>Feature sequence001 1304 339 gene locus_tag LOCUS_00010 1304 339 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810803.1 protein_id gnl|my_center|LOCUS_00010 2711 1389 gene locus_tag LOCUS_00020 2711 1389 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815911.1 protein_id gnl|my_center|LOCUS_00020 3709 2906 gene locus_tag LOCUS_00030 3709 2906 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225669.1 protein_id gnl|my_center|LOCUS_00030 3950 5950 gene locus_tag LOCUS_00040 gene tkt 3950 5950 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064313.1 protein_id gnl|my_center|LOCUS_00040 6040 7038 gene locus_tag LOCUS_00050 gene gap 6040 7038 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_00050 7372 8406 gene locus_tag LOCUS_00060 7372 8406 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089798.1 protein_id gnl|my_center|LOCUS_00060 9418 8393 gene locus_tag LOCUS_00070 gene comC 9418 8393 CDS product L-sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876829.1 protein_id gnl|my_center|LOCUS_00070 9616 11712 gene locus_tag LOCUS_00080 9616 11712 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_00080 11709 13505 gene locus_tag LOCUS_00090 11709 13505 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_00090 14432 13506 gene locus_tag LOCUS_00100 14432 13506 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816572.1 protein_id gnl|my_center|LOCUS_00100 14564 15553 gene locus_tag LOCUS_00110 14564 15553 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064939.1 protein_id gnl|my_center|LOCUS_00110 15578 16519 gene locus_tag LOCUS_00120 15578 16519 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877605.1 protein_id gnl|my_center|LOCUS_00120 16613 17515 gene locus_tag LOCUS_00130 gene prpB 16613 17515 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103044.1 protein_id gnl|my_center|LOCUS_00130 18366 17530 gene locus_tag LOCUS_00140 18366 17530 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085046.1 protein_id gnl|my_center|LOCUS_00140 19402 18389 gene locus_tag LOCUS_00150 19402 18389 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461131.1 protein_id gnl|my_center|LOCUS_00150 19764 19399 gene locus_tag LOCUS_00160 19764 19399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_00160 21143 19761 gene locus_tag LOCUS_00170 21143 19761 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 protein_id gnl|my_center|LOCUS_00170 22015 21140 gene locus_tag LOCUS_00180 22015 21140 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809384.1 protein_id gnl|my_center|LOCUS_00180 23676 22306 gene locus_tag LOCUS_00190 23676 22306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 24725 23673 gene locus_tag LOCUS_00200 24725 23673 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224149877.1 protein_id gnl|my_center|LOCUS_00200 25627 24818 gene locus_tag LOCUS_00210 25627 24818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 26040 25636 gene locus_tag LOCUS_00220 26040 25636 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551114.1 protein_id gnl|my_center|LOCUS_00220 26238 29213 gene locus_tag LOCUS_00230 26238 29213 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_00230 29553 29392 gene locus_tag LOCUS_00240 29553 29392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 29633 29857 gene locus_tag LOCUS_00250 29633 29857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 31783 30353 gene locus_tag LOCUS_00260 31783 30353 CDS product sensor histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526207.1 protein_id gnl|my_center|LOCUS_00260 32505 31834 gene locus_tag LOCUS_00270 32505 31834 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 protein_id gnl|my_center|LOCUS_00270 33228 32695 gene locus_tag LOCUS_00280 33228 32695 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175557.1 protein_id gnl|my_center|LOCUS_00280 33354 34472 gene locus_tag LOCUS_00290 gene recA 33354 34472 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812760.1 protein_id gnl|my_center|LOCUS_00290 34634 35083 gene locus_tag LOCUS_00300 gene recX 34634 35083 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766020.1 protein_id gnl|my_center|LOCUS_00300 36018 35104 gene locus_tag LOCUS_00310 gene argC 36018 35104 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886726.1 protein_id gnl|my_center|LOCUS_00310 36295 37455 gene locus_tag LOCUS_00320 gene sucC 36295 37455 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812749.1 protein_id gnl|my_center|LOCUS_00320 >Feature sequence002 675 2009 gene locus_tag LOCUS_00330 675 2009 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965985.1 protein_id gnl|my_center|LOCUS_00330 2021 2647 gene locus_tag LOCUS_00340 2021 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 2654 4162 gene locus_tag LOCUS_00350 2654 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 4159 5805 gene locus_tag LOCUS_00360 4159 5805 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814996.1 protein_id gnl|my_center|LOCUS_00360 5864 6493 gene locus_tag LOCUS_00370 5864 6493 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037571.1 protein_id gnl|my_center|LOCUS_00370 6851 10819 gene locus_tag LOCUS_00380 6851 10819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 10870 12723 gene locus_tag LOCUS_00390 10870 12723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 13800 12811 gene locus_tag LOCUS_00400 13800 12811 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808786.1 protein_id gnl|my_center|LOCUS_00400 14657 13827 gene locus_tag LOCUS_00410 14657 13827 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729776.1 protein_id gnl|my_center|LOCUS_00410 15705 14692 gene locus_tag LOCUS_00420 15705 14692 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329741.1 protein_id gnl|my_center|LOCUS_00420 16739 15762 gene locus_tag LOCUS_00430 16739 15762 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035278.1 protein_id gnl|my_center|LOCUS_00430 17514 16768 gene locus_tag LOCUS_00440 17514 16768 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814848.1 protein_id gnl|my_center|LOCUS_00440 18394 17525 gene locus_tag LOCUS_00450 18394 17525 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814441.1 protein_id gnl|my_center|LOCUS_00450 19654 18431 gene locus_tag LOCUS_00460 gene prpF 19654 18431 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065151.1 protein_id gnl|my_center|LOCUS_00460 20673 19651 gene locus_tag LOCUS_00470 20673 19651 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064844.1 protein_id gnl|my_center|LOCUS_00470 22054 20720 gene locus_tag LOCUS_00480 22054 20720 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926974.1 protein_id gnl|my_center|LOCUS_00480 24740 22047 gene locus_tag LOCUS_00490 gene acnA 24740 22047 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_00490 25577 24750 gene locus_tag LOCUS_00500 25577 24750 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526776.1 protein_id gnl|my_center|LOCUS_00500 26337 27275 gene locus_tag LOCUS_00510 26337 27275 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329741.1 protein_id gnl|my_center|LOCUS_00510 28502 27300 gene locus_tag LOCUS_00520 28502 27300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 29284 28499 gene locus_tag LOCUS_00530 29284 28499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 29519 29977 gene locus_tag LOCUS_00540 29519 29977 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174739.1 protein_id gnl|my_center|LOCUS_00540 >Feature sequence003 2620 1079 gene locus_tag LOCUS_00550 gene garD 2620 1079 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088615.1 protein_id gnl|my_center|LOCUS_00550 3663 2671 gene locus_tag LOCUS_00560 3663 2671 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967441.1 protein_id gnl|my_center|LOCUS_00560 4515 3688 gene locus_tag LOCUS_00570 4515 3688 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494199.1 protein_id gnl|my_center|LOCUS_00570 5513 4512 gene locus_tag LOCUS_00580 5513 4512 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089289.1 protein_id gnl|my_center|LOCUS_00580 6803 5520 gene locus_tag LOCUS_00590 6803 5520 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103397.1 protein_id gnl|my_center|LOCUS_00590 7324 6806 gene locus_tag LOCUS_00600 7324 6806 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770954.1 protein_id gnl|my_center|LOCUS_00600 8426 7443 gene locus_tag LOCUS_00610 8426 7443 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770956.1 protein_id gnl|my_center|LOCUS_00610 8596 9303 gene locus_tag LOCUS_00620 8596 9303 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400058.1 protein_id gnl|my_center|LOCUS_00620 9404 10735 gene locus_tag LOCUS_00630 gene gudD 9404 10735 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268234.1 protein_id gnl|my_center|LOCUS_00630 10768 11652 gene locus_tag LOCUS_00640 gene glxR 10768 11652 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765839.1 protein_id gnl|my_center|LOCUS_00640 11783 13057 gene locus_tag LOCUS_00650 11783 13057 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 protein_id gnl|my_center|LOCUS_00650 13075 13839 gene locus_tag LOCUS_00660 gene hpaI 13075 13839 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785061.1 protein_id gnl|my_center|LOCUS_00660 13860 14687 gene locus_tag LOCUS_00670 13860 14687 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103399.1 protein_id gnl|my_center|LOCUS_00670 16882 14726 gene locus_tag LOCUS_00680 16882 14726 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335531.1 protein_id gnl|my_center|LOCUS_00680 17622 17035 gene locus_tag LOCUS_00690 17622 17035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 17865 17623 gene locus_tag LOCUS_00700 17865 17623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 17918 19630 gene locus_tag LOCUS_00710 17918 19630 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064121.1 protein_id gnl|my_center|LOCUS_00710 19707 20024 gene locus_tag LOCUS_00720 19707 20024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 20506 20003 gene locus_tag LOCUS_00730 20506 20003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 21846 20509 gene locus_tag LOCUS_00740 21846 20509 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194083.1 protein_id gnl|my_center|LOCUS_00740 23405 21843 gene locus_tag LOCUS_00750 23405 21843 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 protein_id gnl|my_center|LOCUS_00750 24285 23500 gene locus_tag LOCUS_00760 gene lptB 24285 23500 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195214.1 protein_id gnl|my_center|LOCUS_00760 24929 24282 gene locus_tag LOCUS_00770 gene lptA 24929 24282 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936242.1 protein_id gnl|my_center|LOCUS_00770 25733 25071 gene locus_tag LOCUS_00780 25733 25071 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815939.1 protein_id gnl|my_center|LOCUS_00780 26592 25834 gene locus_tag LOCUS_00790 26592 25834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 <28106 26610 gene locus_tag LOCUS_00800 <28106 26610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522947.1:arginine--tRNA ligase >Feature sequence004 58 1347 gene locus_tag LOCUS_00810 58 1347 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388381.1 protein_id gnl|my_center|LOCUS_00810 1357 2949 gene locus_tag LOCUS_00820 gene bchB 1357 2949 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388380.1 protein_id gnl|my_center|LOCUS_00820 2924 6715 gene locus_tag LOCUS_00830 2924 6715 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388379.1 protein_id gnl|my_center|LOCUS_00830 6712 7620 gene locus_tag LOCUS_00840 gene bchL 6712 7620 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388378.1 protein_id gnl|my_center|LOCUS_00840 7632 8351 gene locus_tag LOCUS_00850 gene bchM 7632 8351 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388377.1 protein_id gnl|my_center|LOCUS_00850 8348 9772 gene locus_tag LOCUS_00860 8348 9772 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388376.1 protein_id gnl|my_center|LOCUS_00860 9810 10571 gene locus_tag LOCUS_00870 gene puhA 9810 10571 CDS product photosynthetic reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388375.1 protein_id gnl|my_center|LOCUS_00870 10568 11215 gene locus_tag LOCUS_00880 gene puhB 10568 11215 CDS product photosynthetic complex putative assembly protein PuhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388374.1 protein_id gnl|my_center|LOCUS_00880 11218 11748 gene locus_tag LOCUS_00890 11218 11748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 11745 12860 gene locus_tag LOCUS_00900 gene acsF 11745 12860 CDS product magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338129.1 protein_id gnl|my_center|LOCUS_00900 12903 13727 gene locus_tag LOCUS_00910 gene puhE 12903 13727 CDS product putative photosynthetic complex assembly protein PuhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388372.1 protein_id gnl|my_center|LOCUS_00910 13724 15280 gene locus_tag LOCUS_00920 13724 15280 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388252.1 protein_id gnl|my_center|LOCUS_00920 15302 16432 gene locus_tag LOCUS_00930 15302 16432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 17123 18550 gene locus_tag LOCUS_00940 17123 18550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 18612 19571 gene locus_tag LOCUS_00950 18612 19571 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090457.1 protein_id gnl|my_center|LOCUS_00950 20361 19582 gene locus_tag LOCUS_00960 20361 19582 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040271.1 protein_id gnl|my_center|LOCUS_00960 20474 21262 gene locus_tag LOCUS_00970 20474 21262 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807981.1 protein_id gnl|my_center|LOCUS_00970 22117 21293 gene locus_tag LOCUS_00980 22117 21293 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390733.1 protein_id gnl|my_center|LOCUS_00980 23694 22156 gene locus_tag LOCUS_00990 gene crtI 23694 22156 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390732.1 protein_id gnl|my_center|LOCUS_00990 >Feature sequence005 1154 174 gene locus_tag LOCUS_01000 1154 174 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174325.1 protein_id gnl|my_center|LOCUS_01000 1489 1151 gene locus_tag LOCUS_01010 1489 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967044.1 protein_id gnl|my_center|LOCUS_01010 2187 1486 gene locus_tag LOCUS_01020 2187 1486 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339095.1 protein_id gnl|my_center|LOCUS_01020 2312 3211 gene locus_tag LOCUS_01030 2312 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 3263 4246 gene locus_tag LOCUS_01040 gene dctP 3263 4246 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382874.1 protein_id gnl|my_center|LOCUS_01040 4303 4752 gene locus_tag LOCUS_01050 4303 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 4749 6041 gene locus_tag LOCUS_01060 4749 6041 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970535.1 protein_id gnl|my_center|LOCUS_01060 6043 7479 gene locus_tag LOCUS_01070 6043 7479 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244205.1 protein_id gnl|my_center|LOCUS_01070 7476 8207 gene locus_tag LOCUS_01080 7476 8207 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919670.1 protein_id gnl|my_center|LOCUS_01080 8664 8425 gene locus_tag LOCUS_01090 8664 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 8902 9741 gene locus_tag LOCUS_01100 8902 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 11055 9874 gene locus_tag LOCUS_01110 11055 9874 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_01110 11793 11128 gene locus_tag LOCUS_01120 11793 11128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 12491 11790 gene locus_tag LOCUS_01130 12491 11790 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 protein_id gnl|my_center|LOCUS_01130 14550 12724 gene locus_tag LOCUS_01140 14550 12724 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063644.1 protein_id gnl|my_center|LOCUS_01140 15362 14547 gene locus_tag LOCUS_01150 15362 14547 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063643.1 protein_id gnl|my_center|LOCUS_01150 16575 15370 gene locus_tag LOCUS_01160 16575 15370 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926442.1 protein_id gnl|my_center|LOCUS_01160 17627 16587 gene locus_tag LOCUS_01170 17627 16587 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812443.1 protein_id gnl|my_center|LOCUS_01170 18511 17633 gene locus_tag LOCUS_01180 18511 17633 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812445.1 protein_id gnl|my_center|LOCUS_01180 19320 18511 gene locus_tag LOCUS_01190 19320 18511 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812446.1 protein_id gnl|my_center|LOCUS_01190 20668 19448 gene locus_tag LOCUS_01200 20668 19448 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_01200 21924 20665 gene locus_tag LOCUS_01210 21924 20665 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 protein_id gnl|my_center|LOCUS_01210 22081 23283 gene locus_tag LOCUS_01220 22081 23283 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257345.1 protein_id gnl|my_center|LOCUS_01220 23700 23542 gene locus_tag LOCUS_01230 23700 23542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 >Feature sequence006 2607 286 gene locus_tag LOCUS_01240 2607 286 CDS product cytochrome P450/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187052.1 protein_id gnl|my_center|LOCUS_01240 2692 4377 gene locus_tag LOCUS_01250 2692 4377 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085471.1 protein_id gnl|my_center|LOCUS_01250 4519 4752 gene locus_tag LOCUS_01260 4519 4752 CDS product Arc family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812071.1 protein_id gnl|my_center|LOCUS_01260 4749 5177 gene locus_tag LOCUS_01270 4749 5177 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769733.1 protein_id gnl|my_center|LOCUS_01270 5230 5496 gene locus_tag LOCUS_01280 5230 5496 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_01280 5768 6310 gene locus_tag LOCUS_01290 5768 6310 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 protein_id gnl|my_center|LOCUS_01290 6552 7265 gene locus_tag LOCUS_01300 6552 7265 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064937.1 protein_id gnl|my_center|LOCUS_01300 8326 7346 gene locus_tag LOCUS_01310 8326 7346 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809384.1 protein_id gnl|my_center|LOCUS_01310 11224 8795 gene locus_tag LOCUS_01320 11224 8795 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088977.1 protein_id gnl|my_center|LOCUS_01320 11706 11221 gene locus_tag LOCUS_01330 11706 11221 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088978.1 protein_id gnl|my_center|LOCUS_01330 12579 11725 gene locus_tag LOCUS_01340 12579 11725 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088979.1 protein_id gnl|my_center|LOCUS_01340 13272 12592 gene locus_tag LOCUS_01350 13272 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 13392 14120 gene locus_tag LOCUS_01360 13392 14120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 14195 15265 gene locus_tag LOCUS_01370 14195 15265 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385252.1 protein_id gnl|my_center|LOCUS_01370 15332 15889 gene locus_tag LOCUS_01380 15332 15889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 15886 17214 gene locus_tag LOCUS_01390 15886 17214 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_01390 17623 17231 gene locus_tag LOCUS_01400 17623 17231 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346527.1 protein_id gnl|my_center|LOCUS_01400 19060 17654 gene locus_tag LOCUS_01410 19060 17654 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811151.1 protein_id gnl|my_center|LOCUS_01410 19933 19067 gene locus_tag LOCUS_01420 19933 19067 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925894.1 protein_id gnl|my_center|LOCUS_01420 20961 19972 gene locus_tag LOCUS_01430 20961 19972 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969733.1 protein_id gnl|my_center|LOCUS_01430 22186 21005 gene locus_tag LOCUS_01440 22186 21005 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064994.1 protein_id gnl|my_center|LOCUS_01440 23361 22201 gene locus_tag LOCUS_01450 23361 22201 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807998.1 protein_id gnl|my_center|LOCUS_01450 23880 23566 gene locus_tag LOCUS_01460 23880 23566 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460613.1 protein_id gnl|my_center|LOCUS_01460 >Feature sequence007 3 875 gene locus_tag LOCUS_01470 3 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 904 2061 gene locus_tag LOCUS_01480 904 2061 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878348.1 protein_id gnl|my_center|LOCUS_01480 2072 3739 gene locus_tag LOCUS_01490 2072 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 3715 4929 gene locus_tag LOCUS_01500 3715 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 4933 5445 gene locus_tag LOCUS_01510 4933 5445 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_01510 5426 5854 gene locus_tag LOCUS_01520 5426 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 5858 6457 gene locus_tag LOCUS_01530 5858 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 6479 8023 gene locus_tag LOCUS_01540 6479 8023 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282029.1 protein_id gnl|my_center|LOCUS_01540 8026 8328 gene locus_tag LOCUS_01550 8026 8328 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049831911.1 protein_id gnl|my_center|LOCUS_01550 8357 9469 gene locus_tag LOCUS_01560 8357 9469 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210950.1 protein_id gnl|my_center|LOCUS_01560 9503 10006 gene locus_tag LOCUS_01570 gene ripB 9503 10006 CDS product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188105.1 protein_id gnl|my_center|LOCUS_01570 10019 11416 gene locus_tag LOCUS_01580 10019 11416 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083638.1 protein_id gnl|my_center|LOCUS_01580 11440 12645 gene locus_tag LOCUS_01590 11440 12645 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005186.1 protein_id gnl|my_center|LOCUS_01590 12649 13449 gene locus_tag LOCUS_01600 12649 13449 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925778.1 protein_id gnl|my_center|LOCUS_01600 13456 14622 gene locus_tag LOCUS_01610 13456 14622 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967073.1 protein_id gnl|my_center|LOCUS_01610 14624 15043 gene locus_tag LOCUS_01620 14624 15043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 15643 15098 gene locus_tag LOCUS_01630 15643 15098 CDS product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479671.1 protein_id gnl|my_center|LOCUS_01630 16907 15648 gene locus_tag LOCUS_01640 16907 15648 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_01640 17593 16904 gene locus_tag LOCUS_01650 17593 16904 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269051.1 protein_id gnl|my_center|LOCUS_01650 18108 17596 gene locus_tag LOCUS_01660 18108 17596 CDS product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113048.1 protein_id gnl|my_center|LOCUS_01660 18608 18186 gene locus_tag LOCUS_01670 18608 18186 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_01670 18948 18730 gene locus_tag LOCUS_01680 18948 18730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 18934 19911 gene locus_tag LOCUS_01690 18934 19911 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 protein_id gnl|my_center|LOCUS_01690 19901 20809 gene locus_tag LOCUS_01700 19901 20809 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925611.1 protein_id gnl|my_center|LOCUS_01700 20809 21537 gene locus_tag LOCUS_01710 20809 21537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 22096 21602 gene locus_tag LOCUS_01720 22096 21602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 <22835 22124 gene locus_tag LOCUS_01730 <22835 22124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810564.1:ZIP family metal transporter >Feature sequence008 <1 2076 gene locus_tag LOCUS_01740 <1 2076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929666.1:methionine--tRNA ligase 2100 2306 gene locus_tag LOCUS_01750 2100 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 2351 4072 gene locus_tag LOCUS_01760 gene sulP 2351 4072 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_01760 4105 4323 gene locus_tag LOCUS_01770 4105 4323 CDS product DUF3460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815055.1 protein_id gnl|my_center|LOCUS_01770 4333 5193 gene locus_tag LOCUS_01780 4333 5193 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 protein_id gnl|my_center|LOCUS_01780 5237 6154 gene locus_tag LOCUS_01790 gene panB 5237 6154 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_01790 6267 7118 gene locus_tag LOCUS_01800 gene panC 6267 7118 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192993.1 protein_id gnl|my_center|LOCUS_01800 8412 7393 gene locus_tag LOCUS_01810 8412 7393 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925756.1 protein_id gnl|my_center|LOCUS_01810 8979 8515 gene locus_tag LOCUS_01820 gene secB 8979 8515 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198004.1 protein_id gnl|my_center|LOCUS_01820 9332 9063 gene locus_tag LOCUS_01830 gene grxC 9332 9063 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 protein_id gnl|my_center|LOCUS_01830 9738 9340 gene locus_tag LOCUS_01840 9738 9340 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958278.1 protein_id gnl|my_center|LOCUS_01840 9880 10623 gene locus_tag LOCUS_01850 gene gpmA 9880 10623 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198007.1 protein_id gnl|my_center|LOCUS_01850 10876 12213 gene locus_tag LOCUS_01860 10876 12213 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543824.1 protein_id gnl|my_center|LOCUS_01860 12268 13035 gene locus_tag LOCUS_01870 gene moeB 12268 13035 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198009.1 protein_id gnl|my_center|LOCUS_01870 13236 13448 gene locus_tag LOCUS_01880 13236 13448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 14042 13512 gene locus_tag LOCUS_01890 14042 13512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 14410 14057 gene locus_tag LOCUS_01900 14410 14057 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382894.1 protein_id gnl|my_center|LOCUS_01900 15388 14513 gene locus_tag LOCUS_01910 15388 14513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 15825 15400 gene locus_tag LOCUS_01920 15825 15400 CDS product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055933.1 protein_id gnl|my_center|LOCUS_01920 16613 15885 gene locus_tag LOCUS_01930 16613 15885 CDS product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050480010.1 protein_id gnl|my_center|LOCUS_01930 18788 17019 gene locus_tag LOCUS_01940 18788 17019 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268710.1 protein_id gnl|my_center|LOCUS_01940 19888 18785 gene locus_tag LOCUS_01950 19888 18785 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268709.1 protein_id gnl|my_center|LOCUS_01950 21176 19890 gene locus_tag LOCUS_01960 gene clsB 21176 19890 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522800.1 protein_id gnl|my_center|LOCUS_01960 >Feature sequence009 1752 556 gene locus_tag LOCUS_01970 1752 556 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530301.1 protein_id gnl|my_center|LOCUS_01970 2194 1790 gene locus_tag LOCUS_01980 2194 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 2495 2082 gene locus_tag LOCUS_01990 2495 2082 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807885.1 protein_id gnl|my_center|LOCUS_01990 3689 2514 gene locus_tag LOCUS_02000 3689 2514 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926482.1 protein_id gnl|my_center|LOCUS_02000 3869 3693 gene locus_tag LOCUS_02010 3869 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 4774 3866 gene locus_tag LOCUS_02020 4774 3866 CDS product CBU_1789 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958443.1 protein_id gnl|my_center|LOCUS_02020 4878 7823 gene locus_tag LOCUS_02030 4878 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 7994 7767 gene locus_tag LOCUS_02040 7994 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 8080 8280 gene locus_tag LOCUS_02050 8080 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 8461 11085 gene locus_tag LOCUS_02060 gene alaS 8461 11085 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191158.1 protein_id gnl|my_center|LOCUS_02060 12649 11495 gene locus_tag LOCUS_02070 12649 11495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 13424 13029 gene locus_tag LOCUS_02080 13424 13029 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583691.1 protein_id gnl|my_center|LOCUS_02080 14425 13439 gene locus_tag LOCUS_02090 14425 13439 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_02090 15503 14574 gene locus_tag LOCUS_02100 15503 14574 CDS product delta(1)-pyrroline-2-carboxylate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551610.1 protein_id gnl|my_center|LOCUS_02100 16241 15525 gene locus_tag LOCUS_02110 gene trmB 16241 15525 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185899.1 protein_id gnl|my_center|LOCUS_02110 16538 16762 gene locus_tag LOCUS_02120 16538 16762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 16759 17601 gene locus_tag LOCUS_02130 gene dinD 16759 17601 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_02130 18931 18035 gene locus_tag LOCUS_02140 gene gluQRS 18931 18035 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186469.1 protein_id gnl|my_center|LOCUS_02140 20009 18942 gene locus_tag LOCUS_02150 20009 18942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 21015 20107 gene locus_tag LOCUS_02160 21015 20107 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811174.1 protein_id gnl|my_center|LOCUS_02160 >Feature sequence010 2175 361 gene locus_tag LOCUS_02170 gene aspS 2175 361 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189849.1 protein_id gnl|my_center|LOCUS_02170 2851 2240 gene locus_tag LOCUS_02180 2851 2240 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189093.1 protein_id gnl|my_center|LOCUS_02180 3180 2851 gene locus_tag LOCUS_02190 3180 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 4883 3330 gene locus_tag LOCUS_02200 gene ubiB 4883 3330 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 protein_id gnl|my_center|LOCUS_02200 5455 4880 gene locus_tag LOCUS_02210 5455 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 6490 5519 gene locus_tag LOCUS_02220 6490 5519 CDS product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064917.1 protein_id gnl|my_center|LOCUS_02220 7285 6554 gene locus_tag LOCUS_02230 gene ubiE 7285 6554 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189973.1 protein_id gnl|my_center|LOCUS_02230 7735 7319 gene locus_tag LOCUS_02240 7735 7319 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_02240 11651 7773 gene locus_tag LOCUS_02250 11651 7773 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815152.1 protein_id gnl|my_center|LOCUS_02250 12088 11804 gene locus_tag LOCUS_02260 12088 11804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 12232 13512 gene locus_tag LOCUS_02270 gene hemA 12232 13512 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209421240.1 protein_id gnl|my_center|LOCUS_02270 13610 14725 gene locus_tag LOCUS_02280 gene prfA 13610 14725 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527811.1 protein_id gnl|my_center|LOCUS_02280 14722 15555 gene locus_tag LOCUS_02290 gene prmC 14722 15555 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036071.1 protein_id gnl|my_center|LOCUS_02290 15651 15971 gene locus_tag LOCUS_02300 gene grxD 15651 15971 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186955.1 protein_id gnl|my_center|LOCUS_02300 16286 16047 gene locus_tag LOCUS_02310 16286 16047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 16545 16327 gene locus_tag LOCUS_02320 16545 16327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 17323 16568 gene locus_tag LOCUS_02330 gene zapD 17323 16568 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_02330 17995 17369 gene locus_tag LOCUS_02340 gene coaE 17995 17369 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194322.1 protein_id gnl|my_center|LOCUS_02340 18918 17992 gene locus_tag LOCUS_02350 18918 17992 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266634.1 protein_id gnl|my_center|LOCUS_02350 20123 18918 gene locus_tag LOCUS_02360 20123 18918 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707570.1 protein_id gnl|my_center|LOCUS_02360 <20724 20140 gene locus_tag LOCUS_02370 <20724 20140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002221967.1:type IV-A pilus assembly ATPase PilB >Feature sequence011 239 1687 gene locus_tag LOCUS_02380 239 1687 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 protein_id gnl|my_center|LOCUS_02380 1758 2993 gene locus_tag LOCUS_02390 1758 2993 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089388.1 protein_id gnl|my_center|LOCUS_02390 3010 3774 gene locus_tag LOCUS_02400 3010 3774 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391052.1 protein_id gnl|my_center|LOCUS_02400 3771 4481 gene locus_tag LOCUS_02410 3771 4481 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391053.1 protein_id gnl|my_center|LOCUS_02410 4493 5374 gene locus_tag LOCUS_02420 4493 5374 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809675.1 protein_id gnl|my_center|LOCUS_02420 5396 6334 gene locus_tag LOCUS_02430 5396 6334 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809677.1 protein_id gnl|my_center|LOCUS_02430 8404 6359 gene locus_tag LOCUS_02440 8404 6359 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087443.1 protein_id gnl|my_center|LOCUS_02440 8453 9475 gene locus_tag LOCUS_02450 8453 9475 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816621.1 protein_id gnl|my_center|LOCUS_02450 9472 10512 gene locus_tag LOCUS_02460 9472 10512 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064946.1 protein_id gnl|my_center|LOCUS_02460 10597 11574 gene locus_tag LOCUS_02470 10597 11574 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089798.1 protein_id gnl|my_center|LOCUS_02470 12056 11610 gene locus_tag LOCUS_02480 12056 11610 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528500.1 protein_id gnl|my_center|LOCUS_02480 12317 12781 gene locus_tag LOCUS_02490 12317 12781 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089535.1 protein_id gnl|my_center|LOCUS_02490 12914 14077 gene locus_tag LOCUS_02500 12914 14077 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533146.1 protein_id gnl|my_center|LOCUS_02500 14102 15076 gene locus_tag LOCUS_02510 14102 15076 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970169.1 protein_id gnl|my_center|LOCUS_02510 16067 15093 gene locus_tag LOCUS_02520 16067 15093 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268113.1 protein_id gnl|my_center|LOCUS_02520 16152 16568 gene locus_tag LOCUS_02530 16152 16568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 16565 17716 gene locus_tag LOCUS_02540 16565 17716 CDS product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972380.1 protein_id gnl|my_center|LOCUS_02540 >Feature sequence012 848 111 gene locus_tag LOCUS_02550 848 111 CDS product DUF2894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038796.1 protein_id gnl|my_center|LOCUS_02550 1551 886 gene locus_tag LOCUS_02560 1551 886 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064407.1 protein_id gnl|my_center|LOCUS_02560 4025 1548 gene locus_tag LOCUS_02570 4025 1548 CDS product DUF802 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275456.1 protein_id gnl|my_center|LOCUS_02570 4681 4022 gene locus_tag LOCUS_02580 4681 4022 CDS product DUF3348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206556.1 protein_id gnl|my_center|LOCUS_02580 5101 4808 gene locus_tag LOCUS_02590 5101 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 5004 5558 gene locus_tag LOCUS_02600 5004 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 5993 5592 gene locus_tag LOCUS_02610 5993 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 6285 6983 gene locus_tag LOCUS_02620 6285 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 7149 7586 gene locus_tag LOCUS_02630 7149 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 7514 9373 gene locus_tag LOCUS_02640 7514 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 9474 9788 gene locus_tag LOCUS_02650 9474 9788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 9892 12000 gene locus_tag LOCUS_02660 9892 12000 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 protein_id gnl|my_center|LOCUS_02660 12007 13428 gene locus_tag LOCUS_02670 12007 13428 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971988.1 protein_id gnl|my_center|LOCUS_02670 13938 13459 gene locus_tag LOCUS_02680 13938 13459 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094746.1 protein_id gnl|my_center|LOCUS_02680 14013 14717 gene locus_tag LOCUS_02690 gene queC 14013 14717 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929689.1 protein_id gnl|my_center|LOCUS_02690 14922 16301 gene locus_tag LOCUS_02700 14922 16301 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083890.1 protein_id gnl|my_center|LOCUS_02700 16298 17776 gene locus_tag LOCUS_02710 16298 17776 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083889.1 protein_id gnl|my_center|LOCUS_02710 17803 18138 gene locus_tag LOCUS_02720 17803 18138 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083869.1 protein_id gnl|my_center|LOCUS_02720 >Feature sequence013 853 1314 gene locus_tag LOCUS_02730 853 1314 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930202.1 protein_id gnl|my_center|LOCUS_02730 1575 2165 gene locus_tag LOCUS_02740 1575 2165 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096079.1 protein_id gnl|my_center|LOCUS_02740 2174 3631 gene locus_tag LOCUS_02750 gene tcuA 2174 3631 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704752.1 protein_id gnl|my_center|LOCUS_02750 3628 4392 gene locus_tag LOCUS_02760 gene fabG 3628 4392 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197597.1 protein_id gnl|my_center|LOCUS_02760 4555 5538 gene locus_tag LOCUS_02770 4555 5538 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064939.1 protein_id gnl|my_center|LOCUS_02770 6373 5591 gene locus_tag LOCUS_02780 6373 5591 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991075.1 protein_id gnl|my_center|LOCUS_02780 7406 6501 gene locus_tag LOCUS_02790 7406 6501 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196705.1 protein_id gnl|my_center|LOCUS_02790 7437 8519 gene locus_tag LOCUS_02800 7437 8519 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812334.1 protein_id gnl|my_center|LOCUS_02800 8573 9367 gene locus_tag LOCUS_02810 8573 9367 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965978.1 protein_id gnl|my_center|LOCUS_02810 9396 10364 gene locus_tag LOCUS_02820 9396 10364 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931679.1 protein_id gnl|my_center|LOCUS_02820 10368 10898 gene locus_tag LOCUS_02830 10368 10898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 10903 11412 gene locus_tag LOCUS_02840 10903 11412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 11420 12961 gene locus_tag LOCUS_02850 11420 12961 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223362.1 protein_id gnl|my_center|LOCUS_02850 13001 14623 gene locus_tag LOCUS_02860 13001 14623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 14620 15504 gene locus_tag LOCUS_02870 14620 15504 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086154.1 protein_id gnl|my_center|LOCUS_02870 15501 16292 gene locus_tag LOCUS_02880 15501 16292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 17198 16455 gene locus_tag LOCUS_02890 gene ugpQ 17198 16455 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073571.1 protein_id gnl|my_center|LOCUS_02890 >Feature sequence014 1610 441 gene locus_tag LOCUS_02900 1610 441 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064468.1 protein_id gnl|my_center|LOCUS_02900 2387 1668 gene locus_tag LOCUS_02910 2387 1668 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_02910 3532 2387 gene locus_tag LOCUS_02920 3532 2387 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189686.1 protein_id gnl|my_center|LOCUS_02920 3748 6009 gene locus_tag LOCUS_02930 3748 6009 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189876.1 protein_id gnl|my_center|LOCUS_02930 6086 7375 gene locus_tag LOCUS_02940 6086 7375 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103188.1 protein_id gnl|my_center|LOCUS_02940 7389 8150 gene locus_tag LOCUS_02950 gene rsmA 7389 8150 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065364.1 protein_id gnl|my_center|LOCUS_02950 8446 8264 gene locus_tag LOCUS_02960 8446 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 8844 8425 gene locus_tag LOCUS_02970 8844 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 9336 8902 gene locus_tag LOCUS_02980 9336 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 11790 9481 gene locus_tag LOCUS_02990 11790 9481 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194063.1 protein_id gnl|my_center|LOCUS_02990 12740 12024 gene locus_tag LOCUS_03000 12740 12024 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088690.1 protein_id gnl|my_center|LOCUS_03000 13518 12733 gene locus_tag LOCUS_03010 13518 12733 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088691.1 protein_id gnl|my_center|LOCUS_03010 14492 13515 gene locus_tag LOCUS_03020 14492 13515 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088692.1 protein_id gnl|my_center|LOCUS_03020 15369 14497 gene locus_tag LOCUS_03030 15369 14497 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088693.1 protein_id gnl|my_center|LOCUS_03030 16638 15469 gene locus_tag LOCUS_03040 16638 15469 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088694.1 protein_id gnl|my_center|LOCUS_03040 17568 16789 gene locus_tag LOCUS_03050 17568 16789 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085178.1 protein_id gnl|my_center|LOCUS_03050 >Feature sequence015 <1 4141 gene locus_tag LOCUS_03060 <1 4141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196742.1:glutamate synthase-related protein 4238 5704 gene locus_tag LOCUS_03070 4238 5704 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886828.1 protein_id gnl|my_center|LOCUS_03070 5927 6823 gene locus_tag LOCUS_03080 5927 6823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_03080 6820 7614 gene locus_tag LOCUS_03090 gene mlaE 6820 7614 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815775.1 protein_id gnl|my_center|LOCUS_03090 7763 8263 gene locus_tag LOCUS_03100 gene mlaD 7763 8263 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 protein_id gnl|my_center|LOCUS_03100 8287 9042 gene locus_tag LOCUS_03110 8287 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 9120 9761 gene locus_tag LOCUS_03120 9120 9761 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_03120 9770 10093 gene locus_tag LOCUS_03130 9770 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 10157 11095 gene locus_tag LOCUS_03140 10157 11095 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_03140 11092 11865 gene locus_tag LOCUS_03150 11092 11865 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_03150 11912 12154 gene locus_tag LOCUS_03160 11912 12154 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815785.1 protein_id gnl|my_center|LOCUS_03160 12160 13431 gene locus_tag LOCUS_03170 gene murA 12160 13431 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185050.1 protein_id gnl|my_center|LOCUS_03170 13431 14093 gene locus_tag LOCUS_03180 gene hisG 13431 14093 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 protein_id gnl|my_center|LOCUS_03180 14112 15449 gene locus_tag LOCUS_03190 gene hisD 14112 15449 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931641.1 protein_id gnl|my_center|LOCUS_03190 15470 16546 gene locus_tag LOCUS_03200 gene hisC 15470 16546 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_03200 16543 17163 gene locus_tag LOCUS_03210 gene hisB 16543 17163 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199911.1 protein_id gnl|my_center|LOCUS_03210 >Feature sequence016 2040 841 gene locus_tag LOCUS_03220 2040 841 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 protein_id gnl|my_center|LOCUS_03220 3014 2037 gene locus_tag LOCUS_03230 3014 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 4249 3011 gene locus_tag LOCUS_03240 4249 3011 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920947.1 protein_id gnl|my_center|LOCUS_03240 5250 4246 gene locus_tag LOCUS_03250 5250 4246 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970881.1 protein_id gnl|my_center|LOCUS_03250 6230 5247 gene locus_tag LOCUS_03260 6230 5247 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814318.1 protein_id gnl|my_center|LOCUS_03260 6972 6244 gene locus_tag LOCUS_03270 6972 6244 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265848.1 protein_id gnl|my_center|LOCUS_03270 8687 6969 gene locus_tag LOCUS_03280 8687 6969 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228720.1 protein_id gnl|my_center|LOCUS_03280 10140 8695 gene locus_tag LOCUS_03290 10140 8695 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228721.1 protein_id gnl|my_center|LOCUS_03290 11864 10176 gene locus_tag LOCUS_03300 gene paaN 11864 10176 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186941.1 protein_id gnl|my_center|LOCUS_03300 12331 11861 gene locus_tag LOCUS_03310 12331 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 12888 12574 gene locus_tag LOCUS_03320 12888 12574 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036266.1 protein_id gnl|my_center|LOCUS_03320 13200 12895 gene locus_tag LOCUS_03330 13200 12895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 13442 13197 gene locus_tag LOCUS_03340 13442 13197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 13909 13439 gene locus_tag LOCUS_03350 13909 13439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 14254 13979 gene locus_tag LOCUS_03360 14254 13979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 14611 15741 gene locus_tag LOCUS_03370 gene asd 14611 15741 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930382.1 protein_id gnl|my_center|LOCUS_03370 15741 16793 gene locus_tag LOCUS_03380 15741 16793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 16790 17572 gene locus_tag LOCUS_03390 gene truA 16790 17572 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930384.1 protein_id gnl|my_center|LOCUS_03390 >Feature sequence017 1476 1718 gene locus_tag LOCUS_03400 1476 1718 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528289.1 protein_id gnl|my_center|LOCUS_03400 1715 2110 gene locus_tag LOCUS_03410 1715 2110 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969348.1 protein_id gnl|my_center|LOCUS_03410 3091 2273 gene locus_tag LOCUS_03420 3091 2273 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930761.1 protein_id gnl|my_center|LOCUS_03420 4720 3101 gene locus_tag LOCUS_03430 4720 3101 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_03430 6401 4845 gene locus_tag LOCUS_03440 6401 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 6916 6422 gene locus_tag LOCUS_03450 6916 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 6996 7931 gene locus_tag LOCUS_03460 6996 7931 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083896.1 protein_id gnl|my_center|LOCUS_03460 8083 9750 gene locus_tag LOCUS_03470 gene boxC 8083 9750 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921378.1 protein_id gnl|my_center|LOCUS_03470 9813 11240 gene locus_tag LOCUS_03480 gene boxB 9813 11240 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_03480 11346 12638 gene locus_tag LOCUS_03490 11346 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 17213 12783 gene locus_tag LOCUS_03500 17213 12783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 17655 17224 gene locus_tag LOCUS_03510 17655 17224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 >Feature sequence018 3204 2731 gene locus_tag LOCUS_03520 3204 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 3872 3201 gene locus_tag LOCUS_03530 3872 3201 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194134.1 protein_id gnl|my_center|LOCUS_03530 4715 3882 gene locus_tag LOCUS_03540 gene dapB 4715 3882 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557251.1 protein_id gnl|my_center|LOCUS_03540 5251 4712 gene locus_tag LOCUS_03550 5251 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 5415 5882 gene locus_tag LOCUS_03560 gene fur 5415 5882 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_03560 6854 5904 gene locus_tag LOCUS_03570 gene hprK 6854 5904 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195225.1 protein_id gnl|my_center|LOCUS_03570 7350 6880 gene locus_tag LOCUS_03580 gene ptsN 7350 6880 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 protein_id gnl|my_center|LOCUS_03580 7880 7530 gene locus_tag LOCUS_03590 gene raiA 7880 7530 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195219.1 protein_id gnl|my_center|LOCUS_03590 8275 9261 gene locus_tag LOCUS_03600 gene corA 8275 9261 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002883400.1 protein_id gnl|my_center|LOCUS_03600 9750 9307 gene locus_tag LOCUS_03610 9750 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 10563 9838 gene locus_tag LOCUS_03620 10563 9838 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346925.1 protein_id gnl|my_center|LOCUS_03620 10939 11373 gene locus_tag LOCUS_03630 10939 11373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 12804 11425 gene locus_tag LOCUS_03640 gene purB 12804 11425 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522085.1 protein_id gnl|my_center|LOCUS_03640 12917 13531 gene locus_tag LOCUS_03650 12917 13531 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813020.1 protein_id gnl|my_center|LOCUS_03650 13982 13533 gene locus_tag LOCUS_03660 13982 13533 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073250.1 protein_id gnl|my_center|LOCUS_03660 14755 13979 gene locus_tag LOCUS_03670 14755 13979 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_03670 15354 14770 gene locus_tag LOCUS_03680 15354 14770 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407549.1 protein_id gnl|my_center|LOCUS_03680 16613 15351 gene locus_tag LOCUS_03690 16613 15351 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_03690 17197 16640 gene locus_tag LOCUS_03700 17197 16640 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881186.1 protein_id gnl|my_center|LOCUS_03700 >Feature sequence019 108 497 gene locus_tag LOCUS_03710 108 497 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958096.1 protein_id gnl|my_center|LOCUS_03710 544 1191 gene locus_tag LOCUS_03720 544 1191 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814956.1 