_41830 >Feature sequence207 5097 3961 gene locus_tag LOCUS_41840 5097 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 5543 5226 gene locus_tag LOCUS_41850 5543 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 5804 6754 gene locus_tag LOCUS_41860 5804 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 7283 7501 gene locus_tag LOCUS_41870 7283 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 7860 8636 gene locus_tag LOCUS_41880 7860 8636 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_41880 8647 10314 gene locus_tag LOCUS_41890 8647 10314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120907.1 protein_id gnl|my_center|LOCUS_41890 >Feature sequence208 <1 4851 gene locus_tag LOCUS_41900 <1 4851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211638.1:autotransporter adhesin YapH 5097 10682 gene locus_tag LOCUS_41910 5097 10682 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122240.1 protein_id gnl|my_center|LOCUS_41910 >Feature sequence209 <1 1374 gene locus_tag LOCUS_41920 <1 1374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119585.1:DPP IV N-terminal domain-containing protein 1489 2451 gene locus_tag LOCUS_41930 1489 2451 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120364.1 protein_id gnl|my_center|LOCUS_41930 2561 4087 gene locus_tag LOCUS_41940 2561 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 4084 5946 gene locus_tag LOCUS_41950 4084 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 6107 8524 gene locus_tag LOCUS_41960 6107 8524 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921685.1 protein_id gnl|my_center|LOCUS_41960 8703 10211 gene locus_tag LOCUS_41970 8703 10211 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615908.1 protein_id gnl|my_center|LOCUS_41970 10456 10614 gene locus_tag LOCUS_41980 10456 10614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 >Feature sequence210 899 540 gene locus_tag LOCUS_41990 899 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41990 1275 997 gene locus_tag LOCUS_42000 1275 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 1734 2309 gene locus_tag LOCUS_42010 1734 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42010 2377 2604 gene locus_tag LOCUS_42020 2377 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42020 2804 5959 gene locus_tag LOCUS_42030 2804 5959 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666716.1 protein_id gnl|my_center|LOCUS_42030 6030 7469 gene locus_tag LOCUS_42040 6030 7469 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_42040 7543 10143 gene locus_tag LOCUS_42050 7543 10143 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923035.1 protein_id gnl|my_center|LOCUS_42050 >Feature sequence211 1386 226 gene locus_tag LOCUS_42060 1386 226 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_42060 2245 2105 gene locus_tag LOCUS_42070 2245 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 3317 2676 gene locus_tag LOCUS_42080 3317 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 4494 3235 gene locus_tag LOCUS_42090 4494 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 6225 4654 gene locus_tag LOCUS_42100 6225 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 7691 6420 gene locus_tag LOCUS_42110 7691 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 9419 8499 gene locus_tag LOCUS_42120 9419 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 >Feature sequence212 177 107 gene locus_tag LOCUS_t00320 177 107 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 579 1091 gene locus_tag LOCUS_42130 579 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 1148 2158 gene locus_tag LOCUS_42140 1148 2158 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_42140 2449 4107 gene locus_tag LOCUS_42150 2449 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 4138 5961 gene locus_tag LOCUS_42160 4138 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 6312 7208 gene locus_tag LOCUS_42170 6312 7208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 7364 8629 gene locus_tag LOCUS_42180 7364 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 10326 8638 gene locus_tag LOCUS_42190 10326 8638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 >Feature sequence213 1820 489 gene locus_tag LOCUS_42200 1820 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 protein_id gnl|my_center|LOCUS_42200 3212 2112 gene locus_tag LOCUS_42210 3212 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 3603 3385 gene locus_tag LOCUS_42220 3603 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 3842 4060 gene locus_tag LOCUS_42230 3842 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 6381 4084 gene locus_tag LOCUS_42240 6381 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 7685 6543 gene locus_tag LOCUS_42250 7685 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 7796 8023 gene locus_tag LOCUS_42260 7796 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 8400 8218 gene locus_tag LOCUS_42270 8400 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 9142 8879 gene locus_tag LOCUS_42280 9142 8879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 9029 9544 gene locus_tag LOCUS_42290 9029 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 9721 9515 gene locus_tag LOCUS_42300 9721 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 >Feature sequence214 130 714 gene locus_tag LOCUS_42310 130 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 1311 832 gene locus_tag LOCUS_42320 1311 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 1702 2787 gene locus_tag LOCUS_42330 1702 2787 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325404.1 protein_id gnl|my_center|LOCUS_42330 3303 6920 gene locus_tag LOCUS_42340 3303 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 7068 8006 gene locus_tag LOCUS_42350 7068 8006 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425940.1 protein_id gnl|my_center|LOCUS_42350 9139 8039 gene locus_tag LOCUS_42360 9139 8039 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921852.1 protein_id gnl|my_center|LOCUS_42360 9462 10463 gene locus_tag LOCUS_42370 9462 10463 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388203.1 protein_id gnl|my_center|LOCUS_42370 >Feature sequence215 2158 554 gene locus_tag LOCUS_42380 2158 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 3103 2303 gene locus_tag LOCUS_42390 3103 2303 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518184.1 protein_id gnl|my_center|LOCUS_42390 4560 3256 gene locus_tag LOCUS_42400 4560 3256 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_42400 6859 4586 gene locus_tag LOCUS_42410 6859 4586 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_42410 9506 6903 gene locus_tag LOCUS_42420 9506 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 >Feature sequence216 321 1373 gene locus_tag LOCUS_42430 gene rsmH 321 1373 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_42430 2385 1459 gene locus_tag LOCUS_42440 2385 1459 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121793.1 protein_id gnl|my_center|LOCUS_42440 3557 2388 gene locus_tag LOCUS_42450 3557 2388 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_42450 4496 3900 gene locus_tag LOCUS_42460 4496 3900 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122936.1 protein_id gnl|my_center|LOCUS_42460 4720 5661 gene locus_tag LOCUS_42470 4720 5661 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141330.1 protein_id gnl|my_center|LOCUS_42470 6072 5689 gene locus_tag LOCUS_42480 gene tatA 6072 5689 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403443.1 protein_id gnl|my_center|LOCUS_42480 6394 6185 gene locus_tag LOCUS_42490 6394 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 7925 6978 gene locus_tag LOCUS_42500 7925 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 10511 8136 gene locus_tag LOCUS_42510 10511 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 >Feature sequence217 918 325 gene locus_tag LOCUS_42520 918 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 1160 915 gene locus_tag LOCUS_42530 1160 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 2653 1337 gene locus_tag LOCUS_42540 2653 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 4189 2798 gene locus_tag LOCUS_42550 4189 2798 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_42550 5775 4216 gene locus_tag LOCUS_42560 5775 4216 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108267.1 protein_id gnl|my_center|LOCUS_42560 7917 6184 gene locus_tag LOCUS_42570 7917 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 >Feature sequence218 141 1082 gene locus_tag LOCUS_42580 gene speE 141 1082 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583812.1 protein_id gnl|my_center|LOCUS_42580 1082 2392 gene locus_tag LOCUS_42590 1082 2392 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_42590 3188 2655 gene locus_tag LOCUS_42600 3188 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 5106 3754 gene locus_tag LOCUS_42610 5106 3754 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_42610 5540 5890 gene locus_tag LOCUS_42620 5540 5890 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226860.1 protein_id gnl|my_center|LOCUS_42620 6012 6860 gene locus_tag LOCUS_42630 gene rfbD 6012 6860 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_42630 7512 7042 gene locus_tag LOCUS_42640 7512 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 9251 8181 gene locus_tag LOCUS_42650 9251 8181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 10293 9493 gene locus_tag LOCUS_42660 10293 9493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 >Feature sequence219 300 374 gene locus_tag LOCUS_t00330 300 374 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 480 1649 gene locus_tag LOCUS_42670 480 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 1771 2472 gene locus_tag LOCUS_42680 1771 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 2772 3026 gene locus_tag LOCUS_42690 2772 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 3109 3324 gene locus_tag LOCUS_42700 3109 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 3324 5417 gene locus_tag LOCUS_42710 3324 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 5514 5759 gene locus_tag LOCUS_42720 5514 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 6125 6640 gene locus_tag LOCUS_42730 6125 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 6637 8604 gene locus_tag LOCUS_42740 6637 8604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 8781 9002 gene locus_tag LOCUS_42750 8781 9002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 9049 9216 gene locus_tag LOCUS_42760 9049 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 9966 10115 gene locus_tag LOCUS_42770 9966 10115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 >Feature sequence220 46 2544 gene locus_tag LOCUS_42780 46 2544 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037249708.1 protein_id gnl|my_center|LOCUS_42780 4061 2637 gene locus_tag LOCUS_42790 4061 2637 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121489.1 protein_id gnl|my_center|LOCUS_42790 4465 6531 gene locus_tag LOCUS_42800 4465 6531 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_42800 7317 8981 gene locus_tag LOCUS_42810 7317 8981 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941965.1 protein_id gnl|my_center|LOCUS_42810 9126 10202 gene locus_tag LOCUS_42820 gene hisC 9126 10202 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 protein_id gnl|my_center|LOCUS_42820 >Feature sequence221 1026 1766 gene locus_tag LOCUS_42830 1026 1766 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_42830 1895 3931 gene locus_tag LOCUS_42840 1895 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 4079 5470 gene locus_tag LOCUS_42850 4079 5470 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123471.1 protein_id gnl|my_center|LOCUS_42850 5728 6996 gene locus_tag LOCUS_42860 5728 6996 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_42860 7245 8420 gene