protein_id gnl|my_center|LOCUS_03720 1247 3328 gene locus_tag LOCUS_03730 1247 3328 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014486102.1 protein_id gnl|my_center|LOCUS_03730 3384 4181 gene locus_tag LOCUS_03740 gene mtgA 3384 4181 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814960.1 protein_id gnl|my_center|LOCUS_03740 4178 4765 gene locus_tag LOCUS_03750 gene ruvC 4178 4765 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814225.1 protein_id gnl|my_center|LOCUS_03750 4830 5576 gene locus_tag LOCUS_03760 4830 5576 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528853.1 protein_id gnl|my_center|LOCUS_03760 5778 5602 gene locus_tag LOCUS_03770 5778 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 6725 5802 gene locus_tag LOCUS_03780 gene lpxC 6725 5802 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194158.1 protein_id gnl|my_center|LOCUS_03780 8059 6851 gene locus_tag LOCUS_03790 gene ftsZ 8059 6851 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814568.1 protein_id gnl|my_center|LOCUS_03790 9433 8204 gene locus_tag LOCUS_03800 gene ftsA 9433 8204 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 protein_id gnl|my_center|LOCUS_03800 10240 9440 gene locus_tag LOCUS_03810 10240 9440 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_03810 11208 10237 gene locus_tag LOCUS_03820 11208 10237 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 protein_id gnl|my_center|LOCUS_03820 12614 11205 gene locus_tag LOCUS_03830 gene murC 12614 11205 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814572.1 protein_id gnl|my_center|LOCUS_03830 13702 12611 gene locus_tag LOCUS_03840 gene murG 13702 12611 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194182.1 protein_id gnl|my_center|LOCUS_03840 15018 13777 gene locus_tag LOCUS_03850 gene ftsW 15018 13777 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194175.1 protein_id gnl|my_center|LOCUS_03850 16742 15036 gene locus_tag LOCUS_03860 gene murD 16742 15036 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195134.1 protein_id gnl|my_center|LOCUS_03860 17416 16739 gene locus_tag LOCUS_03870 17416 16739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 >Feature sequence020 83 382 gene locus_tag LOCUS_03880 83 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 563 958 gene locus_tag LOCUS_03890 563 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 1552 1833 gene locus_tag LOCUS_03900 1552 1833 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_03900 1845 2144 gene locus_tag LOCUS_03910 1845 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 2520 2795 gene locus_tag LOCUS_03920 2520 2795 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_03920 2805 3014 gene locus_tag LOCUS_03930 2805 3014 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_03930 3444 3241 gene locus_tag LOCUS_03940 3444 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 3558 3767 gene locus_tag LOCUS_03950 3558 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 3822 4310 gene locus_tag LOCUS_03960 3822 4310 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399128.1 protein_id gnl|my_center|LOCUS_03960 4604 5527 gene locus_tag LOCUS_03970 4604 5527 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085465.1 protein_id gnl|my_center|LOCUS_03970 5532 6884 gene locus_tag LOCUS_03980 5532 6884 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085466.1 protein_id gnl|my_center|LOCUS_03980 7026 7973 gene locus_tag LOCUS_03990 7026 7973 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064939.1 protein_id gnl|my_center|LOCUS_03990 8067 8978 gene locus_tag LOCUS_04000 8067 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 9005 9604 gene locus_tag LOCUS_04010 9005 9604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 9607 10482 gene locus_tag LOCUS_04020 9607 10482 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085465.1 protein_id gnl|my_center|LOCUS_04020 10487 11554 gene locus_tag LOCUS_04030 10487 11554 CDS product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085467.1 protein_id gnl|my_center|LOCUS_04030 15184 12314 gene locus_tag LOCUS_04040 gene ppc 15184 12314 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191560.1 protein_id gnl|my_center|LOCUS_04040 15242 16150 gene locus_tag LOCUS_04050 gene hemC 15242 16150 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193185.1 protein_id gnl|my_center|LOCUS_04050 16169 16927 gene locus_tag LOCUS_04060 16169 16927 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446517.1 protein_id gnl|my_center|LOCUS_04060 >Feature sequence021 <1 933 gene locus_tag LOCUS_04070 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929940.1:MDR family oxidoreductase 967 2889 gene locus_tag LOCUS_04080 967 2889 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813753.1 protein_id gnl|my_center|LOCUS_04080 4098 2917 gene locus_tag LOCUS_04090 4098 2917 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_04090 4354 4776 gene locus_tag LOCUS_04100 4354 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 4783 5091 gene locus_tag LOCUS_04110 gene soxZ 4783 5091 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932697.1 protein_id gnl|my_center|LOCUS_04110 5412 8279 gene locus_tag LOCUS_04120 5412 8279 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813631.1 protein_id gnl|my_center|LOCUS_04120 8332 9594 gene locus_tag LOCUS_04130 gene odhB 8332 9594 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192735.1 protein_id gnl|my_center|LOCUS_04130 9605 9874 gene locus_tag LOCUS_04140 9605 9874 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785693.1 protein_id gnl|my_center|LOCUS_04140 9871 10134 gene locus_tag LOCUS_04150 9871 10134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 10212 11639 gene locus_tag LOCUS_04160 gene lpdA 10212 11639 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813626.1 protein_id gnl|my_center|LOCUS_04160 11718 12815 gene locus_tag LOCUS_04170 gene zapE 11718 12815 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550551.1 protein_id gnl|my_center|LOCUS_04170 12866 13432 gene locus_tag LOCUS_04180 12866 13432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 13446 15449 gene locus_tag LOCUS_04190 13446 15449 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192700.1 protein_id gnl|my_center|LOCUS_04190 16233 15412 gene locus_tag LOCUS_04200 16233 15412 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193722.1 protein_id gnl|my_center|LOCUS_04200 >Feature sequence022 1783 473 gene locus_tag LOCUS_04210 gene rsmB 1783 473 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038748.1 protein_id gnl|my_center|LOCUS_04210 3195 1909 gene locus_tag LOCUS_04220 3195 1909 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_04220 3535 3206 gene locus_tag LOCUS_04230 3535 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 4283 3651 gene locus_tag LOCUS_04240 4283 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 8649 4435 gene locus_tag LOCUS_04250 gene rpoC 8649 4435 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521902.1 protein_id gnl|my_center|LOCUS_04250 12926 8733 gene locus_tag LOCUS_04260 gene rpoB 12926 8733 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198365.1 protein_id gnl|my_center|LOCUS_04260 13506 13129 gene locus_tag LOCUS_04270 13506 13129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 14048 13545 gene locus_tag LOCUS_04280 gene rplJ 14048 13545 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199864.1 protein_id gnl|my_center|LOCUS_04280 14990 14490 gene locus_tag LOCUS_04290 14990 14490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04290 15422 14991 gene locus_tag LOCUS_04300 gene rplK 15422 14991 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198368.1 protein_id gnl|my_center|LOCUS_04300 16164 15574 gene locus_tag LOCUS_04310 gene nusG 16164 15574 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198369.1 protein_id gnl|my_center|LOCUS_04310 16553 16161 gene locus_tag LOCUS_04320 gene secE 16553 16161 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185179.1 protein_id gnl|my_center|LOCUS_04320 16749 16674 gene locus_tag LOCUS_t00010 16749 16674 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence023 62 844 gene locus_tag LOCUS_04330 62 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 2611 1301 gene locus_tag LOCUS_04340 2611 1301 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192757.1 protein_id gnl|my_center|LOCUS_04340 4340 2667 gene locus_tag LOCUS_04350 4340 2667 CDS product UDP phosphate-alpha-4-amino-4-deoxy-L-arabinose arabinosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521317.1 protein_id gnl|my_center|LOCUS_04350 4748 4485 gene locus_tag LOCUS_04360 4748 4485 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193070.1 protein_id gnl|my_center|LOCUS_04360 6115 4853 gene locus_tag LOCUS_04370 gene rho 6115 4853 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810577.1 protein_id gnl|my_center|LOCUS_04370 6684 6352 gene locus_tag LOCUS_04380 gene trxA 6684 6352 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403255.1 protein_id gnl|my_center|LOCUS_04380 6824 9361 gene locus_tag LOCUS_04390 6824 9361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 9358 12669 gene locus_tag LOCUS_04400 gene addA 9358 12669 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_04400 12732 14075 gene locus_tag LOCUS_04410 12732 14075 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202907611.1 protein_id gnl|my_center|LOCUS_04410 14072 14374 gene locus_tag LOCUS_04420 14072 14374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 14543 15010 gene locus_tag LOCUS_04430 14543 15010 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065756.1 protein_id gnl|my_center|LOCUS_04430 15838 15194 gene locus_tag LOCUS_04440 15838 15194 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527196.1 protein_id gnl|my_center|LOCUS_04440 16755 15952 gene locus_tag LOCUS_04450 16755 15952 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192025.1 protein_id gnl|my_center|LOCUS_04450 >Feature sequence024 240 449 gene locus_tag LOCUS_04460 gene rpmC 240 449 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806912.1 protein_id gnl|my_center|LOCUS_04460 446 715 gene locus_tag LOCUS_04470 gene rpsQ 446 715 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690077.1 protein_id gnl|my_center|LOCUS_04470 893 1399 gene locus_tag LOCUS_04480 893 1399 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064337.1 protein_id gnl|my_center|LOCUS_04480 1979 1482 gene locus_tag LOCUS_04490 1979 1482 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902308.1 protein_id gnl|my_center|LOCUS_04490 2634 2023 gene locus_tag LOCUS_04500 2634 2023 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_04500 2879 3337 gene locus_tag LOCUS_04510 2879 3337 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813017.1 protein_id gnl|my_center|LOCUS_04510 3924 3415 gene locus_tag LOCUS_04520 3924 3415 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198028.1 protein_id gnl|my_center|LOCUS_04520 4180 4701 gene locus_tag LOCUS_04530 4180 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 4698 5951 gene locus_tag LOCUS_04540 4698 5951 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526570.1 protein_id gnl|my_center|LOCUS_04540 5948 6391 gene locus_tag LOCUS_04550 5948 6391 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198014.1 protein_id gnl|my_center|LOCUS_04550 6360 6629 gene locus_tag LOCUS_04560 6360 6629 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_04560 6626 8380 gene locus_tag LOCUS_04570 gene ptsP 6626 8380 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_04570 9398 8406 gene locus_tag LOCUS_04580 gene lipA 9398 8406 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189177.1 protein_id gnl|my_center|LOCUS_04580 10107 9421 gene locus_tag LOCUS_04590 gene lipB 10107 9421 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925723.1 protein_id gnl|my_center|LOCUS_04590 10373 10104 gene locus_tag LOCUS_04600 10373 10104 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064725.1 protein_id gnl|my_center|LOCUS_04600 10402 10575 gene locus_tag LOCUS_04610 10402 10575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 10889 11245 gene locus_tag LOCUS_04620 10889 11245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 11267 12145 gene locus_tag LOCUS_04630 gene atpB 11267 12145 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214802.1 protein_id gnl|my_center|LOCUS_04630 12195 12443 gene locus_tag LOCUS_04640 gene atpE 12195 12443 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815363.1 protein_id gnl|my_center|LOCUS_04640 12480 12950 gene locus_tag LOCUS_04650 12480 12950 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185283.1 protein_id gnl|my_center|LOCUS_04650 12954 13484 gene locus_tag LOCUS_04660 12954 13484 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815348.1 protein_id gnl|my_center|LOCUS_04660 13531 15084 gene locus_tag LOCUS_04670 gene atpA 13531 15084 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 protein_id gnl|my_center|LOCUS_04670 15128 15988 gene locus_tag LOCUS_04680 gene atpG 15128 15988 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_04680 >Feature sequence025 3159 400 gene locus_tag LOCUS_04690 gene glnE 3159 400 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196324.1 protein_id gnl|my_center|LOCUS_04690 3289 7374 gene locus_tag LOCUS_04700 3289 7374 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009241452.1 protein_id gnl|my_center|LOCUS_04700 7371 8180 gene locus_tag LOCUS_04710 7371 8180 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813061.1 protein_id gnl|my_center|LOCUS_04710 8273 10279 gene locus_tag LOCUS_04720 8273 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 10293 10961 gene locus_tag LOCUS_04730 10293 10961 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338585.1 protein_id gnl|my_center|LOCUS_04730 11072 12244 gene locus_tag LOCUS_04740 11072 12244 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_04740 12429 12761 gene locus_tag LOCUS_04750 gene yajC 12429 12761 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_04750 12871 14751 gene locus_tag LOCUS_04760 gene secD 12871 14751 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809414.1 protein_id gnl|my_center|LOCUS_04760 14772 15725 gene locus_tag LOCUS_04770 gene secF 14772 15725 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522118.1 protein_id gnl|my_center|LOCUS_04770 >Feature sequence026 1493 840 gene locus_tag LOCUS_04780 gene leuD 1493 840 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926388.1 protein_id gnl|my_center|LOCUS_04780 2964 1513 gene locus_tag LOCUS_04790 gene leuC 2964 1513 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528981.1 protein_id gnl|my_center|LOCUS_04790 3933 3001 gene locus_tag LOCUS_04800 3933 3001 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811152.1 protein_id gnl|my_center|LOCUS_04800 5570 4260 gene locus_tag LOCUS_04810 5570 4260 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065159.1 protein_id gnl|my_center|LOCUS_04810 5923 5603 gene locus_tag LOCUS_04820 5923 5603 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528990.1 protein_id gnl|my_center|LOCUS_04820 6653 5949 gene locus_tag LOCUS_04830 6653 5949 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187935.1 protein_id gnl|my_center|LOCUS_04830 8484 6679 gene locus_tag LOCUS_04840 gene sdhA 8484 6679 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188402.1 protein_id gnl|my_center|LOCUS_04840 8855 8490 gene locus_tag LOCUS_04850 gene sdhD 8855 8490 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187439.1 protein_id gnl|my_center|LOCUS_04850 9338 8895 gene locus_tag LOCUS_04860 gene sdhC 9338 8895 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536542.1 protein_id gnl|my_center|LOCUS_04860 11063 9525 gene locus_tag LOCUS_04870 11063 9525 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267236.1 protein_id gnl|my_center|LOCUS_04870 11085 11405 gene locus_tag LOCUS_04880 11085 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 12215 11421 gene locus_tag LOCUS_04890 12215 11421 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188685.1 protein_id gnl|my_center|LOCUS_04890 12419 13402 gene locus_tag LOCUS_04900 12419 13402 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119517.1 protein_id gnl|my_center|LOCUS_04900 13444 14427 gene locus_tag LOCUS_04910 13444 14427 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188261.1 protein_id gnl|my_center|LOCUS_04910 >Feature sequence027 323 93 gene locus_tag LOCUS_04920 323 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 1549 383 gene locus_tag LOCUS_04930 gene tcuB 1549 383 CDS product tricarballylate utilization protein TcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811143.1 protein_id gnl|my_center|LOCUS_04930 2978 1536 gene locus_tag LOCUS_04940 gene tcuA 2978 1536 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704752.1 protein_id gnl|my_center|LOCUS_04940 3847 3089 gene locus_tag LOCUS_04950 3847 3089 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085532.1 protein_id gnl|my_center|LOCUS_04950 4162 5193 gene locus_tag LOCUS_04960 gene dctP 4162 5193 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063711.1 protein_id gnl|my_center|LOCUS_04960 5358 5888 gene locus_tag LOCUS_04970 5358 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 5907 7226 gene locus_tag LOCUS_04980 5907 7226 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_04980 7253 8662 gene locus_tag LOCUS_04990 7253 8662 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040324.1 protein_id gnl|my_center|LOCUS_04990 10068 8680 gene locus_tag LOCUS_05000 10068 8680 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083638.1 protein_id gnl|my_center|LOCUS_05000 11414 10065 gene locus_tag LOCUS_05010 11414 10065 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809386.1 protein_id gnl|my_center|LOCUS_05010 11522 12376 gene locus_tag LOCUS_05020 11522 12376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 12386 13216 gene locus_tag LOCUS_05030 12386 13216 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965978.1 protein_id gnl|my_center|LOCUS_05030 14261 13224 gene locus_tag LOCUS_05040 14261 13224 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_05040 15700 14276 gene locus_tag LOCUS_05050 15700 14276 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090641.1 protein_id gnl|my_center|LOCUS_05050 15860 15693 gene locus_tag LOCUS_05060 15860 15693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 >Feature sequence028 2106 1639 gene locus_tag LOCUS_05070 2106 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 2381 2752 gene locus_tag LOCUS_05080 gene clpS 2381 2752 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194131.1 protein_id gnl|my_center|LOCUS_05080 2811 5147 gene locus_tag LOCUS_05090 gene clpA 2811 5147 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_05090 6263 5283 gene locus_tag LOCUS_05100 6263 5283 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072295.1 protein_id gnl|my_center|LOCUS_05100 7842 6310 gene locus_tag LOCUS_05110 7842 6310 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853666.1 protein_id gnl|my_center|LOCUS_05110 7926 8651 gene locus_tag LOCUS_05120 7926 8651 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185607.1 protein_id gnl|my_center|LOCUS_05120 8702 9988 gene locus_tag LOCUS_05130 gene purD 8702 9988 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186246.1 protein_id gnl|my_center|LOCUS_05130 10004 10627 gene locus_tag LOCUS_05140 10004 10627 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_05140 10624 11541 gene locus_tag LOCUS_05150 gene hemF 10624 11541 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526433.1 protein_id gnl|my_center|LOCUS_05150 11538 12179 gene locus_tag LOCUS_05160 gene nadD 11538 12179 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161458274.1 protein_id gnl|my_center|LOCUS_05160 12176 12952 gene locus_tag LOCUS_05170 12176 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 12949 13416 gene locus_tag LOCUS_05180 gene rlmH 12949 13416 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 protein_id gnl|my_center|LOCUS_05180 13482 14096 gene locus_tag LOCUS_05190 13482 14096 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185695.1 protein_id gnl|my_center|LOCUS_05190 14099 15574 gene locus_tag LOCUS_05200 gene rng 14099 15574 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 protein_id gnl|my_center|LOCUS_05200 >Feature sequence029 <1 1068 gene locus_tag LOCUS_05210 <1 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185243.1:F0F1 ATP synthase subunit beta 1078 1494 gene locus_tag LOCUS_05220 1078 1494 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_05220 2394 1825 gene locus_tag LOCUS_05230 2394 1825 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275436.1 protein_id gnl|my_center|LOCUS_05230 3267 2395 gene locus_tag LOCUS_05240 3267 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 3959 3357 gene locus_tag LOCUS_05250 3959 3357 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550955.1 protein_id gnl|my_center|LOCUS_05250 4070 4528 gene locus_tag LOCUS_05260 4070 4528 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814197.1 protein_id gnl|my_center|LOCUS_05260 4530 5621 gene locus_tag LOCUS_05270 4530 5621 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189905.1 protein_id gnl|my_center|LOCUS_05270 5699 6250 gene locus_tag LOCUS_05280 5699 6250 CDS product DUF2946 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142820828.1 protein_id gnl|my_center|LOCUS_05280 7175 6306 gene locus_tag LOCUS_05290 7175 6306 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552489.1 protein_id gnl|my_center|LOCUS_05290 7347 7422 gene locus_tag LOCUS_t00020 7347 7422 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8634 7501 gene locus_tag LOCUS_05300 8634 7501 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808448.1 protein_id gnl|my_center|LOCUS_05300 9975 8836 gene locus_tag LOCUS_05310 9975 8836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 10695 9979 gene locus_tag LOCUS_05320 10695 9979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 11397 10708 gene locus_tag LOCUS_05330 11397 10708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 12433 11402 gene locus_tag LOCUS_05340 12433 11402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 13624 12443 gene locus_tag LOCUS_05350 13624 12443 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532113.1 protein_id gnl|my_center|LOCUS_05350 14576 13647 gene locus_tag LOCUS_05360 14576 13647 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388723.1 protein_id gnl|my_center|LOCUS_05360 15217 14582 gene locus_tag LOCUS_05370 15217 14582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 <15877 15230 gene locus_tag LOCUS_05380 <15877 15230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727162.1:aerobic carbon-monoxide dehydrogenase large subunit >Feature sequence030 <1 771 gene locus_tag LOCUS_05390 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039592.1:YifB family Mg chelatase-like AAA ATPase 3020 954 gene locus_tag LOCUS_05400 3020 954 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335531.1 protein_id gnl|my_center|LOCUS_05400 3349 4221 gene locus_tag LOCUS_05410 3349 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 4896 4615 gene locus_tag LOCUS_05420 4896 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 5417 4929 gene locus_tag LOCUS_05430 5417 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 6600 5578 gene locus_tag LOCUS_05440 6600 5578 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810803.1 protein_id gnl|my_center|LOCUS_05440 7977 7216 gene locus_tag LOCUS_05450 7977 7216 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811645.1 protein_id gnl|my_center|LOCUS_05450 9007 7988 gene locus_tag LOCUS_05460 9007 7988 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038776.1 protein_id gnl|my_center|LOCUS_05460 10609 9092 gene locus_tag LOCUS_05470 10609 9092 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064659.1 protein_id gnl|my_center|LOCUS_05470 11063 10614 gene locus_tag LOCUS_05480 11063 10614 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809022.1 protein_id gnl|my_center|LOCUS_05480 11851 11072 gene locus_tag LOCUS_05490 11851 11072 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038928.1 protein_id gnl|my_center|LOCUS_05490 12614 11844 gene locus_tag LOCUS_05500 12614 11844 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807530.1 protein_id gnl|my_center|LOCUS_05500 13415 12639 gene locus_tag LOCUS_05510 13415 12639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807532.1 protein_id gnl|my_center|LOCUS_05510 14502 13429 gene locus_tag LOCUS_05520 14502 13429 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064657.1 protein_id gnl|my_center|LOCUS_05520 15167 14541 gene locus_tag LOCUS_05530 15167 14541 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223118.1 protein_id gnl|my_center|LOCUS_05530 >Feature sequence031 877 1665 gene locus_tag LOCUS_05540 877 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 1719 3182 gene locus_tag LOCUS_05550 gene ppsR 1719 3182 CDS product transcriptional regulator PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388384.1 protein_id gnl|my_center|LOCUS_05550 3407 4291 gene locus_tag LOCUS_05560 gene chlG 3407 4291 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388385.1 protein_id gnl|my_center|LOCUS_05560 4288 5685 gene locus_tag LOCUS_05570 4288 5685 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388386.1 protein_id gnl|my_center|LOCUS_05570 5708 6913 gene locus_tag LOCUS_05580 5708 6913 CDS product geranylgeranyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720441.1 protein_id gnl|my_center|LOCUS_05580 7642 7334 gene locus_tag LOCUS_05590 7642 7334 CDS product high-potential iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197194.1 protein_id gnl|my_center|LOCUS_05590 8022 8963 gene locus_tag LOCUS_05600 8022 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 9151 8999 gene locus_tag LOCUS_05610 9151 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 9238 10578 gene locus_tag LOCUS_05620 9238 10578 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_05620 11100 10588 gene locus_tag LOCUS_05630 11100 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 11518 11285 gene locus_tag LOCUS_05640 11518 11285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 11883 13613 gene locus_tag LOCUS_05650 11883 13613 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_05650 14112 13726 gene locus_tag LOCUS_05660 14112 13726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 15013 14276 gene locus_tag LOCUS_05670 15013 14276 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484679.1 protein_id gnl|my_center|LOCUS_05670 15078 15488 gene locus_tag LOCUS_05680 15078 15488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 >Feature sequence032 <1 2209 gene locus_tag LOCUS_05690 <1 2209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194125.1:preprotein translocase subunit SecA 2251 3480 gene locus_tag LOCUS_05700 gene argJ 2251 3480 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549958.1 protein_id gnl|my_center|LOCUS_05700 3544 4422 gene locus_tag LOCUS_05710 3544 4422 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 protein_id gnl|my_center|LOCUS_05710 4433 4903 gene locus_tag LOCUS_05720 4433 4903 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527779.1 protein_id gnl|my_center|LOCUS_05720 5942 5271 gene locus_tag LOCUS_05730 5942 5271 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219051.1 protein_id gnl|my_center|LOCUS_05730 7681 5939 gene locus_tag LOCUS_05740 7681 5939 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814636.1 protein_id gnl|my_center|LOCUS_05740 7802 8476 gene locus_tag LOCUS_05750 7802 8476 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194263.1 protein_id gnl|my_center|LOCUS_05750 8518 8970 gene locus_tag LOCUS_05760 8518 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 10154 9018 gene locus_tag LOCUS_05770 gene proB 10154 9018 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 protein_id gnl|my_center|LOCUS_05770 11288 10200 gene locus_tag LOCUS_05780 gene obgE 11288 10200 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_05780 11712 11455 gene locus_tag LOCUS_05790 gene rpmA 11712 11455 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194025.1 protein_id gnl|my_center|LOCUS_05790 12048 11737 gene locus_tag LOCUS_05800 gene rplU 12048 11737 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_05800 12223 13206 gene locus_tag LOCUS_05810 12223 13206 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204136.1 protein_id gnl|my_center|LOCUS_05810 <15226 13262 gene locus_tag LOCUS_05820 <15226 13262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205406.1:YjbH domain-containing protein >Feature sequence033 540 1505 gene locus_tag LOCUS_05830 540 1505 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_05830 1527 2360 gene locus_tag LOCUS_05840 gene metF 1527 2360 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_05840 3304 2381 gene locus_tag LOCUS_05850 gene rlmJ 3304 2381 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538077.1 protein_id gnl|my_center|LOCUS_05850 3542 3970 gene locus_tag LOCUS_05860 gene rplM 3542 3970 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522094.1 protein_id gnl|my_center|LOCUS_05860 3980 4372 gene locus_tag LOCUS_05870 gene rpsI 3980 4372 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814889.1 protein_id gnl|my_center|LOCUS_05870 4578 4955 gene locus_tag LOCUS_05880 gene erpA 4578 4955 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194247.1 protein_id gnl|my_center|LOCUS_05880 6236 5055 gene locus_tag LOCUS_05890 6236 5055 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814881.1 protein_id gnl|my_center|LOCUS_05890 7611 6244 gene locus_tag LOCUS_05900 7611 6244 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814879.1 protein_id gnl|my_center|LOCUS_05900 7798 9030 gene locus_tag LOCUS_05910 gene tyrS 7798 9030 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194043.1 protein_id gnl|my_center|LOCUS_05910 9090 10028 gene locus_tag LOCUS_05920 9090 10028 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167917.1 protein_id gnl|my_center|LOCUS_05920 10025 10513 gene locus_tag LOCUS_05930 gene dtd 10025 10513 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200499.1 protein_id gnl|my_center|LOCUS_05930 10981 10535 gene locus_tag LOCUS_05940 10981 10535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 11967 10978 gene locus_tag LOCUS_05950 11967 10978 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809398.1 protein_id gnl|my_center|LOCUS_05950 12099 12671 gene locus_tag LOCUS_05960 gene ruvA 12099 12671 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814226.1 protein_id gnl|my_center|LOCUS_05960 12710 12970 gene locus_tag LOCUS_05970 12710 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 12967 13329 gene locus_tag LOCUS_05980 12967 13329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 13326 14393 gene locus_tag LOCUS_05990 gene ruvB 13326 14393 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814231.1 protein_id gnl|my_center|LOCUS_05990 >Feature sequence034 1184 510 gene locus_tag LOCUS_06000 1184 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 2455 1184 gene locus_tag LOCUS_06010 2455 1184 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_06010 2818 2489 gene locus_tag LOCUS_06020 2818 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 3188 2955 gene locus_tag LOCUS_06030 3188 2955 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141125.1 protein_id gnl|my_center|LOCUS_06030 3499 3185 gene locus_tag LOCUS_06040 3499 3185 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928694.1 protein_id gnl|my_center|LOCUS_06040 3478 3753 gene locus_tag LOCUS_06050 3478 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 4395 3850 gene locus_tag LOCUS_06060 gene def 4395 3850 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268642.1 protein_id gnl|my_center|LOCUS_06060 6499 4382 gene locus_tag LOCUS_06070 gene ligA 6499 4382 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937986.1 protein_id gnl|my_center|LOCUS_06070 7623 6556 gene locus_tag LOCUS_06080 7623 6556 CDS product cell division protein ZipA C-terminal FtsZ-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535807.1 protein_id gnl|my_center|LOCUS_06080 11156 7620 gene locus_tag LOCUS_06090 gene smc 11156 7620 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114484320.1 protein_id gnl|my_center|LOCUS_06090 11426 11635 gene locus_tag LOCUS_06100 11426 11635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 13444 11639 gene locus_tag LOCUS_06110 13444 11639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 <15106 13571 gene locus_tag LOCUS_06120 <15106 13571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011974376.1:PAS-domain containing protein >Feature sequence035 286 1167 gene locus_tag LOCUS_06130 286 1167 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 protein_id gnl|my_center|LOCUS_06130 1176 2252 gene locus_tag LOCUS_06140 1176 2252 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090655.1 protein_id gnl|my_center|LOCUS_06140 2249 3016 gene locus_tag LOCUS_06150 2249 3016 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090654.1 protein_id gnl|my_center|LOCUS_06150 3020 3796 gene locus_tag LOCUS_06160 3020 3796 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090653.1 protein_id gnl|my_center|LOCUS_06160 3804 5639 gene locus_tag LOCUS_06170 3804 5639 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_06170 5678 6844 gene locus_tag LOCUS_06180 5678 6844 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966119.1 protein_id gnl|my_center|LOCUS_06180 6979 8766 gene locus_tag LOCUS_06190 6979 8766 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974115.1 protein_id gnl|my_center|LOCUS_06190 9122 10429 gene locus_tag LOCUS_06200 9122 10429 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557250.1 protein_id gnl|my_center|LOCUS_06200 10516 11808 gene locus_tag LOCUS_06210 gene gshA 10516 11808 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522914.1 protein_id gnl|my_center|LOCUS_06210 11974 12393 gene locus_tag LOCUS_06220 11974 12393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06220 12400 13842 gene locus_tag LOCUS_06230 12400 13842 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207874.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06230 13851 14813 gene locus_tag LOCUS_06240 gene gshB 13851 14813 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198015.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence036 155 985 gene locus_tag LOCUS_06250 gene fabG 155 985 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143495.1 protein_id gnl|my_center|LOCUS_06250 990 2147 gene locus_tag LOCUS_06260 990 2147 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135174843.1 protein_id gnl|my_center|LOCUS_06260 2144 3199 gene locus_tag LOCUS_06270 2144 3199 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525804.1 protein_id gnl|my_center|LOCUS_06270 3196 3978 gene locus_tag LOCUS_06280 3196 3978 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_06280 3975 5927 gene locus_tag LOCUS_06290 3975 5927 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_06290 5932 6816 gene locus_tag LOCUS_06300 5932 6816 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256971.1 protein_id gnl|my_center|LOCUS_06300 6816 7865 gene locus_tag LOCUS_06310 6816 7865 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812443.1 protein_id gnl|my_center|LOCUS_06310 7906 9138 gene locus_tag LOCUS_06320 7906 9138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 9155 9958 gene locus_tag LOCUS_06330 9155 9958 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227947.1 protein_id gnl|my_center|LOCUS_06330 10037 11545 gene locus_tag LOCUS_06340 10037 11545 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877924.1 protein_id gnl|my_center|LOCUS_06340 12541 11582 gene locus_tag LOCUS_06350 12541 11582 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768207.1 protein_id gnl|my_center|LOCUS_06350 13808 12585 gene locus_tag LOCUS_06360 13808 12585 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_06360 14054 14617 gene locus_tag LOCUS_06370 gene ahpC 14054 14617 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083828.1 protein_id gnl|my_center|LOCUS_06370 >Feature sequence037 137 62 gene locus_tag LOCUS_t00030 137 62 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 436 164 gene locus_tag LOCUS_06380 436 164 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 protein_id gnl|my_center|LOCUS_06380 1779 679 gene locus_tag LOCUS_06390 1779 679 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085700.1 protein_id gnl|my_center|LOCUS_06390 2700 1810 gene locus_tag LOCUS_06400 2700 1810 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387897.1 protein_id gnl|my_center|LOCUS_06400 3263 2700 gene locus_tag LOCUS_06410 gene pgsA 3263 2700 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192722.1 protein_id gnl|my_center|LOCUS_06410 5399 3339 gene locus_tag LOCUS_06420 gene uvrC 5399 3339 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449735.1 protein_id gnl|my_center|LOCUS_06420 5859 5455 gene locus_tag LOCUS_06430 5859 5455 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 protein_id gnl|my_center|LOCUS_06430 6083 5856 gene locus_tag LOCUS_06440 6083 5856 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923260.1 protein_id gnl|my_center|LOCUS_06440 6153 7298 gene locus_tag LOCUS_06450 gene earP 6153 7298 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039402.1 protein_id gnl|my_center|LOCUS_06450 7302 7904 gene locus_tag LOCUS_06460 gene efp 7302 7904 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810194.1 protein_id gnl|my_center|LOCUS_06460 7972 8850 gene locus_tag LOCUS_06470 7972 8850 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706015.1 protein_id gnl|my_center|LOCUS_06470 8872 9759 gene locus_tag LOCUS_06480 8872 9759 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528481.1 protein_id gnl|my_center|LOCUS_06480 10967 9747 gene locus_tag LOCUS_06490 10967 9747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 12492 10957 gene locus_tag LOCUS_06500 gene rmuC 12492 10957 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193862.1 protein_id gnl|my_center|LOCUS_06500 13549 12566 gene locus_tag LOCUS_06510 13549 12566 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203830.1 protein_id gnl|my_center|LOCUS_06510 <14733 13570 gene locus_tag LOCUS_06520 <14733 13570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193636.1:sodium:proton antiporter >Feature sequence038 110 895 gene locus_tag LOCUS_06530 110 895 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531128.1 protein_id gnl|my_center|LOCUS_06530 944 1933 gene locus_tag LOCUS_06540 944 1933 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082923.1 protein_id gnl|my_center|LOCUS_06540 3180 1975 gene locus_tag LOCUS_06550 3180 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 5716 3245 gene locus_tag LOCUS_06560 5716 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 8206 6212 gene locus_tag LOCUS_06570 gene acs 8206 6212 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188376.1 protein_id gnl|my_center|LOCUS_06570 8422 9066 gene locus_tag LOCUS_06580 8422 9066 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930554.1 protein_id gnl|my_center|LOCUS_06580 10481 9072 gene locus_tag LOCUS_06590 gene fumC 10481 9072 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707066.1 protein_id gnl|my_center|LOCUS_06590 10666 11739 gene locus_tag LOCUS_06600 10666 11739 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064004.1 protein_id gnl|my_center|LOCUS_06600 11760 12698 gene locus_tag LOCUS_06610 11760 12698 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480227.1 protein_id gnl|my_center|LOCUS_06610 13761 12790 gene locus_tag LOCUS_06620 13761 12790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 <14515 13796 gene locus_tag LOCUS_06630 <14515 13796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090292.1:tripartite tricarboxylate transporter substrate binding protein >Feature sequence039 1194 979 gene locus_tag LOCUS_06640 1194 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 1470 2018 gene locus_tag LOCUS_06650 gene kefF 1470 2018 CDS product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600737.1 protein_id gnl|my_center|LOCUS_06650 2015 3823 gene locus_tag LOCUS_06660 gene kefC 2015 3823 CDS product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368295.1 protein_id gnl|my_center|LOCUS_06660 4227 3892 gene locus_tag LOCUS_06670 4227 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 4610 5728 gene locus_tag LOCUS_06680 4610 5728 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085774.1 protein_id gnl|my_center|LOCUS_06680 6749 5808 gene locus_tag LOCUS_06690 6749 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 7944 6985 gene locus_tag LOCUS_06700 7944 6985 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072824.1 protein_id gnl|my_center|LOCUS_06700 8126 9370 gene locus_tag LOCUS_06710 8126 9370 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028589.1 protein_id gnl|my_center|LOCUS_06710 9367 10284 gene locus_tag LOCUS_06720 9367 10284 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 protein_id gnl|my_center|LOCUS_06720 10288 11130 gene locus_tag LOCUS_06730 10288 11130 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227021.1 protein_id gnl|my_center|LOCUS_06730 11123 12466 gene locus_tag LOCUS_06740 11123 12466 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970270.1 protein_id gnl|my_center|LOCUS_06740 12471 13547 gene locus_tag LOCUS_06750 12471 13547 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097218.1 protein_id gnl|my_center|LOCUS_06750 >Feature sequence040 2566 689 gene locus_tag LOCUS_06760 gene recQ 2566 689 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198363.1 protein_id gnl|my_center|LOCUS_06760 2758 3792 gene locus_tag LOCUS_06770 2758 3792 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204527.1 protein_id gnl|my_center|LOCUS_06770 3867 7346 gene locus_tag LOCUS_06780 3867 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 7409 7708 gene locus_tag LOCUS_06790 7409 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 7907 10711 gene locus_tag LOCUS_06800 gene metH 7907 10711 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197743.1 protein_id gnl|my_center|LOCUS_06800 10839 11177 gene locus_tag LOCUS_06810 10839 11177 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943034.1 protein_id gnl|my_center|LOCUS_06810 11167 12453 gene locus_tag LOCUS_06820 11167 12453 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533388.1 protein_id gnl|my_center|LOCUS_06820 12694 12536 gene locus_tag LOCUS_06830 12694 12536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 13100 12756 gene locus_tag LOCUS_06840 13100 12756 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176929198.1 protein_id gnl|my_center|LOCUS_06840 13669 13421 gene locus_tag LOCUS_06850 13669 13421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06850 >Feature sequence041 891 1 gene locus_tag LOCUS_06860 891 1 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087048.1 protein_id gnl|my_center|LOCUS_06860 1481 1185 gene locus_tag LOCUS_06870 1481 1185 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389060.1 protein_id gnl|my_center|LOCUS_06870 1862 1485 gene locus_tag LOCUS_06880 1862 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 3199 1961 gene locus_tag LOCUS_06890 3199 1961 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099096086.1 protein_id gnl|my_center|LOCUS_06890 3983 3207 gene locus_tag LOCUS_06900 3983 3207 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448626.1 protein_id gnl|my_center|LOCUS_06900 5218 4028 gene locus_tag LOCUS_06910 5218 4028 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063638.1 protein_id gnl|my_center|LOCUS_06910 5638 5222 gene locus_tag LOCUS_06920 5638 5222 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812491.1 protein_id gnl|my_center|LOCUS_06920 6641 5655 gene locus_tag LOCUS_06930 6641 5655 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063640.1 protein_id gnl|my_center|LOCUS_06930 7819 6662 gene locus_tag LOCUS_06940 7819 6662 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450234.1 protein_id gnl|my_center|LOCUS_06940 9077 7869 gene locus_tag LOCUS_06950 9077 7869 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099096086.1 protein_id gnl|my_center|LOCUS_06950 10917 9109 gene locus_tag LOCUS_06960 10917 9109 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808654.1 protein_id gnl|my_center|LOCUS_06960 11913 10942 gene locus_tag LOCUS_06970 11913 10942 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808868.1 protein_id gnl|my_center|LOCUS_06970 12025 12936 gene locus_tag LOCUS_06980 12025 12936 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063959.1 protein_id gnl|my_center|LOCUS_06980 13152 13970 gene locus_tag LOCUS_06990 13152 13970 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811489.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence042 <1 1068 gene locus_tag LOCUS_07000 <1 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522370.1:PQQ-dependent sugar dehydrogenase 1068 1667 gene locus_tag LOCUS_07010 1068 1667 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083419.1 protein_id gnl|my_center|LOCUS_07010 1897 2166 gene locus_tag LOCUS_07020 1897 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 2771 2163 gene locus_tag LOCUS_07030 2771 2163 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186100.1 protein_id gnl|my_center|LOCUS_07030 2659 2880 gene locus_tag LOCUS_07040 2659 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 3184 2870 gene locus_tag LOCUS_07050 3184 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 3684 3208 gene locus_tag LOCUS_07060 3684 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 3963 4322 gene locus_tag LOCUS_07070 3963 4322 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497212.1 protein_id gnl|my_center|LOCUS_07070 4319 4606 gene locus_tag LOCUS_07080 4319 4606 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391158.1 protein_id gnl|my_center|LOCUS_07080 9457 4718 gene locus_tag LOCUS_07090 9457 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 10061 9977 gene locus_tag LOCUS_t00040 10061 9977 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10102 11004 gene locus_tag LOCUS_07100 gene cysM 10102 11004 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550116.1 protein_id gnl|my_center|LOCUS_07100 11016 11570 gene locus_tag LOCUS_07110 11016 11570 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193543.1 protein_id gnl|my_center|LOCUS_07110 11567 11797 gene locus_tag LOCUS_07120 11567 11797 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_07120 12722 11811 gene locus_tag LOCUS_07130 gene galU 12722 11811 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_07130 <14115 12841 gene locus_tag LOCUS_07140 <14115 12841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191922.1:valine--tRNA ligase >Feature sequence043 <1 1396 gene locus_tag LOCUS_07150 <1 1396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928531.1:endonuclease/exonuclease/phosphatase family protein 1684 3369 gene locus_tag LOCUS_07160 1684 3369 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 protein_id gnl|my_center|LOCUS_07160 4653 3487 gene locus_tag LOCUS_07170 4653 3487 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044390643.1 protein_id gnl|my_center|LOCUS_07170 4747 6357 gene locus_tag LOCUS_07180 4747 6357 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_07180 7094 6783 gene locus_tag LOCUS_07190 7094 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 8031 7108 gene locus_tag LOCUS_07200 gene argF 8031 7108 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064107.1 protein_id gnl|my_center|LOCUS_07200 9248 8028 gene locus_tag LOCUS_07210 9248 8028 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039570.1 protein_id gnl|my_center|LOCUS_07210 9822 9583 gene locus_tag LOCUS_07220 9822 9583 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770970.1 protein_id gnl|my_center|LOCUS_07220 10055 10378 gene locus_tag LOCUS_07230 10055 10378 CDS product DUF3579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189028.1 protein_id gnl|my_center|LOCUS_07230 10845 10540 gene locus_tag LOCUS_07240 gene rpsT 10845 10540 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189743.1 protein_id gnl|my_center|LOCUS_07240 10950 12515 gene locus_tag LOCUS_07250 gene murJ 10950 12515 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039578.1 protein_id gnl|my_center|LOCUS_07250 12596 13444 gene locus_tag LOCUS_07260 12596 13444 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522631.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence044 3535 1430 gene locus_tag LOCUS_07270 gene uvrB 3535 1430 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199587.1 protein_id gnl|my_center|LOCUS_07270 3674 4870 gene locus_tag LOCUS_07280 3674 4870 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198124.1 protein_id gnl|my_center|LOCUS_07280 5788 4937 gene locus_tag LOCUS_07290 gene ygiD 5788 4937 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324092.1 protein_id gnl|my_center|LOCUS_07290 6051 7637 gene locus_tag LOCUS_07300 gene phaZ 6051 7637 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204945.1 protein_id gnl|my_center|LOCUS_07300 7712 8383 gene locus_tag LOCUS_07310 gene rsxB 7712 8383 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926953.1 protein_id gnl|my_center|LOCUS_07310 8911 8429 gene locus_tag LOCUS_07320 8911 8429 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247259.1 protein_id gnl|my_center|LOCUS_07320 9225 8908 gene locus_tag LOCUS_07330 9225 8908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 11257 9209 gene locus_tag LOCUS_07340 11257 9209 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_07340 12920 11388 gene locus_tag LOCUS_07350 12920 11388 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_07350 13854 12970 gene locus_tag LOCUS_07360 13854 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence045 1336 41 gene locus_tag LOCUS_07370 1336 41 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187394984.1 protein_id gnl|my_center|LOCUS_07370 1671 1336 gene locus_tag LOCUS_07380 1671 1336 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925868.1 protein_id gnl|my_center|LOCUS_07380 1866 1684 gene locus_tag LOCUS_07390 1866 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 2764 1946 gene locus_tag LOCUS_07400 gene hutG 2764 1946 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193651.1 protein_id gnl|my_center|LOCUS_07400 4155 2761 gene locus_tag LOCUS_07410 4155 2761 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527395.1 protein_id gnl|my_center|LOCUS_07410 5426 4152 gene locus_tag LOCUS_07420 gene hutI 5426 4152 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524690.1 protein_id gnl|my_center|LOCUS_07420 6010 5474 gene locus_tag LOCUS_07430 6010 5474 CDS product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169060.1 protein_id gnl|my_center|LOCUS_07430 7789 6092 gene locus_tag LOCUS_07440 7789 6092 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174873167.1 protein_id gnl|my_center|LOCUS_07440 8526 7822 gene locus_tag LOCUS_07450 8526 7822 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393371.1 protein_id gnl|my_center|LOCUS_07450 9337 8519 gene locus_tag LOCUS_07460 9337 8519 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142277.1 protein_id gnl|my_center|LOCUS_07460 10194 9334 gene locus_tag LOCUS_07470 10194 9334 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870137.1 protein_id gnl|my_center|LOCUS_07470 11074 10211 gene locus_tag LOCUS_07480 11074 10211 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870138.1 protein_id gnl|my_center|LOCUS_07480 12244 11090 gene locus_tag LOCUS_07490 12244 11090 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870134.1 protein_id gnl|my_center|LOCUS_07490 12498 13154 gene locus_tag LOCUS_07500 gene hutC 12498 13154 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193766.1 protein_id gnl|my_center|LOCUS_07500 <13850 13233 gene locus_tag LOCUS_07510 <13850 13233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533089.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence046 3046 1154 gene locus_tag LOCUS_07520 gene dxs 3046 1154 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813105.1 protein_id gnl|my_center|LOCUS_07520 3938 3081 gene locus_tag LOCUS_07530 3938 3081 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190235.1 protein_id gnl|my_center|LOCUS_07530 4347 4051 gene locus_tag LOCUS_07540 4347 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 4563 5681 gene locus_tag LOCUS_07550 4563 5681 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 protein_id gnl|my_center|LOCUS_07550 5732 6598 gene locus_tag LOCUS_07560 5732 6598 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813139.1 protein_id gnl|my_center|LOCUS_07560 6617 7513 gene locus_tag LOCUS_07570 6617 7513 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820280.1 protein_id gnl|my_center|LOCUS_07570 8645 7809 gene locus_tag LOCUS_07580 8645 7809 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_07580 9707 8799 gene locus_tag LOCUS_07590 9707 8799 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446869.1 protein_id gnl|my_center|LOCUS_07590 12616 9824 gene locus_tag LOCUS_07600 gene polA 12616 9824 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540200.1 protein_id gnl|my_center|LOCUS_07600 12896 13204 gene locus_tag LOCUS_07610 12896 13204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 >Feature sequence047 76 543 gene locus_tag LOCUS_07620 76 543 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270458.1 protein_id gnl|my_center|LOCUS_07620 550 1335 gene locus_tag LOCUS_07630 550 1335 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_07630 2880 1507 gene locus_tag LOCUS_07640 2880 1507 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545534.1 protein_id gnl|my_center|LOCUS_07640 3116 2922 gene locus_tag LOCUS_07650 3116 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 3516 4748 gene locus_tag LOCUS_07660 3516 4748 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_07660 4785 5657 gene locus_tag LOCUS_07670 4785 5657 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 protein_id gnl|my_center|LOCUS_07670 5678 7468 gene locus_tag LOCUS_07680 5678 7468 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247367.1 protein_id gnl|my_center|LOCUS_07680 7470 8180 gene locus_tag LOCUS_07690 7470 8180 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_07690 8342 8581 gene locus_tag LOCUS_07700 8342 8581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 9821 8745 gene locus_tag LOCUS_07710 9821 8745 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966058.1 protein_id gnl|my_center|LOCUS_07710 10804 9818 gene locus_tag LOCUS_07720 10804 9818 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810803.1 protein_id gnl|my_center|LOCUS_07720 12012 10801 gene locus_tag LOCUS_07730 12012 10801 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930497.1 protein_id gnl|my_center|LOCUS_07730 12964 13140 gene locus_tag LOCUS_07740 12964 13140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 13156 13551 gene locus_tag LOCUS_07750 gene hicB 13156 13551 CDS product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077627724.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence048 2588 705 gene locus_tag LOCUS_07760 gene htpG 2588 705 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208203.1 protein_id gnl|my_center|LOCUS_07760 2704 3315 gene locus_tag LOCUS_07770 2704 3315 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976134.1 protein_id gnl|my_center|LOCUS_07770 3312 4226 gene locus_tag LOCUS_07780 3312 4226 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064436.1 protein_id gnl|my_center|LOCUS_07780 4223 4573 gene locus_tag LOCUS_07790 4223 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 4577 5476 gene locus_tag LOCUS_07800 4577 5476 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762776.1 protein_id gnl|my_center|LOCUS_07800 5637 6305 gene locus_tag LOCUS_07810 5637 6305 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_07810 7468 6659 gene locus_tag LOCUS_07820 7468 6659 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 protein_id gnl|my_center|LOCUS_07820 9137 7509 gene locus_tag LOCUS_07830 9137 7509 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462181.1 protein_id gnl|my_center|LOCUS_07830 9252 10109 gene locus_tag LOCUS_07840 9252 10109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 10245 12437 gene locus_tag LOCUS_07850 10245 12437 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839960.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence049 1319 1053 gene locus_tag LOCUS_07860 gene rpsO 1319 1053 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185828.1 protein_id gnl|my_center|LOCUS_07860 1624 2115 gene locus_tag LOCUS_07870 1624 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 3405 2221 gene locus_tag LOCUS_07880 3405 2221 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968655.1 protein_id gnl|my_center|LOCUS_07880 4707 3415 gene locus_tag LOCUS_07890 4707 3415 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196429.1 protein_id gnl|my_center|LOCUS_07890 5760 4726 gene locus_tag LOCUS_07900 gene tsaD 5760 4726 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811013.1 protein_id gnl|my_center|LOCUS_07900 7463 5868 gene locus_tag LOCUS_07910 7463 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 8068 7505 gene locus_tag LOCUS_07920 8068 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 8524 9450 gene locus_tag LOCUS_07930 gene ybiB 8524 9450 CDS product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522867.1 protein_id gnl|my_center|LOCUS_07930 9447 10226 gene locus_tag LOCUS_07940 gene cobA 9447 10226 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087845.1 protein_id gnl|my_center|LOCUS_07940 10271 11494 gene locus_tag LOCUS_07950 10271 11494 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190760.1 protein_id gnl|my_center|LOCUS_07950 13181 11499 gene locus_tag LOCUS_07960 13181 11499 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence050 438 16 gene locus_tag LOCUS_07970 gene hadB 438 16 CDS product (3R)-hydroxyacyl-ACP dehydratase subunit HadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903106.1 protein_id gnl|my_center|LOCUS_07970 878 438 gene locus_tag LOCUS_07980 878 438 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086612.1 protein_id gnl|my_center|LOCUS_07980 2065 875 gene locus_tag LOCUS_07990 2065 875 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 protein_id gnl|my_center|LOCUS_07990 2240 3199 gene locus_tag LOCUS_08000 2240 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 3264 3878 gene locus_tag LOCUS_08010 3264 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 4117 4365 gene locus_tag LOCUS_08020 4117 4365 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766946.1 protein_id gnl|my_center|LOCUS_08020 4362 4796 gene locus_tag LOCUS_08030 4362 4796 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_08030 5951 4896 gene locus_tag LOCUS_08040 5951 4896 CDS product DUF4325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682079.1 protein_id gnl|my_center|LOCUS_08040 7095 6163 gene locus_tag LOCUS_08050 7095 6163 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082947.1 protein_id gnl|my_center|LOCUS_08050 7206 8255 gene locus_tag LOCUS_08060 7206 8255 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624176.1 protein_id gnl|my_center|LOCUS_08060 8264 9271 gene locus_tag LOCUS_08070 8264 9271 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810803.1 protein_id gnl|my_center|LOCUS_08070 10058 9453 gene locus_tag LOCUS_08080 10058 9453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 10183 12801 gene locus_tag LOCUS_08090 gene clpB 10183 12801 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818587.1 protein_id gnl|my_center|LOCUS_08090 >Feature sequence051 760 107 gene locus_tag LOCUS_08100 760 107 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194517.1 protein_id gnl|my_center|LOCUS_08100 1458 757 gene locus_tag LOCUS_08110 1458 757 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552494.1 protein_id gnl|my_center|LOCUS_08110 1606 2442 gene locus_tag LOCUS_08120 1606 2442 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533811.1 protein_id gnl|my_center|LOCUS_08120 2525 2959 gene locus_tag LOCUS_08130 2525 2959 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553866.1 protein_id gnl|my_center|LOCUS_08130 4019 3360 gene locus_tag LOCUS_08140 4019 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 4138 4980 gene locus_tag LOCUS_08150 4138 4980 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186676.1 protein_id gnl|my_center|LOCUS_08150 4991 5221 gene locus_tag LOCUS_08160 4991 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 5229 5855 gene locus_tag LOCUS_08170 5229 5855 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225722.1 protein_id gnl|my_center|LOCUS_08170 5849 7054 gene locus_tag LOCUS_08180 5849 7054 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 protein_id gnl|my_center|LOCUS_08180 7070 8947 gene locus_tag LOCUS_08190 7070 8947 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204930.1 protein_id gnl|my_center|LOCUS_08190 8947 12765 gene locus_tag LOCUS_08200 8947 12765 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204931.1 protein_id gnl|my_center|LOCUS_08200 >Feature sequence052 802 386 gene locus_tag LOCUS_08210 802 386 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526443.1 protein_id gnl|my_center|LOCUS_08210 3369 826 gene locus_tag LOCUS_08220 3369 826 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_08220 4425 3577 gene locus_tag LOCUS_08230 4425 3577 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074122.1 protein_id gnl|my_center|LOCUS_08230 7474 4481 gene locus_tag LOCUS_08240 gene fdhF 7474 4481 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_08240 9330 7471 gene locus_tag LOCUS_08250 9330 7471 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_08250 10567 9500 gene locus_tag LOCUS_08260 10567 9500 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_08260 11640 10696 gene locus_tag LOCUS_08270 11640 10696 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338699.1 protein_id gnl|my_center|LOCUS_08270 12755 11640 gene locus_tag LOCUS_08280 gene apbC 12755 11640 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567450.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence053 1184 453 gene locus_tag LOCUS_08290 1184 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 2346 1351 gene locus_tag LOCUS_08300 2346 1351 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194782.1 protein_id gnl|my_center|LOCUS_08300 2424 3467 gene locus_tag LOCUS_08310 2424 3467 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_08310 3496 4473 gene locus_tag LOCUS_08320 3496 4473 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931671.1 protein_id gnl|my_center|LOCUS_08320 5277 4561 gene locus_tag LOCUS_08330 5277 4561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204918.1 protein_id gnl|my_center|LOCUS_08330 6049 5279 gene locus_tag LOCUS_08340 6049 5279 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194783.1 protein_id gnl|my_center|LOCUS_08340 7143 6046 gene locus_tag LOCUS_08350 7143 6046 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186310.1 protein_id gnl|my_center|LOCUS_08350 8085 7156 gene locus_tag LOCUS_08360 8085 7156 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526290.1 protein_id gnl|my_center|LOCUS_08360 9616 8300 gene locus_tag LOCUS_08370 9616 8300 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185515.1 protein_id gnl|my_center|LOCUS_08370 10342 9638 gene locus_tag LOCUS_08380 gene lolA 10342 9638 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222831.1 protein_id gnl|my_center|LOCUS_08380 12660 10339 gene locus_tag LOCUS_08390 12660 10339 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186104.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence054 1116 199 gene locus_tag LOCUS_08400 1116 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1794 2780 gene locus_tag LOCUS_08410 1794 2780 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969365.1 protein_id gnl|my_center|LOCUS_08410 4357 3095 gene locus_tag LOCUS_08420 4357 3095 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039905.1 protein_id gnl|my_center|LOCUS_08420 5795 4611 gene locus_tag LOCUS_08430 5795 4611 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187422.1 protein_id gnl|my_center|LOCUS_08430 6793 5795 gene locus_tag LOCUS_08440 6793 5795 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811475.1 protein_id gnl|my_center|LOCUS_08440 6925 7824 gene locus_tag LOCUS_08450 6925 7824 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114165.1 protein_id gnl|my_center|LOCUS_08450 7949 8476 gene locus_tag LOCUS_08460 7949 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 8631 9347 gene locus_tag LOCUS_08470 8631 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 10153 9377 gene locus_tag LOCUS_08480 gene mpaA 10153 9377 CDS product murein tripeptide amidase MpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705658.1 protein_id gnl|my_center|LOCUS_08480 12455 10959 gene locus_tag LOCUS_08490 12455 10959 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence055 185 937 gene locus_tag LOCUS_08500 185 937 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815182.1 protein_id gnl|my_center|LOCUS_08500 988 2253 gene locus_tag LOCUS_08510 988 2253 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538457.1 protein_id gnl|my_center|LOCUS_08510 3516 2284 gene locus_tag LOCUS_08520 3516 2284 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 protein_id gnl|my_center|LOCUS_08520 3571 4203 gene locus_tag LOCUS_08530 3571 4203 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722188.1 protein_id gnl|my_center|LOCUS_08530 4232 4987 gene locus_tag LOCUS_08540 4232 4987 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188660.1 protein_id gnl|my_center|LOCUS_08540 5003 5917 gene locus_tag LOCUS_08550 5003 5917 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103962.1 protein_id gnl|my_center|LOCUS_08550 6163 6429 gene locus_tag LOCUS_08560 6163 6429 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528289.1 protein_id gnl|my_center|LOCUS_08560 6426 6617 gene locus_tag LOCUS_08570 6426 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08570 6569 6832 gene locus_tag LOCUS_08580 6569 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 7358 6921 gene locus_tag LOCUS_08590 7358 6921 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120966.1 protein_id gnl|my_center|LOCUS_08590 7651 7370 gene locus_tag LOCUS_08600 7651 7370 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_08600 7813 8364 gene locus_tag LOCUS_08610 7813 8364 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197759.1 protein_id gnl|my_center|LOCUS_08610 9324 8404 gene locus_tag LOCUS_08620 9324 8404 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_08620 9609 11699 gene locus_tag LOCUS_08630 9609 11699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 11699 12001 gene locus_tag LOCUS_08640 11699 12001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 12478 12074 gene locus_tag LOCUS_08650 12478 12074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 >Feature sequence056 <1 702 gene locus_tag LOCUS_08660 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191802.1:ABC transporter permease 715 1515 gene locus_tag LOCUS_08670 715 1515 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316181.1 protein_id gnl|my_center|LOCUS_08670 1578 2612 gene locus_tag LOCUS_08680 1578 2612 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269175.1 protein_id gnl|my_center|LOCUS_08680 2615 3442 gene locus_tag LOCUS_08690 2615 3442 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929635.1 protein_id gnl|my_center|LOCUS_08690 3622 4017 gene locus_tag LOCUS_08700 3622 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 5925 4945 gene locus_tag LOCUS_08710 5925 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 7676 5943 gene locus_tag LOCUS_08720 gene soxB 7676 5943 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 protein_id gnl|my_center|LOCUS_08720 8380 7724 gene locus_tag LOCUS_08730 gene soxX 8380 7724 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228665.1 protein_id gnl|my_center|LOCUS_08730 9199 8393 gene locus_tag LOCUS_08740 9199 8393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 9549 9238 gene locus_tag LOCUS_08750 gene soxZ 9549 9238 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932697.1 protein_id gnl|my_center|LOCUS_08750 10059 9601 gene locus_tag LOCUS_08760 gene soxY 10059 9601 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083833.1 protein_id gnl|my_center|LOCUS_08760 11169 10093 gene locus_tag LOCUS_08770 11169 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 12580 11153 gene locus_tag LOCUS_08780 gene soxC 12580 11153 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence057 1637 60 gene locus_tag LOCUS_08790 gene hutH 1637 60 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389056.1 protein_id gnl|my_center|LOCUS_08790 2695 1634 gene locus_tag LOCUS_08800 2695 1634 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530418.1 protein_id gnl|my_center|LOCUS_08800 3466 2801 gene locus_tag LOCUS_08810 gene hutC 3466 2801 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161420743.1 protein_id gnl|my_center|LOCUS_08810 3589 4428 gene locus_tag LOCUS_08820 3589 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 4425 5468 gene locus_tag LOCUS_08830 4425 5468 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208790.1 protein_id gnl|my_center|LOCUS_08830 5577 6731 gene locus_tag LOCUS_08840 gene rodA 5577 6731 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189171.1 protein_id gnl|my_center|LOCUS_08840 6792 8330 gene locus_tag LOCUS_08850 gene tldD 6792 8330 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931196.1 protein_id gnl|my_center|LOCUS_08850 9049 8393 gene locus_tag LOCUS_08860 9049 8393 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085971.1 protein_id gnl|my_center|LOCUS_08860 9864 9046 gene locus_tag LOCUS_08870 9864 9046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973920.1 protein_id gnl|my_center|LOCUS_08870 10868 9861 gene locus_tag LOCUS_08880 10868 9861 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391055.1 protein_id gnl|my_center|LOCUS_08880 11769 10873 gene locus_tag LOCUS_08890 11769 10873 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085968.1 protein_id gnl|my_center|LOCUS_08890 12390 11917 gene locus_tag LOCUS_08900 12390 11917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 >Feature sequence058 1500 268 gene locus_tag LOCUS_08910 gene gspF 1500 268 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196821.1 protein_id gnl|my_center|LOCUS_08910 2906 1509 gene locus_tag LOCUS_08920 gene gspE 2906 1509 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196824.1 protein_id gnl|my_center|LOCUS_08920 5073 2911 gene locus_tag LOCUS_08930 gene gspD 5073 2911 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213605796.1 protein_id gnl|my_center|LOCUS_08930 5895 5077 gene locus_tag LOCUS_08940 5895 5077 CDS product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525775.1 protein_id gnl|my_center|LOCUS_08940 6371 5892 gene locus_tag LOCUS_08950 6371 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 7549 6368 gene locus_tag LOCUS_08960 7549 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 8209 7721 gene locus_tag LOCUS_08970 8209 7721 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689852.1 protein_id gnl|my_center|LOCUS_08970 9048 8227 gene locus_tag LOCUS_08980 gene thyA 9048 8227 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948554.1 protein_id gnl|my_center|LOCUS_08980 10607 9174 gene locus_tag LOCUS_08990 10607 9174 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191226.1 protein_id gnl|my_center|LOCUS_08990 10983 10615 gene locus_tag LOCUS_09000 10983 10615 CDS product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222851.1 protein_id gnl|my_center|LOCUS_09000 11116 12342 gene locus_tag LOCUS_09010 11116 12342 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812701.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence059 1193 2095 gene locus_tag LOCUS_09020 1193 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 2092 2661 gene locus_tag LOCUS_09030 2092 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 2658 3701 gene locus_tag LOCUS_09040 2658 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 3923 5245 gene locus_tag LOCUS_09050 3923 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 5390 5962 gene locus_tag LOCUS_09060 5390 5962 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 protein_id gnl|my_center|LOCUS_09060 5971 7140 gene locus_tag LOCUS_09070 gene aroB 5971 7140 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196751.1 protein_id gnl|my_center|LOCUS_09070 7153 8292 gene locus_tag LOCUS_09080 7153 8292 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806949.1 protein_id gnl|my_center|LOCUS_09080 8289 9494 gene locus_tag LOCUS_09090 8289 9494 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853227.1 protein_id gnl|my_center|LOCUS_09090 10569 9595 gene locus_tag LOCUS_09100 10569 9595 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064939.1 protein_id gnl|my_center|LOCUS_09100 10715 11407 gene locus_tag LOCUS_09110 10715 11407 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196743.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence060 774 103 gene locus_tag LOCUS_09120 gene rpiA 774 103 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192848.1 protein_id gnl|my_center|LOCUS_09120 836 1912 gene locus_tag LOCUS_09130 836 1912 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931480.1 protein_id gnl|my_center|LOCUS_09130 1905 2501 gene locus_tag LOCUS_09140 1905 2501 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207859.1 protein_id gnl|my_center|LOCUS_09140 3672 2536 gene locus_tag LOCUS_09150 3672 2536 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931373.1 protein_id gnl|my_center|LOCUS_09150 4532 3693 gene locus_tag LOCUS_09160 4532 3693 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820328.1 protein_id gnl|my_center|LOCUS_09160 5581 5072 gene locus_tag LOCUS_09170 gene ispF 5581 5072 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191369.1 protein_id gnl|my_center|LOCUS_09170 6387 5578 gene locus_tag LOCUS_09180 gene ispD 6387 5578 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051360364.1 protein_id gnl|my_center|LOCUS_09180 6507 9983 gene locus_tag LOCUS_09190 gene mfd 6507 9983 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193121.1 protein_id gnl|my_center|LOCUS_09190 10657 9989 gene locus_tag LOCUS_09200 10657 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 10859 11578 gene locus_tag LOCUS_09210 gene serB 10859 11578 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 protein_id gnl|my_center|LOCUS_09210 11712 12167 gene locus_tag LOCUS_09220 gene trxC 11712 12167 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence061 1111 683 gene locus_tag LOCUS_09230 1111 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1734 2075 gene locus_tag LOCUS_09240 1734 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 2072 2296 gene locus_tag LOCUS_09250 2072 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 2909 4261 gene locus_tag LOCUS_09260 2909 4261 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660385.1 protein_id gnl|my_center|LOCUS_09260 5806 4367 gene locus_tag LOCUS_09270 5806 4367 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040522.1 protein_id gnl|my_center|LOCUS_09270 6415 5810 gene locus_tag LOCUS_09280 6415 5810 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029628.1 protein_id gnl|my_center|LOCUS_09280 7510 6542 gene locus_tag LOCUS_09290 7510 6542 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065172.1 protein_id gnl|my_center|LOCUS_09290 9086 7533 gene locus_tag LOCUS_09300 9086 7533 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_09300 10016 9138 gene locus_tag LOCUS_09310 10016 9138 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807825.1 protein_id gnl|my_center|LOCUS_09310 10355 10948 gene locus_tag LOCUS_09320 10355 10948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 11117 11932 gene locus_tag LOCUS_09330 11117 11932 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114410.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence062 74 1126 gene locus_tag LOCUS_09340 74 1126 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_09340 1138 1653 gene locus_tag LOCUS_09350 1138 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1707 2915 gene locus_tag LOCUS_09360 1707 2915 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089219.1 protein_id gnl|my_center|LOCUS_09360 3202 4212 gene locus_tag LOCUS_09370 gene hemB 3202 4212 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806939.1 protein_id gnl|my_center|LOCUS_09370 4229 5338 gene locus_tag LOCUS_09380 4229 5338 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208248.1 protein_id gnl|my_center|LOCUS_09380 6089 5406 gene locus_tag LOCUS_09390 6089 5406 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_09390 6732 6130 gene locus_tag LOCUS_09400 6732 6130 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809123.1 protein_id gnl|my_center|LOCUS_09400 6950 8665 gene locus_tag LOCUS_09410 6950 8665 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393021.1 protein_id gnl|my_center|LOCUS_09410 8980 9723 gene locus_tag LOCUS_09420 8980 9723 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994212.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence063 1006 20 gene locus_tag LOCUS_09430 gene lepB 1006 20 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193513.1 protein_id gnl|my_center|LOCUS_09430 2814 1003 gene locus_tag LOCUS_09440 gene lepA 2814 1003 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193305.1 protein_id gnl|my_center|LOCUS_09440 4784 3375 gene locus_tag LOCUS_09450 4784 3375 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192020.1 protein_id gnl|my_center|LOCUS_09450 5467 5078 gene locus_tag LOCUS_09460 5467 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 6816 5572 gene locus_tag LOCUS_09470 gene fabF 6816 5572 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028603047.1 protein_id gnl|my_center|LOCUS_09470 7189 6950 gene locus_tag LOCUS_09480 gene acpP 7189 6950 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197638.1 protein_id gnl|my_center|LOCUS_09480 8048 7308 gene locus_tag LOCUS_09490 gene fabG 8048 7308 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065092.1 protein_id gnl|my_center|LOCUS_09490 9009 8053 gene locus_tag LOCUS_09500 gene fabD 9009 8053 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193828.1 protein_id gnl|my_center|LOCUS_09500 10030 9053 gene locus_tag LOCUS_09510 10030 9053 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524613.1 protein_id gnl|my_center|LOCUS_09510 11152 10076 gene locus_tag LOCUS_09520 gene plsX 11152 10076 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_09520 11420 11238 gene locus_tag LOCUS_09530 gene rpmF 11420 11238 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813827.1 protein_id gnl|my_center|LOCUS_09530 <12107 11584 gene locus_tag LOCUS_09540 <12107 11584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091144.1:DUF177 domain-containing protein >Feature sequence064 2051 876 gene locus_tag LOCUS_09550 2051 876 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526026.1 protein_id gnl|my_center|LOCUS_09550 2722 2069 gene locus_tag LOCUS_09560 2722 2069 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553808.1 protein_id gnl|my_center|LOCUS_09560 3434 2781 gene locus_tag LOCUS_09570 3434 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 3582 3800 gene locus_tag LOCUS_09580 3582 3800 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200193.1 protein_id gnl|my_center|LOCUS_09580 4793 3912 gene locus_tag LOCUS_09590 4793 3912 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197994.1 protein_id gnl|my_center|LOCUS_09590 5086 4880 gene locus_tag LOCUS_09600 5086 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 5718 5089 gene locus_tag LOCUS_09610 5718 5089 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185071.1 protein_id gnl|my_center|LOCUS_09610 7391 5883 gene locus_tag LOCUS_09620 gene ctaD 7391 5883 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197996.1 protein_id gnl|my_center|LOCUS_09620 8783 7542 gene locus_tag LOCUS_09630 8783 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 9415 8918 gene locus_tag LOCUS_09640 9415 8918 CDS product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197998.1 protein_id gnl|my_center|LOCUS_09640 10417 9599 gene locus_tag LOCUS_09650 10417 9599 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247635.1 protein_id gnl|my_center|LOCUS_09650 10797 11339 gene locus_tag LOCUS_09660 10797 11339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 11353 11841 gene locus_tag LOCUS_09670 gene trmL 11353 11841 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185046.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence065 1835 333 gene locus_tag LOCUS_09680 1835 333 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086088023.1 protein_id gnl|my_center|LOCUS_09680 2473 1832 gene locus_tag LOCUS_09690 2473 1832 CDS product N-carbamoylsarcosine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258125.1 protein_id gnl|my_center|LOCUS_09690 3795 2479 gene locus_tag LOCUS_09700 3795 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 4376 3828 gene locus_tag LOCUS_09710 4376 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 5356 4382 gene locus_tag LOCUS_09720 5356 4382 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724273.1 protein_id gnl|my_center|LOCUS_09720 6076 5414 gene locus_tag LOCUS_09730 6076 5414 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728415.1 protein_id gnl|my_center|LOCUS_09730 6419 7684 gene locus_tag LOCUS_09740 6419 7684 CDS product citrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080854964.1 protein_id gnl|my_center|LOCUS_09740 8589 7717 gene locus_tag LOCUS_09750 8589 7717 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194094.1 protein_id gnl|my_center|LOCUS_09750 9291 8599 gene locus_tag LOCUS_09760 9291 8599 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529033.1 protein_id gnl|my_center|LOCUS_09760 9405 9878 gene locus_tag LOCUS_09770 9405 9878 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809010.1 protein_id gnl|my_center|LOCUS_09770 10044 11498 gene locus_tag LOCUS_09780 10044 11498 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970336.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence066 <1 643 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcatgcatgccgggcgcggattgaaac 798 1754 gene locus_tag LOCUS_09790 798 1754 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350357.1 protein_id gnl|my_center|LOCUS_09790 3810 1963 gene locus_tag LOCUS_09800 gene glmS 3810 1963 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064828.1 protein_id gnl|my_center|LOCUS_09800 3931 4425 gene locus_tag LOCUS_09810 3931 4425 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815701.1 protein_id gnl|my_center|LOCUS_09810 6213 5101 gene locus_tag LOCUS_09820 gene hisC 6213 5101 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529387.1 protein_id gnl|my_center|LOCUS_09820 7865 6210 gene locus_tag LOCUS_09830 7865 6210 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399307.1 protein_id gnl|my_center|LOCUS_09830 9511 7895 gene locus_tag LOCUS_09840 9511 7895 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050980078.1 protein_id gnl|my_center|LOCUS_09840 9771 9508 gene locus_tag LOCUS_09850 9771 9508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 10778 9780 gene locus_tag LOCUS_09860 10778 9780 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809986.1 protein_id gnl|my_center|LOCUS_09860 <11924 10876 gene locus_tag LOCUS_09870 <11924 10876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812086.1:sulfatase-like hydrolase/transferase >Feature sequence067 1788 367 gene locus_tag LOCUS_09880 1788 367 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039542.1 protein_id gnl|my_center|LOCUS_09880 1965 2534 gene locus_tag LOCUS_09890 1965 2534 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_09890 3010 2591 gene locus_tag LOCUS_09900 3010 2591 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455359.1 protein_id gnl|my_center|LOCUS_09900 3719 3090 gene locus_tag LOCUS_09910 3719 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 4767 3817 gene locus_tag LOCUS_09920 4767 3817 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390908.1 protein_id gnl|my_center|LOCUS_09920 5299 4781 gene locus_tag LOCUS_09930 5299 4781 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189275.1 protein_id gnl|my_center|LOCUS_09930 5639 6436 gene locus_tag LOCUS_09940 5639 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 6433 7098 gene locus_tag LOCUS_09950 6433 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 8345 7500 gene locus_tag LOCUS_09960 8345 7500 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183806887.1 protein_id gnl|my_center|LOCUS_09960 9316 8342 gene locus_tag LOCUS_09970 9316 8342 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088245.1 protein_id gnl|my_center|LOCUS_09970 9474 9905 gene locus_tag LOCUS_09980 9474 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 11373 9988 gene locus_tag LOCUS_09990 11373 9988 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549996.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence068 622 1809 gene locus_tag LOCUS_10000 622 1809 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_10000 3623 1836 gene locus_tag LOCUS_10010 3623 1836 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090269.1 protein_id gnl|my_center|LOCUS_10010 3818 4975 gene locus_tag LOCUS_10020 3818 4975 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811299.1 protein_id gnl|my_center|LOCUS_10020 5017 5997 gene locus_tag LOCUS_10030 5017 5997 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811660.1 protein_id gnl|my_center|LOCUS_10030 6983 6021 gene locus_tag LOCUS_10040 6983 6021 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064416.1 protein_id gnl|my_center|LOCUS_10040 7258 8481 gene locus_tag LOCUS_10050 7258 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 8478 9419 gene locus_tag LOCUS_10060 8478 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 9468 9860 gene locus_tag LOCUS_10070 9468 9860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 9872 10114 gene locus_tag LOCUS_10080 9872 10114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 10213 11376 gene locus_tag LOCUS_10090 10213 11376 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275363.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence069 1682 369 gene locus_tag LOCUS_10100 1682 369 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176729.1 protein_id gnl|my_center|LOCUS_10100 2112 1684 gene locus_tag LOCUS_10110 2112 1684 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176929198.1 protein_id gnl|my_center|LOCUS_10110 2394 2690 gene locus_tag LOCUS_10120 2394 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 2687 4051 gene locus_tag LOCUS_10130 2687 4051 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857525.1 protein_id gnl|my_center|LOCUS_10130 5932 4298 gene locus_tag LOCUS_10140 gene iaaH 5932 4298 CDS product indoleacetamide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921522.1 protein_id gnl|my_center|LOCUS_10140 6598 7725 gene locus_tag LOCUS_10150 6598 7725 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_10150 7835 7996 gene locus_tag LOCUS_10160 7835 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 7993 9564 gene locus_tag LOCUS_10170 7993 9564 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014163.1 protein_id gnl|my_center|LOCUS_10170 9995 10294 gene locus_tag LOCUS_10180 9995 10294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 10569 10823 gene locus_tag LOCUS_10190 10569 10823 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483180.1 protein_id gnl|my_center|LOCUS_10190 10870 11082 gene locus_tag LOCUS_10200 10870 11082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 <11645 11090 gene locus_tag LOCUS_10210 <11645 11090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004549944.1:CYTH domain-containing protein >Feature sequence070 <1 2220 gene locus_tag LOCUS_10220 <1 2220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100007.1:YgiQ family radical SAM protein 3558 2392 gene locus_tag LOCUS_10230 3558 2392 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207669.1 protein_id gnl|my_center|LOCUS_10230 4598 3747 gene locus_tag LOCUS_10240 4598 3747 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_10240 5331 4633 gene locus_tag LOCUS_10250 5331 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 5391 6377 gene locus_tag LOCUS_10260 5391 6377 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085864.1 protein_id gnl|my_center|LOCUS_10260 6477 7484 gene locus_tag LOCUS_10270 6477 7484 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967370.1 protein_id gnl|my_center|LOCUS_10270 8550 7633 gene locus_tag LOCUS_10280 8550 7633 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110400.1 protein_id gnl|my_center|LOCUS_10280 9543 8710 gene locus_tag LOCUS_10290 9543 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 9705 10670 gene locus_tag LOCUS_10300 9705 10670 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040322.1 protein_id gnl|my_center|LOCUS_10300 <11551 10754 gene locus_tag LOCUS_10310 <11551 10754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973946.1:4-hydroxybenzoate 3-monooxygenase >Feature sequence071 1540 446 gene locus_tag LOCUS_10320 1540 446 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039184056.1 protein_id gnl|my_center|LOCUS_10320 2520 1537 gene locus_tag LOCUS_10330 2520 1537 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085654.1 protein_id gnl|my_center|LOCUS_10330 3329 2517 gene locus_tag LOCUS_10340 3329 2517 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085655.1 protein_id gnl|my_center|LOCUS_10340 4913 3726 gene locus_tag LOCUS_10350 4913 3726 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460369.1 protein_id gnl|my_center|LOCUS_10350 6265 4910 gene locus_tag LOCUS_10360 6265 4910 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244067.1 protein_id gnl|my_center|LOCUS_10360 7875 6292 gene locus_tag LOCUS_10370 7875 6292 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086217.1 protein_id gnl|my_center|LOCUS_10370 8587 7853 gene locus_tag LOCUS_10380 8587 7853 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889519.1 protein_id gnl|my_center|LOCUS_10380 10419 8584 gene locus_tag LOCUS_10390 10419 8584 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086208.1 protein_id gnl|my_center|LOCUS_10390 11471 10416 gene locus_tag LOCUS_10400 11471 10416 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086209.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence072 <1 844 gene locus_tag LOCUS_10410 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808865.1:CoA transferase 864 2024 gene locus_tag LOCUS_10420 864 2024 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_10420 2062 3045 gene locus_tag LOCUS_10430 2062 3045 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812927.1 protein_id gnl|my_center|LOCUS_10430 3069 4064 gene locus_tag LOCUS_10440 3069 4064 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_10440 4119 4952 gene locus_tag LOCUS_10450 4119 4952 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965978.1 protein_id gnl|my_center|LOCUS_10450 6423 6130 gene locus_tag LOCUS_10460 6423 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 6895 7578 gene locus_tag LOCUS_10470 6895 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 9248 7614 gene locus_tag LOCUS_10480 9248 7614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 10255 9251 gene locus_tag LOCUS_10490 10255 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence073 246 926 gene locus_tag LOCUS_10500 gene nthB 246 926 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531053.1 protein_id gnl|my_center|LOCUS_10500 923 1321 gene locus_tag LOCUS_10510 923 1321 CDS product nitrile hydratase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174057.1 protein_id gnl|my_center|LOCUS_10510 2302 1394 gene locus_tag LOCUS_10520 2302 1394 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 protein_id gnl|my_center|LOCUS_10520 3478 2414 gene locus_tag LOCUS_10530 gene fba 3478 2414 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064288.1 protein_id gnl|my_center|LOCUS_10530 3650 4084 gene locus_tag LOCUS_10540 3650 4084 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930898.1 protein_id gnl|my_center|LOCUS_10540 4101 5237 gene locus_tag LOCUS_10550 4101 5237 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038743784.1 protein_id gnl|my_center|LOCUS_10550 5234 5614 gene locus_tag LOCUS_10560 5234 5614 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_10560 5621 6244 gene locus_tag LOCUS_10570 5621 6244 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188999.1 protein_id gnl|my_center|LOCUS_10570 6348 7535 gene locus_tag LOCUS_10580 6348 7535 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807138.1 protein_id gnl|my_center|LOCUS_10580 7674 8051 gene locus_tag LOCUS_10590 gene rpsL 7674 8051 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521903.1 protein_id gnl|my_center|LOCUS_10590 8272 8745 gene locus_tag LOCUS_10600 gene rpsG 8272 8745 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198359.1 protein_id gnl|my_center|LOCUS_10600 8901 11003 gene locus_tag LOCUS_10610 gene fusA 8901 11003 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167370.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence074 389 583 gene locus_tag LOCUS_10620 389 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 583 1722 gene locus_tag LOCUS_10630 583 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1729 4767 gene locus_tag LOCUS_10640 gene cas10 1729 4767 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274454.1 protein_id gnl|my_center|LOCUS_10640 4764 6023 gene locus_tag LOCUS_10650 4764 6023 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229143.1 protein_id gnl|my_center|LOCUS_10650 6085 7050 gene locus_tag LOCUS_10660 gene cmr4 6085 7050 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880200.1 protein_id gnl|my_center|LOCUS_10660 7090 7344 gene locus_tag LOCUS_10670 7090 7344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 7346 7762 gene locus_tag LOCUS_10680 7346 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 7759 8154 gene locus_tag LOCUS_10690 7759 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 8388 9344 gene locus_tag LOCUS_10700 8388 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 9358 9612 gene locus_tag LOCUS_10710 9358 9612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 9664 9990 gene locus_tag LOCUS_10720 9664 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 10000 11136 gene locus_tag LOCUS_10730 10000 11136 CDS product DUF1887 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974439.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence075 2015 966 gene locus_tag LOCUS_10740 2015 966 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524778.1 protein_id gnl|my_center|LOCUS_10740 3027 1999 gene locus_tag LOCUS_10750 3027 1999 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191693.1 protein_id gnl|my_center|LOCUS_10750 4784 3027 gene locus_tag LOCUS_10760 4784 3027 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193219.1 protein_id gnl|my_center|LOCUS_10760 4952 5746 gene locus_tag LOCUS_10770 gene fabI 4952 5746 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191586.1 protein_id gnl|my_center|LOCUS_10770 5861 6733 gene locus_tag LOCUS_10780 5861 6733 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925699.1 protein_id gnl|my_center|LOCUS_10780 9022 6746 gene locus_tag LOCUS_10790 9022 6746 CDS product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808393.1 protein_id gnl|my_center|LOCUS_10790 9191 9619 gene locus_tag LOCUS_10800 9191 9619 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_10800 9740 9829 gene locus_tag LOCUS_t00050 9740 9829 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10513 10079 gene locus_tag LOCUS_10810 10513 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 >Feature sequence076 1765 734 gene locus_tag LOCUS_10820 1765 734 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927097.1 protein_id gnl|my_center|LOCUS_10820 1812 2777 gene locus_tag LOCUS_10830 1812 2777 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810803.1 protein_id gnl|my_center|LOCUS_10830 2784 3530 gene locus_tag LOCUS_10840 2784 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 3542 3997 gene locus_tag LOCUS_10850 3542 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 5085 4237 gene locus_tag LOCUS_10860 5085 4237 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556106.1 protein_id gnl|my_center|LOCUS_10860 5077 6081 gene locus_tag LOCUS_10870 5077 6081 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926004.1 protein_id gnl|my_center|LOCUS_10870 6078 6938 gene locus_tag LOCUS_10880 6078 6938 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526741.1 protein_id gnl|my_center|LOCUS_10880 7683 6943 gene locus_tag LOCUS_10890 7683 6943 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 protein_id gnl|my_center|LOCUS_10890 8986 7691 gene locus_tag LOCUS_10900 8986 7691 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186353.1 protein_id gnl|my_center|LOCUS_10900 9945 8983 gene locus_tag LOCUS_10910 9945 8983 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_10910 10464 9949 gene locus_tag LOCUS_10920 gene pyrR 10464 9949 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185915.1 protein_id gnl|my_center|LOCUS_10920 10877 10461 gene locus_tag LOCUS_10930 gene ruvX 10877 10461 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186163.1 protein_id gnl|my_center|LOCUS_10930 >Feature sequence077 561 307 gene locus_tag LOCUS_10940 561 307 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402372.1 protein_id gnl|my_center|LOCUS_10940 844 1203 gene locus_tag LOCUS_10950 844 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 2830 1271 gene locus_tag LOCUS_10960 2830 1271 CDS product indolepyruvate oxidoreductase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527965.1 protein_id gnl|my_center|LOCUS_10960 5014 2834 gene locus_tag LOCUS_10970 5014 2834 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527966.1 protein_id gnl|my_center|LOCUS_10970 5201 6133 gene locus_tag LOCUS_10980 5201 6133 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402775.1 protein_id gnl|my_center|LOCUS_10980 6357 6800 gene locus_tag LOCUS_10990 6357 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 7717 6935 gene locus_tag LOCUS_11000 7717 6935 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728415.1 protein_id gnl|my_center|LOCUS_11000 8202 7714 gene locus_tag LOCUS_11010 8202 7714 CDS product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086185.1 protein_id gnl|my_center|LOCUS_11010 9521 8199 gene locus_tag LOCUS_11020 9521 8199 CDS product aromatic-ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064970.1 protein_id gnl|my_center|LOCUS_11020 9743 10753 gene locus_tag LOCUS_11030 9743 10753 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence078 1 831 gene locus_tag LOCUS_11040 1 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 850 1653 gene locus_tag LOCUS_11050 850 1653 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210055.1 protein_id gnl|my_center|LOCUS_11050 1691 2080 gene locus_tag LOCUS_11060 1691 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 2077 2916 gene locus_tag LOCUS_11070 2077 2916 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728413.1 protein_id gnl|my_center|LOCUS_11070 3899 2901 gene locus_tag LOCUS_11080 3899 2901 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940020.1 protein_id gnl|my_center|LOCUS_11080 5205 3991 gene locus_tag LOCUS_11090 5205 3991 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807943.1 protein_id gnl|my_center|LOCUS_11090 5969 5262 gene locus_tag LOCUS_11100 5969 5262 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391472.1 protein_id gnl|my_center|LOCUS_11100 7734 5956 gene locus_tag LOCUS_11110 7734 5956 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813865.1 protein_id gnl|my_center|LOCUS_11110 8676 7735 gene locus_tag LOCUS_11120 8676 7735 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_11120 9057 10220 gene locus_tag LOCUS_11130 gene mnmA 9057 10220 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813026.1 protein_id gnl|my_center|LOCUS_11130 10217 10384 gene locus_tag LOCUS_11140 10217 10384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 10755 10417 gene locus_tag LOCUS_11150 10755 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence079 2058 43 gene locus_tag LOCUS_11160 2058 43 CDS product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114515.1 protein_id gnl|my_center|LOCUS_11160 4757 2055 gene locus_tag LOCUS_11170 gene tssH 4757 2055 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269330.1 protein_id gnl|my_center|LOCUS_11170 5762 4773 gene locus_tag LOCUS_11180 gene tssG 5762 4773 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104969.1 protein_id gnl|my_center|LOCUS_11180 7555 5759 gene locus_tag LOCUS_11190 gene tssF 7555 5759 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114518.1 protein_id gnl|my_center|LOCUS_11190 8013 7555 gene locus_tag LOCUS_11200 8013 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 8556 8068 gene locus_tag LOCUS_11210 8556 8068 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089495.1 protein_id gnl|my_center|LOCUS_11210 10130 8640 gene locus_tag LOCUS_11220 gene tssC 10130 8640 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089494.1 protein_id gnl|my_center|LOCUS_11220 10702 10175 gene locus_tag LOCUS_11230 gene tssB 10702 10175 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089493.