locus_tag LOCUS_42870 7245 8420 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942513.1 protein_id gnl|my_center|LOCUS_42870 8575 9984 gene locus_tag LOCUS_42880 8575 9984 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123589.1 protein_id gnl|my_center|LOCUS_42880 >Feature sequence222 6963 343 gene locus_tag LOCUS_42890 6963 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 >Feature sequence223 367 1560 gene locus_tag LOCUS_42900 367 1560 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 protein_id gnl|my_center|LOCUS_42900 1683 2009 gene locus_tag LOCUS_42910 1683 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 2002 2313 gene locus_tag LOCUS_42920 2002 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 2344 4299 gene locus_tag LOCUS_42930 gene asnB 2344 4299 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_42930 4575 7118 gene locus_tag LOCUS_42940 4575 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 7413 8897 gene locus_tag LOCUS_42950 gene pyk 7413 8897 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943944.1 protein_id gnl|my_center|LOCUS_42950 8970 9236 gene locus_tag LOCUS_42960 8970 9236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 >Feature sequence224 2044 1061 gene locus_tag LOCUS_42970 2044 1061 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339822.1 protein_id gnl|my_center|LOCUS_42970 2538 4484 gene locus_tag LOCUS_42980 2538 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 4520 4750 gene locus_tag LOCUS_42990 4520 4750 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142023.1 protein_id gnl|my_center|LOCUS_42990 4940 5137 gene locus_tag LOCUS_43000 4940 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43000 5267 5827 gene locus_tag LOCUS_43010 5267 5827 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881371.1 protein_id gnl|my_center|LOCUS_43010 5987 6304 gene locus_tag LOCUS_43020 5987 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 7659 6586 gene locus_tag LOCUS_43030 7659 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 8100 8029 gene locus_tag LOCUS_t00340 8100 8029 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8436 9233 gene locus_tag LOCUS_43040 8436 9233 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971598.1 protein_id gnl|my_center|LOCUS_43040 >Feature sequence225 5673 5035 gene locus_tag LOCUS_43050 5673 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 7733 6348 gene locus_tag LOCUS_43060 7733 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 8164 7808 gene locus_tag LOCUS_43070 gene mazF6 8164 7808 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410010.1 protein_id gnl|my_center|LOCUS_43070 8412 8161 gene locus_tag LOCUS_43080 8412 8161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 <10008 8425 gene locus_tag LOCUS_43090 <10008 8425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120679.1:DUF1549 domain-containing protein >Feature sequence226 4715 3504 gene locus_tag LOCUS_43100 4715 3504 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_43100 5707 4895 gene locus_tag LOCUS_43110 5707 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118465.1 protein_id gnl|my_center|LOCUS_43110 6011 7330 gene locus_tag LOCUS_43120 6011 7330 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922057.1 protein_id gnl|my_center|LOCUS_43120 7526 7600 gene locus_tag LOCUS_t00350 7526 7600 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8777 7545 gene locus_tag LOCUS_43130 8777 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 9031 9356 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccgctccccactcaatgaggggggagaac 9826 9536 gene locus_tag LOCUS_43140 gene cas2 9826 9536 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932801.1 protein_id gnl|my_center|LOCUS_43140 >Feature sequence227 762 1367 gene locus_tag LOCUS_43150 762 1367 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064101.1 protein_id gnl|my_center|LOCUS_43150 1377 3935 gene locus_tag LOCUS_43160 1377 3935 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921574.1 protein_id gnl|my_center|LOCUS_43160 3952 6537 gene locus_tag LOCUS_43170 3952 6537 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_43170 6841 8031 gene locus_tag LOCUS_43180 6841 8031 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_43180 8105 8269 gene locus_tag LOCUS_43190 8105 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 8316 8627 gene locus_tag LOCUS_43200 8316 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 >Feature sequence228 1222 587 gene locus_tag LOCUS_43210 1222 587 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022715.1 protein_id gnl|my_center|LOCUS_43210 1460 2728 gene locus_tag LOCUS_43220 gene mexE 1460 2728 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103549.1 protein_id gnl|my_center|LOCUS_43220 2798 6106 gene locus_tag LOCUS_43230 2798 6106 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380455.1 protein_id gnl|my_center|LOCUS_43230 6128 9451 gene locus_tag LOCUS_43240 6128 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 9441 9689 gene locus_tag LOCUS_43250 9441 9689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 >Feature sequence229 3885 352 gene locus_tag LOCUS_43260 3885 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 7941 4069 gene locus_tag LOCUS_43270 7941 4069 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921683.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43270 8960 7896 gene locus_tag LOCUS_43280 8960 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43280 >Feature sequence230 978 640 gene locus_tag LOCUS_43290 978 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 2127 1324 gene locus_tag LOCUS_43300 2127 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 2146 2382 gene locus_tag LOCUS_43310 2146 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 3561 2434 gene locus_tag LOCUS_43320 3561 2434 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_43320 5408 3699 gene locus_tag LOCUS_43330 5408 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 6756 5581 gene locus_tag LOCUS_43340 6756 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 8199 6769 gene locus_tag LOCUS_43350 8199 6769 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120139.1 protein_id gnl|my_center|LOCUS_43350 8466 9143 gene locus_tag LOCUS_43360 8466 9143 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809725.1 protein_id gnl|my_center|LOCUS_43360 >Feature sequence231 <1 769 gene locus_tag LOCUS_43370 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921931.1:chromosome segregation protein SMC 997 1911 gene locus_tag LOCUS_43380 997 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 5087 1929 gene locus_tag LOCUS_43390 gene mdtC 5087 1929 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815800.1 protein_id gnl|my_center|LOCUS_43390 8254 5084 gene locus_tag LOCUS_43400 gene muxB 8254 5084 CDS product multidrug efflux RND transporter permease subunit MuxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089920.1 protein_id gnl|my_center|LOCUS_43400 9566 8580 gene locus_tag LOCUS_43410 9566 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 >Feature sequence232 132 899 gene locus_tag LOCUS_43420 132 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 1181 2518 gene locus_tag LOCUS_43430 1181 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 2525 5596 gene locus_tag LOCUS_43440 2525 5596 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144156.1 protein_id gnl|my_center|LOCUS_43440 5806 7263 gene locus_tag LOCUS_43450 5806 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 >Feature sequence233 184 1038 gene locus_tag LOCUS_43460 184 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 1725 1375 gene locus_tag LOCUS_43470 1725 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 2631 1855 gene locus_tag LOCUS_43480 2631 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 4040 5623 gene locus_tag LOCUS_43490 4040 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 5634 5562 gene locus_tag LOCUS_t00360 5634 5562 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5888 5655 gene locus_tag LOCUS_43500 5888 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 6071 7186 gene locus_tag LOCUS_43510 6071 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 7381 8901 gene locus_tag LOCUS_43520 7381 8901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 >Feature sequence234 293 1846 gene locus_tag LOCUS_43530 gene miaB 293 1846 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122282.1 protein_id gnl|my_center|LOCUS_43530 4194 1933 gene locus_tag LOCUS_43540 4194 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 6807 4987 gene locus_tag LOCUS_43550 6807 4987 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_43550 8075 7212 gene locus_tag LOCUS_43560 8075 7212 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877512.1 protein_id gnl|my_center|LOCUS_43560 >Feature sequence235 1230 208 gene locus_tag LOCUS_43570 1230 208 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921814.1 protein_id gnl|my_center|LOCUS_43570 3286 1373 gene locus_tag LOCUS_43580 3286 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 6151 3581 gene locus_tag LOCUS_43590 6151 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 6408 7310 gene locus_tag LOCUS_43600 6408 7310 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008670430.1 protein_id gnl|my_center|LOCUS_43600 8739 7363 gene locus_tag LOCUS_43610 8739 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 >Feature sequence236 164 466 gene locus_tag LOCUS_43620 164 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 1084 1284 gene locus_tag LOCUS_43630 1084 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 1737 1387 gene locus_tag LOCUS_43640 1737 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 1972 2535 gene locus_tag LOCUS_43650 1972 2535 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120329.1 protein_id gnl|my_center|LOCUS_43650 2532 3623 gene locus_tag LOCUS_43660 2532 3623 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046594.1 protein_id gnl|my_center|LOCUS_43660 4235 5680 gene locus_tag LOCUS_43670 4235 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 6565 5753 gene locus_tag LOCUS_43680 6565 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 7975 7013 gene locus_tag LOCUS_43690 7975 7013 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530745.1 protein_id gnl|my_center|LOCUS_43690 9031 8123 gene locus_tag LOCUS_43700 9031 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 >Feature sequence237 144 1451 gene locus_tag LOCUS_43710 144 1451 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_43710 1875 2141 gene locus_tag LOCUS_43720 1875 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 2296 3453 gene locus_tag LOCUS_43730 2296 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 4672 3890 gene locus_tag LOCUS_43740 4672 3890 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122046.1 protein_id gnl|my_center|LOCUS_43740 5071 6534 gene locus_tag LOCUS_43750 5071 6534 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922487.1 protein_id gnl|my_center|LOCUS_43750 6722 6949 gene locus_tag LOCUS_43760 6722 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 7852 7100 gene locus_tag LOCUS_43770 7852 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 8459 9280 gene locus_tag LOCUS_43780 8459 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 >Feature sequence238 2581 1640 gene locus_tag LOCUS_43790 2581 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 2778 3053 gene locus_tag LOCUS_43800 2778 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 3498 3289 gene locus_tag LOCUS_43810 3498 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43810 4196 3495 gene locus_tag LOCUS_43820 4196 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925587.1 protein_id gnl|my_center|LOCUS_43820 4745 4254 gene locus_tag LOCUS_43830 4745 4254 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087757.1 