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence080 1717 836 gene locus_tag LOCUS_11240 1717 836 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087083.1 protein_id gnl|my_center|LOCUS_11240 2163 1768 gene locus_tag LOCUS_11250 2163 1768 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_11250 2410 2135 gene locus_tag LOCUS_11260 2410 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 4450 2630 gene locus_tag LOCUS_11270 gene typA 4450 2630 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193111.1 protein_id gnl|my_center|LOCUS_11270 5444 4464 gene locus_tag LOCUS_11280 gene truB 5444 4464 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_11280 5815 5447 gene locus_tag LOCUS_11290 gene rbfA 5815 5447 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199441.1 protein_id gnl|my_center|LOCUS_11290 8802 5875 gene locus_tag LOCUS_11300 gene infB 8802 5875 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197388.1 protein_id gnl|my_center|LOCUS_11300 10326 8827 gene locus_tag LOCUS_11310 gene nusA 10326 8827 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193517.1 protein_id gnl|my_center|LOCUS_11310 10926 10348 gene locus_tag LOCUS_11320 gene rimP 10926 10348 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193908.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence081 1285 1497 gene locus_tag LOCUS_11330 gene rpsU 1285 1497 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190342.1 protein_id gnl|my_center|LOCUS_11330 1603 2052 gene locus_tag LOCUS_11340 1603 2052 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_11340 2717 3412 gene locus_tag LOCUS_11350 2717 3412 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174863573.1 protein_id gnl|my_center|LOCUS_11350 3409 4599 gene locus_tag LOCUS_11360 3409 4599 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406632.1 protein_id gnl|my_center|LOCUS_11360 4665 7829 gene locus_tag LOCUS_11370 4665 7829 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974031.1 protein_id gnl|my_center|LOCUS_11370 7877 8548 gene locus_tag LOCUS_11380 7877 8548 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_11380 8559 8891 gene locus_tag LOCUS_11390 8559 8891 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_11390 8929 10404 gene locus_tag LOCUS_11400 gene vpoC 8929 10404 CDS product efflux RND transporter outer membrane protein VpoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455451.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence082 <1 527 gene locus_tag LOCUS_11410 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114311.1:taurine dioxygenase 535 1449 gene locus_tag LOCUS_11420 535 1449 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152827762.1 protein_id gnl|my_center|LOCUS_11420 1566 2531 gene locus_tag LOCUS_11430 1566 2531 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089798.1 protein_id gnl|my_center|LOCUS_11430 3476 2595 gene locus_tag LOCUS_11440 3476 2595 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446584.1 protein_id gnl|my_center|LOCUS_11440 4403 3486 gene locus_tag LOCUS_11450 4403 3486 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 protein_id gnl|my_center|LOCUS_11450 5203 4400 gene locus_tag LOCUS_11460 5203 4400 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089114.1 protein_id gnl|my_center|LOCUS_11460 5307 6194 gene locus_tag LOCUS_11470 5307 6194 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064624.1 protein_id gnl|my_center|LOCUS_11470 7714 6191 gene locus_tag LOCUS_11480 7714 6191 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328003.1 protein_id gnl|my_center|LOCUS_11480 7899 8990 gene locus_tag LOCUS_11490 7899 8990 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 protein_id gnl|my_center|LOCUS_11490 9064 9555 gene locus_tag LOCUS_11500 9064 9555 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965056.1 protein_id gnl|my_center|LOCUS_11500 10435 9611 gene locus_tag LOCUS_11510 10435 9611 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813616.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence083 <1 592 gene locus_tag LOCUS_11520 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194313.1:1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD 1218 4145 gene locus_tag LOCUS_11530 1218 4145 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194230.1 protein_id gnl|my_center|LOCUS_11530 4347 5540 gene locus_tag LOCUS_11540 4347 5540 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814929.1 protein_id gnl|my_center|LOCUS_11540 5721 6104 gene locus_tag LOCUS_11550 5721 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 7067 6168 gene locus_tag LOCUS_11560 7067 6168 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522039.1 protein_id gnl|my_center|LOCUS_11560 8139 7231 gene locus_tag LOCUS_11570 gene prmA 8139 7231 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084360451.1 protein_id gnl|my_center|LOCUS_11570 9504 8155 gene locus_tag LOCUS_11580 gene accC 9504 8155 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522043.1 protein_id gnl|my_center|LOCUS_11580 9971 9516 gene locus_tag LOCUS_11590 gene accB 9971 9516 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 protein_id gnl|my_center|LOCUS_11590 >Feature sequence084 1412 399 gene locus_tag LOCUS_11600 1412 399 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082960.1 protein_id gnl|my_center|LOCUS_11600 1904 1455 gene locus_tag LOCUS_11610 1904 1455 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413460.1 protein_id gnl|my_center|LOCUS_11610 2187 1885 gene locus_tag LOCUS_11620 2187 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 2574 2879 gene locus_tag LOCUS_11630 2574 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 4092 2956 gene locus_tag LOCUS_11640 4092 2956 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 protein_id gnl|my_center|LOCUS_11640 5088 4129 gene locus_tag LOCUS_11650 5088 4129 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089798.1 protein_id gnl|my_center|LOCUS_11650 4991 5179 gene locus_tag LOCUS_11660 4991 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 5986 5186 gene locus_tag LOCUS_11670 5986 5186 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229031.1 protein_id gnl|my_center|LOCUS_11670 6143 6874 gene locus_tag LOCUS_11680 gene pdhR 6143 6874 CDS product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070781.1 protein_id gnl|my_center|LOCUS_11680 6867 7712 gene locus_tag LOCUS_11690 6867 7712 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_11690 7872 7796 gene locus_tag LOCUS_t00060 7872 7796 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10224 7981 gene locus_tag LOCUS_11700 10224 7981 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521683.1 protein_id gnl|my_center|LOCUS_11700 10753 10229 gene locus_tag LOCUS_11710 10753 10229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 >Feature sequence085 1340 555 gene locus_tag LOCUS_11720 1340 555 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530221.1 protein_id gnl|my_center|LOCUS_11720 2261 1500 gene locus_tag LOCUS_11730 2261 1500 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 protein_id gnl|my_center|LOCUS_11730 3698 2373 gene locus_tag LOCUS_11740 3698 2373 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926811.1 protein_id gnl|my_center|LOCUS_11740 4190 3753 gene locus_tag LOCUS_11750 4190 3753 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813272.1 protein_id gnl|my_center|LOCUS_11750 5333 4362 gene locus_tag LOCUS_11760 5333 4362 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039499.1 protein_id gnl|my_center|LOCUS_11760 6361 5384 gene locus_tag LOCUS_11770 6361 5384 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194986.1 protein_id gnl|my_center|LOCUS_11770 7236 6415 gene locus_tag LOCUS_11780 7236 6415 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266418.1 protein_id gnl|my_center|LOCUS_11780 7907 7230 gene locus_tag LOCUS_11790 7907 7230 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194988.1 protein_id gnl|my_center|LOCUS_11790 9181 7904 gene locus_tag LOCUS_11800 9181 7904 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528722.1 protein_id gnl|my_center|LOCUS_11800 10101 9178 gene locus_tag LOCUS_11810 10101 9178 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528721.1 protein_id gnl|my_center|LOCUS_11810 <10718 10098 gene locus_tag LOCUS_11820 <10718 10098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004200845.1:FCD domain-containing protein >Feature sequence086 2741 3580 gene locus_tag LOCUS_11830 2741 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3787 5031 gene locus_tag LOCUS_11840 3787 5031 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814873.1 protein_id gnl|my_center|LOCUS_11840 5081 5530 gene locus_tag LOCUS_11850 gene nrdR 5081 5530 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185666.1 protein_id gnl|my_center|LOCUS_11850 5986 5555 gene locus_tag LOCUS_11860 5986 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 6541 5990 gene locus_tag LOCUS_11870 6541 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 7369 6548 gene locus_tag LOCUS_11880 gene pilW 7369 6548 CDS product type IV pilus assembly protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186509.1 protein_id gnl|my_center|LOCUS_11880 8004 7429 gene locus_tag LOCUS_11890 8004 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 8513 7995 gene locus_tag LOCUS_11900 8513 7995 CDS product Tfp pilus assembly protein FimT/FimU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037622.1 protein_id gnl|my_center|LOCUS_11900 8653 9741 gene locus_tag LOCUS_11910 gene ribD 8653 9741 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527563.1 protein_id gnl|my_center|LOCUS_11910 9807 10460 gene locus_tag LOCUS_11920 9807 10460 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence087 1149 250 gene locus_tag LOCUS_11930 1149 250 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729046.1 protein_id gnl|my_center|LOCUS_11930 1289 2506 gene locus_tag LOCUS_11940 1289 2506 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807943.1 protein_id gnl|my_center|LOCUS_11940 2621 3490 gene locus_tag LOCUS_11950 2621 3490 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_11950 3487 4449 gene locus_tag LOCUS_11960 3487 4449 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_11960 4449 5204 gene locus_tag LOCUS_11970 4449 5204 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_11970 5197 5898 gene locus_tag LOCUS_11980 5197 5898 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942652.1 protein_id gnl|my_center|LOCUS_11980 5902 6660 gene locus_tag LOCUS_11990 5902 6660 CDS product D-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188441.1 protein_id gnl|my_center|LOCUS_11990 6665 6994 gene locus_tag LOCUS_12000 6665 6994 CDS product DUF4387 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808129.1 protein_id gnl|my_center|LOCUS_12000 6991 8403 gene locus_tag LOCUS_12010 6991 8403 CDS product acyclic terpene utilization AtuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808130.1 protein_id gnl|my_center|LOCUS_12010 8400 9191 gene locus_tag LOCUS_12020 8400 9191 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064989.1 protein_id gnl|my_center|LOCUS_12020 9220 10512 gene locus_tag LOCUS_12030 9220 10512 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064988.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence088 485 1225 gene locus_tag LOCUS_12040 485 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1231 1857 gene locus_tag LOCUS_12050 1231 1857 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530934.1 protein_id gnl|my_center|LOCUS_12050 1902 2867 gene locus_tag LOCUS_12060 gene fmt 1902 2867 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038739.1 protein_id gnl|my_center|LOCUS_12060 2864 3613 gene locus_tag LOCUS_12070 2864 3613 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931455.1 protein_id gnl|my_center|LOCUS_12070 3624 3962 gene locus_tag LOCUS_12080 3624 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 4172 5365 gene locus_tag LOCUS_12090 4172 5365 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189839.1 protein_id gnl|my_center|LOCUS_12090 5942 5394 gene locus_tag LOCUS_12100 5942 5394 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064306.1 protein_id gnl|my_center|LOCUS_12100 6300 6007 gene locus_tag LOCUS_12110 6300 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 7072 6536 gene locus_tag LOCUS_12120 7072 6536 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_12120 7361 7594 gene locus_tag LOCUS_12130 7361 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 7604 7750 gene locus_tag LOCUS_12140 7604 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 7871 9304 gene locus_tag LOCUS_12150 gene pyk 7871 9304 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188973.1 protein_id gnl|my_center|LOCUS_12150 9835 9428 gene locus_tag LOCUS_12160 9835 9428 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331387.1 protein_id gnl|my_center|LOCUS_12160 10083 9835 gene locus_tag LOCUS_12170 10083 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence089 1821 565 gene locus_tag LOCUS_12180 1821 565 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807983.1 protein_id gnl|my_center|LOCUS_12180 2734 1814 gene locus_tag LOCUS_12190 gene puuE 2734 1814 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267253.1 protein_id gnl|my_center|LOCUS_12190 2754 3539 gene locus_tag LOCUS_12200 2754 3539 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284474.1 protein_id gnl|my_center|LOCUS_12200 3536 4927 gene locus_tag LOCUS_12210 3536 4927 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931675.1 protein_id gnl|my_center|LOCUS_12210 5827 4943 gene locus_tag LOCUS_12220 5827 4943 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733747.1 protein_id gnl|my_center|LOCUS_12220 6915 5860 gene locus_tag LOCUS_12230 6915 5860 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926712.1 protein_id gnl|my_center|LOCUS_12230 8242 6950 gene locus_tag LOCUS_12240 8242 6950 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811061.1 protein_id gnl|my_center|LOCUS_12240 8817 8239 gene locus_tag LOCUS_12250 8817 8239 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811059.1 protein_id gnl|my_center|LOCUS_12250 9910 9104 gene locus_tag LOCUS_12260 9910 9104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 10313 9912 gene locus_tag LOCUS_12270 10313 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence090 229 651 gene locus_tag LOCUS_12280 229 651 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191805.1 protein_id gnl|my_center|LOCUS_12280 2029 1145 gene locus_tag LOCUS_12290 2029 1145 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_12290 2607 2026 gene locus_tag LOCUS_12300 2607 2026 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086598.1 protein_id gnl|my_center|LOCUS_12300 4501 2756 gene locus_tag LOCUS_12310 4501 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 5671 4511 gene locus_tag LOCUS_12320 5671 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 9381 6217 gene locus_tag LOCUS_12330 9381 6217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 9769 9389 gene locus_tag LOCUS_12340 9769 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 9733 9930 gene locus_tag LOCUS_12350 9733 9930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence091 355 14 gene locus_tag LOCUS_12360 355 14 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703181.1 protein_id gnl|my_center|LOCUS_12360 1399 377 gene locus_tag LOCUS_12370 gene cas7c 1399 377 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_12370 3216 1396 gene locus_tag LOCUS_12380 gene cas8c 3216 1396 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926986.1 protein_id gnl|my_center|LOCUS_12380 3869 3213 gene locus_tag LOCUS_12390 gene cas5c 3869 3213 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448696.1 protein_id gnl|my_center|LOCUS_12390 4238 3879 gene locus_tag LOCUS_12400 4238 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 6152 4356 gene locus_tag LOCUS_12410 gene cas3 6152 4356 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932807.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12410 >Feature sequence092 <1 762 gene locus_tag LOCUS_12420 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014625915.1:LysR substrate-binding domain-containing protein 888 1433 gene locus_tag LOCUS_12430 888 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1541 2929 gene locus_tag LOCUS_12440 1541 2929 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389413.1 protein_id gnl|my_center|LOCUS_12440 4595 3285 gene locus_tag LOCUS_12450 4595 3285 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338375.1 protein_id gnl|my_center|LOCUS_12450 5150 4617 gene locus_tag LOCUS_12460 5150 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 6361 5219 gene locus_tag LOCUS_12470 6361 5219 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 protein_id gnl|my_center|LOCUS_12470 8535 6673 gene locus_tag LOCUS_12480 8535 6673 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817018.1 protein_id gnl|my_center|LOCUS_12480 8961 8803 gene locus_tag LOCUS_12490 8961 8803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 9759 9127 gene locus_tag LOCUS_12500 gene ccmA 9759 9127 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895571.1 protein_id gnl|my_center|LOCUS_12500 10012 9845 gene locus_tag LOCUS_12510 10012 9845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence093 96 1037 gene locus_tag LOCUS_12520 96 1037 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198065.1 protein_id gnl|my_center|LOCUS_12520 1271 2467 gene locus_tag LOCUS_12530 1271 2467 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064401.1 protein_id gnl|my_center|LOCUS_12530 2471 3244 gene locus_tag LOCUS_12540 2471 3244 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808963.1 protein_id gnl|my_center|LOCUS_12540 3261 3977 gene locus_tag LOCUS_12550 3261 3977 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038939.1 protein_id gnl|my_center|LOCUS_12550 4086 4619 gene locus_tag LOCUS_12560 4086 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 4865 5743 gene locus_tag LOCUS_12570 4865 5743 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064396.1 protein_id gnl|my_center|LOCUS_12570 5780 6562 gene locus_tag LOCUS_12580 5780 6562 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064395.1 protein_id gnl|my_center|LOCUS_12580 6579 7805 gene locus_tag LOCUS_12590 6579 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 7843 8817 gene locus_tag LOCUS_12600 7843 8817 CDS product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063889.1 protein_id gnl|my_center|LOCUS_12600 8831 9598 gene locus_tag LOCUS_12610 8831 9598 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064245.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence094 258 1013 gene locus_tag LOCUS_12620 258 1013 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812658.1 protein_id gnl|my_center|LOCUS_12620 1010 1699 gene locus_tag LOCUS_12630 1010 1699 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930378.1 protein_id gnl|my_center|LOCUS_12630 1696 2514 gene locus_tag LOCUS_12640 1696 2514 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567445.1 protein_id gnl|my_center|LOCUS_12640 4283 2565 gene locus_tag LOCUS_12650 4283 2565 CDS product Wzy polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818252.1 protein_id gnl|my_center|LOCUS_12650 5005 5550 gene locus_tag LOCUS_12660 5005 5550 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529535.1 protein_id gnl|my_center|LOCUS_12660 5571 6080 gene locus_tag LOCUS_12670 5571 6080 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007249558.1 protein_id gnl|my_center|LOCUS_12670 6341 6814 gene locus_tag LOCUS_12680 6341 6814 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175651.1 protein_id gnl|my_center|LOCUS_12680 6905 9280 gene locus_tag LOCUS_12690 6905 9280 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_12690 9327 10121 gene locus_tag LOCUS_12700 9327 10121 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337815.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence095 1110 271 gene locus_tag LOCUS_12710 1110 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1592 1239 gene locus_tag LOCUS_12720 1592 1239 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968490.1 protein_id gnl|my_center|LOCUS_12720 1694 3043 gene locus_tag LOCUS_12730 gene folC 1694 3043 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528975.1 protein_id gnl|my_center|LOCUS_12730 3134 3964 gene locus_tag LOCUS_12740 3134 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 4007 4492 gene locus_tag LOCUS_12750 4007 4492 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188369.1 protein_id gnl|my_center|LOCUS_12750 4511 6016 gene locus_tag LOCUS_12760 gene purF 4511 6016 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525195.1 protein_id gnl|my_center|LOCUS_12760 6027 7280 gene locus_tag LOCUS_12770 6027 7280 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 protein_id gnl|my_center|LOCUS_12770 7277 8677 gene locus_tag LOCUS_12780 gene gltX 7277 8677 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197094.1 protein_id gnl|my_center|LOCUS_12780 8753 8828 gene locus_tag LOCUS_t00070 8753 8828 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8878 8953 gene locus_tag LOCUS_t00080 8878 8953 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9047 9123 gene locus_tag LOCUS_t00090 9047 9123 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence096 822 298 gene locus_tag LOCUS_12790 822 298 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811410.1 protein_id gnl|my_center|LOCUS_12790 2792 819 gene locus_tag LOCUS_12800 2792 819 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926646.1 protein_id gnl|my_center|LOCUS_12800 3256 2789 gene locus_tag LOCUS_12810 gene ccmE 3256 2789 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_12810 3444 3253 gene locus_tag LOCUS_12820 3444 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 4172 3441 gene locus_tag LOCUS_12830 gene ccmC 4172 3441 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_12830 4910 4179 gene locus_tag LOCUS_12840 gene ccmB 4910 4179 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_12840 5476 4925 gene locus_tag LOCUS_12850 5476 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 5865 6767 gene locus_tag LOCUS_12860 5865 6767 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390731.1 protein_id gnl|my_center|LOCUS_12860 6764 7912 gene locus_tag LOCUS_12870 6764 7912 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390730.1 protein_id gnl|my_center|LOCUS_12870 7995 8960 gene locus_tag LOCUS_12880 gene bchC 7995 8960 CDS product chlorophyll synthesis pathway protein BchC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390729.1 protein_id gnl|my_center|LOCUS_12880 8960 9982 gene locus_tag LOCUS_12890 8960 9982 CDS product chlorophyllide a reductase iron protein subunit X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390728.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence097 31 570 gene locus_tag LOCUS_12900 gene ppa 31 570 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812734.1 protein_id gnl|my_center|LOCUS_12900 1873 680 gene locus_tag LOCUS_12910 1873 680 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832356.1 protein_id gnl|my_center|LOCUS_12910 1975 3621 gene locus_tag LOCUS_12920 1975 3621 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198600.1 protein_id gnl|my_center|LOCUS_12920 3688 4026 gene locus_tag LOCUS_12930 3688 4026 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193987.1 protein_id gnl|my_center|LOCUS_12930 4634 4035 gene locus_tag LOCUS_12940 4634 4035 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929870.1 protein_id gnl|my_center|LOCUS_12940 4861 4631 gene locus_tag LOCUS_12950 4861 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 5404 4868 gene locus_tag LOCUS_12960 5404 4868 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533619.1 protein_id gnl|my_center|LOCUS_12960 6182 5466 gene locus_tag LOCUS_12970 6182 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 6607 6179 gene locus_tag LOCUS_12980 6607 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 7176 6604 gene locus_tag LOCUS_12990 7176 6604 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186304.1 protein_id gnl|my_center|LOCUS_12990 7489 9261 gene locus_tag LOCUS_13000 7489 9261 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 protein_id gnl|my_center|LOCUS_13000 9391 9882 gene locus_tag LOCUS_13010 gene ilvN 9391 9882 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence098 114 587 gene locus_tag LOCUS_13020 114 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529239.1 protein_id gnl|my_center|LOCUS_13020 1093 1018 gene locus_tag LOCUS_t00100 1093 1018 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1327 1252 gene locus_tag LOCUS_t00110 1327 1252 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1997 2278 gene locus_tag LOCUS_13030 1997 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 4938 2644 gene locus_tag LOCUS_13040 4938 2644 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113616.1 protein_id gnl|my_center|LOCUS_13040 5069 6145 gene locus_tag LOCUS_13050 5069 6145 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813006.1 protein_id gnl|my_center|LOCUS_13050 6657 6343 gene locus_tag LOCUS_13060 6657 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 7073 6765 gene locus_tag LOCUS_13070 7073 6765 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_13070 7362 7084 gene locus_tag LOCUS_13080 7362 7084 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_13080 7934 7599 gene locus_tag LOCUS_13090 7934 7599 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101499.1 protein_id gnl|my_center|LOCUS_13090 8233 8637 gene locus_tag LOCUS_13100 8233 8637 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192504.1 protein_id gnl|my_center|LOCUS_13100 8671 9591 gene locus_tag LOCUS_13110 8671 9591 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811759.1 protein_id gnl|my_center|LOCUS_13110 >Feature sequence099 628 83 gene locus_tag LOCUS_13120 628 83 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222874.1 protein_id gnl|my_center|LOCUS_13120 2289 628 gene locus_tag LOCUS_13130 gene ettA 2289 628 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814257.1 protein_id gnl|my_center|LOCUS_13130 4329 2512 gene locus_tag LOCUS_13140 4329 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 5983 4427 gene locus_tag LOCUS_13150 5983 4427 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256609.1 protein_id gnl|my_center|LOCUS_13150 7788 6433 gene locus_tag LOCUS_13160 gene yjjJ 7788 6433 CDS product type II toxin-antitoxin system HipA family toxin YjjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815521.1 protein_id gnl|my_center|LOCUS_13160 7915 9492 gene locus_tag LOCUS_13170 7915 9492 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143598.1 protein_id gnl|my_center|LOCUS_13170 9510 10028 gene locus_tag LOCUS_13180 9510 10028 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929781.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence100 <1 951 gene locus_tag LOCUS_13190 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037402650.1:ATP-binding protein 1058 1306 gene locus_tag LOCUS_13200 1058 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1303 1710 gene locus_tag LOCUS_13210 1303 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1918 3087 gene locus_tag LOCUS_13220 1918 3087 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976271.1 protein_id gnl|my_center|LOCUS_13220 3113 3979 gene locus_tag LOCUS_13230 3113 3979 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316573.1 protein_id gnl|my_center|LOCUS_13230 3998 4993 gene locus_tag LOCUS_13240 3998 4993 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976269.1 protein_id gnl|my_center|LOCUS_13240 5002 5751 gene locus_tag LOCUS_13250 5002 5751 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973920.1 protein_id gnl|my_center|LOCUS_13250 5755 6465 gene locus_tag LOCUS_13260 5755 6465 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973919.1 protein_id gnl|my_center|LOCUS_13260 6487 7713 gene locus_tag LOCUS_13270 6487 7713 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083868.1 protein_id gnl|my_center|LOCUS_13270 7742 8065 gene locus_tag LOCUS_13280 7742 8065 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083869.1 protein_id gnl|my_center|LOCUS_13280 8062 8607 gene locus_tag LOCUS_13290 8062 8607 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083867.1 protein_id gnl|my_center|LOCUS_13290 8604 9821 gene locus_tag LOCUS_13300 8604 9821 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527917.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence101 4108 2876 gene locus_tag LOCUS_13310 gene carA 4108 2876 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198695.1 protein_id gnl|my_center|LOCUS_13310 5047 4271 gene locus_tag LOCUS_13320 5047 4271 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118372.1 protein_id gnl|my_center|LOCUS_13320 5679 5044 gene locus_tag LOCUS_13330 gene rnhB 5679 5044 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191384.1 protein_id gnl|my_center|LOCUS_13330 6808 5651 gene locus_tag LOCUS_13340 gene lpxB 6808 5651 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063750.1 protein_id gnl|my_center|LOCUS_13340 7609 6815 gene locus_tag LOCUS_13350 gene lpxA 7609 6815 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811774.1 protein_id gnl|my_center|LOCUS_13350 8070 7630 gene locus_tag LOCUS_13360 gene fabZ 8070 7630 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 protein_id gnl|my_center|LOCUS_13360 9192 8146 gene locus_tag LOCUS_13370 gene lpxD 9192 8146 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039864.1 protein_id gnl|my_center|LOCUS_13370 <9773 9229 gene locus_tag LOCUS_13380 <9773 9229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009930951.1:OmpH family outer membrane protein >Feature sequence102 688 395 gene locus_tag LOCUS_13390 688 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 938 1360 gene locus_tag LOCUS_13400 938 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1547 2062 gene locus_tag LOCUS_13410 1547 2062 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 protein_id gnl|my_center|LOCUS_13410 2172 3386 gene locus_tag LOCUS_13420 2172 3386 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814665.1 protein_id gnl|my_center|LOCUS_13420 3523 4641 gene locus_tag LOCUS_13430 3523 4641 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_13430 4712 6019 gene locus_tag LOCUS_13440 gene guaD 4712 6019 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189962.1 protein_id gnl|my_center|LOCUS_13440 6051 6620 gene locus_tag LOCUS_13450 gene dcd 6051 6620 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_13450 6666 7451 gene locus_tag LOCUS_13460 gene uppS 6666 7451 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527291.1 protein_id gnl|my_center|LOCUS_13460 8075 7494 gene locus_tag LOCUS_13470 8075 7494 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262765.1 protein_id gnl|my_center|LOCUS_13470 9638 8337 gene locus_tag LOCUS_13480 9638 8337 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043922084.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence103 2418 1927 gene locus_tag LOCUS_13490 2418 1927 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_13490 3303 2440 gene locus_tag LOCUS_13500 3303 2440 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_13500 4258 3503 gene locus_tag LOCUS_13510 4258 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 4616 5575 gene locus_tag LOCUS_13520 4616 5575 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090806.1 protein_id gnl|my_center|LOCUS_13520 6889 5648 gene locus_tag LOCUS_13530 6889 5648 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036313.1 protein_id gnl|my_center|LOCUS_13530 7797 6886 gene locus_tag LOCUS_13540 gene rsmI 7797 6886 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525682.1 protein_id gnl|my_center|LOCUS_13540 7797 8246 gene locus_tag LOCUS_13550 7797 8246 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196859.1 protein_id gnl|my_center|LOCUS_13550 8287 8886 gene locus_tag LOCUS_13560 8287 8886 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446211.1 protein_id gnl|my_center|LOCUS_13560 8883 9509 gene locus_tag LOCUS_13570 8883 9509 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815190.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence104 952 71 gene locus_tag LOCUS_13580 952 71 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223811.1 protein_id gnl|my_center|LOCUS_13580 3233 945 gene locus_tag LOCUS_13590 3233 945 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_13590 4236 3253 gene locus_tag LOCUS_13600 4236 3253 CDS product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813030.1 protein_id gnl|my_center|LOCUS_13600 4394 4963 gene locus_tag LOCUS_13610 4394 4963 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640429.1 protein_id gnl|my_center|LOCUS_13610 6010 4973 gene locus_tag LOCUS_13620 6010 4973 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112910.1 protein_id gnl|my_center|LOCUS_13620 6287 6063 gene locus_tag LOCUS_13630 6287 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112909.1 protein_id gnl|my_center|LOCUS_13630 7270 6305 gene locus_tag LOCUS_13640 7270 6305 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524007.1 protein_id gnl|my_center|LOCUS_13640 7492 8262 gene locus_tag LOCUS_13650 7492 8262 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544079.1 protein_id gnl|my_center|LOCUS_13650 8275 9042 gene locus_tag LOCUS_13660 gene cysE 8275 9042 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193377.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence105 1605 676 gene locus_tag LOCUS_13670 1605 676 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807265.1 protein_id gnl|my_center|LOCUS_13670 2451 1618 gene locus_tag LOCUS_13680 2451 1618 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807268.1 protein_id gnl|my_center|LOCUS_13680 4394 2448 gene locus_tag LOCUS_13690 4394 2448 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807270.1 protein_id gnl|my_center|LOCUS_13690 4573 5286 gene locus_tag LOCUS_13700 4573 5286 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807272.1 protein_id gnl|my_center|LOCUS_13700 5428 6177 gene locus_tag LOCUS_13710 5428 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 6418 6116 gene locus_tag LOCUS_13720 6418 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13720 6634 6419 gene locus_tag LOCUS_13730 6634 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 7029 6616 gene locus_tag LOCUS_13740 7029 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 9133 7214 gene locus_tag LOCUS_13750 9133 7214 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550744.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence106 <1 888 gene locus_tag LOCUS_13760 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809055.1:type I secretion system permease/ATPase 899 2248 gene locus_tag LOCUS_13770 899 2248 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809053.1 protein_id gnl|my_center|LOCUS_13770 2238 3956 gene locus_tag LOCUS_13780 2238 3956 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147968.1 protein_id gnl|my_center|LOCUS_13780 3953 5644 gene locus_tag LOCUS_13790 gene aprD 3953 5644 CDS product alkaline protease secretion ATP-binding protein AprD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082539.1 protein_id gnl|my_center|LOCUS_13790 5631 6953 gene locus_tag LOCUS_13800 5631 6953 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 protein_id gnl|my_center|LOCUS_13800 7021 8277 gene locus_tag LOCUS_13810 7021 8277 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405041.1 protein_id gnl|my_center|LOCUS_13810 9037 8249 gene locus_tag LOCUS_13820 9037 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 9132 9371 gene locus_tag LOCUS_13830 9132 9371 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402169.1 protein_id gnl|my_center|LOCUS_13830 9368 9562 gene locus_tag LOCUS_13840 9368 9562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence107 1243 380 gene locus_tag LOCUS_13850 gene phnE 1243 380 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113152.1 protein_id gnl|my_center|LOCUS_13850 2109 1240 gene locus_tag LOCUS_13860 2109 1240 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103283.1 protein_id gnl|my_center|LOCUS_13860 2954 2118 gene locus_tag LOCUS_13870 2954 2118 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113154.1 protein_id gnl|my_center|LOCUS_13870 3838 2975 gene locus_tag LOCUS_13880 3838 2975 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169047059.1 protein_id gnl|my_center|LOCUS_13880 3984 4952 gene locus_tag LOCUS_13890 gene egtD 3984 4952 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931515.1 protein_id gnl|my_center|LOCUS_13890 6194 4968 gene locus_tag LOCUS_13900 6194 4968 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057240.1 protein_id gnl|my_center|LOCUS_13900 6209 7189 gene locus_tag LOCUS_13910 6209 7189 CDS product GPMC system family 4 glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039643499.1 protein_id gnl|my_center|LOCUS_13910 7189 9474 gene locus_tag LOCUS_13920 7189 9474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence108 512 673 gene locus_tag LOCUS_13930 512 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 2039 897 gene locus_tag LOCUS_13940 2039 897 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930435.1 protein_id gnl|my_center|LOCUS_13940 2108 2650 gene locus_tag LOCUS_13950 2108 2650 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_13950 3103 2657 gene locus_tag LOCUS_13960 gene dut 3103 2657 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812576.1 protein_id gnl|my_center|LOCUS_13960 4388 3129 gene locus_tag LOCUS_13970 gene coaBC 4388 3129 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186216.1 protein_id gnl|my_center|LOCUS_13970 4479 6146 gene locus_tag LOCUS_13980 4479 6146 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813705.1 protein_id gnl|my_center|LOCUS_13980 6224 7000 gene locus_tag LOCUS_13990 gene kdsA 6224 7000 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193658.1 protein_id gnl|my_center|LOCUS_13990 6997 7296 gene locus_tag LOCUS_14000 6997 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 7335 8618 gene locus_tag LOCUS_14010 gene eno 7335 8618 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192585.1 protein_id gnl|my_center|LOCUS_14010 8633 8914 gene locus_tag LOCUS_14020 8633 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence109 395 42 gene locus_tag LOCUS_14030 gene uraH 395 42 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521222.1 protein_id gnl|my_center|LOCUS_14030 478 1143 gene locus_tag LOCUS_14040 478 1143 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812213.1 protein_id gnl|my_center|LOCUS_14040 1140 2093 gene locus_tag LOCUS_14050 gene puuE 1140 2093 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521217.1 protein_id gnl|my_center|LOCUS_14050 2083 2295 gene locus_tag LOCUS_14060 2083 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 2279 4045 gene locus_tag LOCUS_14070 2279 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 4069 5313 gene locus_tag LOCUS_14080 4069 5313 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_14080 5756 6811 gene locus_tag LOCUS_14090 5756 6811 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 protein_id gnl|my_center|LOCUS_14090 6815 7627 gene locus_tag LOCUS_14100 6815 7627 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687942.1 protein_id gnl|my_center|LOCUS_14100 7624 8391 gene locus_tag LOCUS_14110 7624 8391 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971358.1 protein_id gnl|my_center|LOCUS_14110 8934 8458 gene locus_tag LOCUS_14120 8934 8458 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence110 <1 759 gene locus_tag LOCUS_14130 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065037.1:dipeptide ABC transporter ATP-binding protein 971 1417 gene locus_tag LOCUS_14140 971 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1712 2071 gene locus_tag LOCUS_14150 1712 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 2568 2720 gene locus_tag LOCUS_14160 2568 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 2730 2942 gene locus_tag LOCUS_14170 2730 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 3016 4410 gene locus_tag LOCUS_14180 3016 4410 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388376.1 protein_id gnl|my_center|LOCUS_14180 5184 4684 gene locus_tag LOCUS_14190 5184 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 5510 5166 gene locus_tag LOCUS_14200 5510 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 5662 5736 gene locus_tag LOCUS_t00120 5662 5736 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6127 5828 gene locus_tag LOCUS_14210 6127 5828 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_14210 7640 6189 gene locus_tag LOCUS_14220 7640 6189 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115242.1 protein_id gnl|my_center|LOCUS_14220 7917 9002 gene locus_tag LOCUS_14230 7917 9002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence111 1985 633 gene locus_tag LOCUS_14240 1985 633 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_14240 2052 2936 gene locus_tag LOCUS_14250 2052 2936 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930369.1 protein_id gnl|my_center|LOCUS_14250 3978 3118 gene locus_tag LOCUS_14260 3978 3118 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190029.1 protein_id gnl|my_center|LOCUS_14260 3977 4675 gene locus_tag LOCUS_14270 gene pyrE 3977 4675 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459018.1 protein_id gnl|my_center|LOCUS_14270 5225 4710 gene locus_tag LOCUS_14280 5225 4710 CDS product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762644.1 protein_id gnl|my_center|LOCUS_14280 5426 5638 gene locus_tag LOCUS_14290 5426 5638 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171671.1 protein_id gnl|my_center|LOCUS_14290 5622 5891 gene locus_tag LOCUS_14300 5622 5891 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390944.1 protein_id gnl|my_center|LOCUS_14300 7383 5929 gene locus_tag LOCUS_14310 gene gatB 7383 5929 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929770.1 protein_id gnl|my_center|LOCUS_14310 8880 7402 gene locus_tag LOCUS_14320 gene gatA 8880 7402 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence112 1253 1429 gene locus_tag LOCUS_14330 1253 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 1509 1910 gene locus_tag LOCUS_14340 1509 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 2514 2266 gene locus_tag LOCUS_14350 2514 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3511 2783 gene locus_tag LOCUS_14360 3511 2783 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810365.1 protein_id gnl|my_center|LOCUS_14360 3875 3504 gene locus_tag LOCUS_14370 3875 3504 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818553.1 protein_id gnl|my_center|LOCUS_14370 5383 3881 gene locus_tag LOCUS_14380 5383 3881 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538734.1 protein_id gnl|my_center|LOCUS_14380 6619 5711 gene locus_tag LOCUS_14390 6619 5711 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190485.1 protein_id gnl|my_center|LOCUS_14390 7484 6627 gene locus_tag LOCUS_14400 gene purU 7484 6627 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522850.1 protein_id gnl|my_center|LOCUS_14400 7605 8942 gene locus_tag LOCUS_14410 7605 8942 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920685.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence113 398 862 gene locus_tag LOCUS_14420 398 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1782 1111 gene locus_tag LOCUS_14430 1782 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 2390 1794 gene locus_tag LOCUS_14440 2390 1794 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200146.1 protein_id gnl|my_center|LOCUS_14440 3445 2390 gene locus_tag LOCUS_14450 3445 2390 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_14450 3507 5444 gene locus_tag LOCUS_14460 3507 5444 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 protein_id gnl|my_center|LOCUS_14460 5441 6028 gene locus_tag LOCUS_14470 5441 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 6361 6600 gene locus_tag LOCUS_14480 6361 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 7056 6619 gene locus_tag LOCUS_14490 7056 6619 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401406.1 protein_id gnl|my_center|LOCUS_14490 7288 7046 gene locus_tag LOCUS_14500 7288 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 7725 7345 gene locus_tag LOCUS_14510 7725 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 <8985 7774 gene locus_tag LOCUS_14520 <8985 7774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096121.1:MFS transporter 8262 8170 gene locus_tag LOCUS_t00130 8262 8170 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence114 1487 1987 gene locus_tag LOCUS_14530 1487 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2949 2014 gene locus_tag LOCUS_14540 2949 2014 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337055.1 protein_id gnl|my_center|LOCUS_14540 3752 2946 gene locus_tag LOCUS_14550 gene pcaD 3752 2946 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727990.1 protein_id gnl|my_center|LOCUS_14550 4747 3755 gene locus_tag LOCUS_14560 4747 3755 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088828.1 protein_id gnl|my_center|LOCUS_14560 5824 4751 gene locus_tag LOCUS_14570 5824 4751 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966697.1 protein_id gnl|my_center|LOCUS_14570 <8976 5959 gene locus_tag LOCUS_14580 <8976 5959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004202033.1:ATP-dependent RNA helicase HrpA >Feature sequence115 1870 761 gene locus_tag LOCUS_14590 gene dnaN 1870 761 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196275.1 protein_id gnl|my_center|LOCUS_14590 3407 2001 gene locus_tag LOCUS_14600 gene dnaA 3407 2001 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929554.1 protein_id gnl|my_center|LOCUS_14600 3932 4066 gene locus_tag LOCUS_14610 gene rpmH 3932 4066 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214728.1 protein_id gnl|my_center|LOCUS_14610 4260 4610 gene locus_tag LOCUS_14620 4260 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 4627 4923 gene locus_tag LOCUS_14630 gene yidD 4627 4923 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112905182.1 protein_id gnl|my_center|LOCUS_14630 4920 6662 gene locus_tag LOCUS_14640 gene yidC 4920 6662 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198813.1 protein_id gnl|my_center|LOCUS_14640 6700 8148 gene locus_tag LOCUS_14650 gene mnmE 6700 8148 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524586.1 protein_id gnl|my_center|LOCUS_14650 8270 8920 gene locus_tag LOCUS_14660 8270 8920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence116 134 646 gene locus_tag LOCUS_14670 134 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1520 657 gene locus_tag LOCUS_14680 1520 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 2501 1542 gene locus_tag LOCUS_14690 2501 1542 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521279.1 protein_id gnl|my_center|LOCUS_14690 2684 3820 gene locus_tag LOCUS_14700 2684 3820 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192588.1 protein_id gnl|my_center|LOCUS_14700 4953 3889 gene locus_tag LOCUS_14710 4953 3889 CDS product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198339.1 protein_id gnl|my_center|LOCUS_14710 6164 5100 gene locus_tag LOCUS_14720 6164 5100 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528582.1 protein_id gnl|my_center|LOCUS_14720 6512 6165 gene locus_tag LOCUS_14730 6512 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 7330 6542 gene locus_tag LOCUS_14740 7330 6542 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_14740 8014 7613 gene locus_tag LOCUS_14750 8014 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 8712 8014 gene locus_tag LOCUS_14760 8712 8014 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194030.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence117 1490 510 gene locus_tag LOCUS_14770 1490 510 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853543.1 protein_id gnl|my_center|LOCUS_14770 2689 1487 gene locus_tag LOCUS_14780 2689 1487 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522681.1 protein_id gnl|my_center|LOCUS_14780 3201 2686 gene locus_tag LOCUS_14790 gene purE 3201 2686 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188932.1 protein_id gnl|my_center|LOCUS_14790 3320 4282 gene locus_tag LOCUS_14800 gene trxA 3320 4282 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522640.1 protein_id gnl|my_center|LOCUS_14800 4454 5161 gene locus_tag LOCUS_14810 4454 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 5418 7676 gene locus_tag LOCUS_14820 5418 7676 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891851.1 protein_id gnl|my_center|LOCUS_14820 7711 8217 gene locus_tag LOCUS_14830 7711 8217 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403299.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence118 1498 641 gene locus_tag LOCUS_14840 1498 641 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435248.1 protein_id gnl|my_center|LOCUS_14840 2737 1535 gene locus_tag LOCUS_14850 2737 1535 CDS product substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532997.1 protein_id gnl|my_center|LOCUS_14850 2959 2795 gene locus_tag LOCUS_14860 2959 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 4113 2956 gene locus_tag LOCUS_14870 4113 2956 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811389.1 protein_id gnl|my_center|LOCUS_14870 4923 4117 gene locus_tag LOCUS_14880 4923 4117 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244068.1 protein_id gnl|my_center|LOCUS_14880 5906 5004 gene locus_tag LOCUS_14890 5906 5004 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201675997.1 protein_id gnl|my_center|LOCUS_14890 6579 5995 gene locus_tag LOCUS_14900 6579 5995 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926772.1 protein_id gnl|my_center|LOCUS_14900 7624 6644 gene locus_tag LOCUS_14910 7624 6644 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_14910 8273 7656 gene locus_tag LOCUS_14920 8273 7656 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966152.1 protein_id gnl|my_center|LOCUS_14920 8608 8297 gene locus_tag LOCUS_14930 8608 8297 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085468.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence119 907 134 gene locus_tag LOCUS_14940 907 134 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194094.1 protein_id gnl|my_center|LOCUS_14940 1150 926 gene locus_tag LOCUS_14950 1150 926 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230573.1 protein_id gnl|my_center|LOCUS_14950 1999 1259 gene locus_tag LOCUS_14960 1999 1259 CDS product 2OG-Fe dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640646.1 protein_id gnl|my_center|LOCUS_14960 2138 2482 gene locus_tag LOCUS_14970 2138 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 3542 2505 gene locus_tag LOCUS_14980 3542 2505 CDS product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039547.1 protein_id gnl|my_center|LOCUS_14980 4631 3645 gene locus_tag LOCUS_14990 4631 3645 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969733.1 protein_id gnl|my_center|LOCUS_14990 5979 4732 gene locus_tag LOCUS_15000 5979 4732 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818460.1 protein_id gnl|my_center|LOCUS_15000 6800 5991 gene locus_tag LOCUS_15010 6800 5991 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807257.1 protein_id gnl|my_center|LOCUS_15010 8284 6947 gene locus_tag LOCUS_15020 8284 6947 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448384.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence120 1006 530 gene locus_tag LOCUS_15030 1006 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 2089 1316 gene locus_tag LOCUS_15040 2089 1316 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192554.1 protein_id gnl|my_center|LOCUS_15040 2895 2086 gene locus_tag LOCUS_15050 2895 2086 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064171.1 protein_id gnl|my_center|LOCUS_15050 3415 2906 gene locus_tag LOCUS_15060 3415 2906 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_15060 4060 3419 gene locus_tag LOCUS_15070 4060 3419 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191635.1 protein_id gnl|my_center|LOCUS_15070 5244 4126 gene locus_tag LOCUS_15080 5244 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 6548 5430 gene locus_tag LOCUS_15090 6548 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 6716 8095 gene locus_tag LOCUS_15100 gene cysS 6716 8095 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192752.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence121 492 2597 gene locus_tag LOCUS_15110 492 2597 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192524.1 protein_id gnl|my_center|LOCUS_15110 2641 3816 gene locus_tag LOCUS_15120 2641 3816 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191856.1 protein_id gnl|my_center|LOCUS_15120 3872 5722 gene locus_tag LOCUS_15130 3872 5722 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206873.1 protein_id gnl|my_center|LOCUS_15130 5725 5898 gene locus_tag LOCUS_15140 5725 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 5967 6758 gene locus_tag LOCUS_15150 5967 6758 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889459.1 protein_id gnl|my_center|LOCUS_15150 6759 7175 gene locus_tag LOCUS_15160 6759 7175 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240402.1 protein_id gnl|my_center|LOCUS_15160 7209 8225 gene locus_tag LOCUS_15170 7209 8225 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192815.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence122 1062 631 gene locus_tag LOCUS_15180 1062 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1778 1059 gene locus_tag LOCUS_15190 1778 1059 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036036.1 protein_id gnl|my_center|LOCUS_15190 3080 1896 gene locus_tag LOCUS_15200 3080 1896 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088694.1 protein_id gnl|my_center|LOCUS_15200 4502 3279 gene locus_tag LOCUS_15210 4502 3279 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057204.1 protein_id gnl|my_center|LOCUS_15210 4653 5189 gene locus_tag LOCUS_15220 4653 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 5574 5338 gene locus_tag LOCUS_15230 5574 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 5790 6065 gene locus_tag LOCUS_15240 5790 6065 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_15240 6255 7913 gene locus_tag LOCUS_15250 gene mnmC 6255 7913 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204185.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence123 255 1361 gene locus_tag LOCUS_15260 255 1361 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086305.1 protein_id gnl|my_center|LOCUS_15260 2612 1434 gene locus_tag LOCUS_15270 2612 1434 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_15270 3036 2728 gene locus_tag LOCUS_15280 3036 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 3483 3073 gene locus_tag LOCUS_15290 3483 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 3949 3563 gene locus_tag LOCUS_15300 3949 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 5322 4153 gene locus_tag LOCUS_15310 5322 4153 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969248.1 protein_id gnl|my_center|LOCUS_15310 8278 5369 gene locus_tag LOCUS_15320 gene acnA 8278 5369 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805056.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence124 1732 1208 gene locus_tag LOCUS_15330 1732 1208 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063925.1 protein_id gnl|my_center|LOCUS_15330 3113 1773 gene locus_tag LOCUS_15340 3113 1773 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534924.1 protein_id gnl|my_center|LOCUS_15340 4312 3152 gene locus_tag LOCUS_15350 4312 3152 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192327.1 protein_id gnl|my_center|LOCUS_15350 4587 4399 gene locus_tag LOCUS_15360 4587 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 5518 4607 gene locus_tag LOCUS_15370 gene hflC 5518 4607 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930787.1 protein_id gnl|my_center|LOCUS_15370 7003 5528 gene locus_tag LOCUS_15380 gene hflK 7003 5528 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930788.1 protein_id gnl|my_center|LOCUS_15380 8174 6984 gene locus_tag LOCUS_15390 gene hflX 8174 6984 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198587.1 protein_id gnl|my_center|LOCUS_15390 8470 8201 gene locus_tag LOCUS_15400 gene hfq 8470 8201 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810707.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence125 695 129 gene locus_tag LOCUS_15410 695 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1309 692 gene locus_tag LOCUS_15420 1309 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1611 1306 gene locus_tag LOCUS_15430 1611 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 2584 1706 gene locus_tag LOCUS_15440 2584 1706 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529196.1 protein_id gnl|my_center|LOCUS_15440 2934 2620 gene locus_tag LOCUS_15450 2934 2620 CDS product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529164.1 protein_id gnl|my_center|LOCUS_15450 3177 2938 gene locus_tag LOCUS_15460 3177 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 3852 3379 gene locus_tag LOCUS_15470 3852 3379 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266690.1 protein_id gnl|my_center|LOCUS_15470 4478 3849 gene locus_tag LOCUS_15480 4478 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 5119 5337 gene locus_tag LOCUS_15490 5119 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 5500 7710 gene locus_tag LOCUS_15500 gene katG 5500 7710 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942744.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence126 1719 3506 gene locus_tag LOCUS_15510 1719 3506 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553995.1 protein_id gnl|my_center|LOCUS_15510 3517 3909 gene locus_tag LOCUS_15520 3517 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 3906 4652 gene locus_tag LOCUS_15530 3906 4652 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565842.1 protein_id gnl|my_center|LOCUS_15530 4649 5599 gene locus_tag LOCUS_15540 gene cysD 4649 5599 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813323.1 protein_id gnl|my_center|LOCUS_15540 5599 6906 gene locus_tag LOCUS_15550 5599 6906 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928137.1 protein_id gnl|my_center|LOCUS_15550 6942 7271 gene locus_tag LOCUS_15560 6942 7271 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199372.1 protein_id gnl|my_center|LOCUS_15560 7305 8420 gene locus_tag LOCUS_15570 7305 8420 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531877.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence127 74 499 gene locus_tag LOCUS_15580 gene arfB 74 499 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193488.1 protein_id gnl|my_center|LOCUS_15580 584 1489 gene locus_tag LOCUS_15590 584 1489 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057901.1 protein_id gnl|my_center|LOCUS_15590 1848 1507 gene locus_tag LOCUS_15600 1848 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 2123 1848 gene locus_tag LOCUS_15610 2123 1848 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957712.1 protein_id gnl|my_center|LOCUS_15610 3034 2237 gene locus_tag LOCUS_15620 3034 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 4453 3452 gene locus_tag LOCUS_15630 4453 3452 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528459.1 protein_id gnl|my_center|LOCUS_15630 4847 4524 gene locus_tag LOCUS_15640 4847 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 6346 4844 gene locus_tag LOCUS_15650 gene dacB 6346 4844 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408519.1 protein_id gnl|my_center|LOCUS_15650 6506 7258 gene locus_tag LOCUS_15660 gene tsaB 6506 7258 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199104.1 protein_id gnl|my_center|LOCUS_15660 7255 7758 gene locus_tag LOCUS_15670 gene rimI 7255 7758 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191864.1 protein_id gnl|my_center|LOCUS_15670 8079 7792 gene locus_tag LOCUS_15680 8079 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 8118 8576 gene locus_tag LOCUS_15690 8118 8576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence128 301 35 gene locus_tag LOCUS_15700 301 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 1566 328 gene locus_tag LOCUS_15710 gene frc 1566 328 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226411.1 protein_id gnl|my_center|LOCUS_15710 2458 1589 gene locus_tag LOCUS_15720 2458 1589 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_15720 4241 2592 gene locus_tag LOCUS_15730 4241 2592 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_15730 4380 5327 gene locus_tag LOCUS_15740 4380 5327 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927166.1 protein_id gnl|my_center|LOCUS_15740 6601 5711 gene locus_tag LOCUS_15750 6601 5711 CDS product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085464.1 protein_id gnl|my_center|LOCUS_15750 7823 6630 gene locus_tag LOCUS_15760 7823 6630 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807655.1 protein_id gnl|my_center|LOCUS_15760 8262 7957 gene locus_tag LOCUS_15770 8262 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 8547 8308 gene locus_tag LOCUS_15780 8547 8308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence129 419 1174 gene locus_tag LOCUS_15790 419 1174 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536803.1 protein_id gnl|my_center|LOCUS_15790 1162 1467 gene locus_tag LOCUS_15800 1162 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1383 1697 gene locus_tag LOCUS_15810 1383 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 1711 2802 gene locus_tag LOCUS_15820 1711 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 4516 3206 gene locus_tag LOCUS_15830 4516 3206 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932228.1 protein_id gnl|my_center|LOCUS_15830 4541 5386 gene locus_tag LOCUS_15840 4541 5386 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814962.1 protein_id gnl|my_center|LOCUS_15840 6113 5454 gene locus_tag LOCUS_15850 6113 5454 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189569.1 protein_id gnl|my_center|LOCUS_15850 6313 7797 gene locus_tag LOCUS_15860 6313 7797 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194757.1 protein_id gnl|my_center|LOCUS_15860 8101 7859 gene locus_tag LOCUS_15870 8101 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence130 <1 1304 gene locus_tag LOCUS_15880 <1 1304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194266.1:DNA mismatch repair endonuclease MutL 1598 3982 gene locus_tag LOCUS_15890 1598 3982 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233452.1 protein_id gnl|my_center|LOCUS_15890 4073 5221 gene locus_tag LOCUS_15900 4073 5221 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035313.1 protein_id gnl|my_center|LOCUS_15900 5886 5368 gene locus_tag LOCUS_15910 5886 5368 CDS product DUF3429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267848.1 protein_id gnl|my_center|LOCUS_15910 6043 7230 gene locus_tag LOCUS_15920 6043 7230 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770075.1 protein_id gnl|my_center|LOCUS_15920 7241 8212 gene locus_tag LOCUS_15930 gene miaA 7241 8212 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065014.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence131 260 1537 gene locus_tag LOCUS_15940 260 1537 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532932.1 protein_id gnl|my_center|LOCUS_15940 1537 3087 gene locus_tag LOCUS_15950 1537 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 3186 3641 gene locus_tag LOCUS_15960 3186 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 3667 5007 gene locus_tag LOCUS_15970 3667 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 5044 5805 gene locus_tag LOCUS_15980 5044 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence132 4558 2312 gene locus_tag LOCUS_15990 gene cphA 4558 2312 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447960.1 protein_id gnl|my_center|LOCUS_15990 4783 6954 gene locus_tag LOCUS_16000 4783 6954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_16000 6969 7439 gene locus_tag LOCUS_16010 6969 7439 CDS product DUF1854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930535.1 protein_id gnl|my_center|LOCUS_16010 7454 8062 gene locus_tag LOCUS_16020 7454 8062 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727024.1 protein_id gnl|my_center|LOCUS_16020 >Feature sequence133 890 72 gene locus_tag LOCUS_16030 gene mutM 890 72 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522858.1 protein_id gnl|my_center|LOCUS_16030 1141 2721 gene locus_tag LOCUS_16040 1141 2721 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_16040 2733 3233 gene locus_tag LOCUS_16050 2733 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 3275 4144 gene locus_tag LOCUS_16060 gene ispE 3275 4144 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808500.1 protein_id gnl|my_center|LOCUS_16060 4213 4289 gene locus_tag LOCUS_t00140 4213 4289 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4382 5356 gene locus_tag LOCUS_16070 4382 5356 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195243.1 protein_id gnl|my_center|LOCUS_16070 5444 6070 gene locus_tag LOCUS_16080 5444 6070 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200150.1 protein_id gnl|my_center|LOCUS_16080 6157 6828 gene locus_tag LOCUS_16090 gene pth 6157 6828 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221185.1 protein_id gnl|my_center|LOCUS_16090 7128 6847 gene locus_tag LOCUS_16100 7128 6847 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 protein_id gnl|my_center|LOCUS_16100 7641 7141 gene locus_tag LOCUS_16110 gene coaD 7641 7141 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704185.1 protein_id gnl|my_center|LOCUS_16110 8132 7692 gene locus_tag LOCUS_16120 8132 7692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence134 1168 425 gene locus_tag LOCUS_16130 1168 425 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448626.1 protein_id gnl|my_center|LOCUS_16130 1621 1313 gene locus_tag LOCUS_16140 1621 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 2198 1953 gene locus_tag LOCUS_16150 2198 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 2193 2345 gene locus_tag LOCUS_16160 2193 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 2713 2333 gene locus_tag LOCUS_16170 2713 2333 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_16170 2964 2716 gene locus_tag LOCUS_16180 2964 2716 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_16180 3350 4339 gene locus_tag LOCUS_16190 3350 4339 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817045.1 protein_id gnl|my_center|LOCUS_16190 4339 4866 gene locus_tag LOCUS_16200 4339 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 4866 6356 gene locus_tag LOCUS_16210 4866 6356 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368539.1 protein_id gnl|my_center|LOCUS_16210 7323 7186 gene locus_tag LOCUS_16220 7323 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 7613 7338 gene locus_tag LOCUS_16230 7613 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 7708 8034 gene locus_tag LOCUS_16240 7708 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 7988 8317 gene locus_tag LOCUS_16250 7988 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence135 698 949 gene locus_tag LOCUS_16260 698 949 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813109.1 protein_id gnl|my_center|LOCUS_16260 946 1848 gene locus_tag LOCUS_16270 946 1848 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190235.1 protein_id gnl|my_center|LOCUS_16270 1860 3749 gene locus_tag LOCUS_16280 gene dxs 1860 3749 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266656.1 protein_id gnl|my_center|LOCUS_16280 3885 4964 gene locus_tag LOCUS_16290 3885 4964 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315175.1 protein_id gnl|my_center|LOCUS_16290 6976 5114 gene locus_tag LOCUS_16300 6976 5114 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812634.1 protein_id gnl|my_center|LOCUS_16300 7582 6977 gene locus_tag LOCUS_16310 7582 6977 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807402.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence136 1381 347 gene locus_tag LOCUS_16320 1381 347 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984106.1 protein_id gnl|my_center|LOCUS_16320 2723 1374 gene locus_tag LOCUS_16330 2723 1374 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887578.1 protein_id gnl|my_center|LOCUS_16330 2950 2732 gene locus_tag LOCUS_16340 2950 2732 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 protein_id gnl|my_center|LOCUS_16340 3662 3027 gene locus_tag LOCUS_16350 3662 3027 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338471.1 protein_id gnl|my_center|LOCUS_16350 4521 3652 gene locus_tag LOCUS_16360 4521 3652 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807247.1 protein_id gnl|my_center|LOCUS_16360 4616 4954 gene locus_tag LOCUS_16370 4616 4954 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298602.1 protein_id gnl|my_center|LOCUS_16370 4951 5388 gene locus_tag LOCUS_16380 4951 5388 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_16380 5401 5862 gene locus_tag LOCUS_16390 5401 5862 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 protein_id gnl|my_center|LOCUS_16390 5882 7639 gene locus_tag LOCUS_16400 5882 7639 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_16400 8112 7630 gene locus_tag LOCUS_16410 8112 7630 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815154.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence137 955 152 gene locus_tag LOCUS_16420 955 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1949 963 gene locus_tag LOCUS_16430 1949 963 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186471.1 protein_id gnl|my_center|LOCUS_16430 2133 3032 gene locus_tag LOCUS_16440 2133 3032 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 protein_id gnl|my_center|LOCUS_16440 3860 3072 gene locus_tag LOCUS_16450 3860 3072 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053361.1 protein_id gnl|my_center|LOCUS_16450 4812 3883 gene locus_tag LOCUS_16460 4812 3883 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 protein_id gnl|my_center|LOCUS_16460 6438 4927 gene locus_tag LOCUS_16470 6438 4927 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820743.1 protein_id gnl|my_center|LOCUS_16470 6969 6463 gene locus_tag LOCUS_16480 6969 6463 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124220547.1 protein_id gnl|my_center|LOCUS_16480 7820 7050 gene locus_tag LOCUS_16490 7820 7050 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185567.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence138 1012 92 gene locus_tag LOCUS_16500 gene rsmH 1012 92 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194427.1 protein_id gnl|my_center|LOCUS_16500 1320 1024 gene locus_tag LOCUS_16510 1320 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 3261 1822 gene locus_tag LOCUS_16520 3261 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 4407 3328 gene locus_tag LOCUS_16530 4407 3328 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199061.1 protein_id gnl|my_center|LOCUS_16530 5705 4503 gene locus_tag LOCUS_16540 gene rlmI 5705 4503 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704914.1 protein_id gnl|my_center|LOCUS_16540 6686 5724 gene locus_tag LOCUS_16550 gene xerC 6686 5724 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064714.1 protein_id gnl|my_center|LOCUS_16550 7396 6692 gene locus_tag LOCUS_16560 7396 6692 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199066.1 protein_id gnl|my_center|LOCUS_16560 <8163 7432 gene locus_tag LOCUS_16570 <8163 7432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199067.1:diaminopimelate epimerase >Feature sequence139 <1 1090 gene locus_tag LOCUS_16580 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186115.1:bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II 1102 1560 gene locus_tag LOCUS_16590 gene ribH 1102 1560 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 protein_id gnl|my_center|LOCUS_16590 1608 2072 gene locus_tag LOCUS_16600 gene nusB 1608 2072 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039075.1 protein_id gnl|my_center|LOCUS_16600 2075 3316 gene locus_tag LOCUS_16610 2075 3316 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194932.1 protein_id gnl|my_center|LOCUS_16610 3330 3731 gene locus_tag LOCUS_16620 gene ybgC 3330 3731 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527641.1 protein_id gnl|my_center|LOCUS_16620 3728 4414 gene locus_tag LOCUS_16630 gene tolQ 3728 4414 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_16630 4417 4848 gene locus_tag LOCUS_16640 gene tolR 4417 4848 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 protein_id gnl|my_center|LOCUS_16640 4894 5859 gene locus_tag LOCUS_16650 4894 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 <8102 6140 gene locus_tag LOCUS_16660 <8102 6140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522462.1:DNA polymerase III subunit alpha >Feature sequence140 <1 762 gene locus_tag LOCUS_16670 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968125.1:formylglycine-generating enzyme family protein 2000 798 gene locus_tag LOCUS_16680 2000 798 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814551.1 protein_id gnl|my_center|LOCUS_16680 2172 2567 gene locus_tag LOCUS_16690 gene gloA 2172 2567 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237802.1 protein_id gnl|my_center|LOCUS_16690 3479 2814 gene locus_tag LOCUS_16700 gene eda 3479 2814 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_16700 5269 3470 gene locus_tag LOCUS_16710 gene edd 5269 3470 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091478.1 protein_id gnl|my_center|LOCUS_16710 5474 6040 gene locus_tag LOCUS_16720 5474 6040 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814300.1 protein_id gnl|my_center|LOCUS_16720 6097 6744 gene locus_tag LOCUS_16730 gene pdxH 6097 6744 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_16730 7560 7027 gene locus_tag LOCUS_16740 7560 7027 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065009.1 protein_id gnl|my_center|LOCUS_16740 <8092 7565 gene locus_tag LOCUS_16750 <8092 7565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065010.1:polynucleotide adenylyltransferase PcnB >Feature sequence141 1361 447 gene locus_tag LOCUS_16760 1361 447 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193291.1 protein_id gnl|my_center|LOCUS_16760 2690 1410 gene locus_tag LOCUS_16770 gene lplT 2690 1410 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 protein_id gnl|my_center|LOCUS_16770 2903 4006 gene locus_tag LOCUS_16780 gene alr 2903 4006 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191260.1 protein_id gnl|my_center|LOCUS_16780 4126 5100 gene locus_tag LOCUS_16790 4126 5100 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813988.1 protein_id gnl|my_center|LOCUS_16790 6297 5185 gene locus_tag LOCUS_16800 6297 5185 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088689.1 protein_id gnl|my_center|LOCUS_16800 7303 6353 gene locus_tag LOCUS_16810 7303 6353 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243875.1 protein_id gnl|my_center|LOCUS_16810 <8024 7320 gene locus_tag LOCUS_16820 <8024 7320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640483.1:aromatic ring-hydroxylating dioxygenase subunit alpha >Feature sequence142 906 1988 gene locus_tag LOCUS_16830 906 1988 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809015.1 protein_id gnl|my_center|LOCUS_16830 2125 3702 gene locus_tag LOCUS_16840 2125 3702 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065033.1 protein_id gnl|my_center|LOCUS_16840 3702 4682 gene locus_tag LOCUS_16850 3702 4682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814271.1 protein_id gnl|my_center|LOCUS_16850 4687 5922 gene locus_tag LOCUS_16860 4687 5922 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820761.1 protein_id gnl|my_center|LOCUS_16860 5974 7548 gene locus_tag LOCUS_16870 5974 7548 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085661.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence143 477 935 gene locus_tag LOCUS_16880 477 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1016 2086 gene locus_tag LOCUS_16890 gene glnL 1016 2086 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135202727.1 protein_id gnl|my_center|LOCUS_16890 2133 3668 gene locus_tag LOCUS_16900 gene ntrC 2133 3668 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192209.1 protein_id gnl|my_center|LOCUS_16900 3729 4766 gene locus_tag LOCUS_16910 3729 4766 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339018.1 protein_id gnl|my_center|LOCUS_16910 5764 4817 gene locus_tag LOCUS_16920 gene bchC 5764 4817 CDS product chlorophyll synthesis pathway protein BchC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390729.1 protein_id gnl|my_center|LOCUS_16920 5961 6884 gene locus_tag LOCUS_16930 5961 6884 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338826.1 protein_id gnl|my_center|LOCUS_16930 7831 6941 gene locus_tag LOCUS_16940 7831 6941 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967128.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence144 41 1450 gene locus_tag LOCUS_16950 41 1450 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225694.1 protein_id gnl|my_center|LOCUS_16950 1994 1659 gene locus_tag LOCUS_16960 1994 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 2307 2011 gene locus_tag LOCUS_16970 2307 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 2733 2660 gene locus_tag LOCUS_t00150 2733 2660 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2864 2789 gene locus_tag LOCUS_t00160 2864 2789 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5409 2962 gene locus_tag LOCUS_16980 gene lon 5409 2962 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 protein_id gnl|my_center|LOCUS_16980 6781 5516 gene locus_tag LOCUS_16990 gene clpX 6781 5516 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521258.1 protein_id gnl|my_center|LOCUS_16990 7559 6918 gene locus_tag LOCUS_17000 gene clpP 7559 6918 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812508.1 protein_id gnl|my_center|LOCUS_17000 7935 7702 gene locus_tag LOCUS_17010 7935 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence145 1429 2586 gene locus_tag LOCUS_17020 1429 2586 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225693.1 protein_id gnl|my_center|LOCUS_17020 2705 4837 gene locus_tag LOCUS_17030 2705 4837 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225692.1 protein_id gnl|my_center|LOCUS_17030 4895 5788 gene locus_tag LOCUS_17040 4895 5788 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729046.1 protein_id gnl|my_center|LOCUS_17040 5785 7074 gene locus_tag LOCUS_17050 5785 7074 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815911.1 protein_id gnl|my_center|LOCUS_17050 7753 7106 gene locus_tag LOCUS_17060 7753 7106 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463751.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence146 419 583 gene locus_tag LOCUS_17070 419 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17070 1018 683 gene locus_tag LOCUS_17080 1018 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 1340 1125 gene locus_tag LOCUS_17090 1340 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1808 2656 gene locus_tag LOCUS_17100 1808 2656 CDS product DUF6502 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207485.1 protein_id gnl|my_center|LOCUS_17100 2701 4017 gene locus_tag LOCUS_17110 2701 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 4093 5715 gene locus_tag LOCUS_17120 4093 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 7130 5883 gene locus_tag LOCUS_17130 7130 5883 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972795.1 protein_id gnl|my_center|LOCUS_17130 <7927 7138 gene locus_tag LOCUS_17140 <7927 7138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926703.1:TRAP transporter large permease subunit >Feature sequence147 1501 299 gene locus_tag LOCUS_17150 1501 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 2642 1614 gene locus_tag LOCUS_17160 gene waaF 2642 1614 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526219.1 protein_id gnl|my_center|LOCUS_17160 2882 2667 gene locus_tag LOCUS_17170 2882 2667 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197553.1 protein_id gnl|my_center|LOCUS_17170 3859 2921 gene locus_tag LOCUS_17180 3859 2921 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 protein_id gnl|my_center|LOCUS_17180 4370 3945 gene locus_tag LOCUS_17190 4370 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 4603 4412 gene locus_tag LOCUS_17200 4603 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 5627 4743 gene locus_tag LOCUS_17210 5627 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 <7926 5949 gene locus_tag LOCUS_17220 <7926 5949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208315.1:PhoX family phosphatase >Feature sequence148 1829 939 gene locus_tag LOCUS_17230 1829 939 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196438.1 protein_id gnl|my_center|LOCUS_17230 2566 1934 gene locus_tag LOCUS_17240 2566 1934 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813135.1 protein_id gnl|my_center|LOCUS_17240 2740 3582 gene locus_tag LOCUS_17250 gene phnC 2740 3582 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201618.1 protein_id gnl|my_center|LOCUS_17250 3645 4577 gene locus_tag LOCUS_17260 gene phnD 3645 4577 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527693.1 protein_id gnl|my_center|LOCUS_17260 4581 5402 gene locus_tag LOCUS_17270 gene phnE 4581 5402 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091793.1 protein_id gnl|my_center|LOCUS_17270 5412 6470 gene locus_tag LOCUS_17280 5412 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 6467 7585 gene locus_tag LOCUS_17290 6467 7585 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813122.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence149 1003 1566 gene locus_tag LOCUS_17300 1003 1566 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189913.1 protein_id gnl|my_center|LOCUS_17300 1666 2889 gene locus_tag LOCUS_17310 1666 2889 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198305.1 protein_id gnl|my_center|LOCUS_17310 2886 3479 gene locus_tag LOCUS_17320 gene metW 2886 3479 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545692.1 protein_id gnl|my_center|LOCUS_17320 3604 5397 gene locus_tag LOCUS_17330 3604 5397 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 protein_id gnl|my_center|LOCUS_17330 5404 6039 gene locus_tag LOCUS_17340 5404 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 6065 7546 gene locus_tag LOCUS_17350 6065 7546 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812393.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence150 808 2292 gene locus_tag LOCUS_17360 808 2292 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_17360 3203 2301 gene locus_tag LOCUS_17370 3203 2301 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525413.1 protein_id gnl|my_center|LOCUS_17370 3575 4906 gene locus_tag LOCUS_17380 gene aceA 3575 4906 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706620.1 protein_id gnl|my_center|LOCUS_17380 5064 7043 gene locus_tag LOCUS_17390 gene thrS 5064 7043 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812608.1 protein_id gnl|my_center|LOCUS_17390 7205 7738 gene locus_tag LOCUS_17400 gene infC 7205 7738 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446215.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence151 <1 830 gene locus_tag LOCUS_17410 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965054.1:Bug family tripartite tricarboxylate transporter substrate binding protein 1895 897 gene locus_tag LOCUS_17420 1895 897 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807825.1 protein_id gnl|my_center|LOCUS_17420 3052 1931 gene locus_tag LOCUS_17430 3052 1931 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525764.1 protein_id gnl|my_center|LOCUS_17430 3128 3904 gene locus_tag LOCUS_17440 gene yaaA 3128 3904 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814010.1 protein_id gnl|my_center|LOCUS_17440 4013 4879 gene locus_tag LOCUS_17450 4013 4879 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038527.1 protein_id gnl|my_center|LOCUS_17450 4934 5779 gene locus_tag LOCUS_17460 gene queF 4934 5779 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526121.1 protein_id gnl|my_center|LOCUS_17460 6158 5871 gene locus_tag LOCUS_17470 6158 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 7401 6208 gene locus_tag LOCUS_17480 7401 6208 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391277.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence152 <1 1245 gene locus_tag LOCUS_17490 <1 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064014.1:phenylacetate--CoA ligase 1272 2282 gene locus_tag LOCUS_17500 gene paaA 1272 2282 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523130.1 protein_id gnl|my_center|LOCUS_17500 2299 2598 gene locus_tag LOCUS_17510 gene paaB 2299 2598 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551024.1 protein_id gnl|my_center|LOCUS_17510 2606 3382 gene locus_tag LOCUS_17520 gene paaC 2606 3382 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199193.1 protein_id gnl|my_center|LOCUS_17520 3379 3906 gene locus_tag LOCUS_17530 gene paaJ 3379 3906 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153451216.1 protein_id gnl|my_center|LOCUS_17530 3926 5017 gene locus_tag LOCUS_17540 gene paaK 3926 5017 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551026.1 protein_id gnl|my_center|LOCUS_17540 5037 5699 gene locus_tag LOCUS_17550 5037 5699 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523127.1 protein_id gnl|my_center|LOCUS_17550 5705 7750 gene locus_tag LOCUS_17560 gene paaZ 5705 7750 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186481.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence153 3173 741 gene locus_tag LOCUS_17570 3173 741 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555925.1 protein_id gnl|my_center|LOCUS_17570 3197 3928 gene locus_tag LOCUS_17580 3197 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 4164 4904 gene locus_tag LOCUS_17590 gene guaC 4164 4904 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244278.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17590 4962 5141 gene locus_tag LOCUS_17600 4962 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17600 6180 5326 gene locus_tag LOCUS_17610 6180 5326 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929728.1 protein_id gnl|my_center|LOCUS_17610 6305 7651 gene locus_tag LOCUS_17620 6305 7651 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807718.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence154 1554 211 gene locus_tag LOCUS_17630 gene fahA 1554 211 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818932.1 protein_id gnl|my_center|LOCUS_17630 2360 1551 gene locus_tag LOCUS_17640 2360 1551 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 protein_id gnl|my_center|LOCUS_17640 3429 2392 gene locus_tag LOCUS_17650 3429 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 4748 3426 gene locus_tag LOCUS_17660 4748 3426 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338375.1 protein_id gnl|my_center|LOCUS_17660 5299 4745 gene locus_tag LOCUS_17670 5299 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 6366 5299 gene locus_tag LOCUS_17680 6366 5299 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065005.1 protein_id gnl|my_center|LOCUS_17680 7111 6413 gene locus_tag LOCUS_17690 7111 6413 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037144.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence155 <1 916 gene locus_tag LOCUS_17700 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086618.1:tripartite tricarboxylate transporter substrate binding protein 1997 1167 gene locus_tag LOCUS_17710 1997 1167 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_17710 2373 4580 gene locus_tag LOCUS_17720 2373 4580 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088788.1 protein_id gnl|my_center|LOCUS_17720 4638 5099 gene locus_tag LOCUS_17730 4638 5099 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088787.1 protein_id gnl|my_center|LOCUS_17730 5148 6263 gene locus_tag LOCUS_17740 5148 6263 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_17740 6318 7307 gene locus_tag LOCUS_17750 6318 7307 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814852.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence156 686 1999 gene locus_tag LOCUS_17760 686 1999 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_17760 1992 2684 gene locus_tag LOCUS_17770 gene lolD 1992 2684 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195923.1 protein_id gnl|my_center|LOCUS_17770 3764 2727 gene locus_tag LOCUS_17780 3764 2727 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407530.1 protein_id gnl|my_center|LOCUS_17780 4822 3821 gene locus_tag LOCUS_17790 4822 3821 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226780.1 protein_id gnl|my_center|LOCUS_17790 5837 4803 gene locus_tag LOCUS_17800 5837 4803 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_17800 6839 5868 gene locus_tag LOCUS_17810 6839 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence157 1027 194 gene locus_tag LOCUS_17820 1027 194 CDS product hydroxyquinol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731481.1 protein_id gnl|my_center|LOCUS_17820 1107 2132 gene locus_tag LOCUS_17830 1107 2132 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085469.1 protein_id gnl|my_center|LOCUS_17830 2615 2142 gene locus_tag LOCUS_17840 2615 2142 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087172.1 protein_id gnl|my_center|LOCUS_17840 2881 2612 gene locus_tag LOCUS_17850 2881 2612 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045874275.1 protein_id gnl|my_center|LOCUS_17850 3053 4507 gene locus_tag LOCUS_17860 gene argH 3053 4507 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812010.1 protein_id gnl|my_center|LOCUS_17860 4540 5037 gene locus_tag LOCUS_17870 4540 5037 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527428.1 protein_id gnl|my_center|LOCUS_17870 6059 5043 gene locus_tag LOCUS_17880 6059 5043 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_17880 6262 7422 gene locus_tag LOCUS_17890 gene lldA 6262 7422 CDS product L-lactate dehydrogenase LldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104946.1 protein_id gnl|my_center|LOCUS_17890 >Feature sequence158 <1 742 gene locus_tag LOCUS_17900 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230560.1:NUDIX domain-containing protein 1153 776 gene locus_tag LOCUS_17910 1153 776 CDS product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532310.1 protein_id gnl|my_center|LOCUS_17910 2030 1713 gene locus_tag LOCUS_17920 2030 1713 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809828.1 protein_id gnl|my_center|LOCUS_17920 2532 2044 gene locus_tag LOCUS_17930 2532 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 3792 2536 gene locus_tag LOCUS_17940 3792 2536 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809837.1 protein_id gnl|my_center|LOCUS_17940 3905 4810 gene locus_tag LOCUS_17950 3905 4810 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808483.1 protein_id gnl|my_center|LOCUS_17950 5316 4819 gene locus_tag LOCUS_17960 5316 4819 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350686.1 protein_id gnl|my_center|LOCUS_17960 5973 6197 gene locus_tag LOCUS_17970 5973 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 6194 6487 gene locus_tag LOCUS_17980 6194 6487 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_17980 6661 6900 gene locus_tag LOCUS_17990 6661 6900 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244189.1 protein_id gnl|my_center|LOCUS_17990 6900 7298 gene locus_tag LOCUS_18000 6900 7298 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243822.1 protein_id gnl|my_center|LOCUS_18000 7440 7276 gene locus_tag LOCUS_18010 7440 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence159 2344 1010 gene locus_tag LOCUS_18020 2344 1010 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039986.1 protein_id gnl|my_center|LOCUS_18020 2574 3305 gene locus_tag LOCUS_18030 gene rpsB 2574 3305 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193246.1 protein_id gnl|my_center|LOCUS_18030 3477 4346 gene locus_tag LOCUS_18040 gene tsf 3477 4346 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197087.1 protein_id gnl|my_center|LOCUS_18040 4392 5102 gene locus_tag LOCUS_18050 gene pyrH 4392 5102 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193606.1 protein_id gnl|my_center|LOCUS_18050 5164 5724 gene locus_tag LOCUS_18060 gene frr 5164 5724 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192143.1 protein_id gnl|my_center|LOCUS_18060 5746 6606 gene locus_tag LOCUS_18070 5746 6606 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521189.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence160 169 1713 gene locus_tag LOCUS_18080 gene rlmD 169 1713 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816525.1 protein_id gnl|my_center|LOCUS_18080 1817 2407 gene locus_tag LOCUS_18090 1817 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 2431 3417 gene locus_tag LOCUS_18100 2431 3417 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814174.1 protein_id gnl|my_center|LOCUS_18100 3477 4658 gene locus_tag LOCUS_18110 3477 4658 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086066.1 protein_id gnl|my_center|LOCUS_18110 5409 4717 gene locus_tag LOCUS_18120 5409 4717 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191933.1 protein_id gnl|my_center|LOCUS_18120 5652 6155 gene locus_tag LOCUS_18130 5652 6155 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821377.1 protein_id gnl|my_center|LOCUS_18130 6798 6385 gene locus_tag LOCUS_18140 6798 6385 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200660.1 protein_id gnl|my_center|LOCUS_18140 7522 6803 gene locus_tag LOCUS_18150 7522 6803 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188455.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence161 2203 1367 gene locus_tag LOCUS_18160 2203 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 3909 2200 gene locus_tag LOCUS_18170 3909 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 4750 3896 gene locus_tag LOCUS_18180 4750 3896 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 protein_id gnl|my_center|LOCUS_18180 7604 4830 gene locus_tag LOCUS_18190 7604 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence162 1084 314 gene locus_tag LOCUS_18200 1084 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 2289 1081 gene locus_tag LOCUS_18210 2289 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 3200 2286 gene locus_tag LOCUS_18220 3200 2286 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191272.1 protein_id gnl|my_center|LOCUS_18220 4466 3300 gene locus_tag LOCUS_18230 4466 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 6257 4635 gene locus_tag LOCUS_18240 6257 4635 CDS product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence163 469 1233 gene locus_tag LOCUS_18250 469 1233 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193573.1 protein_id gnl|my_center|LOCUS_18250 1634 3133 gene locus_tag LOCUS_18260 gene trpE 1634 3133 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186866.1 protein_id gnl|my_center|LOCUS_18260 3130 3723 gene locus_tag LOCUS_18270 3130 3723 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186792.1 protein_id gnl|my_center|LOCUS_18270 3720 4820 gene locus_tag LOCUS_18280 gene ltaE 3720 4820 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065118.1 protein_id gnl|my_center|LOCUS_18280 4968 6014 gene locus_tag LOCUS_18290 gene trpD 4968 6014 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186823.1 protein_id gnl|my_center|LOCUS_18290 6038 6826 gene locus_tag LOCUS_18300 gene trpC 6038 6826 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522001.1 protein_id gnl|my_center|LOCUS_18300 6847 7572 gene locus_tag LOCUS_18310 6847 7572 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818450.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence164 568 1269 gene locus_tag LOCUS_18320 gene ypfH 568 1269 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703146.1 protein_id gnl|my_center|LOCUS_18320 1487 2806 gene locus_tag LOCUS_18330 1487 2806 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044946.1 protein_id gnl|my_center|LOCUS_18330 2820 4958 gene locus_tag LOCUS_18340 2820 4958 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940950.1 protein_id gnl|my_center|LOCUS_18340 4955 6106 gene locus_tag LOCUS_18350 4955 6106 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940949.1 protein_id gnl|my_center|LOCUS_18350 <7564 6789 gene locus_tag LOCUS_18360 <7564 6789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083692.1:site-specific integrase >Feature sequence165 3 539 gene locus_tag LOCUS_18370 3 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 1081 536 gene locus_tag LOCUS_18380 1081 536 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194943.1 protein_id gnl|my_center|LOCUS_18380 3408 1120 gene locus_tag LOCUS_18390 gene rnr 3408 1120 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550537.1 protein_id gnl|my_center|LOCUS_18390 3557 3641 gene locus_tag LOCUS_t00170 3557 3641 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4597 3836 gene locus_tag LOCUS_18400 4597 3836 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535747.1 protein_id gnl|my_center|LOCUS_18400 4823 5824 gene locus_tag LOCUS_18410 gene galE 4823 5824 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876270.1 protein_id gnl|my_center|LOCUS_18410 5903 6931 gene locus_tag LOCUS_18420 5903 6931 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639891.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence166 1219 359 gene locus_tag LOCUS_18430 1219 359 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192042.1 protein_id gnl|my_center|LOCUS_18430 1332 2561 gene locus_tag LOCUS_18440 1332 2561 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810358.1 protein_id gnl|my_center|LOCUS_18440 2653 3342 gene locus_tag LOCUS_18450 2653 3342 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965709.1 protein_id gnl|my_center|LOCUS_18450 3332 4762 gene locus_tag LOCUS_18460 3332 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 5166 4873 gene locus_tag LOCUS_18470 5166 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 5303 6469 gene locus_tag LOCUS_18480 5303 6469 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113133.1 protein_id gnl|my_center|LOCUS_18480 5563 5660 gene locus_tag LOCUS_t00180 5563 5660 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence167 2295 1513 gene locus_tag LOCUS_18490 2295 1513 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809724.1 protein_id gnl|my_center|LOCUS_18490 3052 2303 gene locus_tag LOCUS_18500 3052 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 4038 3049 gene locus_tag LOCUS_18510 4038 3049 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812334.1 protein_id gnl|my_center|LOCUS_18510 5074 4085 gene locus_tag LOCUS_18520 5074 4085 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064098.1 protein_id gnl|my_center|LOCUS_18520 5923 5108 gene locus_tag LOCUS_18530 5923 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 5976 6227 gene locus_tag LOCUS_18540 5976 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 6361 6969 gene locus_tag LOCUS_18550 6361 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967527.