protein_id gnl|my_center|LOCUS_43830 6050 6532 gene locus_tag LOCUS_43840 6050 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 6601 7053 gene locus_tag LOCUS_43850 6601 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 7161 7637 gene locus_tag LOCUS_43860 7161 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 7725 8201 gene locus_tag LOCUS_43870 7725 8201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 <9342 8523 gene locus_tag LOCUS_43880 <9342 8523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144360.1:geranylgeranyl reductase >Feature sequence239 3482 486 gene locus_tag LOCUS_43890 3482 486 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119333.1 protein_id gnl|my_center|LOCUS_43890 5148 3946 gene locus_tag LOCUS_43900 5148 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 7145 5418 gene locus_tag LOCUS_43910 7145 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 7502 8455 gene locus_tag LOCUS_43920 7502 8455 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061017.1 protein_id gnl|my_center|LOCUS_43920 8470 8667 gene locus_tag LOCUS_43930 8470 8667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 8839 9285 gene locus_tag LOCUS_43940 8839 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 >Feature sequence240 209 940 gene locus_tag LOCUS_43950 209 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 994 1347 gene locus_tag LOCUS_43960 994 1347 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963264.1 protein_id gnl|my_center|LOCUS_43960 1389 1865 gene locus_tag LOCUS_43970 1389 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 1866 4835 gene locus_tag LOCUS_43980 1866 4835 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_43980 6650 5127 gene locus_tag LOCUS_43990 6650 5127 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941608.1 protein_id gnl|my_center|LOCUS_43990 7070 7708 gene locus_tag LOCUS_44000 7070 7708 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583365.1 protein_id gnl|my_center|LOCUS_44000 7784 8401 gene locus_tag LOCUS_44010 7784 8401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 >Feature sequence241 377 165 gene locus_tag LOCUS_44020 377 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 2317 2580 gene locus_tag LOCUS_44030 2317 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 2837 3826 gene locus_tag LOCUS_44040 2837 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 3829 4089 gene locus_tag LOCUS_44050 3829 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 4082 4348 gene locus_tag LOCUS_44060 4082 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 4457 7207 gene locus_tag LOCUS_44070 4457 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 7204 8541 gene locus_tag LOCUS_44080 7204 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 8555 8800 gene locus_tag LOCUS_44090 8555 8800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 >Feature sequence242 2711 201 gene locus_tag LOCUS_44100 2711 201 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247075.1 protein_id gnl|my_center|LOCUS_44100 3169 2861 gene locus_tag LOCUS_44110 3169 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 4390 3278 gene locus_tag LOCUS_44120 gene dnaN 4390 3278 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427747.1 protein_id gnl|my_center|LOCUS_44120 5694 6080 gene locus_tag LOCUS_44130 5694 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 7811 6225 gene locus_tag LOCUS_44140 7811 6225 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665541.1 protein_id gnl|my_center|LOCUS_44140 8909 7860 gene locus_tag LOCUS_44150 8909 7860 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615605.1 protein_id gnl|my_center|LOCUS_44150 >Feature sequence243 3266 1791 gene locus_tag LOCUS_44160 gene gatA 3266 1791 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_44160 3862 4131 gene locus_tag LOCUS_44170 3862 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 4335 4631 gene locus_tag LOCUS_44180 gene gatC 4335 4631 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404034.1 protein_id gnl|my_center|LOCUS_44180 6611 4740 gene locus_tag LOCUS_44190 6611 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 6994 7806 gene locus_tag LOCUS_44200 6994 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922519.1 protein_id gnl|my_center|LOCUS_44200 >Feature sequence244 890 4213 gene locus_tag LOCUS_44210 890 4213 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142749.1 protein_id gnl|my_center|LOCUS_44210 6018 4510 gene locus_tag LOCUS_44220 6018 4510 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584110.1 protein_id gnl|my_center|LOCUS_44220 6642 7763 gene locus_tag LOCUS_44230 6642 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 8817 7774 gene locus_tag LOCUS_44240 gene arsS 8817 7774 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257184.1 protein_id gnl|my_center|LOCUS_44240 >Feature sequence245 2592 82 gene locus_tag LOCUS_44250 2592 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 4076 2691 gene locus_tag LOCUS_44260 4076 2691 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_44260 4455 4147 gene locus_tag LOCUS_44270 4455 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 4665 5009 gene locus_tag LOCUS_44280 4665 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 5039 5863 gene locus_tag LOCUS_44290 5039 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 5931 7355 gene locus_tag LOCUS_44300 5931 7355 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_44300 7632 8372 gene locus_tag LOCUS_44310 7632 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 >Feature sequence246 105 1298 gene locus_tag LOCUS_44320 105 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 1334 1834 gene locus_tag LOCUS_44330 1334 1834 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921433.1 protein_id gnl|my_center|LOCUS_44330 1831 2643 gene locus_tag LOCUS_44340 1831 2643 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817305.1 protein_id gnl|my_center|LOCUS_44340 2832 3140 gene locus_tag LOCUS_44350 2832 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 3170 3664 gene locus_tag LOCUS_44360 3170 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 3716 4162 gene locus_tag LOCUS_44370 3716 4162 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 protein_id gnl|my_center|LOCUS_44370 4977 4168 gene locus_tag LOCUS_44380 4977 4168 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258578.1 protein_id gnl|my_center|LOCUS_44380 6444 5005 gene locus_tag LOCUS_44390 gene sthA 6444 5005 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325276.1 protein_id gnl|my_center|LOCUS_44390 8204 6645 gene locus_tag LOCUS_44400 8204 6645 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120586.1 protein_id gnl|my_center|LOCUS_44400 >Feature sequence247 326 517 gene locus_tag LOCUS_44410 326 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 659 838 gene locus_tag LOCUS_44420 659 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 894 1169 gene locus_tag LOCUS_44430 894 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 1703 2908 gene locus_tag LOCUS_44440 1703 2908 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707887.1 protein_id gnl|my_center|LOCUS_44440 2905 3063 gene locus_tag LOCUS_44450 2905 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 4586 3216 gene locus_tag LOCUS_44460 gene hisD 4586 3216 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118440.1 protein_id gnl|my_center|LOCUS_44460 4737 4892 gene locus_tag LOCUS_44470 4737 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 4951 6057 gene locus_tag LOCUS_44480 gene ltaE 4951 6057 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877119.1 protein_id gnl|my_center|LOCUS_44480 6563 6859 gene locus_tag LOCUS_44490 6563 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 6911 7408 gene locus_tag LOCUS_44500 6911 7408 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334911.1 protein_id gnl|my_center|LOCUS_44500 7849 8049 gene locus_tag LOCUS_44510 7849 8049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 8283 7948 gene locus_tag LOCUS_44520 8283 7948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 >Feature sequence248 428 1273 gene locus_tag LOCUS_44530 428 1273 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922445.1 protein_id gnl|my_center|LOCUS_44530 1350 2003 gene locus_tag LOCUS_44540 1350 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 2707 2429 gene locus_tag LOCUS_44550 2707 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 3261 3608 gene locus_tag LOCUS_44560 3261 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 4276 6093 gene locus_tag LOCUS_44570 4276 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 6463 7611 gene locus_tag LOCUS_44580 6463 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 8337 7789 gene locus_tag LOCUS_44590 8337 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 >Feature sequence249 1545 517 gene locus_tag LOCUS_44600 1545 517 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922070.1 protein_id gnl|my_center|LOCUS_44600 2132 2503 gene locus_tag LOCUS_44610 2132 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 2919 4286 gene locus_tag LOCUS_44620 2919 4286 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_44620 5675 4503 gene locus_tag LOCUS_44630 5675 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 4517 4603 gene locus_tag LOCUS_t00370 4517 4603 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6076 8022 gene locus_tag LOCUS_44640 6076 8022 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728405.1 protein_id gnl|my_center|LOCUS_44640 8216 7911 gene locus_tag LOCUS_44650 8216 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 >Feature sequence250 <1 1404 gene locus_tag LOCUS_44660 <1 1404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_145299176.1:c-type cytochrome 1766 2044 gene locus_tag LOCUS_44670 1766 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 2293 2601 gene locus_tag LOCUS_44680 2293 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 3150 2629 gene locus_tag LOCUS_44690 3150 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 3771 3439 gene locus_tag LOCUS_44700 3771 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 4068 3847 gene locus_tag LOCUS_44710 4068 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 4636 5778 gene locus_tag LOCUS_44720 4636 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 5867 6082 gene locus_tag LOCUS_44730 5867 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 6186 6674 gene locus_tag LOCUS_44740 6186 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 >Feature sequence251 1860 913 gene locus_tag LOCUS_44750 1860 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 2598 2143 gene locus_tag LOCUS_44760 2598 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 4957 3092 gene locus_tag LOCUS_44770 4957 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 5247 5453 gene locus_tag LOCUS_44780 gene rpsU 5247 5453 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338941.1 protein_id gnl|my_center|LOCUS_44780 5743 5816 gene locus_tag LOCUS_t00380 5743 5816 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6530 6727 gene locus_tag LOCUS_44790 6530 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 6714 7001 gene locus_tag LOCUS_44800 6714 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 6961 8082 gene locus_tag LOCUS_44810 6961 8082 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_44810 >Feature sequence252 43 1164 gene locus_tag LOCUS_44820 43 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 1789 5484 gene locus_tag LOCUS_44830 1789 5484 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615995.1 protein_id gnl|my_center|LOCUS_44830 6195 8609 gene locus_tag LOCUS_44840 6195 8609 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962866.1 protein_id gnl|my_center|LOCUS_44840 >Feature sequence253 547 359 gene locus_tag LOCUS_44850 547 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 1020 1247 gene locus_tag LOCUS_44860 1020 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 1429 1238 gene locus_tag LOCUS_44870 1429 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 1356 2279 gene locus_tag LOCUS_44880 1356 2279 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335559.1 protein_id gnl|my_center|LOCUS_44880 2361 3602 gene locus_tag LOCUS_44890 2361 3602 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922308.1 protein_id gnl|my_center|LOCUS_44890 3753 3841 gene locus_tag LOCUS_t00390 3753 3841 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5226 3952 gene locus_tag LOCUS_44900 5226 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 6757 5672 gene locus_tag LOCUS_44910 6757 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 8081 8272 gene locus_tag LOCUS_44920 8081 8272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 >Feature sequence254 2831 804 gene locus_tag LOCUS_44930 2831 804 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_44930 5191 3029 gene locus_tag LOCUS_44940 5191 3029 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268668.1 protein_id gnl|my_center|LOCUS_44940 5358 5570 gene locus_tag LOCUS_44950 5358 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 5655 6023 gene locus_tag LOCUS_44960 5655 6023 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331447.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44960 >Feature sequence255 53 715 gene locus_tag LOCUS_44970 53 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 831 2363 gene locus_tag LOCUS_44980 831 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 2437 3921 gene locus_tag LOCUS_44990 2437 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 4001 5362 gene locus_tag LOCUS_45000 4001 5362 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_45000 5455 5739 gene locus_tag LOCUS_45010 5455 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 5821 5979 gene locus_tag LOCUS_45020 5821 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 6043 6219 gene locus_tag LOCUS_45030 6043 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 7439 6384 gene locus_tag LOCUS_45040 7439 6384 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_45040 8001 7729 gene locus_tag LOCUS_45050 8001 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 >Feature sequence256 5919 6755 gene locus_tag LOCUS_45060 gene truA 5919 6755 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_45060 8275 6731 gene locus_tag LOCUS_45070 8275 6731 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615945.1 protein_id gnl|my_center|LOCUS_45070 >Feature sequence257 735 1964 gene locus_tag LOCUS_45080 735 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 2670 2170 gene locus_tag LOCUS_45090 2670 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 4036 2801 gene locus_tag LOCUS_45100 4036 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 5784 4300 gene locus_tag LOCUS_45110 5784 4300 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_45110 6520 8370 gene locus_tag LOCUS_45120 6520 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 >Feature sequence258 312 2006 gene locus_tag LOCUS_45130 312 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 2387 4864 gene locus_tag LOCUS_45140 2387 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 5728 4943 gene locus_tag LOCUS_45150 5728 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922325.1 protein_id gnl|my_center|LOCUS_45150 6556 5783 gene locus_tag LOCUS_45160 6556 5783 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118949.1 protein_id gnl|my_center|LOCUS_45160 7045 6626 gene locus_tag LOCUS_45170 7045 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 <8374 7115 gene locus_tag LOCUS_45180 <8374 7115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932458.1:NADH-quinone oxidoreductase subunit N >Feature sequence259 85 2748 gene locus_tag LOCUS_45190 85 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 3151 2897 gene locus_tag LOCUS_45200 3151 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 3197 3400 gene locus_tag LOCUS_45210 3197 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 3535 5232 gene locus_tag LOCUS_45220 3535 5232 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081614227.1 protein_id gnl|my_center|LOCUS_45220 6740 5502 gene locus_tag LOCUS_45230 6740 5502 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_45230 8077 6791 gene locus_tag LOCUS_45240 8077 6791 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_45240 >Feature sequence260 1182 358 gene locus_tag LOCUS_45250 1182 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 2671 1334 gene locus_tag LOCUS_45260 2671 1334 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_45260 5138 2721 gene locus_tag LOCUS_45270 5138 2721 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816832.1 protein_id gnl|my_center|LOCUS_45270 5581 5327 gene locus_tag LOCUS_45280 5581 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45280 6184 5954 gene locus_tag LOCUS_45290 6184 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45290 6468 6223 gene locus_tag LOCUS_45300 6468 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922214.1 protein_id gnl|my_center|LOCUS_45300 7432 6641 gene locus_tag LOCUS_45310 7432 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 >Feature sequence261 2477 411 gene locus_tag LOCUS_45320 2477 411 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328238.1 protein_id gnl|my_center|LOCUS_45320 4593 2488 gene locus_tag LOCUS_45330 4593 2488 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922336.1 protein_id gnl|my_center|LOCUS_45330 6895 4670 gene locus_tag LOCUS_45340 6895 4670 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_45340 <7842 7000 gene locus_tag LOCUS_45350 <7842 7000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922225.1:HlyD family efflux transporter periplasmic adaptor subunit >Feature sequence262 2654 2490 gene locus_tag LOCUS_45360 2654 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 2660 3754 gene locus_tag LOCUS_45370 2660 3754 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962256.1 protein_id gnl|my_center|LOCUS_45370 4004 4606 gene locus_tag LOCUS_45380 4004 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 4700 5008 gene locus_tag LOCUS_45390 4700 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 5311 6648 gene locus_tag LOCUS_45400 5311 6648 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_45400 >Feature sequence263 1513 293 gene locus_tag LOCUS_45410 gene glgC 1513 293 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_45410 3210 1726 gene locus_tag LOCUS_45420 3210 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_45420 3807 4346 gene locus_tag LOCUS_45430 3807 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 4464 5210 gene locus_tag LOCUS_45440 gene rlmB 4464 5210 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287441.1 protein_id gnl|my_center|LOCUS_45440 5311 6066 gene locus_tag LOCUS_45450 gene rlmB 5311 6066 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095638.1 protein_id gnl|my_center|LOCUS_45450 6475 7569 gene locus_tag LOCUS_45460 6475 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 >Feature sequence264 819 391 gene locus_tag LOCUS_45470 819 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 901 2109 gene locus_tag LOCUS_45480 901 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 3383 2217 gene locus_tag LOCUS_45490 3383 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 3985 6006 gene locus_tag LOCUS_45500 3985 6006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122606.1 protein_id gnl|my_center|LOCUS_45500 6123 7568 gene locus_tag LOCUS_45510 6123 7568 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921859.1 protein_id gnl|my_center|LOCUS_45510 >Feature sequence265 1049 3436 gene locus_tag LOCUS_45520 1049 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 3706 4392 gene locus_tag LOCUS_45530 3706 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 4618 5142 gene locus_tag LOCUS_45540 4618 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 5126 5386 gene locus_tag LOCUS_45550 5126 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 5383 7587 gene locus_tag LOCUS_45560 5383 7587 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_45560 >Feature sequence266 369 713 gene locus_tag LOCUS_45570 369 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45570 1854 2123 gene locus_tag LOCUS_45580 1854 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 2363 3487 gene locus_tag LOCUS_45590 2363 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 4319 3705 gene locus_tag LOCUS_45600 4319 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 5410 4673 gene locus_tag LOCUS_45610 5410 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 7485 5995 gene locus_tag LOCUS_45620 gene glpK 7485 5995 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_45620 >Feature sequence267 1196 2596 gene locus_tag LOCUS_45630 1196 2596 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_45630 2593 5181 gene locus_tag LOCUS_45640 2593 5181 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_45640 5358 6521 gene locus_tag LOCUS_45650 5358 6521 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_45650 6687 7085 gene locus_tag LOCUS_45660 6687 7085 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035303.1 protein_id gnl|my_center|LOCUS_45660 >Feature sequence268 349 98 gene locus_tag LOCUS_45670 349 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 862 1857 gene locus_tag LOCUS_45680 862 1857 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_45680 2092 2733 gene locus_tag LOCUS_45690 2092 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 2804 4471 gene locus_tag LOCUS_45700 2804 4471 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_45700 5740 4697 gene locus_tag LOCUS_45710 5740 4697 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 protein_id gnl|my_center|LOCUS_45710 6408 6136 gene locus_tag LOCUS_45720 6408 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 6678 7049 gene locus_tag LOCUS_45730 6678 7049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 >Feature sequence269 1364 21 gene locus_tag LOCUS_45740 1364 21 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_45740 3322 1535 gene locus_tag LOCUS_45750 3322 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 3657 5321 gene locus_tag LOCUS_45760 3657 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 6272 5496 gene locus_tag LOCUS_45770 6272 5496 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903268.1 protein_id gnl|my_center|LOCUS_45770 6547 7506 gene locus_tag LOCUS_45780 6547 7506 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211128.1 protein_id gnl|my_center|LOCUS_45780 >Feature sequence270 88 1506 gene locus_tag LOCUS_45790 88 1506 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247553.1 protein_id gnl|my_center|LOCUS_45790 1496 3301 gene locus_tag LOCUS_45800 1496 3301 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123969.1 protein_id gnl|my_center|LOCUS_45800 3688 3353 gene locus_tag LOCUS_45810 3688 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 5092 3914 gene locus_tag LOCUS_45820 5092 3914 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922187.1 protein_id gnl|my_center|LOCUS_45820 5847 5089 gene locus_tag LOCUS_45830 5847 5089 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_45830 5868 6170 gene locus_tag LOCUS_45840 5868 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 6170 7261 gene locus_tag LOCUS_45850 6170 7261 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122037.1 protein_id gnl|my_center|LOCUS_45850 >Feature sequence271 3093 4751 gene locus_tag LOCUS_45860 3093 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 5238 4816 gene locus_tag LOCUS_45870 5238 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 5267 5509 gene locus_tag LOCUS_45880 5267 