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence168 115 597 gene locus_tag LOCUS_18560 115 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 620 696 gene locus_tag LOCUS_t00190 620 696 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 945 1421 gene locus_tag LOCUS_18570 945 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2000 2710 gene locus_tag LOCUS_18580 2000 2710 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806896.1 protein_id gnl|my_center|LOCUS_18580 2729 3475 gene locus_tag LOCUS_18590 2729 3475 CDS product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185598.1 protein_id gnl|my_center|LOCUS_18590 3650 4600 gene locus_tag LOCUS_18600 3650 4600 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788737.1 protein_id gnl|my_center|LOCUS_18600 4587 5438 gene locus_tag LOCUS_18610 4587 5438 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448285.1 protein_id gnl|my_center|LOCUS_18610 5438 6373 gene locus_tag LOCUS_18620 5438 6373 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815411.1 protein_id gnl|my_center|LOCUS_18620 6398 7288 gene locus_tag LOCUS_18630 6398 7288 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533957.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence169 1141 2037 gene locus_tag LOCUS_18640 1141 2037 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173543.1 protein_id gnl|my_center|LOCUS_18640 2034 2921 gene locus_tag LOCUS_18650 2034 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 2966 4726 gene locus_tag LOCUS_18660 2966 4726 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135176397.1 protein_id gnl|my_center|LOCUS_18660 4781 5164 gene locus_tag LOCUS_18670 4781 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 5221 6705 gene locus_tag LOCUS_18680 5221 6705 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243012.1 protein_id gnl|my_center|LOCUS_18680 <7494 6733 gene locus_tag LOCUS_18690 <7494 6733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257832.1:quinone oxidoreductase >Feature sequence170 <1 999 gene locus_tag LOCUS_18700 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902212.1:TRAP transporter large permease 996 2033 gene locus_tag LOCUS_18710 996 2033 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973464.1 protein_id gnl|my_center|LOCUS_18710 2030 3046 gene locus_tag LOCUS_18720 2030 3046 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975777.1 protein_id gnl|my_center|LOCUS_18720 3393 3662 gene locus_tag LOCUS_18730 3393 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 3700 4062 gene locus_tag LOCUS_18740 3700 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 5138 4170 gene locus_tag LOCUS_18750 5138 4170 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329741.1 protein_id gnl|my_center|LOCUS_18750 6376 5186 gene locus_tag LOCUS_18760 6376 5186 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226918.1 protein_id gnl|my_center|LOCUS_18760 6909 6373 gene locus_tag LOCUS_18770 6909 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence171 1108 194 gene locus_tag LOCUS_18780 1108 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1475 1200 gene locus_tag LOCUS_18790 1475 1200 CDS product DUF3567 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189087.1 protein_id gnl|my_center|LOCUS_18790 2318 1536 gene locus_tag LOCUS_18800 2318 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 2590 2799 gene locus_tag LOCUS_18810 2590 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 2957 3964 gene locus_tag LOCUS_18820 2957 3964 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536264.1 protein_id gnl|my_center|LOCUS_18820 4244 3990 gene locus_tag LOCUS_18830 4244 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18830 4984 4553 gene locus_tag LOCUS_18840 4984 4553 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313628.1 protein_id gnl|my_center|LOCUS_18840 5118 5996 gene locus_tag LOCUS_18850 5118 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 5993 7267 gene locus_tag LOCUS_18860 5993 7267 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence172 222 1889 gene locus_tag LOCUS_18870 222 1889 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764923.1 protein_id gnl|my_center|LOCUS_18870 3388 1892 gene locus_tag LOCUS_18880 3388 1892 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970709.1 protein_id gnl|my_center|LOCUS_18880 3871 3407 gene locus_tag LOCUS_18890 3871 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 4776 3868 gene locus_tag LOCUS_18900 4776 3868 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969884.1 protein_id gnl|my_center|LOCUS_18900 5968 4949 gene locus_tag LOCUS_18910 5968 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 7385 6471 gene locus_tag LOCUS_18920 7385 6471 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194310.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence173 1979 666 gene locus_tag LOCUS_18930 1979 666 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063709.1 protein_id gnl|my_center|LOCUS_18930 2542 1976 gene locus_tag LOCUS_18940 2542 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 3526 2555 gene locus_tag LOCUS_18950 3526 2555 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253036.1 protein_id gnl|my_center|LOCUS_18950 4113 3706 gene locus_tag LOCUS_18960 4113 3706 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253940.1 protein_id gnl|my_center|LOCUS_18960 5541 4168 gene locus_tag LOCUS_18970 5541 4168 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253941.1 protein_id gnl|my_center|LOCUS_18970 6632 5571 gene locus_tag LOCUS_18980 6632 5571 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272527.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence174 <1 746 gene locus_tag LOCUS_18990 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530236.1:glucose-6-phosphate dehydrogenase 746 1525 gene locus_tag LOCUS_19000 gene pgl 746 1525 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266837.1 protein_id gnl|my_center|LOCUS_19000 1548 2555 gene locus_tag LOCUS_19010 1548 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 3809 2661 gene locus_tag LOCUS_19020 3809 2661 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407996.1 protein_id gnl|my_center|LOCUS_19020 4789 3872 gene locus_tag LOCUS_19030 4789 3872 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 protein_id gnl|my_center|LOCUS_19030 5847 4789 gene locus_tag LOCUS_19040 5847 4789 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 protein_id gnl|my_center|LOCUS_19040 7384 5834 gene locus_tag LOCUS_19050 7384 5834 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184304236.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence175 948 94 gene locus_tag LOCUS_19060 948 94 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927226.1 protein_id gnl|my_center|LOCUS_19060 1049 2188 gene locus_tag LOCUS_19070 1049 2188 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 protein_id gnl|my_center|LOCUS_19070 3022 2225 gene locus_tag LOCUS_19080 gene tatC 3022 2225 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815810.1 protein_id gnl|my_center|LOCUS_19080 3549 3070 gene locus_tag LOCUS_19090 gene tatB 3549 3070 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531855.1 protein_id gnl|my_center|LOCUS_19090 3843 3592 gene locus_tag LOCUS_19100 gene tatA 3843 3592 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 protein_id gnl|my_center|LOCUS_19100 4355 3984 gene locus_tag LOCUS_19110 4355 3984 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815807.1 protein_id gnl|my_center|LOCUS_19110 4738 4352 gene locus_tag LOCUS_19120 4738 4352 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207864.1 protein_id gnl|my_center|LOCUS_19120 5166 4777 gene locus_tag LOCUS_19130 5166 4777 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202813.1 protein_id gnl|my_center|LOCUS_19130 5558 5163 gene locus_tag LOCUS_19140 gene hisI 5558 5163 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201279.1 protein_id gnl|my_center|LOCUS_19140 6387 5608 gene locus_tag LOCUS_19150 gene hisF 6387 5608 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_19150 7194 6454 gene locus_tag LOCUS_19160 gene hisA 7194 6454 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199906.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence176 2472 1147 gene locus_tag LOCUS_19170 2472 1147 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965985.1 protein_id gnl|my_center|LOCUS_19170 3254 2490 gene locus_tag LOCUS_19180 3254 2490 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086187.1 protein_id gnl|my_center|LOCUS_19180 4039 3251 gene locus_tag LOCUS_19190 4039 3251 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965976.1 protein_id gnl|my_center|LOCUS_19190 5292 4036 gene locus_tag LOCUS_19200 5292 4036 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086214.1 protein_id gnl|my_center|LOCUS_19200 6461 5289 gene locus_tag LOCUS_19210 6461 5289 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086213.1 protein_id gnl|my_center|LOCUS_19210 <7427 6458 gene locus_tag LOCUS_19220 <7427 6458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965984.1:ATP-dependent acyl-CoA ligase >Feature sequence177 <1 603 gene locus_tag LOCUS_19230 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190040.1:lysophospholipid acyltransferase family protein 747 1730 gene locus_tag LOCUS_19240 747 1730 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 protein_id gnl|my_center|LOCUS_19240 2819 1752 gene locus_tag LOCUS_19250 2819 1752 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815946.1 protein_id gnl|my_center|LOCUS_19250 2965 3378 gene locus_tag LOCUS_19260 2965 3378 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929528.1 protein_id gnl|my_center|LOCUS_19260 3412 3858 gene locus_tag LOCUS_19270 3412 3858 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337636.1 protein_id gnl|my_center|LOCUS_19270 3929 5110 gene locus_tag LOCUS_19280 3929 5110 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815950.1 protein_id gnl|my_center|LOCUS_19280 5167 5772 gene locus_tag LOCUS_19290 gene can 5167 5772 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368205.1 protein_id gnl|my_center|LOCUS_19290 6047 7228 gene locus_tag LOCUS_19300 6047 7228 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818204.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence178 1711 2388 gene locus_tag LOCUS_19310 1711 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 2832 3212 gene locus_tag LOCUS_19320 2832 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 3384 4454 gene locus_tag LOCUS_19330 gene rfbB 3384 4454 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_19330 4451 5341 gene locus_tag LOCUS_19340 gene rfbD 4451 5341 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706708.1 protein_id gnl|my_center|LOCUS_19340 5352 6239 gene locus_tag LOCUS_19350 gene rfbA 5352 6239 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_19350 6242 6787 gene locus_tag LOCUS_19360 gene rfbC 6242 6787 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_19360 6911 7279 gene locus_tag LOCUS_19370 6911 7279 CDS product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813062.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence179 952 326 gene locus_tag LOCUS_19380 gene rsmD 952 326 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522861.1 protein_id gnl|my_center|LOCUS_19380 2262 949 gene locus_tag LOCUS_19390 2262 949 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958524.1 protein_id gnl|my_center|LOCUS_19390 3882 2371 gene locus_tag LOCUS_19400 3882 2371 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_19400 4129 5103 gene locus_tag LOCUS_19410 4129 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 5748 5122 gene locus_tag LOCUS_19420 5748 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 6448 5750 gene locus_tag LOCUS_19430 6448 5750 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_19430 6648 7025 gene locus_tag LOCUS_19440 6648 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 >Feature sequence180 4 348 gene locus_tag LOCUS_19450 4 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 1452 364 gene locus_tag LOCUS_19460 1452 364 CDS product DUF3616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037817.1 protein_id gnl|my_center|LOCUS_19460 1675 1902 gene locus_tag LOCUS_19470 1675 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1914 2237 gene locus_tag LOCUS_19480 1914 2237 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214977.1 protein_id gnl|my_center|LOCUS_19480 2617 2270 gene locus_tag LOCUS_19490 2617 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 3114 2614 gene locus_tag LOCUS_19500 3114 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 3961 3152 gene locus_tag LOCUS_19510 3961 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 5142 3958 gene locus_tag LOCUS_19520 5142 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 6205 5147 gene locus_tag LOCUS_19530 6205 5147 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198645.1 protein_id gnl|my_center|LOCUS_19530 7050 6223 gene locus_tag LOCUS_19540 7050 6223 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence181 203 1435 gene locus_tag LOCUS_19550 gene glcE 203 1435 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_19550 1435 2670 gene locus_tag LOCUS_19560 gene glcF 1435 2670 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522135.1 protein_id gnl|my_center|LOCUS_19560 2987 4270 gene locus_tag LOCUS_19570 2987 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929157.1 protein_id gnl|my_center|LOCUS_19570 4267 5439 gene locus_tag LOCUS_19580 4267 5439 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_19580 5591 5866 gene locus_tag LOCUS_19590 5591 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 5863 6258 gene locus_tag LOCUS_19600 5863 6258 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972683.1 protein_id gnl|my_center|LOCUS_19600 6784 6299 gene locus_tag LOCUS_19610 6784 6299 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192400.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence182 <1 1177 gene locus_tag LOCUS_19620 <1 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000221779.1:glycine betaine ABC transporter permease YehY 1174 2103 gene locus_tag LOCUS_19630 1174 2103 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210802.1 protein_id gnl|my_center|LOCUS_19630 2105 2881 gene locus_tag LOCUS_19640 2105 2881 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824854.1 protein_id gnl|my_center|LOCUS_19640 3724 2990 gene locus_tag LOCUS_19650 3724 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 4494 5318 gene locus_tag LOCUS_19660 4494 5318 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_19660 5315 6280 gene locus_tag LOCUS_19670 5315 6280 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083775.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence183 <1 533 gene locus_tag LOCUS_19680 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033446517.1:uroporphyrinogen-III synthase 707 516 gene locus_tag LOCUS_19690 707 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 773 1750 gene locus_tag LOCUS_19700 773 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 1785 3053 gene locus_tag LOCUS_19710 1785 3053 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526333.1 protein_id gnl|my_center|LOCUS_19710 6473 3315 gene locus_tag LOCUS_19720 6473 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19720 >Feature sequence184 182 1210 gene locus_tag LOCUS_19730 182 1210 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809986.1 protein_id gnl|my_center|LOCUS_19730 2007 1231 gene locus_tag LOCUS_19740 2007 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 2931 2017 gene locus_tag LOCUS_19750 2931 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 3215 4660 gene locus_tag LOCUS_19760 3215 4660 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941769.1 protein_id gnl|my_center|LOCUS_19760 5325 4669 gene locus_tag LOCUS_19770 5325 4669 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463747.1 protein_id gnl|my_center|LOCUS_19770 5459 5989 gene locus_tag LOCUS_19780 5459 5989 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206035.1 protein_id gnl|my_center|LOCUS_19780 6089 7081 gene locus_tag LOCUS_19790 6089 7081 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807628.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence185 1067 216 gene locus_tag LOCUS_19800 gene folD 1067 216 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192825.1 protein_id gnl|my_center|LOCUS_19800 1771 1151 gene locus_tag LOCUS_19810 gene fixJ 1771 1151 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_19810 4251 1816 gene locus_tag LOCUS_19820 gene fixL 4251 1816 CDS product oxygen sensor histidine kinase FixL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557112.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence186 1348 167 gene locus_tag LOCUS_19830 1348 167 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529519.1 protein_id gnl|my_center|LOCUS_19830 1620 2249 gene locus_tag LOCUS_19840 gene coq7 1620 2249 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194286.1 protein_id gnl|my_center|LOCUS_19840 2792 2331 gene locus_tag LOCUS_19850 2792 2331 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549988.1 protein_id gnl|my_center|LOCUS_19850 3548 3072 gene locus_tag LOCUS_19860 3548 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 3850 3551 gene locus_tag LOCUS_19870 3850 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 3961 5592 gene locus_tag LOCUS_19880 gene ilvA 3961 5592 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_19880 5966 6937 gene locus_tag LOCUS_19890 5966 6937 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence187 1034 87 gene locus_tag LOCUS_19900 1034 87 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521226.1 protein_id gnl|my_center|LOCUS_19900 1088 2605 gene locus_tag LOCUS_19910 gene xdhA 1088 2605 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527625.1 protein_id gnl|my_center|LOCUS_19910 2602 4911 gene locus_tag LOCUS_19920 gene xdhB 2602 4911 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522221.1 protein_id gnl|my_center|LOCUS_19920 5020 5319 gene locus_tag LOCUS_19930 5020 5319 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529138.1 protein_id gnl|my_center|LOCUS_19930 5316 5486 gene locus_tag LOCUS_19940 5316 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 5483 6910 gene locus_tag LOCUS_19950 5483 6910 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_19950 >Feature sequence188 359 1081 gene locus_tag LOCUS_19960 359 1081 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218867.1 protein_id gnl|my_center|LOCUS_19960 1109 2137 gene locus_tag LOCUS_19970 1109 2137 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 protein_id gnl|my_center|LOCUS_19970 2291 2974 gene locus_tag LOCUS_19980 2291 2974 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086623.1 protein_id gnl|my_center|LOCUS_19980 2997 3926 gene locus_tag LOCUS_19990 2997 3926 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 protein_id gnl|my_center|LOCUS_19990 4068 4505 gene locus_tag LOCUS_20000 4068 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 4508 5389 gene locus_tag LOCUS_20010 4508 5389 CDS product gallate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 protein_id gnl|my_center|LOCUS_20010 5430 5711 gene locus_tag LOCUS_20020 5430 5711 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_20020 5728 6030 gene locus_tag LOCUS_20030 5728 6030 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739893.1 protein_id gnl|my_center|LOCUS_20030 6083 7033 gene locus_tag LOCUS_20040 6083 7033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence189 <1 2100 gene locus_tag LOCUS_20050 <1 2100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067720.1:YDG domain-containing protein 2769 2143 gene locus_tag LOCUS_20060 2769 2143 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081157.1 protein_id gnl|my_center|LOCUS_20060 4349 2766 gene locus_tag LOCUS_20070 gene pgi 4349 2766 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888377.1 protein_id gnl|my_center|LOCUS_20070 5296 4346 gene locus_tag LOCUS_20080 gene tal 5296 4346 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533671.1 protein_id gnl|my_center|LOCUS_20080 5410 6258 gene locus_tag LOCUS_20090 gene hexR 5410 6258 CDS product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688727.1 protein_id gnl|my_center|LOCUS_20090 <7080 6275 gene locus_tag LOCUS_20100 <7080 6275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838970.1:DUF3047 domain-containing protein >Feature sequence190 3204 70 gene locus_tag LOCUS_20110 3204 70 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040502.1 protein_id gnl|my_center|LOCUS_20110 4773 3277 gene locus_tag LOCUS_20120 4773 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 5479 4994 gene locus_tag LOCUS_20130 gene rnhA 5479 4994 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_20130 6389 5568 gene locus_tag LOCUS_20140 6389 5568 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence191 112 1968 gene locus_tag LOCUS_20150 112 1968 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173455.1 protein_id gnl|my_center|LOCUS_20150 2053 3078 gene locus_tag LOCUS_20160 2053 3078 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035573.1 protein_id gnl|my_center|LOCUS_20160 3206 4525 gene locus_tag LOCUS_20170 3206 4525 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194166.1 protein_id gnl|my_center|LOCUS_20170 6868 4625 gene locus_tag LOCUS_20180 6868 4625 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114258.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence192 301 2145 gene locus_tag LOCUS_20190 gene atsA 301 2145 CDS product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106692.1 protein_id gnl|my_center|LOCUS_20190 2142 3494 gene locus_tag LOCUS_20200 2142 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 4598 3705 gene locus_tag LOCUS_20210 gene cysW 4598 3705 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813328.1 protein_id gnl|my_center|LOCUS_20210 5413 4595 gene locus_tag LOCUS_20220 gene cysT 5413 4595 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942000.1 protein_id gnl|my_center|LOCUS_20220 6415 5417 gene locus_tag LOCUS_20230 6415 5417 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522973.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence193 <1 1677 gene locus_tag LOCUS_20240 <1 1677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550186.1:M3 family metallopeptidase 2618 1719 gene locus_tag LOCUS_20250 2618 1719 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408081.1 protein_id gnl|my_center|LOCUS_20250 2880 3614 gene locus_tag LOCUS_20260 gene rutB 2880 3614 CDS product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307708.1 protein_id gnl|my_center|LOCUS_20260 3611 4660 gene locus_tag LOCUS_20270 3611 4660 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 protein_id gnl|my_center|LOCUS_20270 4716 5924 gene locus_tag LOCUS_20280 4716 5924 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819167.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence194 2958 3461 gene locus_tag LOCUS_20290 gene ssb 2958 3461 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_20290 4573 3662 gene locus_tag LOCUS_20300 4573 3662 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080429.1 protein_id gnl|my_center|LOCUS_20300 5236 4634 gene locus_tag LOCUS_20310 gene paaY 5236 4634 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096750.1 protein_id gnl|my_center|LOCUS_20310 5388 6188 gene locus_tag LOCUS_20320 gene paaG 5388 6188 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969790.1 protein_id gnl|my_center|LOCUS_20320 6204 6641 gene locus_tag LOCUS_20330 gene paaI 6204 6641 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence195 296 1279 gene locus_tag LOCUS_20340 296 1279 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927008.1 protein_id gnl|my_center|LOCUS_20340 1301 1984 gene locus_tag LOCUS_20350 1301 1984 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925693.1 protein_id gnl|my_center|LOCUS_20350 2967 2050 gene locus_tag LOCUS_20360 2967 2050 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767508.1 protein_id gnl|my_center|LOCUS_20360 3079 4017 gene locus_tag LOCUS_20370 3079 4017 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392167.1 protein_id gnl|my_center|LOCUS_20370 4052 5023 gene locus_tag LOCUS_20380 4052 5023 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813902.1 protein_id gnl|my_center|LOCUS_20380 5001 5735 gene locus_tag LOCUS_20390 5001 5735 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705315.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence196 2202 940 gene locus_tag LOCUS_20400 2202 940 CDS product 3-hydroxybenzoate 6-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150113.1 protein_id gnl|my_center|LOCUS_20400 2290 3339 gene locus_tag LOCUS_20410 2290 3339 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113256.1 protein_id gnl|my_center|LOCUS_20410 3676 4662 gene locus_tag LOCUS_20420 3676 4662 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020699611.1 protein_id gnl|my_center|LOCUS_20420 4853 5833 gene locus_tag LOCUS_20430 4853 5833 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372821.1 protein_id gnl|my_center|LOCUS_20430 5842 6546 gene locus_tag LOCUS_20440 5842 6546 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088789.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence197 1073 435 gene locus_tag LOCUS_20450 1073 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 1788 1459 gene locus_tag LOCUS_20460 1788 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 2626 1772 gene locus_tag LOCUS_20470 2626 1772 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_20470 2768 3745 gene locus_tag LOCUS_20480 2768 3745 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809986.1 protein_id gnl|my_center|LOCUS_20480 4396 3845 gene locus_tag LOCUS_20490 4396 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 4848 4402 gene locus_tag LOCUS_20500 4848 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 5430 6665 gene locus_tag LOCUS_20510 gene lplT 5430 6665 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813878.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence198 1962 766 gene locus_tag LOCUS_20520 gene pncB 1962 766 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192078.1 protein_id gnl|my_center|LOCUS_20520 2341 1985 gene locus_tag LOCUS_20530 2341 1985 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 protein_id gnl|my_center|LOCUS_20530 2999 2352 gene locus_tag LOCUS_20540 2999 2352 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810083.1 protein_id gnl|my_center|LOCUS_20540 3771 2992 gene locus_tag LOCUS_20550 3771 2992 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810082.1 protein_id gnl|my_center|LOCUS_20550 5642 3768 gene locus_tag LOCUS_20560 5642 3768 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086607.1 protein_id gnl|my_center|LOCUS_20560 6400 5678 gene locus_tag LOCUS_20570 6400 5678 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207546.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence199 3150 2218 gene locus_tag LOCUS_20580 3150 2218 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057121.1 protein_id gnl|my_center|LOCUS_20580 3370 3546 gene locus_tag LOCUS_20590 3370 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 3855 4949 gene locus_tag LOCUS_20600 gene dusA 3855 4949 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009920631.1 protein_id gnl|my_center|LOCUS_20600 6221 4953 gene locus_tag LOCUS_20610 6221 4953 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063812.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence200 <1 1378 gene locus_tag LOCUS_20620 <1 1378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338110.1:chlorophyllide a reductase subunit Y 1375 2871 gene locus_tag LOCUS_20630 gene bchZ 1375 2871 CDS product chlorophyllide a reductase subunit Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390726.1 protein_id gnl|my_center|LOCUS_20630 3122 3409 gene locus_tag LOCUS_20640 3122 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 3421 3618 gene locus_tag LOCUS_20650 3421 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 3763 4602 gene locus_tag LOCUS_20660 gene pufL 3763 4602 CDS product photosynthetic reaction center subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390723.1 protein_id gnl|my_center|LOCUS_20660 4618 5595 gene locus_tag LOCUS_20670 gene pufM 4618 5595 CDS product photosynthetic reaction center subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390722.1 protein_id gnl|my_center|LOCUS_20670 5595 6689 gene locus_tag LOCUS_20680 5595 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 >Feature sequence201 874 425 gene locus_tag LOCUS_20690 874 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 2003 864 gene locus_tag LOCUS_20700 2003 864 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926482.1 protein_id gnl|my_center|LOCUS_20700 2766 2011 gene locus_tag LOCUS_20710 2766 2011 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085532.1 protein_id gnl|my_center|LOCUS_20710 3199 2822 gene locus_tag LOCUS_20720 3199 2822 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065002.1 protein_id gnl|my_center|LOCUS_20720 4228 3422 gene locus_tag LOCUS_20730 4228 3422 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085496.1 protein_id gnl|my_center|LOCUS_20730 4717 4247 gene locus_tag LOCUS_20740 4717 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 5967 4714 gene locus_tag LOCUS_20750 5967 4714 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190694.1 protein_id gnl|my_center|LOCUS_20750 6476 6057 gene locus_tag LOCUS_20760 6476 6057 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028144578.1 protein_id gnl|my_center|LOCUS_20760 >Feature sequence202 648 487 gene locus_tag LOCUS_20770 648 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20770 934 1860 gene locus_tag LOCUS_20780 934 1860 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_20780 3607 1862 gene locus_tag LOCUS_20790 3607 1862 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695901.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20790 3811 3650 gene locus_tag LOCUS_20800 3811 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 4983 3937 gene locus_tag LOCUS_20810 4983 3937 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_20810 5615 5325 gene locus_tag LOCUS_20820 5615 5325 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526806.1 protein_id gnl|my_center|LOCUS_20820 5889 5632 gene locus_tag LOCUS_20830 5889 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20830 >Feature sequence203 539 282 gene locus_tag LOCUS_20840 539 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 588 1229 gene locus_tag LOCUS_20850 588 1229 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463751.1 protein_id gnl|my_center|LOCUS_20850 1542 2666 gene locus_tag LOCUS_20860 gene fic 1542 2666 CDS product adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073937.1 protein_id gnl|my_center|LOCUS_20860 3746 2757 gene locus_tag LOCUS_20870 3746 2757 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064844.1 protein_id gnl|my_center|LOCUS_20870 4674 3802 gene locus_tag LOCUS_20880 4674 3802 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814441.1 protein_id gnl|my_center|LOCUS_20880 5198 4671 gene locus_tag LOCUS_20890 5198 4671 CDS product Isopropylmalate/citramalate isomerase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870790.1 protein_id gnl|my_center|LOCUS_20890 6463 5195 gene locus_tag LOCUS_20900 gene leuC 6463 5195 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880579.1 protein_id gnl|my_center|LOCUS_20900 >Feature sequence204 <1 966 gene locus_tag LOCUS_20910 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065064.1:thioredoxin-disulfide reductase 1198 1395 gene locus_tag LOCUS_20920 gene rpmB 1198 1395 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186391.1 protein_id gnl|my_center|LOCUS_20920 1407 1574 gene locus_tag LOCUS_20930 gene rpmG 1407 1574 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810296.1 protein_id gnl|my_center|LOCUS_20930 2917 1718 gene locus_tag LOCUS_20940 2917 1718 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812548.1 protein_id gnl|my_center|LOCUS_20940 4351 3098 gene locus_tag LOCUS_20950 4351 3098 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522602.1 protein_id gnl|my_center|LOCUS_20950 4393 4653 gene locus_tag LOCUS_20960 4393 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 4883 6493 gene locus_tag LOCUS_20970 4883 6493 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815895.1 protein_id gnl|my_center|LOCUS_20970 >Feature sequence205 1638 1117 gene locus_tag LOCUS_20980 1638 1117 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930615.1 protein_id gnl|my_center|LOCUS_20980 2676 1669 gene locus_tag LOCUS_20990 2676 1669 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089913.1 protein_id gnl|my_center|LOCUS_20990 3570 2815 gene locus_tag LOCUS_21000 3570 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 3642 5024 gene locus_tag LOCUS_21010 3642 5024 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545534.1 protein_id gnl|my_center|LOCUS_21010 5021 6310 gene locus_tag LOCUS_21020 5021 6310 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339249.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence206 1315 557 gene locus_tag LOCUS_21030 1315 557 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_21030 2287 1325 gene locus_tag LOCUS_21040 gene cbbX 2287 1325 CDS product CbbX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975098.1 protein_id gnl|my_center|LOCUS_21040 2742 2308 gene locus_tag LOCUS_21050 2742 2308 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532057.1 protein_id gnl|my_center|LOCUS_21050 4240 2756 gene locus_tag LOCUS_21060 4240 2756 CDS product ribulose-bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532056.1 protein_id gnl|my_center|LOCUS_21060 4344 5324 gene locus_tag LOCUS_21070 4344 5324 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390154.1 protein_id gnl|my_center|LOCUS_21070 5948 5373 gene locus_tag LOCUS_21080 5948 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 6517 5945 gene locus_tag LOCUS_21090 6517 5945 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206517.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence207 950 714 gene locus_tag LOCUS_21100 950 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 1716 1078 gene locus_tag LOCUS_21110 gene ompW 1716 1078 CDS product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925667.1 protein_id gnl|my_center|LOCUS_21110 2932 1742 gene locus_tag LOCUS_21120 2932 1742 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552487.1 protein_id gnl|my_center|LOCUS_21120 4257 3283 gene locus_tag LOCUS_21130 4257 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 4574 4254 gene locus_tag LOCUS_21140 4574 4254 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810732.1 protein_id gnl|my_center|LOCUS_21140 4734 4597 gene locus_tag LOCUS_21150 4734 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 4898 5152 gene locus_tag LOCUS_21160 4898 5152 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614401.1 protein_id gnl|my_center|LOCUS_21160 5159 5566 gene locus_tag LOCUS_21170 5159 5566 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_21170 6137 5721 gene locus_tag LOCUS_21180 6137 5721 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969926.1 protein_id gnl|my_center|LOCUS_21180 6349 6149 gene locus_tag LOCUS_21190 6349 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 >Feature sequence208 1795 3141 gene locus_tag LOCUS_21200 gene argA 1795 3141 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 protein_id gnl|my_center|LOCUS_21200 3884 3372 gene locus_tag LOCUS_21210 3884 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 3895 6036 gene locus_tag LOCUS_21220 gene rpoD 3895 6036 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190933.1 protein_id gnl|my_center|LOCUS_21220 >Feature sequence209 <1 576 gene locus_tag LOCUS_21230 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195450.1:IclR family transcriptional regulator 584 2257 gene locus_tag LOCUS_21240 584 2257 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524004.1 protein_id gnl|my_center|LOCUS_21240 2262 3077 gene locus_tag LOCUS_21250 2262 3077 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551585.1 protein_id gnl|my_center|LOCUS_21250 3089 4558 gene locus_tag LOCUS_21260 3089 4558 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939933.1 protein_id gnl|my_center|LOCUS_21260 4574 4909 gene locus_tag LOCUS_21270 4574 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112908.1 protein_id gnl|my_center|LOCUS_21270 4948 5727 gene locus_tag LOCUS_21280 4948 5727 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053361.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence210 216 2348 gene locus_tag LOCUS_21290 216 2348 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_21290 2472 3272 gene locus_tag LOCUS_21300 2472 3272 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266418.1 protein_id gnl|my_center|LOCUS_21300 3282 4406 gene locus_tag LOCUS_21310 gene moaA 3282 4406 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532083.1 protein_id gnl|my_center|LOCUS_21310 4450 5061 gene locus_tag LOCUS_21320 gene mobA 4450 5061 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446521.1 protein_id gnl|my_center|LOCUS_21320 5058 6338 gene locus_tag LOCUS_21330 5058 6338 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039620.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence211 429 965 gene locus_tag LOCUS_21340 429 965 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243841.1 protein_id gnl|my_center|LOCUS_21340 982 2262 gene locus_tag LOCUS_21350 982 2262 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243758.1 protein_id gnl|my_center|LOCUS_21350 2339 3340 gene locus_tag LOCUS_21360 2339 3340 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 protein_id gnl|my_center|LOCUS_21360 3413 4459 gene locus_tag LOCUS_21370 3413 4459 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192249737.1 protein_id gnl|my_center|LOCUS_21370 4491 4931 gene locus_tag LOCUS_21380 gene aroQ 4491 4931 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942665.1 protein_id gnl|my_center|LOCUS_21380 4928 5761 gene locus_tag LOCUS_21390 4928 5761 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367002.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence212 291 1505 gene locus_tag LOCUS_21400 291 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 1534 2172 gene locus_tag LOCUS_21410 1534 2172 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_21410 2321 3724 gene locus_tag LOCUS_21420 2321 3724 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088478.1 protein_id gnl|my_center|LOCUS_21420 3731 4600 gene locus_tag LOCUS_21430 gene ntrB 3731 4600 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967199.1 protein_id gnl|my_center|LOCUS_21430 4662 5456 gene locus_tag LOCUS_21440 4662 5456 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088476.1 protein_id gnl|my_center|LOCUS_21440 5494 5937 gene locus_tag LOCUS_21450 gene cynS 5494 5937 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088475.1 protein_id gnl|my_center|LOCUS_21450 6244 5951 gene locus_tag LOCUS_21460 6244 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence213 443 892 gene locus_tag LOCUS_21470 443 892 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_21470 911 1306 gene locus_tag LOCUS_21480 911 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 1331 2293 gene locus_tag LOCUS_21490 1331 2293 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808634.1 protein_id gnl|my_center|LOCUS_21490 2323 3303 gene locus_tag LOCUS_21500 2323 3303 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_21500 4509 3535 gene locus_tag LOCUS_21510 4509 3535 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064939.1 protein_id gnl|my_center|LOCUS_21510 4970 4596 gene locus_tag LOCUS_21520 4970 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 5764 4991 gene locus_tag LOCUS_21530 5764 4991 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064245.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence214 2625 796 gene locus_tag LOCUS_21540 2625 796 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_21540 3652 2723 gene locus_tag LOCUS_21550 3652 2723 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064585.1 protein_id gnl|my_center|LOCUS_21550 4549 3800 gene locus_tag LOCUS_21560 4549 3800 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930110.1 protein_id gnl|my_center|LOCUS_21560 6072 4750 gene locus_tag LOCUS_21570 6072 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 >Feature sequence215 2368 1241 gene locus_tag LOCUS_21580 gene bamB 2368 1241 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193323.1 protein_id gnl|my_center|LOCUS_21580 3081 2365 gene locus_tag LOCUS_21590 3081 2365 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193441.1 protein_id gnl|my_center|LOCUS_21590 4514 3204 gene locus_tag LOCUS_21600 gene hisS 4514 3204 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521334.1 protein_id gnl|my_center|LOCUS_21600 5844 4567 gene locus_tag LOCUS_21610 gene ispG 5844 4567 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527159.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence216 1423 449 gene locus_tag LOCUS_21620 1423 449 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813988.1 protein_id gnl|my_center|LOCUS_21620 2655 1597 gene locus_tag LOCUS_21630 2655 1597 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812403.1 protein_id gnl|my_center|LOCUS_21630 3982 2684 gene locus_tag LOCUS_21640 3982 2684 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812401.1 protein_id gnl|my_center|LOCUS_21640 4449 3979 gene locus_tag LOCUS_21650 4449 3979 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812400.1 protein_id gnl|my_center|LOCUS_21650 4548 5567 gene locus_tag LOCUS_21660 4548 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21660 >Feature sequence217 <1 899 gene locus_tag LOCUS_21670 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004535897.1:bifunctional riboflavin kinase/FAD synthetase 1023 3875 gene locus_tag LOCUS_21680 gene ileS 1023 3875 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185348.1 protein_id gnl|my_center|LOCUS_21680 3875 4381 gene locus_tag LOCUS_21690 gene lspA 3875 4381 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186086.1 protein_id gnl|my_center|LOCUS_21690 4467 5246 gene locus_tag LOCUS_21700 4467 5246 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728415.1 protein_id gnl|my_center|LOCUS_21700 5336 6196 gene locus_tag LOCUS_21710 5336 6196 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence218 2445 127 gene locus_tag LOCUS_21720 2445 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2585 3442 gene locus_tag LOCUS_21730 2585 3442 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818173.1 protein_id gnl|my_center|LOCUS_21730 3475 4170 gene locus_tag LOCUS_21740 3475 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 4632 4381 gene locus_tag LOCUS_21750 4632 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 <6168 5058 gene locus_tag LOCUS_21760 <6168 5058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040321.1:MmgE/PrpD family protein >Feature sequence219 758 48 gene locus_tag LOCUS_21770 758 48 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974959.1 protein_id gnl|my_center|LOCUS_21770 1752 829 gene locus_tag LOCUS_21780 1752 829 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089136.1 protein_id gnl|my_center|LOCUS_21780 2307 1945 gene locus_tag LOCUS_21790 2307 1945 CDS product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313912.1 protein_id gnl|my_center|LOCUS_21790 2397 3125 gene locus_tag LOCUS_21800 2397 3125 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204015.1 protein_id gnl|my_center|LOCUS_21800 3195 5414 gene locus_tag LOCUS_21810 3195 5414 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925701.1 protein_id gnl|my_center|LOCUS_21810 5592 5897 gene locus_tag LOCUS_21820 5592 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence220 197 892 gene locus_tag LOCUS_21830 197 892 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 protein_id gnl|my_center|LOCUS_21830 889 2259 gene locus_tag LOCUS_21840 889 2259 CDS product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267055.1 protein_id gnl|my_center|LOCUS_21840 2397 2852 gene locus_tag LOCUS_21850 2397 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2845 3084 gene locus_tag LOCUS_21860 2845 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 4170 3094 gene locus_tag LOCUS_21870 gene thiE 4170 3094 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205266.1 protein_id gnl|my_center|LOCUS_21870 4985 4164 gene locus_tag LOCUS_21880 4985 4164 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221723.1 protein_id gnl|my_center|LOCUS_21880 5192 4995 gene locus_tag LOCUS_21890 gene thiS 5192 4995 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199938.1 protein_id gnl|my_center|LOCUS_21890 <6135 5199 gene locus_tag LOCUS_21900 <6135 5199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004202820.1:FAD-dependent oxidoreductase >Feature sequence221 568 1521 gene locus_tag LOCUS_21910 568 1521 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185661.1 protein_id gnl|my_center|LOCUS_21910 1607 3286 gene locus_tag LOCUS_21920 1607 3286 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 protein_id gnl|my_center|LOCUS_21920 3280 3510 gene locus_tag LOCUS_21930 3280 3510 CDS product DUF2783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064480.1 protein_id gnl|my_center|LOCUS_21930 5435 3750 gene locus_tag LOCUS_21940 5435 3750 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence222 1883 1671 gene locus_tag LOCUS_21950 1883 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 3630 1987 gene locus_tag LOCUS_21960 3630 1987 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189684.1 protein_id gnl|my_center|LOCUS_21960 4116 4412 gene locus_tag LOCUS_21970 4116 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 5170 4529 gene locus_tag LOCUS_21980 5170 4529 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040654.1 protein_id gnl|my_center|LOCUS_21980 5931 5206 gene locus_tag LOCUS_21990 5931 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 >Feature sequence223 959 2170 gene locus_tag LOCUS_22000 959 2170 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808413.1 protein_id gnl|my_center|LOCUS_22000 3372 2206 gene locus_tag LOCUS_22010 3372 2206 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063903.1 protein_id gnl|my_center|LOCUS_22010 5023 3401 gene locus_tag LOCUS_22020 5023 3401 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 protein_id gnl|my_center|LOCUS_22020 5993 5058 gene locus_tag LOCUS_22030 5993 5058 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521279.1 protein_id gnl|my_center|LOCUS_22030 >Feature sequence224 1138 368 gene locus_tag LOCUS_22040 1138 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 1463 2593 gene locus_tag LOCUS_22050 1463 2593 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251937.1 protein_id gnl|my_center|LOCUS_22050 2668 3291 gene locus_tag LOCUS_22060 2668 3291 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810992.1 protein_id gnl|my_center|LOCUS_22060 3288 5255 gene locus_tag LOCUS_22070 3288 5255 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930517.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence225 1193 219 gene locus_tag LOCUS_22080 1193 219 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266314.1 protein_id gnl|my_center|LOCUS_22080 1777 1277 gene locus_tag LOCUS_22090 1777 1277 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_22090 3426 1774 gene locus_tag LOCUS_22100 3426 1774 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086825.1 protein_id gnl|my_center|LOCUS_22100 3785 3423 gene locus_tag LOCUS_22110 3785 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 5104 3782 gene locus_tag LOCUS_22120 5104 3782 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 protein_id gnl|my_center|LOCUS_22120 5820 5104 gene locus_tag LOCUS_22130 5820 5104 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089217.1 protein_id gnl|my_center|LOCUS_22130 >Feature sequence226 <1 771 gene locus_tag LOCUS_22140 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390154.1:LysR family transcriptional regulator 2089 851 gene locus_tag LOCUS_22150 2089 851 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_22150 2285 2539 gene locus_tag LOCUS_22160 2285 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 2881 3171 gene locus_tag LOCUS_22170 2881 3171 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_22170 3545 3456 gene locus_tag LOCUS_t00200 3545 3456 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3969 4673 gene locus_tag LOCUS_22180 3969 4673 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195593.1 protein_id gnl|my_center|LOCUS_22180 4769 5425 gene locus_tag LOCUS_22190 4769 5425 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918530.1 protein_id gnl|my_center|LOCUS_22190 >Feature sequence227 145 435 gene locus_tag LOCUS_22200 145 435 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389943.1 protein_id gnl|my_center|LOCUS_22200 432 779 gene locus_tag LOCUS_22210 432 779 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_22210 1224 1529 gene locus_tag LOCUS_22220 1224 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 1548 1838 gene locus_tag LOCUS_22230 1548 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 1982 2302 gene locus_tag LOCUS_22240 1982 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 2299 3603 gene locus_tag LOCUS_22250 2299 3603 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173917.1 protein_id gnl|my_center|LOCUS_22250 3789 4247 gene locus_tag LOCUS_22260 3789 4247 CDS product mobile mystery protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974879.1 protein_id gnl|my_center|LOCUS_22260 4251 4838 gene locus_tag LOCUS_22270 4251 4838 CDS product mobile mystery protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942040.1 protein_id gnl|my_center|LOCUS_22270 5928 4972 gene locus_tag LOCUS_22280 5928 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence228 2037 1600 gene locus_tag LOCUS_22290 2037 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2270 2034 gene locus_tag LOCUS_22300 2270 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 4344 2374 gene locus_tag LOCUS_22310 gene parE 4344 2374 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185934.1 protein_id gnl|my_center|LOCUS_22310 4575 5765 gene locus_tag LOCUS_22320 4575 5765 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_22320 5778 5915 gene locus_tag LOCUS_22330 5778 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence229 284 1153 gene locus_tag LOCUS_22340 284 1153 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064968.1 protein_id gnl|my_center|LOCUS_22340 1636 1172 gene locus_tag LOCUS_22350 1636 1172 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185972.1 protein_id gnl|my_center|LOCUS_22350 2269 1679 gene locus_tag LOCUS_22360 2269 1679 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930239.1 protein_id gnl|my_center|LOCUS_22360 2581 2285 gene locus_tag LOCUS_22370 2581 2285 CDS product DUF2818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185355.1 protein_id gnl|my_center|LOCUS_22370 4117 2615 gene locus_tag LOCUS_22380 gene nuoN 4117 2615 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_22380 5629 4154 gene locus_tag LOCUS_22390 5629 4154 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_22390 >Feature sequence230 175 732 gene locus_tag LOCUS_22400 175 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 776 1957 gene locus_tag LOCUS_22410 776 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 1957 2463 gene locus_tag LOCUS_22420 1957 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2592 3692 gene locus_tag LOCUS_22430 2592 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 3698 3973 gene locus_tag LOCUS_22440 3698 3973 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941037.1 protein_id gnl|my_center|LOCUS_22440 4279 4653 gene locus_tag LOCUS_22450 4279 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 4842 5144 gene locus_tag LOCUS_22460 4842 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 5207 5608 gene locus_tag LOCUS_22470 5207 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence231 1620 277 gene locus_tag LOCUS_22480 1620 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2721 1639 gene locus_tag LOCUS_22490 2721 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 3889 2759 gene locus_tag LOCUS_22500 3889 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 5622 3886 gene locus_tag LOCUS_22510 5622 3886 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_22510 >Feature sequence232 734 204 gene locus_tag LOCUS_22520 734 204 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336873.1 protein_id gnl|my_center|LOCUS_22520 1750 731 gene locus_tag LOCUS_22530 1750 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 2131 2388 gene locus_tag LOCUS_22540 2131 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 2546 3502 gene locus_tag LOCUS_22550 2546 3502 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812927.1 protein_id gnl|my_center|LOCUS_22550 3605 4816 gene locus_tag LOCUS_22560 3605 4816 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814920.1 protein_id gnl|my_center|LOCUS_22560 5735 4833 gene locus_tag LOCUS_22570 5735 4833 CDS product MOSC N-terminal beta barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194630.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence233 65 1084 gene locus_tag LOCUS_22580 65 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 1407 1213 gene locus_tag LOCUS_22590 1407 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 2093 2371 gene locus_tag LOCUS_22600 2093 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 2368 2523 gene locus_tag LOCUS_22610 2368 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2966 3709 gene locus_tag LOCUS_22620 2966 3709 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813874.1 protein_id gnl|my_center|LOCUS_22620 4189 3713 gene locus_tag LOCUS_22630 4189 3713 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809250.1 protein_id gnl|my_center|LOCUS_22630 4478 5308 gene locus_tag LOCUS_22640 4478 5308 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269030.1 protein_id gnl|my_center|LOCUS_22640 <5868 5361 gene locus_tag LOCUS_22650 <5868 5361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005763108.1:urea ABC transporter ATP-binding subunit UrtE >Feature sequence234 2205 205 gene locus_tag LOCUS_22660 2205 205 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038717.1 protein_id gnl|my_center|LOCUS_22660 2242 2874 gene locus_tag LOCUS_22670 2242 2874 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197233.1 protein_id gnl|my_center|LOCUS_22670 4203 3328 gene locus_tag LOCUS_22680 4203 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 4231 5646 gene locus_tag LOCUS_22690 gene glmU 4231 5646 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064821.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence235 215 2317 gene locus_tag LOCUS_22700 gene flhA 215 2317 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_22700 2376 4139 gene locus_tag LOCUS_22710 2376 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 4136 4957 gene locus_tag LOCUS_22720 4136 4957 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010374294.1 protein_id gnl|my_center|LOCUS_22720 4972 5727 gene locus_tag LOCUS_22730 4972 5727 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457739.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence236 104 577 gene locus_tag LOCUS_22740 104 577 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193328.1 protein_id gnl|my_center|LOCUS_22740 632 1726 gene locus_tag LOCUS_22750 gene aroC 632 1726 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534774.1 protein_id gnl|my_center|LOCUS_22750 1741 2928 gene locus_tag LOCUS_22760 1741 2928 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207024.1 protein_id gnl|my_center|LOCUS_22760 5113 3296 gene locus_tag LOCUS_22770 5113 3296 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193654.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence237 1242 529 gene locus_tag LOCUS_22780 1242 529 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446410.1 protein_id gnl|my_center|LOCUS_22780 2012 1239 gene locus_tag LOCUS_22790 2012 1239 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040563.1 protein_id gnl|my_center|LOCUS_22790 3016 2009 gene locus_tag LOCUS_22800 3016 2009 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_22800 3937 3023 gene locus_tag LOCUS_22810 3937 3023 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815013.1 protein_id gnl|my_center|LOCUS_22810 5224 4043 gene locus_tag LOCUS_22820 5224 4043 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815015.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence238 161 928 gene locus_tag LOCUS_22830 161 928 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971780.1 protein_id gnl|my_center|LOCUS_22830 2071 968 gene locus_tag LOCUS_22840 2071 968 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 protein_id gnl|my_center|LOCUS_22840 2346 2119 gene locus_tag LOCUS_22850 2346 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 5047 2504 gene locus_tag LOCUS_22860 5047 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 5725 5051 gene locus_tag LOCUS_22870 5725 5051 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020493338.1 protein_id gnl|my_center|LOCUS_22870 >Feature sequence239 3 218 gene locus_tag LOCUS_22880 3 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 218 1297 gene locus_tag LOCUS_22890 218 1297 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919057.1 protein_id gnl|my_center|LOCUS_22890 1322 2755 gene locus_tag LOCUS_22900 1322 2755 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529049.1 protein_id gnl|my_center|LOCUS_22900 2757 3614 gene locus_tag LOCUS_22910 2757 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 4284 3643 gene locus_tag LOCUS_22920 4284 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 >Feature sequence240 1668 241 gene locus_tag LOCUS_22930 gene thrC 1668 241 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192708.1 protein_id gnl|my_center|LOCUS_22930 3005 1668 gene locus_tag LOCUS_22940 3005 1668 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 protein_id gnl|my_center|LOCUS_22940 4325 3069 gene locus_tag LOCUS_22950 4325 3069 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527177.1 protein_id gnl|my_center|LOCUS_22950 4521 4919 gene locus_tag LOCUS_22960 4521 4919 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 protein_id gnl|my_center|LOCUS_22960 5110 5586 gene locus_tag LOCUS_22970 5110 5586 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence241 1173 175 gene locus_tag LOCUS_22980 1173 175 CDS product CobD/CbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195964.1 protein_id gnl|my_center|LOCUS_22980 1920 1240 gene locus_tag LOCUS_22990 1920 1240 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550123.1 protein_id gnl|my_center|LOCUS_22990 2382 2017 gene locus_tag LOCUS_23000 gene rplS 2382 2017 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217809.1 protein_id gnl|my_center|LOCUS_23000 3295 2528 gene locus_tag LOCUS_23010 gene trmD 3295 2528 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040081.1 protein_id gnl|my_center|LOCUS_23010 3917 3327 gene locus_tag LOCUS_23020 gene rimM 3917 3327 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527496.1 protein_id gnl|my_center|LOCUS_23020 4189 3929 gene locus_tag LOCUS_23030 gene rpsP 4189 3929 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189402.1 protein_id gnl|my_center|LOCUS_23030 4346 4879 gene locus_tag LOCUS_23040 4346 4879 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104495.1 protein_id gnl|my_center|LOCUS_23040 4943 5398 gene locus_tag LOCUS_23050 4943 5398 CDS product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550121.1 protein_id gnl|my_center|LOCUS_23050 >Feature sequence242 <1 563 gene locus_tag LOCUS_23060 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390122.1:PQQ-dependent sugar dehydrogenase 679 1524 gene locus_tag LOCUS_23070 gene asd 679 1524 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357921.1 protein_id gnl|my_center|LOCUS_23070 1676 2134 gene locus_tag LOCUS_23080 1676 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 2131 2436 gene locus_tag LOCUS_23090 2131 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2830 3018 gene locus_tag LOCUS_23100 2830 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 3461 4123 gene locus_tag LOCUS_23110 3461 4123 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814899.1 protein_id gnl|my_center|LOCUS_23110 >Feature sequence243 184 834 gene locus_tag LOCUS_23120 184 834 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072952.1 protein_id gnl|my_center|LOCUS_23120 1349 1549 gene locus_tag LOCUS_23130 1349 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 1900 1637 gene locus_tag LOCUS_23140 gene minE 1900 1637 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814252.1 protein_id gnl|my_center|LOCUS_23140 2716 1901 gene locus_tag LOCUS_23150 gene minD 2716 1901 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185427.1 protein_id gnl|my_center|LOCUS_23150 3617 2814 gene locus_tag LOCUS_23160 gene minC 3617 2814 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522312.1 protein_id gnl|my_center|LOCUS_23160 4033 3806 gene locus_tag LOCUS_23170 4033 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 4970 4140 gene locus_tag LOCUS_23180 4970 4140 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113348.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence244 <1 501 gene locus_tag LOCUS_23190 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002120879.1:IclR family transcriptional regulator PcaU 1078 590 gene locus_tag LOCUS_23200 1078 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 2157 1339 gene locus_tag LOCUS_23210 2157 1339 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813022.1 protein_id gnl|my_center|LOCUS_23210 2815 2480 gene locus_tag LOCUS_23220 2815 2480 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039082.1 protein_id gnl|my_center|LOCUS_23220 3054 2812 gene locus_tag LOCUS_23230 3054 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 3432 5408 gene locus_tag LOCUS_23240 3432 5408 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087534.1 protein_id gnl|my_center|LOCUS_23240 >Feature sequence245 131 391 gene locus_tag LOCUS_23250 131 391 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814042.1 protein_id gnl|my_center|LOCUS_23250 388 2484 gene locus_tag LOCUS_23260 388 2484 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814040.1 protein_id gnl|my_center|LOCUS_23260 2590 2952 gene locus_tag LOCUS_23270 gene rpsF 2590 2952 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193673.1 protein_id gnl|my_center|LOCUS_23270 3011 3298 gene locus_tag LOCUS_23280 gene priB 3011 3298 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813095.1 protein_id gnl|my_center|LOCUS_23280 3309 3593 gene locus_tag LOCUS_23290 gene rpsR 3309 3593 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813094.1 protein_id gnl|my_center|LOCUS_23290 3606 4058 gene locus_tag LOCUS_23300 gene rplI 3606 4058 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191711.1 protein_id gnl|my_center|LOCUS_23300 4245 4033 gene locus_tag LOCUS_23310 4245 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence246 21 677 gene locus_tag LOCUS_23320 21 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 2899 680 gene locus_tag LOCUS_23330 2899 680 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399866.1 protein_id gnl|my_center|LOCUS_23330 3381 2896 gene locus_tag LOCUS_23340 3381 2896 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730866.1 protein_id gnl|my_center|LOCUS_23340 4163 3378 gene locus_tag LOCUS_23350 4163 3378 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970338.1 protein_id gnl|my_center|LOCUS_23350 4260 4565 gene locus_tag LOCUS_23360 4260 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 >Feature sequence247 203 487 gene locus_tag LOCUS_23370 203 487 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918377.1 protein_id gnl|my_center|LOCUS_23370 471 740 gene locus_tag LOCUS_23380 471 740 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918376.1 protein_id gnl|my_center|LOCUS_23380 1641 805 gene locus_tag LOCUS_23390 1641 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2380 1880 gene locus_tag LOCUS_23400 2380 1880 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236777.1 protein_id gnl|my_center|LOCUS_23400 2383 2700 gene locus_tag LOCUS_23410 2383 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 4567 2690 gene locus_tag LOCUS_23420 4567 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence248 <1 509 gene locus_tag LOCUS_23430 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198896.1:succinyldiaminopimelate transaminase 518 1345 gene locus_tag LOCUS_23440 gene dapD 518 1345 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191680.1 protein_id gnl|my_center|LOCUS_23440 1353 2510 gene locus_tag LOCUS_23450 gene dapE 1353 2510 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521179.1 protein_id gnl|my_center|LOCUS_23450 2507 3397 gene locus_tag LOCUS_23460 gene prmB 2507 3397 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930547.1 protein_id gnl|my_center|LOCUS_23460 3423 5363 gene locus_tag LOCUS_23470 3423 5363 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531442.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence249 845 769 gene locus_tag LOCUS_t00210 845 769 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1711 923 gene locus_tag LOCUS_23480 1711 923 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 protein_id gnl|my_center|LOCUS_23480 3573 1819 gene locus_tag LOCUS_23490 3573 1819 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931383.1 protein_id gnl|my_center|LOCUS_23490 4319 3579 gene locus_tag LOCUS_23500 4319 3579 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186871.1 protein_id gnl|my_center|LOCUS_23500 5440 4328 gene locus_tag LOCUS_23510 5440 4328 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521997.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence250 139 1776 gene locus_tag LOCUS_23520 139 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 2907 2080 gene locus_tag LOCUS_23530 gene hpnC 2907 2080 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 protein_id gnl|my_center|LOCUS_23530 3108 3326 gene locus_tag LOCUS_23540 3108 3326 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943111.1 protein_id gnl|my_center|LOCUS_23540 3645 4796 gene locus_tag LOCUS_23550 gene mexJ 3645 4796 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113855.1 protein_id gnl|my_center|LOCUS_23550 >Feature sequence251 <1 780 gene locus_tag LOCUS_23560 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202410.1:Fic family protein 957 1103 gene locus_tag LOCUS_23570 957 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 1340 1906 gene locus_tag LOCUS_23580 gene grpE 1340 1906 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194243.1 protein_id gnl|my_center|LOCUS_23580 2000 3988 gene locus_tag LOCUS_23590 gene dnaK 2000 3988 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039219.1 protein_id gnl|my_center|LOCUS_23590 4127 5290 gene locus_tag LOCUS_23600 gene dnaJ 4127 5290 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522147.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence252 930 337 gene locus_tag LOCUS_23610 gene gmhB 930 337 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522791.1 protein_id gnl|my_center|LOCUS_23610 3074 945 gene locus_tag LOCUS_23620 gene glyS 3074 945 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189008.1 protein_id gnl|my_center|LOCUS_23620 3994 3080 gene locus_tag LOCUS_23630 gene glyQ 3994 3080 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189444.1 protein_id gnl|my_center|LOCUS_23630 <5511 4105 gene locus_tag LOCUS_23640 <5511 4105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064331.1:apolipoprotein N-acyltransferase >Feature sequence253 3182 1476 gene locus_tag LOCUS_23650 3182 1476 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810103.1 protein_id gnl|my_center|LOCUS_23650 4149 3790 gene locus_tag LOCUS_23660 4149 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 4727 4158 gene locus_tag LOCUS_23670 4727 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 <5479 4752 gene locus_tag LOCUS_23680 <5479 4752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004529973.1:copper oxidase >Feature sequence254 1403 531 gene locus_tag LOCUS_23690 gene htpX 1403 531 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813142.1 protein_id gnl|my_center|LOCUS_23690 2274 1504 gene locus_tag LOCUS_23700 2274 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 3330 2299 gene locus_tag LOCUS_23710 gene pyrC 3330 2299 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_23710 3551 3880 gene locus_tag LOCUS_23720 gene groES 3551 3880 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186661.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence255 2162 3124 gene locus_tag LOCUS_23730 2162 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23730 3242 3487 gene locus_tag LOCUS_23740 3242 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 3760 4854 gene locus_tag LOCUS_23750 3760 4854 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567739.1 protein_id gnl|my_center|LOCUS_23750 >Feature sequence256 <1 1020 gene locus_tag LOCUS_23760 <1 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004552132.1:S8 family peptidase 1017 1541 gene locus_tag LOCUS_23770 1017 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 1586 2749 gene locus_tag LOCUS_23780 1586 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 2842 3777 gene locus_tag LOCUS_23790 gene rpoH 2842 3777 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522872.1 protein_id gnl|my_center|LOCUS_23790 3899 4888 gene locus_tag LOCUS_23800 3899 4888 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807415.1 protein_id gnl|my_center|LOCUS_23800 <5419 4898 gene locus_tag LOCUS_23810 <5419 4898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197988.1:SCO family protein >Feature sequence257 45 347 gene locus_tag LOCUS_23820 45 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 385 660 gene locus_tag LOCUS_23830 385 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 647 1048 gene locus_tag LOCUS_23840 647 1048 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971327.1 protein_id gnl|my_center|LOCUS_23840 1215 2360 gene locus_tag LOCUS_23850 1215 2360 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807953.1 protein_id gnl|my_center|LOCUS_23850 2479 3261 gene locus_tag LOCUS_23860 2479 3261 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_23860 3275 5278 gene locus_tag LOCUS_23870 3275 5278 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555739.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence258 <1 1677 gene locus_tag LOCUS_23880 <1 1677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393464.1:hydantoinase B/oxoprolinase family protein 1686 2096 gene locus_tag LOCUS_23890 1686 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 2129 3109 gene locus_tag LOCUS_23900 2129 3109 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_23900 3820 5004 gene locus_tag LOCUS_23910 3820 5004 CDS product IS4-like element IS421 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300563.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence259 114 878 gene locus_tag LOCUS_23920 114 878 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122046.1 protein_id gnl|my_center|LOCUS_23920 1031 1987 gene locus_tag LOCUS_23930 1031 1987 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085864.1 protein_id gnl|my_center|LOCUS_23930 2000 2437 gene locus_tag LOCUS_23940 2000 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 2479 3798 gene locus_tag LOCUS_23950 gene hmgA 2479 3798 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194851.1 protein_id gnl|my_center|LOCUS_23950 3900 5087 gene locus_tag LOCUS_23960 3900 5087 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039906.1 protein_id gnl|my_center|LOCUS_23960 >Feature sequence260 474 1463 gene locus_tag LOCUS_23970 474 1463 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813988.1 protein_id gnl|my_center|LOCUS_23970 1507 3300 gene locus_tag LOCUS_23980 1507 3300 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399880.1 protein_id gnl|my_center|LOCUS_23980 3446 4900 gene locus_tag LOCUS_23990 3446 4900 CDS product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039291.1 protein_id gnl|my_center|LOCUS_23990 >Feature sequence261 1484 132 gene locus_tag LOCUS_24000 1484 132 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811151.1 protein_id gnl|my_center|LOCUS_24000 1607 2590 gene locus_tag LOCUS_24010 1607 2590 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810803.1 protein_id gnl|my_center|LOCUS_24010 2587 3948 gene locus_tag LOCUS_24020 2587 3948 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243160.1 protein_id gnl|my_center|LOCUS_24020 3972 4943 gene locus_tag LOCUS_24030 3972 4943 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812334.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence262 963 55 gene locus_tag LOCUS_24040 963 55 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814620.1 protein_id gnl|my_center|LOCUS_24040 2085 1009 gene locus_tag LOCUS_24050 2085 1009 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808265.1 protein_id gnl|my_center|LOCUS_24050 2109 2843 gene locus_tag LOCUS_24060 2109 2843 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_24060 2989 2840 gene locus_tag LOCUS_24070 2989 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 3048 3365 gene locus_tag LOCUS_24080 3048 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 4404 3394 gene locus_tag LOCUS_24090 4404 3394 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041244087.1 protein_id gnl|my_center|LOCUS_24090 >Feature sequence263 982 464 gene locus_tag LOCUS_24100 982 464 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193985.1 protein_id gnl|my_center|LOCUS_24100 982 1665 gene locus_tag LOCUS_24110 982 1665 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193119.1 protein_id gnl|my_center|LOCUS_24110 1824 3740 gene locus_tag LOCUS_24120 gene ftsH 1824 3740 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809623.1 protein_id gnl|my_center|LOCUS_24120 3813 4667 gene locus_tag LOCUS_24130 gene folP 3813 4667 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence264 1267 2190 gene locus_tag LOCUS_24140 1267 2190 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064999.1 protein_id gnl|my_center|LOCUS_24140 2187 2948 gene locus_tag LOCUS_24150 gene pcaD 2187 2948 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337348.1 protein_id gnl|my_center|LOCUS_24150 <5297 3060 gene locus_tag LOCUS_24160 <5297 3060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208315.1:PhoX family phosphatase >Feature sequence265 942 781 gene locus_tag LOCUS_24170 942 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 1394 933 gene locus_tag LOCUS_24180 1394 933 CDS product mobile mystery protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942039.1 protein_id gnl|my_center|LOCUS_24180 1608 1880 gene locus_tag LOCUS_24190 1608 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 2971 1961 gene locus_tag LOCUS_24200 2971 1961 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064098.1 protein_id gnl|my_center|LOCUS_24200 5026 3044 gene locus_tag LOCUS_24210 5026 3044 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114537.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence266 <1 1044 gene locus_tag LOCUS_24220 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015923330.1:citrate/2-methylcitrate synthase 2378 1086 gene locus_tag LOCUS_24230 2378 1086 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267305.1 protein_id gnl|my_center|LOCUS_24230 3625 2390 gene locus_tag LOCUS_24240 gene arsJ 3625 2390 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331467.1 protein_id gnl|my_center|LOCUS_24240 4674 3625 gene locus_tag LOCUS_24250 4674 3625 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255924.1 protein_id gnl|my_center|LOCUS_24250 4828 5130 gene locus_tag LOCUS_24260 4828 5130 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence267 2065 815 gene locus_tag LOCUS_24270 2065 815 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 protein_id gnl|my_center|LOCUS_24270 3305 2082 gene locus_tag LOCUS_24280 3305 2082 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141940.1 protein_id gnl|my_center|LOCUS_24280 4440 3406 gene locus_tag LOCUS_24290 4440 3406 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275492.1 protein_id gnl|my_center|LOCUS_24290 >Feature sequence268 1688 621 gene locus_tag LOCUS_24300 1688 621 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027335.1 protein_id gnl|my_center|LOCUS_24300 2127 2576 gene locus_tag LOCUS_24310 2127 2576 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173534.1 protein_id gnl|my_center|LOCUS_24310 3366 2614 gene locus_tag LOCUS_24320 3366 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 3761 3985 gene locus_tag LOCUS_24330 3761 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 4139 4393 gene locus_tag LOCUS_24340 4139 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 4403 4597 gene locus_tag LOCUS_24350 4403 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence269 <1 1120 gene locus_tag LOCUS_24360 <1 1120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706842.1:gamma-glutamyltransferase 1143 3098 gene locus_tag LOCUS_24370 1143 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 3361 3741 gene locus_tag LOCUS_24380 3361 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 4832 4134 gene locus_tag LOCUS_24390 4832 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence270 98 721 gene locus_tag LOCUS_24400 98 721 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_24400 1331 897 gene locus_tag LOCUS_24410 1331 897 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957536.1 protein_id gnl|my_center|LOCUS_24410 2582 1602 gene locus_tag LOCUS_24420 2582 1602 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372821.1 protein_id gnl|my_center|LOCUS_24420 3408 2614 gene locus_tag LOCUS_24430 3408 2614 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869263.1 protein_id gnl|my_center|LOCUS_24430 3684 4997 gene locus_tag LOCUS_24440 3684 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 >Feature sequence271 757 107 gene locus_tag LOCUS_24450 757 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 1528 830 gene locus_tag LOCUS_24460 gene radC 1528 830 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203904.1 protein_id gnl|my_center|LOCUS_24460 1655 2137 gene locus_tag LOCUS_24470 1655 2137 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186190.1 protein_id gnl|my_center|LOCUS_24470 2134 3084 gene locus_tag LOCUS_24480 gene ispH 2134 3084 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186453.1 protein_id gnl|my_center|LOCUS_24480 3139 4473 gene locus_tag LOCUS_24490 gene serS 3139 4473 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 protein_id gnl|my_center|LOCUS_24490 4645 4457 gene locus_tag LOCUS_24500 4645 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 4596 4937 gene locus_tag LOCUS_24510 4596 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 5040 5129 gene locus_tag LOCUS_t00220 5040 5129 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence272 1592 225 gene locus_tag LOCUS_24520 gene yjjJ 1592 225 CDS product type II toxin-antitoxin system HipA family toxin YjjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035780.1 protein_id gnl|my_center|LOCUS_24520 1908 3290 gene locus_tag LOCUS_24530 1908 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 4316 3390 gene locus_tag LOCUS_24540 gene thiD 4316 3390 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202801.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence273 2524 2066 gene locus_tag LOCUS_24550 2524 2066 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965172.1 protein_id gnl|my_center|LOCUS_24550 2720 3772 gene locus_tag LOCUS_24560 gene bchI 2720 3772 CDS product magnesium chelatase ATPase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625950.1 protein_id gnl|my_center|LOCUS_24560 >Feature sequence274 1126 350 gene locus_tag LOCUS_24570 1126 350 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 protein_id gnl|my_center|LOCUS_24570 1932 1366 gene locus_tag LOCUS_24580 1932 1366 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202737.1 protein_id gnl|my_center|LOCUS_24580 3120 2179 gene locus_tag LOCUS_24590 3120 2179 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817216.1 protein_id gnl|my_center|LOCUS_24590 3161 4075 gene locus_tag LOCUS_24600 3161 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 4112 4339 gene locus_tag LOCUS_24610 4112 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 4421 5110 gene locus_tag LOCUS_24620 gene phoP 4421 5110 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210917.1 protein_id gnl|my_center|LOCUS_24620 >Feature sequence275 <1 537 gene locus_tag LOCUS_24630 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186393.1:NADH-quinone oxidoreductase subunit NuoG 534 1595 gene locus_tag LOCUS_24640 gene nuoH 534 1595 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813926.1 protein_id gnl|my_center|LOCUS_24640 1592 2116 gene locus_tag LOCUS_24650 gene nuoI 1592 2116 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186558.1 protein_id gnl|my_center|LOCUS_24650 2202 2852 gene locus_tag LOCUS_24660 2202 2852 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_24660 2849 3157 gene locus_tag LOCUS_24670 gene nuoK 2849 3157 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813920.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence276 <1 812 gene locus_tag LOCUS_24680 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807629.1:xanthine dehydrogenase family protein subunit M 809 1315 gene locus_tag LOCUS_24690 809 1315 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807630.1 protein_id gnl|my_center|LOCUS_24690 1302 3665 gene locus_tag LOCUS_24700 1302 3665 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807632.1 protein_id gnl|my_center|LOCUS_24700 3715 4698 gene locus_tag LOCUS_24710 3715 4698 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064939.1 protein_id gnl|my_center|LOCUS_24710 >Feature sequence277 1240 89 gene locus_tag LOCUS_24720 1240 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 4068 1237 gene locus_tag LOCUS_24730 4068 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 4777 4076 gene locus_tag LOCUS_24740 4777 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 >Feature sequence278 2410 377 gene locus_tag LOCUS_24750 gene mrdA 2410 377 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 protein_id gnl|my_center|LOCUS_24750 2995 2477 gene locus_tag LOCUS_24760 gene mreD 2995 2477 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523092.1 protein_id gnl|my_center|LOCUS_24760 3933 2992 gene locus_tag LOCUS_24770 gene mreC 3933 2992 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 protein_id gnl|my_center|LOCUS_24770 5015 3972 gene locus_tag LOCUS_24780 5015 3972 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence279 298 59 gene locus_tag LOCUS_24790 298 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 833 375 gene locus_tag LOCUS_24800 833 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 951 1466 gene locus_tag LOCUS_24810 951 1466 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391482.1 protein_id gnl|my_center|LOCUS_24810 1463 1939 gene locus_tag LOCUS_24820 1463 1939 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169553.1 protein_id gnl|my_center|LOCUS_24820 2047 2790 gene locus_tag LOCUS_24830 2047 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24830 4819 3317 gene locus_tag LOCUS_24840 4819 3317 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315176.1 protein_id gnl|my_center|LOCUS_24840 5039 4824 gene locus_tag LOCUS_24850 5039 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 >Feature sequence280 770 279 gene locus_tag LOCUS_24860 770 279 CDS product DUF6152 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808351.1 protein_id gnl|my_center|LOCUS_24860 1202 783 gene locus_tag LOCUS_24870 1202 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927660.1 protein_id gnl|my_center|LOCUS_24870 2139 1741 gene locus_tag LOCUS_24880 gene crcB 2139 1741 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 protein_id gnl|my_center|LOCUS_24880 3453 2143 gene locus_tag LOCUS_24890 3453 2143 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811093.1 protein_id gnl|my_center|LOCUS_24890 4023 3463 gene locus_tag LOCUS_24900 4023 3463 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811089.1 protein_id gnl|my_center|LOCUS_24900 5010 4033 gene locus_tag LOCUS_24910 5010 4033 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930616.1 protein_id gnl|my_center|LOCUS_24910 >Feature sequence281 246 908 gene locus_tag LOCUS_24920 246 908 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522956.1 protein_id gnl|my_center|LOCUS_24920 946 2079 gene locus_tag LOCUS_24930 946 2079 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207123.1 protein_id gnl|my_center|LOCUS_24930 2105 2533 gene locus_tag LOCUS_24940 2105 2533 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089431.1 protein_id gnl|my_center|LOCUS_24940 2599 2928 gene locus_tag LOCUS_24950 2599 2928 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039223.1 protein_id gnl|my_center|LOCUS_24950 3331 3717 gene locus_tag LOCUS_24960 3331 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 3714 4355 gene locus_tag LOCUS_24970 3714 4355 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390496.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence282 1289 396 gene locus_tag LOCUS_24980 gene asd 1289 396 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089371.1 protein_id gnl|my_center|LOCUS_24980 2953 1286 gene locus_tag LOCUS_24990 2953 1286 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089372.1 protein_id gnl|my_center|LOCUS_24990 3563 2955 gene locus_tag LOCUS_25000 3563 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089373.1 protein_id gnl|my_center|LOCUS_25000 3726 4919 gene locus_tag LOCUS_25010 3726 4919 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_25010 >Feature sequence283 <1 616 gene locus_tag LOCUS_25020 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186121.1:NADH-quinone oxidoreductase subunit C 644 1897 gene locus_tag LOCUS_25030 644 1897 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_25030 1905 2399 gene locus_tag LOCUS_25040 gene nuoE 1905 2399 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185492.1 protein_id gnl|my_center|LOCUS_25040 2396 3751 gene locus_tag LOCUS_25050 gene nuoF 2396 3751 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_25050 >Feature sequence284 2098 578 gene locus_tag LOCUS_25060 2098 578 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200059.1 protein_id gnl|my_center|LOCUS_25060 2206 3159 gene locus_tag LOCUS_25070 2206 3159 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811205.1 protein_id gnl|my_center|LOCUS_25070 3211 3732 gene locus_tag LOCUS_25080 3211 3732 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 protein_id gnl|my_center|LOCUS_25080 4473 3742 gene locus_tag LOCUS_25090 4473 3742 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397690.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence285 672 1103 gene locus_tag LOCUS_25100 672 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 2147 1128 gene locus_tag LOCUS_25110 2147 1128 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 protein_id gnl|my_center|LOCUS_25110 2790 2236 gene locus_tag LOCUS_25120 2790 2236 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_25120 3581 2853 gene locus_tag LOCUS_25130 3581 2853 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812732.1 protein_id gnl|my_center|LOCUS_25130 3678 4133 gene locus_tag LOCUS_25140 3678 4133 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966628.1 protein_id gnl|my_center|LOCUS_25140 4450 4148 gene locus_tag LOCUS_25150 4450 4148 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087723.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence286 <1 938 gene locus_tag LOCUS_25160 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524724.1:IscS subfamily cysteine desulfurase 1020 1412 gene locus_tag LOCUS_25170 gene iscU 1020 1412 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812460.1 protein_id gnl|my_center|LOCUS_25170 1465 1788 gene locus_tag LOCUS_25180 gene iscA 1465 1788 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_25180 1810 2328 gene locus_tag LOCUS_25190 gene hscB 1810 2328 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 protein_id gnl|my_center|LOCUS_25190 2427 4289 gene locus_tag LOCUS_25200 gene hscA 2427 4289 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938156.1 protein_id gnl|my_center|LOCUS_25200 4299 4637 gene locus_tag LOCUS_25210 gene fdx 4299 4637 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387062.1 protein_id gnl|my_center|LOCUS_25210 >Feature sequence287 1289 765 gene locus_tag LOCUS_25220 1289 765 CDS product DUF45 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940855.1 protein_id gnl|my_center|LOCUS_25220 2815 1286 gene locus_tag LOCUS_25230 gene lysS 2815 1286 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816835.1 protein_id gnl|my_center|LOCUS_25230 3581 2937 gene locus_tag LOCUS_25240 3581 2937 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812191.1 protein_id gnl|my_center|LOCUS_25240 4551 3679 gene locus_tag LOCUS_25250 gene accD 4551 3679 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence288 580 801 gene locus_tag LOCUS_25260 580 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 801 1205 gene locus_tag LOCUS_25270 801 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 1659 1396 gene locus_tag LOCUS_25280 1659 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 2434 1676 gene locus_tag LOCUS_25290 2434 1676 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730670.1 protein_id gnl|my_center|LOCUS_25290 3250 3086 gene locus_tag LOCUS_25300 3250 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 3998 3258 gene locus_tag LOCUS_25310 3998 3258 CDS product igiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895987.1 protein_id gnl|my_center|LOCUS_25310 4634 4002 gene locus_tag LOCUS_25320 4634 4002 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929893.1 protein_id gnl|my_center|LOCUS_25320 >Feature sequence289 1731 730 gene locus_tag LOCUS_25330 1731 730 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840243.1 protein_id gnl|my_center|LOCUS_25330 1844 2383 gene locus_tag LOCUS_25340 1844 2383 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114324.1 protein_id gnl|my_center|LOCUS_25340 2493 3206 gene locus_tag LOCUS_25350 2493 3206 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364547.1 protein_id gnl|my_center|LOCUS_25350 3619 3828 gene locus_tag LOCUS_25360 3619 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 >Feature sequence290 1481 873 gene locus_tag LOCUS_25370 1481 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 2269 1478 gene locus_tag LOCUS_25380 2269 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 3204 2461 gene locus_tag LOCUS_25390 gene pseF 3204 2461 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_25390 4409 3204 gene locus_tag LOCUS_25400 gene pseC 4409 3204 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence291 3100 383 gene locus_tag LOCUS_25410 3100 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence292 616 443 gene locus_tag LOCUS_25420 616 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 880 1047 gene locus_tag LOCUS_25430 880 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 1967 1515 gene locus_tag LOCUS_25440 1967 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 2104 2547 gene locus_tag LOCUS_25450 2104 2547 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389771.1 protein_id gnl|my_center|LOCUS_25450 2573 3430 gene locus_tag LOCUS_25460 gene cho 2573 3430 CDS product excinuclease Cho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097025.1 protein_id gnl|my_center|LOCUS_25460 3434 4732 gene locus_tag LOCUS_25470 gene umuC 3434 4732 CDS product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267005.1 protein_id gnl|my_center|LOCUS_25470 >Feature sequence293 385 179 gene locus_tag LOCUS_25480 385 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 761 426 gene locus_tag LOCUS_25490 761 426 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039907.1 protein_id gnl|my_center|LOCUS_25490 2054 822 gene locus_tag LOCUS_25500 2054 822 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015099.1 protein_id gnl|my_center|LOCUS_25500 2235 3485 gene locus_tag LOCUS_25510 2235 3485 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223123.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence294 312 1652 gene locus_tag LOCUS_25520 312 1652 CDS product leucine-rich repeat-containing protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895623.1 protein_id gnl|my_center|LOCUS_25520 2096 1842 gene locus_tag LOCUS_25530 2096 1842 CDS product Arc family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381346.1 protein_id gnl|my_center|LOCUS_25530 2248 2126 gene locus_tag LOCUS_25540 2248 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 2424 2245 gene locus_tag LOCUS_25550 2424 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 2710 3087 gene locus_tag LOCUS_25560 2710 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 >Feature sequence295 327 25 gene locus_tag LOCUS_25570 327 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 1359 346 gene locus_tag LOCUS_25580 gene rfaD 1359 346 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544120.1 protein_id gnl|my_center|LOCUS_25580 2315 1356 gene locus_tag LOCUS_25590 gene rfaE1 2315 1356 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189069.1 protein_id gnl|my_center|LOCUS_25590 3475 2330 gene locus_tag LOCUS_25600 gene lapB 3475 2330 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188993.1 protein_id gnl|my_center|LOCUS_25600 3773 3465 gene locus_tag LOCUS_25610 3773 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 4164 3856 gene locus_tag LOCUS_25620 4164 3856 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_25620 >Feature sequence296 1271 93 gene locus_tag LOCUS_25630 1271 93 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808121.1 protein_id gnl|my_center|LOCUS_25630 2321 1431 gene locus_tag LOCUS_25640 2321 1431 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482188.1 protein_id gnl|my_center|LOCUS_25640 3700 2330 gene locus_tag LOCUS_25650 gene pmbA 3700 2330 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814895.1 protein_id gnl|my_center|LOCUS_25650 3815 4372 gene locus_tag LOCUS_25660 gene yjgA 3815 4372 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101581.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence297 1447 704 gene locus_tag LOCUS_25670 gene ompR 1447 704 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207855.1 protein_id gnl|my_center|LOCUS_25670 3246 1444 gene locus_tag LOCUS_25680 3246 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 3488 3799 gene locus_tag LOCUS_25690 3488 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence298 202 1041 gene locus_tag LOCUS_25700 gene map 202 1041 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193235.1 protein_id gnl|my_center|LOCUS_25700 1074 3746 gene locus_tag LOCUS_25710 1074 3746 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544413.1 protein_id gnl|my_center|LOCUS_25710 3843 4307 gene locus_tag LOCUS_25720 3843 4307 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_25720 >Feature sequence299 634 1695 gene locus_tag LOCUS_25730 gene queA 634 1695 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665804.1 protein_id gnl|my_center|LOCUS_25730 2679 1699 gene locus_tag LOCUS_25740 2679 1699 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813988.1 protein_id gnl|my_center|LOCUS_25740 2742 3473 gene locus_tag LOCUS_25750 2742 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 >Feature sequence300 2266 1160 gene locus_tag LOCUS_25760 2266 1160 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810063.1 protein_id gnl|my_center|LOCUS_25760 2871 2263 gene locus_tag LOCUS_25770 gene gstA 2871 2263 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765749.1 protein_id gnl|my_center|LOCUS_25770 3337 3660 gene locus_tag LOCUS_25780 3337 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 <4597 3893 gene locus_tag LOCUS_25790 <4597 3893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192518.1:acetyl-CoA C-acyltransferase family protein >Feature sequence301 <1 1259 gene locus_tag LOCUS_25800 <1 1259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225694.1:MmgE/PrpD family protein 1388 2083 gene locus_tag LOCUS_25810 1388 2083 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537831.1 protein_id gnl|my_center|LOCUS_25810 2080 2994 gene locus_tag LOCUS_25820 2080 2994 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384692.1 protein_id gnl|my_center|LOCUS_25820 2991 3923 gene locus_tag LOCUS_25830 2991 3923 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384693.1 protein_id gnl|my_center|LOCUS_25830 3940 4497 gene locus_tag LOCUS_25840 3940 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 >Feature sequence302 758 1327 gene locus_tag LOCUS_25850 758 1327 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106702718.1 protein_id gnl|my_center|LOCUS_25850 >Feature sequence303 <1 884 gene locus_tag LOCUS_25860 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207765.1:DEAD/DEAH box helicase 1811 1026 gene locus_tag LOCUS_25870 gene xth 1811 1026 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812032.1 protein_id gnl|my_center|LOCUS_25870 2843 1878 gene locus_tag LOCUS_25880 gene gspK 2843 1878 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112726.1 protein_id gnl|my_center|LOCUS_25880 3562 2843 gene locus_tag LOCUS_25890 3562 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 3927 3559 gene locus_tag LOCUS_25900 3927 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 4382 3924 gene locus_tag LOCUS_25910 4382 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 >Feature sequence304 1626 505 gene locus_tag LOCUS_25920 gene lptF 1626 505 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 protein_id gnl|my_center|LOCUS_25920 1674 3221 gene locus_tag LOCUS_25930 1674 3221 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522572.1 protein_id gnl|my_center|LOCUS_25930 3218 3646 gene locus_tag LOCUS_25940 3218 3646 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522571.