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 7142 5577 gene locus_tag LOCUS_45890 7142 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324153.1 protein_id gnl|my_center|LOCUS_45890 >Feature sequence272 30 668 gene locus_tag LOCUS_45900 gene pdxH 30 668 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522643.1 protein_id gnl|my_center|LOCUS_45900 1055 792 gene locus_tag LOCUS_45910 1055 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 1524 2438 gene locus_tag LOCUS_45920 1524 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 2481 3698 gene locus_tag LOCUS_45930 gene fabF 2481 3698 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419106.1 protein_id gnl|my_center|LOCUS_45930 4537 3815 gene locus_tag LOCUS_45940 gene deoC 4537 3815 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228457.1 protein_id gnl|my_center|LOCUS_45940 5594 4677 gene locus_tag LOCUS_45950 5594 4677 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_45950 6483 5689 gene locus_tag LOCUS_45960 6483 5689 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403421.1 protein_id gnl|my_center|LOCUS_45960 7414 6509 gene locus_tag LOCUS_45970 7414 6509 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753571.1 protein_id gnl|my_center|LOCUS_45970 >Feature sequence273 529 272 gene locus_tag LOCUS_45980 529 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 1614 616 gene locus_tag LOCUS_45990 1614 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 4099 2333 gene locus_tag LOCUS_46000 4099 2333 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123879.1 protein_id gnl|my_center|LOCUS_46000 4552 5625 gene locus_tag LOCUS_46010 4552 5625 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_46010 5698 7170 gene locus_tag LOCUS_46020 gene gnd 5698 7170 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119037.1 protein_id gnl|my_center|LOCUS_46020 >Feature sequence274 <1 1989 gene locus_tag LOCUS_46030 <1 1989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118806.1:arylsulfatase 3386 2064 gene locus_tag LOCUS_46040 3386 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 4821 3424 gene locus_tag LOCUS_46050 4821 3424 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922245.1 protein_id gnl|my_center|LOCUS_46050 >Feature sequence275 335 844 gene locus_tag LOCUS_46060 335 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 965 1480 gene locus_tag LOCUS_46070 965 1480 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924863.1 protein_id gnl|my_center|LOCUS_46070 2880 1501 gene locus_tag LOCUS_46080 2880 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_46080 4638 3001 gene locus_tag LOCUS_46090 4638 3001 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123091.1 protein_id gnl|my_center|LOCUS_46090 <7237 4911 gene locus_tag LOCUS_46100 <7237 4911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_145299176.1:c-type cytochrome >Feature sequence276 281 75 gene locus_tag LOCUS_46110 281 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 502 1167 gene locus_tag LOCUS_46120 502 1167 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120140.1 protein_id gnl|my_center|LOCUS_46120 1445 2803 gene locus_tag LOCUS_46130 1445 2803 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327631.1 protein_id gnl|my_center|LOCUS_46130 2925 4337 gene locus_tag LOCUS_46140 gene rsmB 2925 4337 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_46140 4594 4992 gene locus_tag LOCUS_46150 4594 4992 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119951.1 protein_id gnl|my_center|LOCUS_46150 6256 5312 gene locus_tag LOCUS_46160 gene fhcD 6256 5312 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020069.1 protein_id gnl|my_center|LOCUS_46160 7130 6525 gene locus_tag LOCUS_46170 7130 6525 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922815.1 protein_id gnl|my_center|LOCUS_46170 >Feature sequence277 275 988 gene locus_tag LOCUS_46180 275 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46180 1183 2448 gene locus_tag LOCUS_46190 1183 2448 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_46190 4049 2712 gene locus_tag LOCUS_46200 4049 2712 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_46200 5302 4181 gene locus_tag LOCUS_46210 5302 4181 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 protein_id gnl|my_center|LOCUS_46210 5301 6413 gene locus_tag LOCUS_46220 5301 6413 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775309.1 protein_id gnl|my_center|LOCUS_46220 7020 6421 gene locus_tag LOCUS_46230 7020 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 >Feature sequence278 388 2124 gene locus_tag LOCUS_46240 388 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 2281 3237 gene locus_tag LOCUS_46250 gene fliG 2281 3237 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326344.1 protein_id gnl|my_center|LOCUS_46250 3384 4076 gene locus_tag LOCUS_46260 3384 4076 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392294.1 protein_id gnl|my_center|LOCUS_46260 4249 5526 gene locus_tag LOCUS_46270 gene fliI 4249 5526 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460756.1 protein_id gnl|my_center|LOCUS_46270 5538 5975 gene locus_tag LOCUS_46280 5538 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 6891 6550 gene locus_tag LOCUS_46290 6891 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 >Feature sequence279 784 50 gene locus_tag LOCUS_46300 784 50 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329136.1 protein_id gnl|my_center|LOCUS_46300 3661 1040 gene locus_tag LOCUS_46310 3661 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 4142 6826 gene locus_tag LOCUS_46320 gene topA 4142 6826 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057718.1 protein_id gnl|my_center|LOCUS_46320 >Feature sequence280 2618 255 gene locus_tag LOCUS_46330 2618 255 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844465.1 protein_id gnl|my_center|LOCUS_46330 5114 2709 gene locus_tag LOCUS_46340 5114 2709 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844465.1 protein_id gnl|my_center|LOCUS_46340 6978 5197 gene locus_tag LOCUS_46350 6978 5197 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454162.1 protein_id gnl|my_center|LOCUS_46350 >Feature sequence281 440 997 gene locus_tag LOCUS_46360 440 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 2545 1364 gene locus_tag LOCUS_46370 2545 1364 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_46370 3120 2626 gene locus_tag LOCUS_46380 3120 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 4218 3295 gene locus_tag LOCUS_46390 4218 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 4757 6070 gene locus_tag LOCUS_46400 4757 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 6199 6747 gene locus_tag LOCUS_46410 6199 6747 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_46410 >Feature sequence282 175 1575 gene locus_tag LOCUS_46420 175 1575 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_46420 4583 1950 gene locus_tag LOCUS_46430 4583 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 6380 4908 gene locus_tag LOCUS_46440 6380 4908 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_46440 >Feature sequence283 53 715 gene locus_tag LOCUS_46450 53 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 831 1115 gene locus_tag LOCUS_46460 831 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 1177 1458 gene locus_tag LOCUS_46470 1177 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 1430 1723 gene locus_tag LOCUS_46480 1430 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 1716 3020 gene locus_tag LOCUS_46490 gene vexA 1716 3020 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759349.1 protein_id gnl|my_center|LOCUS_46490 3068 6205 gene locus_tag LOCUS_46500 3068 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 >Feature sequence284 76 149 gene locus_tag LOCUS_t00400 76 149 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 576 109 gene locus_tag LOCUS_46510 576 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 1164 595 gene locus_tag LOCUS_46520 1164 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 1483 1166 gene locus_tag LOCUS_46530 1483 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 1605 1937 gene locus_tag LOCUS_46540 1605 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46540 1850 2242 gene locus_tag LOCUS_46550 1850 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46550 2441 3445 gene locus_tag LOCUS_46560 2441 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 3574 3867 gene locus_tag LOCUS_46570 3574 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 3987 5330 gene locus_tag LOCUS_46580 3987 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 5693 5412 gene locus_tag LOCUS_46590 5693 5412 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329447.1 protein_id gnl|my_center|LOCUS_46590 6060 5776 gene locus_tag LOCUS_46600 6060 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 6366 6530 gene locus_tag LOCUS_46610 6366 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_46610 >Feature sequence285 642 187 gene locus_tag LOCUS_46620 642 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 1062 1679 gene locus_tag LOCUS_46630 1062 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 1992 2411 gene locus_tag LOCUS_46640 1992 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122820.1 protein_id gnl|my_center|LOCUS_46640 2561 3826 gene locus_tag LOCUS_46650 2561 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 4069 4491 gene locus_tag LOCUS_46660 4069 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 4963 4418 gene locus_tag LOCUS_46670 4963 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 6503 5424 gene locus_tag LOCUS_46680 6503 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 >Feature sequence286 393 70 gene locus_tag LOCUS_46690 393 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330016.1 protein_id gnl|my_center|LOCUS_46690 917 2425 gene locus_tag LOCUS_46700 gene glgA 917 2425 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121026.1 protein_id gnl|my_center|LOCUS_46700 5163 2683 gene locus_tag LOCUS_46710 5163 2683 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120349.1 protein_id gnl|my_center|LOCUS_46710 >Feature sequence287 716 1867 gene locus_tag LOCUS_46720 716 1867 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861636.1 protein_id gnl|my_center|LOCUS_46720 2555 1986 gene locus_tag LOCUS_46730 gene rimI 2555 1986 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017535.1 protein_id gnl|my_center|LOCUS_46730 3701 2742 gene locus_tag LOCUS_46740 3701 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008670193.1 protein_id gnl|my_center|LOCUS_46740 4844 4032 gene locus_tag LOCUS_46750 4844 4032 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816586.