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence305 43 1563 gene locus_tag LOCUS_25950 43 1563 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815305.1 protein_id gnl|my_center|LOCUS_25950 1567 2346 gene locus_tag LOCUS_25960 1567 2346 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196422.1 protein_id gnl|my_center|LOCUS_25960 2470 3195 gene locus_tag LOCUS_25970 2470 3195 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107720.1 protein_id gnl|my_center|LOCUS_25970 3293 4366 gene locus_tag LOCUS_25980 3293 4366 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 protein_id gnl|my_center|LOCUS_25980 >Feature sequence306 698 796 gene locus_tag LOCUS_t00230 698 796 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 761 1651 gene locus_tag LOCUS_25990 761 1651 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815145.1 protein_id gnl|my_center|LOCUS_25990 3802 1868 gene locus_tag LOCUS_26000 3802 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 >Feature sequence307 <1 726 gene locus_tag LOCUS_26010 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532114.1:MoxR family ATPase 751 1938 gene locus_tag LOCUS_26020 751 1938 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337089.1 protein_id gnl|my_center|LOCUS_26020 2024 2605 gene locus_tag LOCUS_26030 2024 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 2619 3743 gene locus_tag LOCUS_26040 2619 3743 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525879.1 protein_id gnl|my_center|LOCUS_26040 >Feature sequence308 2450 951 gene locus_tag LOCUS_26050 2450 951 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549955.1 protein_id gnl|my_center|LOCUS_26050 4180 2447 gene locus_tag LOCUS_26060 4180 2447 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532007.1 protein_id gnl|my_center|LOCUS_26060 4455 4177 gene locus_tag LOCUS_26070 4455 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 >Feature sequence309 143 643 gene locus_tag LOCUS_26080 143 643 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142755.1 protein_id gnl|my_center|LOCUS_26080 802 1875 gene locus_tag LOCUS_26090 802 1875 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970133.1 protein_id gnl|my_center|LOCUS_26090 2028 2366 gene locus_tag LOCUS_26100 2028 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 2564 3013 gene locus_tag LOCUS_26110 2564 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 3598 3062 gene locus_tag LOCUS_26120 3598 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence310 158 844 gene locus_tag LOCUS_26130 158 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 1312 2628 gene locus_tag LOCUS_26140 1312 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26140 2769 3194 gene locus_tag LOCUS_26150 gene ndk 2769 3194 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_26150 >Feature sequence311 230 979 gene locus_tag LOCUS_26160 gene fliP 230 979 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549847.1 protein_id gnl|my_center|LOCUS_26160 994 1263 gene locus_tag LOCUS_26170 gene fliQ 994 1263 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199882.1 protein_id gnl|my_center|LOCUS_26170 1273 2046 gene locus_tag LOCUS_26180 gene fliR 1273 2046 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114278.1 protein_id gnl|my_center|LOCUS_26180 2060 3211 gene locus_tag LOCUS_26190 gene flhB 2060 3211 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence312 1195 338 gene locus_tag LOCUS_26200 1195 338 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815000.1 protein_id gnl|my_center|LOCUS_26200 1770 1192 gene locus_tag LOCUS_26210 1770 1192 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815019.1 protein_id gnl|my_center|LOCUS_26210 4131 1783 gene locus_tag LOCUS_26220 4131 1783 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086220.1 protein_id gnl|my_center|LOCUS_26220 >Feature sequence313 2552 1179 gene locus_tag LOCUS_26230 2552 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 >Feature sequence314 162 380 gene locus_tag LOCUS_26240 162 380 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_26240 377 2350 gene locus_tag LOCUS_26250 377 2350 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_26250 2395 3372 gene locus_tag LOCUS_26260 2395 3372 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970169.1 protein_id gnl|my_center|LOCUS_26260 <4443 3735 gene locus_tag LOCUS_26270 <4443 3735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087353.1:acetylornithine transaminase >Feature sequence315 145 765 gene locus_tag LOCUS_26280 145 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26280 695 1405 gene locus_tag LOCUS_26290 695 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26290 1926 2390 gene locus_tag LOCUS_26300 gene mqsA 1926 2390 CDS product type II toxin-antitoxin system antitoxin MqsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650107.1 protein_id gnl|my_center|LOCUS_26300 2646 2571 gene locus_tag LOCUS_t00240 2646 2571 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3641 2724 gene locus_tag LOCUS_26310 3641 2724 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065028.1 protein_id gnl|my_center|LOCUS_26310 <4426 3638 gene locus_tag LOCUS_26320 <4426 3638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086289.1:YeeE/YedE family protein >Feature sequence316 2294 924 gene locus_tag LOCUS_26330 2294 924 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_26330 2846 2622 gene locus_tag LOCUS_26340 2846 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 4044 2857 gene locus_tag LOCUS_26350 gene hemW 4044 2857 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 protein_id gnl|my_center|LOCUS_26350 >Feature sequence317 1121 246 gene locus_tag LOCUS_26360 gene ubiA 1121 246 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_26360 1621 1124 gene locus_tag LOCUS_26370 1621 1124 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811209.1 protein_id gnl|my_center|LOCUS_26370 2671 1685 gene locus_tag LOCUS_26380 2671 1685 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194383.1 protein_id gnl|my_center|LOCUS_26380 <4425 2734 gene locus_tag LOCUS_26390 <4425 2734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014917883.1:ATP-dependent DNA helicase RecG >Feature sequence318 1183 392 gene locus_tag LOCUS_26400 gene gloB 1183 392 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391018.1 protein_id gnl|my_center|LOCUS_26400 1390 2007 gene locus_tag LOCUS_26410 1390 2007 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058086430.1 protein_id gnl|my_center|LOCUS_26410 2734 2012 gene locus_tag LOCUS_26420 2734 2012 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022565.1 protein_id gnl|my_center|LOCUS_26420 4223 2766 gene locus_tag LOCUS_26430 4223 2766 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992328.1 protein_id gnl|my_center|LOCUS_26430 >Feature sequence319 <1 597 gene locus_tag LOCUS_26440 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085521.1:molybdopterin-dependent oxidoreductase 594 1034 gene locus_tag LOCUS_26450 594 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 1133 1516 gene locus_tag LOCUS_26460 1133 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 1519 1854 gene locus_tag LOCUS_26470 1519 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 1901 2716 gene locus_tag LOCUS_26480 gene soxA 1901 2716 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174733.1 protein_id gnl|my_center|LOCUS_26480 3585 2992 gene locus_tag LOCUS_26490 3585 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 >Feature sequence320 451 1242 gene locus_tag LOCUS_26500 gene fabG 451 1242 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_26500 1254 2699 gene locus_tag LOCUS_26510 1254 2699 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390686.1 protein_id gnl|my_center|LOCUS_26510 2696 3517 gene locus_tag LOCUS_26520 2696 3517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687942.1 protein_id gnl|my_center|LOCUS_26520 3514 4296 gene locus_tag LOCUS_26530 3514 4296 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971358.1 protein_id gnl|my_center|LOCUS_26530 >Feature sequence321 428 1366 gene locus_tag LOCUS_26540 gene ylqF 428 1366 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687704.1 protein_id gnl|my_center|LOCUS_26540 1529 3850 gene locus_tag LOCUS_26550 1529 3850 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965457.1 protein_id gnl|my_center|LOCUS_26550 >Feature sequence322 723 1205 gene locus_tag LOCUS_26560 gene rfaE2 723 1205 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815102.1 protein_id gnl|my_center|LOCUS_26560 <4384 1446 gene locus_tag LOCUS_26570 <4384 1446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014328246.1:efflux RND transporter permease subunit >Feature sequence323 1549 341 gene locus_tag LOCUS_26580 gene argE 1549 341 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534727.1 protein_id gnl|my_center|LOCUS_26580 2023 1721 gene locus_tag LOCUS_26590 2023 1721 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258929.1 protein_id gnl|my_center|LOCUS_26590 2360 2037 gene locus_tag LOCUS_26600 2360 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26600 >Feature sequence324 >Feature sequence325 330 1286 gene locus_tag LOCUS_26610 330 1286 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931174.1 protein_id gnl|my_center|LOCUS_26610 1669 1340 gene locus_tag LOCUS_26620 1669 1340 CDS product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035952.1 protein_id gnl|my_center|LOCUS_26620 1919 1674 gene locus_tag LOCUS_26630 1919 1674 CDS product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029217148.1 protein_id gnl|my_center|LOCUS_26630 3139 2015 gene locus_tag LOCUS_26640 gene aroG 3139 2015 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_26640 >Feature sequence326 1730 963 gene locus_tag LOCUS_26650 1730 963 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338709.1 protein_id gnl|my_center|LOCUS_26650 3162 1741 gene locus_tag LOCUS_26660 3162 1741 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163651105.1 protein_id gnl|my_center|LOCUS_26660 3798 3346 gene locus_tag LOCUS_26670 3798 3346 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082631.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence327 689 970 gene locus_tag LOCUS_26680 689 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 1381 1836 gene locus_tag LOCUS_26690 1381 1836 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086602.1 protein_id gnl|my_center|LOCUS_26690 1833 4013 gene locus_tag LOCUS_26700 1833 4013 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975278.1 protein_id gnl|my_center|LOCUS_26700 >Feature sequence328 <1 725 gene locus_tag LOCUS_26710 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197496.1:exodeoxyribonuclease VII large subunit 847 1428 gene locus_tag LOCUS_26720 gene sodB 847 1428 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185841.1 protein_id gnl|my_center|LOCUS_26720 1662 3908 gene locus_tag LOCUS_26730 1662 3908 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899797.1 protein_id gnl|my_center|LOCUS_26730 3962 4288 gene locus_tag LOCUS_26740 3962 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence329 400 2367 gene locus_tag LOCUS_26750 400 2367 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249757.1 protein_id gnl|my_center|LOCUS_26750 3358 2384 gene locus_tag LOCUS_26760 3358 2384 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931174.1 protein_id gnl|my_center|LOCUS_26760 3529 3774 gene locus_tag LOCUS_26770 3529 3774 CDS product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048897891.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence330 1480 98 gene locus_tag LOCUS_26780 1480 98 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141651.1 protein_id gnl|my_center|LOCUS_26780 2345 1506 gene locus_tag LOCUS_26790 2345 1506 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807015.1 protein_id gnl|my_center|LOCUS_26790 4134 2830 gene locus_tag LOCUS_26800 4134 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence331 <1 964 gene locus_tag LOCUS_26810 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089807.1:esterase-like activity of phytase family protein 2547 1171 gene locus_tag LOCUS_26820 gene radA 2547 1171 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193568.1 protein_id gnl|my_center|LOCUS_26820 2663 3607 gene locus_tag LOCUS_26830 2663 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 >Feature sequence332 462 139 gene locus_tag LOCUS_26840 462 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 767 474 gene locus_tag LOCUS_26850 767 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 1776 787 gene locus_tag LOCUS_26860 gene fliM 1776 787 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420346.1 protein_id gnl|my_center|LOCUS_26860 2421 1798 gene locus_tag LOCUS_26870 2421 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 4176 2476 gene locus_tag LOCUS_26880 4176 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence333 698 159 gene locus_tag LOCUS_26890 698 159 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243986.1 protein_id gnl|my_center|LOCUS_26890 1736 762 gene locus_tag LOCUS_26900 1736 762 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647844.1 protein_id gnl|my_center|LOCUS_26900 2118 1780 gene locus_tag LOCUS_26910 2118 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 2677 2153 gene locus_tag LOCUS_26920 2677 2153 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210265.1 protein_id gnl|my_center|LOCUS_26920 3735 2782 gene locus_tag LOCUS_26930 3735 2782 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974076.1 protein_id gnl|my_center|LOCUS_26930 >Feature sequence334 <1 935 gene locus_tag LOCUS_26940 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186397.1:hydroxymethylpyrimidine/phosphomethylpyrimidine kinase 943 2229 gene locus_tag LOCUS_26950 gene hemL 943 2229 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_26950 2234 2749 gene locus_tag LOCUS_26960 2234 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 3092 2763 gene locus_tag LOCUS_26970 3092 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 3510 3229 gene locus_tag LOCUS_26980 3510 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 >Feature sequence335 >Feature sequence336 1426 2844 gene locus_tag LOCUS_26990 gene dbpA 1426 2844 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198857.1 protein_id gnl|my_center|LOCUS_26990 2844 3533 gene locus_tag LOCUS_27000 2844 3533 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974210.1 protein_id gnl|my_center|LOCUS_27000 >Feature sequence337 1318 167 gene locus_tag LOCUS_27010 1318 167 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204969.1 protein_id gnl|my_center|LOCUS_27010 2505 1318 gene locus_tag LOCUS_27020 2505 1318 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 protein_id gnl|my_center|LOCUS_27020 2623 3528 gene locus_tag LOCUS_27030 2623 3528 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237633.1 protein_id gnl|my_center|LOCUS_27030 3648 3881 gene locus_tag LOCUS_27040 3648 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 >Feature sequence338 308 913 gene locus_tag LOCUS_27050 gene ureG 308 913 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931336.1 protein_id gnl|my_center|LOCUS_27050 1392 2180 gene locus_tag LOCUS_27060 gene surE 1392 2180 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930526.1 protein_id gnl|my_center|LOCUS_27060 2177 3010 gene locus_tag LOCUS_27070 2177 3010 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203980.1 protein_id gnl|my_center|LOCUS_27070 3110 4039 gene locus_tag LOCUS_27080 3110 4039 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192107.1 protein_id gnl|my_center|LOCUS_27080 >Feature sequence339 3406 1661 gene locus_tag LOCUS_27090 3406 1661 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550550.1 protein_id gnl|my_center|LOCUS_27090 4211 3852 gene locus_tag LOCUS_27100 4211 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 >Feature sequence340 49 124 gene locus_tag LOCUS_t00250 49 124 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1150 224 gene locus_tag LOCUS_27110 1150 224 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339529.1 protein_id gnl|my_center|LOCUS_27110 1213 1395 gene locus_tag LOCUS_27120 1213 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 1527 2300 gene locus_tag LOCUS_27130 1527 2300 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195806.1 protein_id gnl|my_center|LOCUS_27130 2300 3004 gene locus_tag LOCUS_27140 2300 3004 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813858.1 protein_id gnl|my_center|LOCUS_27140 >Feature sequence341 1127 1393 gene locus_tag LOCUS_27150 1127 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 1390 1902 gene locus_tag LOCUS_27160 1390 1902 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417282.1 protein_id gnl|my_center|LOCUS_27160 3531 1912 gene locus_tag LOCUS_27170 3531 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 >Feature sequence342 1482 1396 gene locus_tag LOCUS_t00260 1482 1396 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <4180 1608 gene locus_tag LOCUS_27180 <4180 1608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024698545.1:efflux RND transporter permease subunit >Feature sequence343 1016 378 gene locus_tag LOCUS_27190 1016 378 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 protein_id gnl|my_center|LOCUS_27190 1945 1031 gene locus_tag LOCUS_27200 1945 1031 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 protein_id gnl|my_center|LOCUS_27200 2802 1942 gene locus_tag LOCUS_27210 2802 1942 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_27210 <4173 3070 gene locus_tag LOCUS_27220 <4173 3070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191649.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence344 1376 345 gene locus_tag LOCUS_27230 gene purM 1376 345 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065013.1 protein_id gnl|my_center|LOCUS_27230 1550 2236 gene locus_tag LOCUS_27240 gene hda 1550 2236 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196484.1 protein_id gnl|my_center|LOCUS_27240 2233 2916 gene locus_tag LOCUS_27250 2233 2916 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194213.1 protein_id gnl|my_center|LOCUS_27250 >Feature sequence345 606 412 gene locus_tag LOCUS_27260 606 412 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189988.1 protein_id gnl|my_center|LOCUS_27260 1774 665 gene locus_tag LOCUS_27270 1774 665 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189567.1 protein_id gnl|my_center|LOCUS_27270 1899 2678 gene locus_tag LOCUS_27280 1899 2678 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194458.1 protein_id gnl|my_center|LOCUS_27280 2675 3064 gene locus_tag LOCUS_27290 2675 3064 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199336.1 protein_id gnl|my_center|LOCUS_27290 3075 3989 gene locus_tag LOCUS_27300 gene ttcA 3075 3989 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189298.1 protein_id gnl|my_center|LOCUS_27300 >Feature sequence346 649 320 gene locus_tag LOCUS_27310 649 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 1996 713 gene locus_tag LOCUS_27320 1996 713 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183209478.1 protein_id gnl|my_center|LOCUS_27320 2773 2150 gene locus_tag LOCUS_27330 gene purN 2773 2150 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700925.1 protein_id gnl|my_center|LOCUS_27330 >Feature sequence347 1218 838 gene locus_tag LOCUS_27340 1218 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 2838 1411 gene locus_tag LOCUS_27350 gene fliD 2838 1411 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073119.1 protein_id gnl|my_center|LOCUS_27350 3845 2910 gene locus_tag LOCUS_27360 gene flgL 3845 2910 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266799.1 protein_id gnl|my_center|LOCUS_27360 >Feature sequence348 781 1221 gene locus_tag LOCUS_27370 781 1221 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814554.1 protein_id gnl|my_center|LOCUS_27370 1372 2247 gene locus_tag LOCUS_27380 1372 2247 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 protein_id gnl|my_center|LOCUS_27380 2254 3330 gene locus_tag LOCUS_27390 2254 3330 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090655.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence349 1655 780 gene locus_tag LOCUS_27400 1655 780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085650.1 protein_id gnl|my_center|LOCUS_27400 2600 1659 gene locus_tag LOCUS_27410 2600 1659 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085651.1 protein_id gnl|my_center|LOCUS_27410 <3990 2701 gene locus_tag LOCUS_27420 <3990 2701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965798.1:ABC transporter substrate-binding protein >Feature sequence350 300 4 gene locus_tag LOCUS_27430 300 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 1339 293 gene locus_tag LOCUS_27440 1339 293 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136620024.1 protein_id gnl|my_center|LOCUS_27440 2301 1336 gene locus_tag LOCUS_27450 2301 1336 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532498.1 protein_id gnl|my_center|LOCUS_27450 3647 2310 gene locus_tag LOCUS_27460 3647 2310 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210664.1 protein_id gnl|my_center|LOCUS_27460 3979 3644 gene locus_tag LOCUS_27470 3979 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence351 854 105 gene locus_tag LOCUS_27480 854 105 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529743.1 protein_id gnl|my_center|LOCUS_27480 1923 877 gene locus_tag LOCUS_27490 1923 877 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088034.1 protein_id gnl|my_center|LOCUS_27490 2711 1944 gene locus_tag LOCUS_27500 2711 1944 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530852.1 protein_id gnl|my_center|LOCUS_27500 <3978 2708 gene locus_tag LOCUS_27510 <3978 2708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066704.1:TRAP transporter large permease subunit >Feature sequence352 <1 523 gene locus_tag LOCUS_27520 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259030.1:4-alpha-glucanotransferase 510 2705 gene locus_tag LOCUS_27530 gene glgB 510 2705 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174776.1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence353 <1 1560 gene locus_tag LOCUS_27540 <1 1560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705444.1:bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase 1581 2549 gene locus_tag LOCUS_27550 1581 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461155.1 protein_id gnl|my_center|LOCUS_27550 <3975 2581 gene locus_tag LOCUS_27560 <3975 2581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064616.1:4-hydroxyphenylacetate 3-hydroxylase family protein >Feature sequence354 3524 2796 gene locus_tag LOCUS_27570 3524 2796 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 protein_id gnl|my_center|LOCUS_27570 >Feature sequence355 1273 335 gene locus_tag LOCUS_27580 gene pstC 1273 335 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193912.1 protein_id gnl|my_center|LOCUS_27580 2476 1442 gene locus_tag LOCUS_27590 gene pstS 2476 1442 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930170.1 protein_id gnl|my_center|LOCUS_27590 >Feature sequence356 1895 849 gene locus_tag LOCUS_27600 1895 849 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104220.1 protein_id gnl|my_center|LOCUS_27600 2907 1945 gene locus_tag LOCUS_27610 2907 1945 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035658.1 protein_id gnl|my_center|LOCUS_27610 3503 2961 gene locus_tag LOCUS_27620 3503 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 >Feature sequence357 493 197 gene locus_tag LOCUS_27630 493 197 CDS product type II toxin-antitoxin system MqsR family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809515.1 protein_id gnl|my_center|LOCUS_27630 1398 661 gene locus_tag LOCUS_27640 1398 661 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193701.1 protein_id gnl|my_center|LOCUS_27640 2671 1493 gene locus_tag LOCUS_27650 2671 1493 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 protein_id gnl|my_center|LOCUS_27650 <3888 2814 gene locus_tag LOCUS_27660 <3888 2814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527151.1:class I poly(R)-hydroxyalkanoic acid synthase >Feature sequence358 2899 1856 gene locus_tag LOCUS_27670 gene prfB 2899 1856 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199566.1 protein_id gnl|my_center|LOCUS_27670 3882 3124 gene locus_tag LOCUS_27680 3882 3124 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 protein_id gnl|my_center|LOCUS_27680 >Feature sequence359 2176 2943 gene locus_tag LOCUS_27690 2176 2943 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 protein_id gnl|my_center|LOCUS_27690 >Feature sequence360 <1 503 gene locus_tag LOCUS_27700 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816058.1:enoyl-CoA hydratase-related protein 2526 547 gene locus_tag LOCUS_27710 2526 547 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_27710 3488 2619 gene locus_tag LOCUS_27720 3488 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 >Feature sequence361 1115 1354 gene locus_tag LOCUS_27730 1115 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 1356 1637 gene locus_tag LOCUS_27740 1356 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 1878 2519 gene locus_tag LOCUS_27750 1878 2519 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939951.1 protein_id gnl|my_center|LOCUS_27750 <3870 2526 gene locus_tag LOCUS_27760 <3870 2526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_019247543.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence362 1181 1750 gene locus_tag LOCUS_27770 gene rfaH 1181 1750 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418261.1 protein_id gnl|my_center|LOCUS_27770 3048 1831 gene locus_tag LOCUS_27780 3048 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 <3863 3048 gene locus_tag LOCUS_27790 <3863 3048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009956704.1:SLBB domain-containing protein >Feature sequence363 1243 464 gene locus_tag LOCUS_27800 1243 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 2011 1256 gene locus_tag LOCUS_27810 2011 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 2454 2008 gene locus_tag LOCUS_27820 2454 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 3800 2478 gene locus_tag LOCUS_27830 gene fliI 3800 2478 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086458.1 protein_id gnl|my_center|LOCUS_27830 >Feature sequence364 178 1254 gene locus_tag LOCUS_27840 178 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_27840 1506 2294 gene locus_tag LOCUS_27850 1506 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 2373 3068 gene locus_tag LOCUS_27860 2373 3068 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036958.1 protein_id gnl|my_center|LOCUS_27860 3114 3545 gene locus_tag LOCUS_27870 3114 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 >Feature sequence365 1853 15 gene locus_tag LOCUS_27880 gene lpdA 1853 15 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930129.1 protein_id gnl|my_center|LOCUS_27880 2443 1850 gene locus_tag LOCUS_27890 2443 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 <3832 2510 gene locus_tag LOCUS_27900 <3832 2510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063727.1:dihydrolipoyllysine-residue acetyltransferase >Feature sequence366 2273 267 gene locus_tag LOCUS_27910 2273 267 CDS product 7TM diverse intracellular signaling domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054993691.1 protein_id gnl|my_center|LOCUS_27910 2474 3148 gene locus_tag LOCUS_27920 gene torR 2474 3148 CDS product two-component system response regulator TorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120285.1 protein_id gnl|my_center|LOCUS_27920 <3824 3210 gene locus_tag LOCUS_27930 <3824 3210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190826.1:TOBE domain-containing protein >Feature sequence367 2082 1021 gene locus_tag LOCUS_27940 2082 1021 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229210.1 protein_id gnl|my_center|LOCUS_27940 >Feature sequence368 >Feature sequence369 1100 282 gene locus_tag LOCUS_27950 1100 282 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_27950 3195 1057 gene locus_tag LOCUS_27960 3195 1057 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_27960 <3809 3197 gene locus_tag LOCUS_27970 <3809 3197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207598.1:acetyl-CoA C-acetyltransferase >Feature sequence370 91 906 gene locus_tag LOCUS_27980 91 906 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892000.1 protein_id gnl|my_center|LOCUS_27980 910 1674 gene locus_tag LOCUS_27990 910 1674 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_27990 >Feature sequence371 <1 1017 gene locus_tag LOCUS_28000 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522490.1:DNA topoisomerase IV subunit A 1583 2713 gene locus_tag LOCUS_28010 1583 2713 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810953.1 protein_id gnl|my_center|LOCUS_28010 3319 2849 gene locus_tag LOCUS_28020 3319 2849 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197479.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence372 26 397 gene locus_tag LOCUS_28030 26 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 1656 736 gene locus_tag LOCUS_28040 1656 736 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808415.1 protein_id gnl|my_center|LOCUS_28040 2002 2769 gene locus_tag LOCUS_28050 2002 2769 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808745.1 protein_id gnl|my_center|LOCUS_28050 >Feature sequence373 906 238 gene locus_tag LOCUS_28060 906 238 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389137.1 protein_id gnl|my_center|LOCUS_28060 1165 2760 gene locus_tag LOCUS_28070 1165 2760 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_28070 3683 2769 gene locus_tag LOCUS_28080 3683 2769 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395910.1 protein_id gnl|my_center|LOCUS_28080 >Feature sequence374 923 1930 gene locus_tag LOCUS_28090 gene mltG 923 1930 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930596.1 protein_id gnl|my_center|LOCUS_28090 1920 2600 gene locus_tag LOCUS_28100 gene tmk 1920 2600 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193022.1 protein_id gnl|my_center|LOCUS_28100 2597 3673 gene locus_tag LOCUS_28110 2597 3673 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 protein_id gnl|my_center|LOCUS_28110 >Feature sequence375 1936 23 gene locus_tag LOCUS_28120 1936 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 >Feature sequence376 494 1423 gene locus_tag LOCUS_28130 gene gcvA 494 1423 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813028.1 protein_id gnl|my_center|LOCUS_28130 2243 1530 gene locus_tag LOCUS_28140 2243 1530 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944002.1 protein_id gnl|my_center|LOCUS_28140 <3713 2236 gene locus_tag LOCUS_28150 <3713 2236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085709.1:ABC transporter ATP-binding protein >Feature sequence377 373 1350 gene locus_tag LOCUS_28160 373 1350 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193798.1 protein_id gnl|my_center|LOCUS_28160 1334 1990 gene locus_tag LOCUS_28170 1334 1990 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_28170 2018 2410 gene locus_tag LOCUS_28180 2018 2410 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810840.1 protein_id gnl|my_center|LOCUS_28180 2420 3454 gene locus_tag LOCUS_28190 2420 3454 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 protein_id gnl|my_center|LOCUS_28190 >Feature sequence378 1626 526 gene locus_tag LOCUS_28200 gene pheA 1626 526 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813370.1 protein_id gnl|my_center|LOCUS_28200 2779 1691 gene locus_tag LOCUS_28210 gene serC 2779 1691 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189993.1 protein_id gnl|my_center|LOCUS_28210 <3659 2779 gene locus_tag LOCUS_28220 <3659 2779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926826.1:DNA gyrase subunit A >Feature sequence379 <1 896 gene locus_tag LOCUS_28230 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004557110.1:D-alanyl-D-alanine endopeptidase 1766 972 gene locus_tag LOCUS_28240 1766 972 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191360.1 protein_id gnl|my_center|LOCUS_28240 2604 1852 gene locus_tag LOCUS_28250 2604 1852 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192823.1 protein_id gnl|my_center|LOCUS_28250 3359 2601 gene locus_tag LOCUS_28260 gene aat 3359 2601 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900429.1 protein_id gnl|my_center|LOCUS_28260 >Feature sequence380 1129 401 gene locus_tag LOCUS_28270 1129 401 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193988.1 protein_id gnl|my_center|LOCUS_28270 1227 1859 gene locus_tag LOCUS_28280 1227 1859 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447512.1 protein_id gnl|my_center|LOCUS_28280 1856 2908 gene locus_tag LOCUS_28290 gene mnmH 1856 2908 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526161.1 protein_id gnl|my_center|LOCUS_28290 <3623 3058 gene locus_tag LOCUS_28300 <3623 3058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930621.1:hydantoinase B/oxoprolinase family protein >Feature sequence381 298 374 gene locus_tag LOCUS_t00270 298 374 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 558 842 gene locus_tag LOCUS_28310 558 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 2470 920 gene locus_tag LOCUS_28320 2470 920 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925999.1 protein_id gnl|my_center|LOCUS_28320 3066 3392 gene locus_tag LOCUS_28330 gene bprA 3066 3392 CDS product T3SS protein BprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187356.1 protein_id gnl|my_center|LOCUS_28330 >Feature sequence382 570 998 gene locus_tag LOCUS_28340 570 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 995 1804 gene locus_tag LOCUS_28350 995 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 1838 2071 gene locus_tag LOCUS_28360 1838 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 2072 2452 gene locus_tag LOCUS_28370 2072 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 3502 2651 gene locus_tag LOCUS_28380 3502 2651 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_28380 >Feature sequence383 404 712 gene locus_tag LOCUS_28390 404 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 2737 866 gene locus_tag LOCUS_28400 2737 866 CDS product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202034.1 protein_id gnl|my_center|LOCUS_28400 3558 2734 gene locus_tag LOCUS_28410 3558 2734 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090568.1 protein_id gnl|my_center|LOCUS_28410 >Feature sequence384 47 448 gene locus_tag LOCUS_28420 47 448 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876264.1 protein_id gnl|my_center|LOCUS_28420 1480 518 gene locus_tag LOCUS_28430 1480 518 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191991.1 protein_id gnl|my_center|LOCUS_28430 1651 2346 gene locus_tag LOCUS_28440 gene lexA 1651 2346 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930566.1 protein_id gnl|my_center|LOCUS_28440 >Feature sequence385 <1 855 gene locus_tag LOCUS_28450 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815335.1:primosomal protein N' 1833 862 gene locus_tag LOCUS_28460 1833 862 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390930.1 protein_id gnl|my_center|LOCUS_28460 >Feature sequence386 <1 587 gene locus_tag LOCUS_28470 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004533965.1:class I SAM-dependent methyltransferase 698 1582 gene locus_tag LOCUS_28480 gene dapA 698 1582 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191516.1 protein_id gnl|my_center|LOCUS_28480 1599 2744 gene locus_tag LOCUS_28490 gene bamC 1599 2744 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524737.1 protein_id gnl|my_center|LOCUS_28490 2767 3534 gene locus_tag LOCUS_28500 2767 3534 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_28500 >Feature sequence387 1988 1353 gene locus_tag LOCUS_28510 gene petA 1988 1353 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064798.1 protein_id gnl|my_center|LOCUS_28510 2261 2701 gene locus_tag LOCUS_28520 gene mscL 2261 2701 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192898.1 protein_id gnl|my_center|LOCUS_28520 3509 2679 gene locus_tag LOCUS_28530 3509 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 >Feature sequence388 1278 151 gene locus_tag LOCUS_28540 gene dprA 1278 151 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929874.1 protein_id gnl|my_center|LOCUS_28540 1602 1381 gene locus_tag LOCUS_28550 1602 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 3302 1599 gene locus_tag LOCUS_28560 3302 1599 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 protein_id gnl|my_center|LOCUS_28560 >Feature sequence389 181 2721 gene locus_tag LOCUS_28570 181 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 <3493 2848 gene locus_tag LOCUS_28580 <3493 2848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921245.1:polyphosphate kinase 2 >Feature sequence390 3 176 gene locus_tag LOCUS_28590 3 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 173 946 gene locus_tag LOCUS_28600 173 946 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066716.1 protein_id gnl|my_center|LOCUS_28600 2153 975 gene locus_tag LOCUS_28610 2153 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 3074 2328 gene locus_tag LOCUS_28620 3074 2328 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976287.1 protein_id gnl|my_center|LOCUS_28620 >Feature sequence391 531 731 gene locus_tag LOCUS_28630 531 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014745.1 protein_id gnl|my_center|LOCUS_28630 1177 770 gene locus_tag LOCUS_28640 1177 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 1503 1174 gene locus_tag LOCUS_28650 1503 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 2845 1568 gene locus_tag LOCUS_28660 2845 1568 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198058.1 protein_id gnl|my_center|LOCUS_28660 >Feature sequence392 320 1039 gene locus_tag LOCUS_28670 320 1039 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808411.1 protein_id gnl|my_center|LOCUS_28670 1242 1994 gene locus_tag LOCUS_28680 1242 1994 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972532.1 protein_id gnl|my_center|LOCUS_28680 2024 2998 gene locus_tag LOCUS_28690 2024 2998 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089798.1 protein_id gnl|my_center|LOCUS_28690 >Feature sequence393 <1 750 gene locus_tag LOCUS_28700 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003895987.1:igiC 1085 768 gene locus_tag LOCUS_28710 1085 768 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521451.1 protein_id gnl|my_center|LOCUS_28710 1291 2727 gene locus_tag LOCUS_28720 1291 2727 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104140.1 protein_id gnl|my_center|LOCUS_28720 2727 3410 gene locus_tag LOCUS_28730 gene pcp 2727 3410 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704765.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence394 <1 3070 gene locus_tag LOCUS_28740 <1 3070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224369.1:methylmalonyl-CoA mutase family protein >Feature sequence395 1295 279 gene locus_tag LOCUS_28750 gene hrcA 1295 279 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 protein_id gnl|my_center|LOCUS_28750 1342 2217 gene locus_tag LOCUS_28760 1342 2217 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533590.1 protein_id gnl|my_center|LOCUS_28760 >Feature sequence396 <1 1023 gene locus_tag LOCUS_28770 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010928938.1:cyanophycin synthetase 2080 1106 gene locus_tag LOCUS_28780 2080 1106 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808079.1 protein_id gnl|my_center|LOCUS_28780 <3429 2105 gene locus_tag LOCUS_28790 <3429 2105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980494.1:thiamine pyrophosphate-requiring protein >Feature sequence397 1366 614 gene locus_tag LOCUS_28800 1366 614 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967870.1 protein_id gnl|my_center|LOCUS_28800 1678 2628 gene locus_tag LOCUS_28810 1678 2628 CDS product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931187.1 protein_id gnl|my_center|LOCUS_28810 2744 3385 gene locus_tag LOCUS_28820 2744 3385 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967871.1 protein_id gnl|my_center|LOCUS_28820 >Feature sequence398 667 182 gene locus_tag LOCUS_28830 667 182 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_28830 666 1772 gene locus_tag LOCUS_28840 gene murB 666 1772 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189377.1 protein_id gnl|my_center|LOCUS_28840 <3412 2218 gene locus_tag LOCUS_28850 <3412 2218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002223213.1:argininosuccinate synthase >Feature sequence399 <1 1644 gene locus_tag LOCUS_28860 <1 1644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004535017.1:penicillin-binding protein 1A 2017 1688 gene locus_tag LOCUS_28870 gene cyaY 2017 1688 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196764.1 protein_id gnl|my_center|LOCUS_28870 >Feature sequence400 <1 1530 gene locus_tag LOCUS_28880 <1 1530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943238.1:tetratricopeptide repeat protein 2170 1931 gene locus_tag LOCUS_28890 2170 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 2246 2473 gene locus_tag LOCUS_28900 2246 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 2571 2972 gene locus_tag LOCUS_28910 2571 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence401 155 589 gene locus_tag LOCUS_28920 155 589 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141677.1 protein_id gnl|my_center|LOCUS_28920 913 2187 gene locus_tag LOCUS_28930 913 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 3163 2264 gene locus_tag LOCUS_28940 3163 2264 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532790.1 protein_id gnl|my_center|LOCUS_28940 >Feature sequence402 209 454 gene locus_tag LOCUS_28950 209 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 707 483 gene locus_tag LOCUS_28960 707 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 829 1092 gene locus_tag LOCUS_28970 829 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 1286 2665 gene locus_tag LOCUS_28980 gene chrA 1286 2665 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_28980 >Feature sequence403 1076 636 gene locus_tag LOCUS_28990 1076 636 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808652.1 protein_id gnl|my_center|LOCUS_28990 <3339 1420 gene locus_tag LOCUS_29000 <3339 1420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030473.1:DEAD/DEAH box helicase >Feature sequence404 425 1297 gene locus_tag LOCUS_29010 gene yghU 425 1297 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_29010 1294 1926 gene locus_tag LOCUS_29020 1294 1926 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_29020 1996 2565 gene locus_tag LOCUS_29030 1996 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 >Feature sequence405 358 1497 gene locus_tag LOCUS_29040 358 1497 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082169.1 protein_id gnl|my_center|LOCUS_29040 1550 2050 gene locus_tag LOCUS_29050 1550 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 >Feature sequence406 1711 92 gene locus_tag LOCUS_29060 1711 92 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_29060 2711 1713 gene locus_tag LOCUS_29070 2711 1713 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064939.1 protein_id gnl|my_center|LOCUS_29070 <3333 2764 gene locus_tag LOCUS_29080 <3333 2764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930658.1:FAD-dependent monooxygenase >Feature sequence407 1507 302 gene locus_tag LOCUS_29090 1507 302 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267830.1 protein_id gnl|my_center|LOCUS_29090 3125 1614 gene locus_tag LOCUS_29100 3125 1614 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267829.1 protein_id gnl|my_center|LOCUS_29100 >Feature sequence408 1093 275 gene locus_tag LOCUS_29110 1093 275 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192738.1 protein_id gnl|my_center|LOCUS_29110 >Feature sequence409 1769 372 gene locus_tag LOCUS_29120 1769 372 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040324.1 protein_id gnl|my_center|LOCUS_29120 2287 1766 gene locus_tag LOCUS_29130 2287 1766 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064987.1 protein_id gnl|my_center|LOCUS_29130 <3315 2284 gene locus_tag LOCUS_29140 <3315 2284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064988.1:3-isopropylmalate dehydratase large subunit >Feature sequence410 560 330 gene locus_tag LOCUS_29150 560 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 1064 972 gene locus_tag LOCUS_t00280 1064 972 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2366 1098 gene locus_tag LOCUS_29160 2366 1098 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191166.1 protein_id gnl|my_center|LOCUS_29160 <3289 2538 gene locus_tag LOCUS_29170 <3289 2538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172452888.1:tRNA lysidine(34) synthetase TilS >Feature sequence411 <1 903 gene locus_tag LOCUS_29180 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_022771536.1:DUF1566 domain-containing protein >Feature sequence412 2155 1496 gene locus_tag LOCUS_29190 2155 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 >Feature sequence413 1370 621 gene locus_tag LOCUS_29200 gene recO 1370 621 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192953.1 protein_id gnl|my_center|LOCUS_29200 2378 1383 gene locus_tag LOCUS_29210 gene era 2378 1383 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 protein_id gnl|my_center|LOCUS_29210 3071 2406 gene locus_tag LOCUS_29220 3071 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 >Feature sequence414 158 691 gene locus_tag LOCUS_29230 158 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 808 1863 gene locus_tag LOCUS_29240 808 1863 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_29240 2630 1917 gene locus_tag LOCUS_29250 2630 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 >Feature sequence415 878 78 gene locus_tag LOCUS_29260 gene ccsA 878 78 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538773.1 protein_id gnl|my_center|LOCUS_29260 939 2315 gene locus_tag LOCUS_29270 gene ffh 939 2315 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194338.1 protein_id gnl|my_center|LOCUS_29270 <3251 2408 gene locus_tag LOCUS_29280 <3251 2408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190165.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB >Feature sequence416 275 1261 gene locus_tag LOCUS_29290 275 1261 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040464.1 protein_id gnl|my_center|LOCUS_29290 >Feature sequence417 321 115 gene locus_tag LOCUS_29300 321 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 2223 343 gene locus_tag LOCUS_29310 2223 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 2844 2389 gene locus_tag LOCUS_29320 2844 2389 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_29320 >Feature sequence418 >Feature sequence419 756 2075 gene locus_tag LOCUS_29330 756 2075 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083760.1 protein_id gnl|my_center|LOCUS_29330 2081 3070 gene locus_tag LOCUS_29340 2081 3070 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038796.1 protein_id gnl|my_center|LOCUS_29340 >Feature sequence420 <1 894 gene locus_tag LOCUS_29350 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003118564.1:aminopeptidase 916 1287 gene locus_tag LOCUS_29360 916 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 1292 2497 gene locus_tag LOCUS_29370 1292 2497 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245808.1 protein_id gnl|my_center|LOCUS_29370 2794 2531 gene locus_tag LOCUS_29380 2794 2531 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191359.1 protein_id gnl|my_center|LOCUS_29380 >Feature sequence421 1042 233 gene locus_tag LOCUS_29390 gene murI 1042 233 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552506.1 protein_id gnl|my_center|LOCUS_29390 2611 1058 gene locus_tag LOCUS_29400 2611 1058 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814384.1 protein_id gnl|my_center|LOCUS_29400 >Feature sequence422 304 504 gene locus_tag LOCUS_29410 304 504 CDS product DUF2281 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140129.1 protein_id gnl|my_center|LOCUS_29410 665 1573 gene locus_tag LOCUS_29420 665 1573 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814325.1 protein_id gnl|my_center|LOCUS_29420 2638 1583 gene locus_tag LOCUS_29430 gene queG 2638 1583 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550792.1 protein_id gnl|my_center|LOCUS_29430 2642 3166 gene locus_tag LOCUS_29440 2642 3166 CDS product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189096.1 protein_id gnl|my_center|LOCUS_29440 >Feature sequence423 1191 169 gene locus_tag LOCUS_29450 1191 169 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087190.1 protein_id gnl|my_center|LOCUS_29450 1402 3009 gene locus_tag LOCUS_29460 1402 3009 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815953.1 protein_id gnl|my_center|LOCUS_29460 >Feature sequence424 267 1382 gene locus_tag LOCUS_29470 267 1382 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269378.1 protein_id gnl|my_center|LOCUS_29470 1397 1726 gene locus_tag LOCUS_29480 1397 1726 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555867.1 protein_id gnl|my_center|LOCUS_29480 1723 3156 gene locus_tag LOCUS_29490 1723 3156 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083975.1 protein_id gnl|my_center|LOCUS_29490 >Feature sequence425 1043 42 gene locus_tag LOCUS_29500 1043 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 2975 1335 gene locus_tag LOCUS_29510 2975 1335 CDS product DNA alkylation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027581.1 protein_id gnl|my_center|LOCUS_29510 3161 2997 gene locus_tag LOCUS_29520 3161 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 >Feature sequence426 <1 1362 gene locus_tag LOCUS_29530 <1 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_149504110.1:aminopeptidase N 1411 2415 gene locus_tag LOCUS_29540 1411 2415 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 protein_id gnl|my_center|LOCUS_29540 2461 2536 gene locus_tag LOCUS_t00290 2461 2536 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence427 313 1584 gene locus_tag LOCUS_29550 313 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 1858 2883 gene locus_tag LOCUS_29560 1858 2883 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070823.1 protein_id gnl|my_center|LOCUS_29560 >Feature sequence428 861 2705 gene locus_tag LOCUS_29570 861 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 >Feature sequence429 <1 1587 gene locus_tag LOCUS_29580 <1 1587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122785.1:hemolysin D >Feature sequence430 <1 812 gene locus_tag LOCUS_29590 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196955152.1:hybrid sensor histidine kinase/response regulator transcription factor >Feature sequence431 525 1289 gene locus_tag LOCUS_29600 525 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29600 1316 1492 gene locus_tag LOCUS_29610 1316 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 1489 2652 gene locus_tag LOCUS_29620 1489 2652 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118153.1 protein_id gnl|my_center|LOCUS_29620 >Feature sequence432 1637 984 gene locus_tag LOCUS_29630 1637 984 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529923.1 protein_id gnl|my_center|LOCUS_29630 2036 1725 gene locus_tag LOCUS_29640 2036 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 >Feature sequence433 2603 306 gene locus_tag LOCUS_29650 2603 306 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_29650 3070 2600 gene locus_tag LOCUS_29660 3070 2600 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_29660 >Feature sequence434 1413 265 gene locus_tag LOCUS_29670 gene tssA 1413 265 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549922.1 protein_id gnl|my_center|LOCUS_29670 >Feature sequence435 <1 1023 gene locus_tag LOCUS_29680 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930962.1:DNA repair protein RecN 1020 1913 gene locus_tag LOCUS_29690 gene rapZ 1020 1913 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815183.1 protein_id gnl|my_center|LOCUS_29690 2978 1917 gene locus_tag LOCUS_29700 gene mutY 2978 1917 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195232.1 protein_id gnl|my_center|LOCUS_29700 >Feature sequence436 1583 48 gene locus_tag LOCUS_29710 gene amt 1583 48 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707418.1 protein_id gnl|my_center|LOCUS_29710 1960 1622 gene locus_tag LOCUS_29720 1960 1622 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_29720