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46750 5214 4849 gene locus_tag LOCUS_46760 5214 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 <6661 5138 gene locus_tag LOCUS_46770 <6661 5138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_109982246.1:response regulator note possible pseudo, frameshifted >Feature sequence288 <1 1358 gene locus_tag LOCUS_46780 <1 1358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065729.1:DUF3320 domain-containing protein 1368 1553 gene locus_tag LOCUS_46790 1368 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 2268 1516 gene locus_tag LOCUS_46800 2268 1516 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122308.1 protein_id gnl|my_center|LOCUS_46800 3313 2360 gene locus_tag LOCUS_46810 3313 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 4102 3560 gene locus_tag LOCUS_46820 4102 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 5628 4327 gene locus_tag LOCUS_46830 5628 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 6278 5709 gene locus_tag LOCUS_46840 6278 5709 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332895.1 protein_id gnl|my_center|LOCUS_46840 6545 6315 gene locus_tag LOCUS_46850 6545 6315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 >Feature sequence289 399 2573 gene locus_tag LOCUS_46860 399 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 2570 3607 gene locus_tag LOCUS_46870 2570 3607 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122136.1 protein_id gnl|my_center|LOCUS_46870 3714 4154 gene locus_tag LOCUS_46880 3714 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 4238 6556 gene locus_tag LOCUS_46890 gene priA 4238 6556 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922147.1 protein_id gnl|my_center|LOCUS_46890 5570 5477 gene locus_tag LOCUS_t00410 5570 5477 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence290 2202 1348 gene locus_tag LOCUS_46900 2202 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 2760 6326 gene locus_tag LOCUS_46910 2760 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 >Feature sequence291 1135 317 gene locus_tag LOCUS_46920 1135 317 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333044.1 protein_id gnl|my_center|LOCUS_46920 1562 1173 gene locus_tag LOCUS_46930 1562 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 2504 1704 gene locus_tag LOCUS_46940 gene dapB 2504 1704 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123511.1 protein_id gnl|my_center|LOCUS_46940 6378 2698 gene locus_tag LOCUS_46950 6378 2698 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615508.1 protein_id gnl|my_center|LOCUS_46950 >Feature sequence292 461 1657 gene locus_tag LOCUS_46960 461 1657 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616105.1 protein_id gnl|my_center|LOCUS_46960 2272 1781 gene locus_tag LOCUS_46970 2272 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 4055 2460 gene locus_tag LOCUS_46980 gene gltX 4055 2460 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922083.1 protein_id gnl|my_center|LOCUS_46980 4373 5356 gene locus_tag LOCUS_46990 4373 5356 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975555.1 protein_id gnl|my_center|LOCUS_46990 5564 6421 gene locus_tag LOCUS_47000 5564 6421 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325558.1 protein_id gnl|my_center|LOCUS_47000 >Feature sequence293 1849 344 gene locus_tag LOCUS_47010 1849 344 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176627.1 protein_id gnl|my_center|LOCUS_47010 2746 2039 gene locus_tag LOCUS_47020 2746 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 2963 5530 gene locus_tag LOCUS_47030 2963 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 5908 6297 gene locus_tag LOCUS_47040 5908 6297 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173310.1 protein_id gnl|my_center|LOCUS_47040 >Feature sequence294 1211 1861 gene locus_tag LOCUS_47050 gene lexA 1211 1861 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_47050 1870 2592 gene locus_tag LOCUS_47060 1870 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 2519 4051 gene locus_tag LOCUS_47070 2519 4051 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528777.1 protein_id gnl|my_center|LOCUS_47070 >Feature sequence295 5994 445 gene locus_tag LOCUS_47080 5994 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 >Feature sequence296 1584 685 gene locus_tag LOCUS_47090 1584 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 3235 1616 gene locus_tag LOCUS_47100 3235 1616 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937938.1 protein_id gnl|my_center|LOCUS_47100 4356 3232 gene locus_tag LOCUS_47110 gene lptG 4356 3232 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391153.1 protein_id gnl|my_center|LOCUS_47110 4910 6181 gene locus_tag LOCUS_47120 4910 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327711.1 protein_id gnl|my_center|LOCUS_47120 >Feature sequence297 223 65 gene locus_tag LOCUS_47130 223 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 688 2316 gene locus_tag LOCUS_47140 688 2316 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921665.1 protein_id gnl|my_center|LOCUS_47140 2434 3777 gene locus_tag LOCUS_47150 2434 3777 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118607.1 protein_id gnl|my_center|LOCUS_47150 3897 5000 gene locus_tag LOCUS_47160 3897 5000 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161951924.1 protein_id gnl|my_center|LOCUS_47160 5186 6067 gene locus_tag LOCUS_47170 5186 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118058.1 protein_id gnl|my_center|LOCUS_47170 >Feature sequence298 308 2779 gene locus_tag LOCUS_47180 308 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 2776 3258 gene locus_tag LOCUS_47190 2776 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 3255 5954 gene locus_tag LOCUS_47200 3255 5954 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_47200 6048 6209 gene locus_tag LOCUS_47210 6048 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 >Feature sequence299 1178 927 gene locus_tag LOCUS_47220 1178 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 2375 1272 gene locus_tag LOCUS_47230 2375 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 4349 2427 gene locus_tag LOCUS_47240 4349 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 5627 4611 gene locus_tag LOCUS_47250 5627 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 >Feature sequence300 212 1153 gene locus_tag LOCUS_47260 gene ispH 212 1153 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922221.1 protein_id gnl|my_center|LOCUS_47260 4348 1265 gene locus_tag LOCUS_47270 4348 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 4797 4576 gene locus_tag LOCUS_47280 4797 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 5022 4810 gene locus_tag LOCUS_47290 5022 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 5273 5079 gene locus_tag LOCUS_47300 5273 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 >Feature sequence301 624 1166 gene locus_tag LOCUS_47310 624 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 1413 1976 gene locus_tag LOCUS_47320 1413 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 2277 2056 gene locus_tag LOCUS_47330 2277 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 2845 2294 gene locus_tag LOCUS_47340 2845 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 3545 2847 gene locus_tag LOCUS_47350 3545 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 4272 3826 gene locus_tag LOCUS_47360 4272 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 >Feature sequence302 1184 261 gene locus_tag LOCUS_47370 1184 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 1417 3027 gene locus_tag LOCUS_47380 1417 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 >Feature sequence303 <1 1224 gene locus_tag LOCUS_47390 <1 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258507.1:valine--tRNA ligase 1268 1972 gene locus_tag LOCUS_47400 1268 1972 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221202124.1 protein_id gnl|my_center|LOCUS_47400 1986 2180 gene locus_tag LOCUS_47410 1986 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 2254 2655 gene locus_tag LOCUS_47420 2254 2655 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328635.1 protein_id gnl|my_center|LOCUS_47420 3191 2772 gene locus_tag LOCUS_47430 3191 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 3567 3716 gene locus_tag LOCUS_47440 3567 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 4186 3821 gene locus_tag LOCUS_47450 4186 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 5987 4932 gene locus_tag LOCUS_47460 5987 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 >Feature sequence304 133 267 gene locus_tag LOCUS_47470 133 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 457 759 gene locus_tag LOCUS_47480 457 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 1175 840 gene locus_tag LOCUS_47490 1175 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 1315 1572 gene locus_tag LOCUS_47500 1315 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47500 1747 1830 gene locus_tag LOCUS_t00420 1747 1830 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1940 3004 gene locus_tag LOCUS_47510 1940 3004 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922445.1 protein_id gnl|my_center|LOCUS_47510 3130 3705 gene locus_tag LOCUS_47520 3130 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 3830 4111 gene locus_tag LOCUS_47530 3830 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 4185 4406 gene locus_tag LOCUS_47540 4185 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 4403 6010 gene locus_tag LOCUS_47550 4403 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 >Feature sequence305 81 1559 gene locus_tag LOCUS_47560 81 1559 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671603.1 protein_id gnl|my_center|LOCUS_47560 3444 1804 gene locus_tag LOCUS_47570 3444 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 3942 3496 gene locus_tag LOCUS_47580 3942 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 4011 4247 gene locus_tag LOCUS_47590 4011 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 5234 4413 gene locus_tag LOCUS_47600 5234 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 5838 5287 gene locus_tag LOCUS_47610 5838 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 >Feature sequence306 81 869 gene locus_tag LOCUS_47620 81 869 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_47620 1038 2264 gene locus_tag LOCUS_47630 1038 2264 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103756.1 protein_id gnl|my_center|LOCUS_47630 2261 2896 gene locus_tag LOCUS_47640 2261 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 3204 2905 gene locus_tag LOCUS_47650 3204 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 3644 3405 gene locus_tag LOCUS_47660 3644 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 4591 3923 gene locus_tag LOCUS_47670 4591 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_47670 4725 5120 gene locus_tag LOCUS_47680 4725 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 5117 5818 gene locus_tag LOCUS_47690 5117 5818 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327343.1 protein_id gnl|my_center|LOCUS_47690 >Feature sequence307 1352 2590 gene locus_tag LOCUS_47700 1352 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 3906 2914 gene locus_tag LOCUS_47710 3906 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 5432 4053 gene locus_tag LOCUS_47720 5432 4053 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_47720 >Feature sequence308 423 1148 gene locus_tag LOCUS_47730 423 1148 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617027.1 protein_id gnl|my_center|LOCUS_47730 1656 3740 gene locus_tag LOCUS_47740 1656 3740 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335531.1 protein_id gnl|my_center|LOCUS_47740 >Feature sequence309 2 580 gene locus_tag LOCUS_47750 2 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 591 1271 gene locus_tag LOCUS_47760 591 1271 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 protein_id gnl|my_center|LOCUS_47760 2258 1413 gene locus_tag LOCUS_47770 gene dapF 2258 1413 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_47770 2569 3183 gene locus_tag LOCUS_47780 2569 3183 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807705.1 protein_id gnl|my_center|LOCUS_47780 4948 3245 gene locus_tag LOCUS_47790 gene panF 4948 3245 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647973.1 protein_id gnl|my_center|LOCUS_47790 >Feature sequence310 1675 305 gene locus_tag LOCUS_47800 1675 305 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_47800 2998 1688 gene locus_tag LOCUS_47810 2998 1688 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_47810 2936 3118 gene locus_tag LOCUS_47820 2936 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 3455 4264 gene locus_tag LOCUS_47830 3455 4264 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088380.1 protein_id gnl|my_center|LOCUS_47830 4959 4342 gene locus_tag LOCUS_47840 4959 4342 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812379.1 protein_id gnl|my_center|LOCUS_47840 <5764 4984 gene locus_tag LOCUS_47850 <5764 4984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922068.1:bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD >Feature sequence311 1691 1969 gene locus_tag LOCUS_47860 1691 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 2379 5249 gene locus_tag LOCUS_47870 2379 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 5246 5458 gene locus_tag LOCUS_47880 5246 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 5739 5344 gene locus_tag LOCUS_47890 5739 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 >Feature sequence312 251 2380 gene locus_tag LOCUS_47900 gene katG 251 2380 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021009.1 protein_id gnl|my_center|LOCUS_47900 2530 3879 gene locus_tag LOCUS_47910 2530 3879 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_47910 3938 4213 gene locus_tag LOCUS_47920 3938 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 4217 4615 gene locus_tag LOCUS_47930 4217 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 4671 5591 gene locus_tag LOCUS_47940 4671 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 >Feature sequence313 2574 1108 gene locus_tag LOCUS_47950 2574 1108 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194516.1 protein_id gnl|my_center|LOCUS_47950 4216 3293 gene locus_tag LOCUS_47960 4216 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 4344 4808 gene locus_tag LOCUS_47970 4344 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 4928 5377 gene locus_tag LOCUS_47980 4928 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47980 >Feature sequence314 1890 112 gene locus_tag LOCUS_47990 1890 112 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_47990 5376 1972 gene locus_tag LOCUS_48000 5376 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 >Feature sequence315 3 701 gene locus_tag LOCUS_48010 3 701 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_48010 1300 1590 gene locus_tag LOCUS_48020 1300 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 1620 1793 gene locus_tag LOCUS_48030 1620 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 2075 2962 gene locus_tag LOCUS_48040 gene argB 2075 2962 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335411.1 protein_id gnl|my_center|LOCUS_48040 3079 4299 gene locus_tag LOCUS_48050 3079 4299 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_48050 >Feature sequence316 2894 5410 gene locus_tag LOCUS_48060 2894 5410 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921574.1 protein_id gnl|my_center|LOCUS_48060 >Feature sequence317 <1 4138 gene locus_tag LOCUS_48070 <1 4138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026868.1:type I polyketide synthase >Feature sequence318 574 1848 gene locus_tag LOCUS_48080 574 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 2085 3746 gene locus_tag LOCUS_48090 2085 3746 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117783.1 protein_id gnl|my_center|LOCUS_48090 3951 4340 gene locus_tag LOCUS_48100 gene hisI 3951 4340 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937424.1 protein_id gnl|my_center|LOCUS_48100 4503 5381 gene locus_tag LOCUS_48110 gene hisG 4503 5381 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_48110 >Feature sequence319 <1 2398 gene locus_tag LOCUS_48120 <1 2398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118530.1:peptidase 2708 4417 gene locus_tag LOCUS_48130 2708 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 5261 4476 gene locus_tag LOCUS_48140 5261 4476 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258719.1 protein_id gnl|my_center|LOCUS_48140 >Feature sequence320 479 183 gene locus_tag LOCUS_48150 479 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 1843 605 gene locus_tag LOCUS_48160 1843 605 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339900.1 protein_id gnl|my_center|LOCUS_48160 3217 2129 gene locus_tag LOCUS_48170 3217 2129 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122599.1 protein_id gnl|my_center|LOCUS_48170 3582 4661 gene locus_tag LOCUS_48180 3582 4661 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061731.1 protein_id gnl|my_center|LOCUS_48180 4678 5193 gene locus_tag LOCUS_48190 4678 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 >Feature sequence321 683 279 gene locus_tag LOCUS_48200 683 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 1053 781 gene locus_tag LOCUS_48210 1053 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 2519 2884 gene locus_tag LOCUS_48220 2519 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 3113 3469 gene locus_tag LOCUS_48230 3113 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 3744 5222 gene locus_tag LOCUS_48240 3744 5222 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_48240 >Feature sequence322 670 50 gene locus_tag LOCUS_48250 670 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 3072 1501 gene locus_tag LOCUS_48260 gene zwf 3072 1501 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_48260 3431 3991 gene locus_tag LOCUS_48270 3431 3991 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528254.1 protein_id gnl|my_center|LOCUS_48270 >Feature sequence323 940 335 gene locus_tag LOCUS_48280 940 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 1438 1363 gene locus_tag LOCUS_t00430 1438 1363 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1806 3182 gene locus_tag LOCUS_48290 1806 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 3340 3903 gene locus_tag LOCUS_48300 3340 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 4248 4793 gene locus_tag LOCUS_48310 4248 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 >Feature sequence324 190 1617 gene locus_tag LOCUS_48320 190 1617 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799204.1 protein_id gnl|my_center|LOCUS_48320 >Feature sequence325 4356 310 gene locus_tag LOCUS_48330 4356 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 5160 4930 gene locus_tag LOCUS_48340 5160 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 >Feature sequence326 393 710 gene locus_tag LOCUS_48350 393 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 1430 729 gene locus_tag LOCUS_48360 1430 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 1617 3656 gene locus_tag LOCUS_48370 1617 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 4153 3740 gene locus_tag LOCUS_48380 4153 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48380 4752 4588 gene locus_tag LOCUS_48390 4752 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 4797 4976 gene locus_tag LOCUS_48400 4797 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 >Feature sequence327 40 303 gene locus_tag LOCUS_48410 40 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 1064 579 gene locus_tag LOCUS_48420 1064 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 1483 1163 gene locus_tag LOCUS_48430 1483 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 1880 1476 gene locus_tag LOCUS_48440 1880 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 3478 2420 gene locus_tag LOCUS_48450 3478 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 <5140 4497 gene locus_tag LOCUS_48460 <5140 4497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929392.1:IS3-like element ISGvi5 family transposase note possible pseudo, internal stop codon >Feature sequence328 1282 1581 gene locus_tag LOCUS_48470 1282 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 1891 3171 gene locus_tag LOCUS_48480 1891 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 3526 4836 gene locus_tag LOCUS_48490 3526 4836 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037198907.1 protein_id gnl|my_center|LOCUS_48490 >Feature sequence329 3716 1590 gene locus_tag LOCUS_48500 3716 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 5009 4023 gene locus_tag LOCUS_48510 5009 4023 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_48510 >Feature sequence330 109 2577 gene locus_tag LOCUS_48520 109 2577 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_48520 3278 3568 gene locus_tag LOCUS_48530 3278 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 3898 3608 gene locus_tag LOCUS_48540 3898 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 4552 4016 gene locus_tag LOCUS_48550 4552 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48550 4524 4993 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatggggccgtgcttcatcagcacggaagac >Feature sequence331 636 127 gene locus_tag LOCUS_48560 636 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 1117 3255 gene locus_tag LOCUS_48570 gene glgX 1117 3255 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258959.1 protein_id gnl|my_center|LOCUS_48570 3449 4834 gene locus_tag LOCUS_48580 3449 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 >Feature sequence332 479 886 gene locus_tag LOCUS_48590 479 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 1225 2907 gene locus_tag LOCUS_48600 1225 2907 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_48600 3154 4062 gene locus_tag LOCUS_48610 3154 4062 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121256.1 protein_id gnl|my_center|LOCUS_48610 4230 4826 gene locus_tag LOCUS_48620 4230 4826 CDS product phosphatidylethanolamine N-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509340.1 protein_id gnl|my_center|LOCUS_48620 >Feature sequence333 155 1426 gene locus_tag LOCUS_48630 155 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 2894 1629 gene locus_tag LOCUS_48640 2894 1629 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037764.1 protein_id gnl|my_center|LOCUS_48640 4161 3112 gene locus_tag LOCUS_48650 4161 3112 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_48650 >Feature sequence334 <4847 3346 gene locus_tag LOCUS_48660 <4847 3346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393786.1:lactate permease LctP family transporter >Feature sequence335 810 475 gene locus_tag LOCUS_48670 810 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 2126 1035 gene locus_tag LOCUS_48680 2126 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 3101 2175 gene locus_tag LOCUS_48690 3101 2175 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_48690 3560 3700 gene locus_tag LOCUS_48700 3560 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 >Feature sequence336 978 3017 gene locus_tag LOCUS_48710 978 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 3475 4647 gene locus_tag LOCUS_48720 3475 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 >Feature sequence337 1551 145 gene locus_tag LOCUS_48730 1551 145 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_48730 1895 1584 gene locus_tag LOCUS_48740 1895 1584 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207800.1 protein_id gnl|my_center|LOCUS_48740 3083 2031 gene locus_tag LOCUS_48750 3083 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 4574 3267 gene locus_tag LOCUS_48760 4574 3267 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_48760 >Feature sequence338 1153 1081 gene locus_tag LOCUS_t00440 1153 1081 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2043 1498 gene locus_tag LOCUS_48770 2043 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 3336 2173 gene locus_tag LOCUS_48780 3336 2173 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816110.1 protein_id gnl|my_center|LOCUS_48780 3917 4417 gene locus_tag LOCUS_48790 3917 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 >Feature sequence339 3657 1741 gene locus_tag LOCUS_48800 3657 1741 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_48800 <4615 3785 gene locus_tag LOCUS_48810 <4615 3785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119295.1:c-type cytochrome >Feature sequence340 >Feature sequence341 756 1091 gene locus_tag LOCUS_48820 756 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 2753 1341 gene locus_tag LOCUS_48830 2753 1341 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122540.1 protein_id gnl|my_center|LOCUS_48830 >Feature sequence342 <1 1812 gene locus_tag LOCUS_48840 <1 1812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120693.1:metallopeptidase 2310 1849 gene locus_tag LOCUS_48850 2310 1849 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349893.1 protein_id gnl|my_center|LOCUS_48850 2667 3254 gene locus_tag LOCUS_48860 2667 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 3395 4123 gene locus_tag LOCUS_48870 gene fabG 3395 4123 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324898.1 protein_id gnl|my_center|LOCUS_48870 >Feature sequence343 610 807 gene locus_tag LOCUS_48880 610 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_48880 859 1104 gene locus_tag LOCUS_48890 859 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_48890 1098 1442 gene locus_tag LOCUS_48900 1098 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_48900 1782 2753 gene locus_tag LOCUS_48910 1782 2753 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615392.1 protein_id gnl|my_center|LOCUS_48910 3338 2889 gene locus_tag LOCUS_48920 3338 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 >Feature sequence344 492 1967 gene locus_tag LOCUS_48930 492 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 4077 2128 gene locus_tag LOCUS_48940 4077 2128 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664668.1 protein_id gnl|my_center|LOCUS_48940 >Feature sequence345 <1 954 gene locus_tag LOCUS_48950 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256956.1:S9 family peptidase 3123 2128 gene locus_tag LOCUS_48960 3123 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215438250.1 protein_id gnl|my_center|LOCUS_48960 3525 4133 gene locus_tag LOCUS_48970 3525 4133 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123705.1 protein_id gnl|my_center|LOCUS_48970 >Feature sequence346 2196 934 gene locus_tag LOCUS_48980 2196 934 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123538.1 protein_id gnl|my_center|LOCUS_48980 <4334 3255 gene locus_tag LOCUS_48990 <4334 3255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615966.1:DUF1592 domain-containing protein >Feature sequence347 1822 104 gene locus_tag LOCUS_49000 gene polX 1822 104 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615613.1 protein_id gnl|my_center|LOCUS_49000 2334 2014 gene locus_tag LOCUS_49010 2334 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334037.1 protein_id gnl|my_center|LOCUS_49010 2767 4128 gene locus_tag LOCUS_49020 gene glmM 2767 4128 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922275.1 protein_id gnl|my_center|LOCUS_49020 >Feature sequence348 <4219 2944 gene locus_tag LOCUS_49030 <4219 2944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120991.1:DUF1552 domain-containing protein >Feature sequence349 <1 624 gene locus_tag LOCUS_49040 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122381.1:DUF1501 domain-containing protein 687 1601 gene locus_tag LOCUS_49050 687 1601 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121783.1 protein_id gnl|my_center|LOCUS_49050 3384 1666 gene locus_tag LOCUS_49060 3384 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 >Feature sequence350 338 1441 gene locus_tag LOCUS_49070 338 1441 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 protein_id gnl|my_center|LOCUS_49070 1601 3409 gene locus_tag LOCUS_49080 1601 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 >Feature sequence351 404 54 gene locus_tag LOCUS_tm00010 404 54 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 744 1973 gene locus_tag LOCUS_49090 744 1973 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_49090 2800 2057 gene locus_tag LOCUS_49100 2800 2057 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121464.1 protein_id gnl|my_center|LOCUS_49100 3340 3588 gene locus_tag LOCUS_49110 3340 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 3775 3861 gene locus_tag LOCUS_t00450 3775 3861 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence352 178 312 gene locus_tag LOCUS_49120 178 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 355 1329 gene locus_tag LOCUS_49130 355 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 1754 2830 gene locus_tag LOCUS_49140 1754 2830 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803903.1 protein_id gnl|my_center|LOCUS_49140 3072 3371 gene locus_tag LOCUS_49150 3072 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 >Feature sequence353 <1 1636 gene locus_tag LOCUS_49160 <1 1636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921330.1:PAS domain S-box protein 1997 1815 gene locus_tag LOCUS_49170 1997 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 2353 1994 gene locus_tag LOCUS_49180 2353 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 >Feature sequence354 1296 724 gene locus_tag LOCUS_49190 gene istB 1296 724 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49190 1454 1293 gene locus_tag LOCUS_49200 1454 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 3076 1451 gene locus_tag LOCUS_49210 gene istA 3076 1451 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974233.1 protein_id gnl|my_center|LOCUS_49210 >Feature sequence355 1027 821 gene locus_tag LOCUS_49220 1027 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 1745 1314 gene locus_tag LOCUS_49230 1745 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 2128 1745 gene locus_tag LOCUS_49240 2128 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 2568 3671 gene locus_tag LOCUS_49250 2568 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 >Feature sequence356 988 98 gene locus_tag LOCUS_49260 988 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 2096 1128 gene locus_tag LOCUS_49270 2096 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49270 2955 2113 gene locus_tag LOCUS_49280 2955 2113 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_49280 >Feature sequence357 285 88 gene locus_tag LOCUS_49290 285 88 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_49290 565 849 gene locus_tag LOCUS_49300 565 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 897 1097 gene locus_tag LOCUS_49310 897 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 1356 1111 gene locus_tag LOCUS_49320 1356 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 1667 1305 gene locus_tag LOCUS_49330 1667 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 3364 1784 gene locus_tag LOCUS_49340 3364 1784 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_49340 >Feature sequence358 1931 471 gene locus_tag LOCUS_49350 1931 471 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145033984.1 protein_id gnl|my_center|LOCUS_49350 <3614 1989 gene locus_tag LOCUS_49360 <3614 1989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120839.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence359 798 1103 gene locus_tag LOCUS_49370 798 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 1244 2299 gene locus_tag LOCUS_49380 1244 2299 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922457.1 protein_id gnl|my_center|LOCUS_49380 2866 2666 gene locus_tag LOCUS_49390 2866 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 2801 3208 gene locus_tag LOCUS_49400 2801 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 3227 3361 gene locus_tag LOCUS_49410 3227 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 >Feature sequence360 <1 1203 gene locus_tag LOCUS_49420 <1 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122381.1:DUF1501 domain-containing protein 1329 2648 gene locus_tag LOCUS_49430 1329 2648 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_49430 >Feature sequence361 402 2915 gene locus_tag LOCUS_49440 402 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 2912 3097 gene locus_tag LOCUS_49450 2912 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49450 >Feature sequence362 248 1087 gene locus_tag LOCUS_49460 248 1087 CDS product IS5-like element ISMac15 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065538.1 protein_id gnl|my_center|LOCUS_49460 1465 1130 gene locus_tag LOCUS_49470 1465 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 2201 2398 gene locus_tag LOCUS_49480 2201 2398 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_49480 2542 2937 gene locus_tag LOCUS_49490 2542 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 >Feature sequence363 822 151 gene locus_tag LOCUS_49500 822 151 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921755.1 protein_id gnl|my_center|LOCUS_49500 1189 2274 gene locus_tag LOCUS_49510 1189 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 >Feature sequence364 1 624 gene locus_tag LOCUS_49520 1 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 1184 780 gene locus_tag LOCUS_49530 1184 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 1621 1184 gene locus_tag LOCUS_49540 1621 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 >Feature sequence365 >Feature sequence366 <1 696 gene locus_tag LOCUS_49550 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121211.1:DUF1552 domain-containing protein 1280 1765 gene locus_tag LOCUS_49560 1280 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 1800 2162 gene locus_tag LOCUS_49570 1800 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 2291 2539 gene locus_tag LOCUS_49580 2291 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 2526 2846 gene locus_tag LOCUS_49590 2526 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 >Feature sequence367 419 2593 gene locus_tag LOCUS_49600 419 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 3043 2759 gene locus_tag LOCUS_49610 3043 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 >Feature sequence368 558 61 gene locus_tag LOCUS_49620 558 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 1634 693 gene locus_tag LOCUS_49630 1634 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 2774 1725 gene locus_tag LOCUS_49640 2774 1725 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_49640 >Feature sequence369 >Feature sequence370 212 1096 gene locus_tag LOCUS_49650 212 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 2148 2510 gene locus_tag LOCUS_49660 2148 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_49660 2520 2675 gene locus_tag LOCUS_49670 2520 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49670 2697 3059 gene locus_tag LOCUS_49680 2697 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_49680 >Feature sequence371 297 1466 gene locus_tag LOCUS_49690 297 1466 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_49690 1466 2446 gene locus_tag LOCUS_49700 1466 2446 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_49700 >Feature sequence372 2952 841 gene locus_tag LOCUS_49710 2952 841 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225490.1 protein_id gnl|my_center|LOCUS_49710 >Feature sequence373 1871 207 gene locus_tag LOCUS_49720 1871 207 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615587.1 protein_id gnl|my_center|LOCUS_49720 <3131 1959 gene locus_tag LOCUS_49730 <3131 1959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122711.1:proton-conducting transporter membrane subunit >Feature sequence374 939 439 gene locus_tag LOCUS_49740 939 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 2492 996 gene locus_tag LOCUS_49750 2492 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120360.1 protein_id gnl|my_center|LOCUS_49750 >Feature sequence375 548 1810 gene locus_tag LOCUS_49760 548 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 1846 2610 gene locus_tag LOCUS_49770 1846 2610 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 protein_id gnl|my_center|LOCUS_49770 >Feature sequence376 108 3008 gene locus_tag LOCUS_49780 108 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 >Feature sequence377 1775 312 gene locus_tag LOCUS_49790 1775 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 2122 1916 gene locus_tag LOCUS_49800 2122 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 2462 2223 gene locus_tag LOCUS_49810 2462 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810