>Feature sequence01 <1 525 gene locus_tag LOCUS_00010 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002352221.1:cell surface antigen I/II 917 3118 gene locus_tag LOCUS_00020 gene nt5e 917 3118 CDS product cell surface ecto-5'-nucleotidase Nt5e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837008.1 protein_id gnl|my_center|LOCUS_00020 3240 3752 gene locus_tag LOCUS_00030 3240 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00030 3755 3994 gene locus_tag LOCUS_00040 3755 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00040 4005 4457 gene locus_tag LOCUS_00050 4005 4457 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559880.1 protein_id gnl|my_center|LOCUS_00050 5108 4464 gene locus_tag LOCUS_00060 gene plsY 5108 4464 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263268.1 protein_id gnl|my_center|LOCUS_00060 5216 7165 gene locus_tag LOCUS_00070 gene parE 5216 7165 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037270.1 protein_id gnl|my_center|LOCUS_00070 7254 7736 gene locus_tag LOCUS_00080 7254 7736 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003091.1 protein_id gnl|my_center|LOCUS_00080 8046 10457 gene locus_tag LOCUS_00090 gene parC 8046 10457 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352284.1 protein_id gnl|my_center|LOCUS_00090 10573 11595 gene locus_tag LOCUS_00100 10573 11595 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922186.1 protein_id gnl|my_center|LOCUS_00100 11660 11890 gene locus_tag LOCUS_00110 11660 11890 CDS product DUF2969 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002268586.1 protein_id gnl|my_center|LOCUS_00110 11948 12030 gene locus_tag LOCUS_t00010 11948 12030 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 12035 12109 gene locus_tag LOCUS_t00020 12035 12109 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12237 13436 gene locus_tag LOCUS_00120 gene rpsA 12237 13436 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262153.1 protein_id gnl|my_center|LOCUS_00120 13530 13874 gene locus_tag LOCUS_tm00010 13530 13874 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 13921 14523 gene locus_tag LOCUS_00130 13921 14523 CDS product DUF3862 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074596.1 protein_id gnl|my_center|LOCUS_00130 14642 14571 gene locus_tag LOCUS_t00030 14642 14571 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14776 15390 gene locus_tag LOCUS_00140 14776 15390 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262154.1 protein_id gnl|my_center|LOCUS_00140 16170 15415 gene locus_tag LOCUS_00150 16170 15415 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262156.1 protein_id gnl|my_center|LOCUS_00150 16890 16180 gene locus_tag LOCUS_00160 16890 16180 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262157.1 protein_id gnl|my_center|LOCUS_00160 17257 16892 gene locus_tag LOCUS_00170 gene stsR 17257 16892 CDS product GntR family transcriptional regulator StsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262158.1 protein_id gnl|my_center|LOCUS_00170 17439 20543 gene locus_tag LOCUS_00180 17439 20543 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262159.1 protein_id gnl|my_center|LOCUS_00180 20626 21642 gene locus_tag LOCUS_00190 gene pfkA 20626 21642 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262160.1 protein_id gnl|my_center|LOCUS_00190 21721 23223 gene locus_tag LOCUS_00200 gene pyk 21721 23223 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262161.1 protein_id gnl|my_center|LOCUS_00200 23318 23563 gene locus_tag LOCUS_00210 23318 23563 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286666.1 protein_id gnl|my_center|LOCUS_00210 23606 23800 gene locus_tag LOCUS_00220 23606 23800 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051182.1 protein_id gnl|my_center|LOCUS_00220 23909 24463 gene locus_tag LOCUS_00230 gene lepB 23909 24463 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262163.1 protein_id gnl|my_center|LOCUS_00230 24645 26459 gene locus_tag LOCUS_00240 gene glmS 24645 26459 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262164.1 protein_id gnl|my_center|LOCUS_00240 26747 28504 gene locus_tag LOCUS_00250 26747 28504 CDS product PTS mannitol-specific transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391686.1 protein_id gnl|my_center|LOCUS_00250 28531 30483 gene locus_tag LOCUS_00260 28531 30483 CDS product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262166.1 protein_id gnl|my_center|LOCUS_00260 30485 30922 gene locus_tag LOCUS_00270 30485 30922 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262167.1 protein_id gnl|my_center|LOCUS_00270 30942 32090 gene locus_tag LOCUS_00280 30942 32090 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262168.1 protein_id gnl|my_center|LOCUS_00280 32180 32512 gene locus_tag LOCUS_00290 32180 32512 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262169.1 protein_id gnl|my_center|LOCUS_00290 32625 33266 gene locus_tag LOCUS_00300 32625 33266 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992417.1 protein_id gnl|my_center|LOCUS_00300 33274 33903 gene locus_tag LOCUS_00310 33274 33903 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262171.1 protein_id gnl|my_center|LOCUS_00310 33922 34761 gene locus_tag LOCUS_00320 33922 34761 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262172.1 protein_id gnl|my_center|LOCUS_00320 35961 34774 gene locus_tag LOCUS_00330 35961 34774 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262173.1 protein_id gnl|my_center|LOCUS_00330 37377 36049 gene locus_tag LOCUS_00340 37377 36049 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262174.1 protein_id gnl|my_center|LOCUS_00340 37738 40014 gene locus_tag LOCUS_00350 gene pcrA 37738 40014 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265517.1 protein_id gnl|my_center|LOCUS_00350 40153 41439 gene locus_tag LOCUS_00360 40153 41439 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196324.1 protein_id gnl|my_center|LOCUS_00360 41519 42424 gene locus_tag LOCUS_00370 41519 42424 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209260.1 protein_id gnl|my_center|LOCUS_00370 43084 44019 gene locus_tag LOCUS_00380 43084 44019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 44012 45700 gene locus_tag LOCUS_00390 44012 45700 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160857111.1 protein_id gnl|my_center|LOCUS_00390 46067 46264 gene locus_tag LOCUS_00400 46067 46264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 46261 47514 gene locus_tag LOCUS_00410 46261 47514 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262189.1 protein_id gnl|my_center|LOCUS_00410 47520 47951 gene locus_tag LOCUS_00420 47520 47951 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836809.1 protein_id gnl|my_center|LOCUS_00420 48011 48244 gene locus_tag LOCUS_00430 48011 48244 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262193.1 protein_id gnl|my_center|LOCUS_00430 48244 49551 gene locus_tag LOCUS_00440 48244 49551 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289298.1 protein_id gnl|my_center|LOCUS_00440 50042 50887 gene locus_tag LOCUS_00450 gene truB 50042 50887 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262200.1 protein_id gnl|my_center|LOCUS_00450 50908 51840 gene locus_tag LOCUS_00460 50908 51840 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262201.1 protein_id gnl|my_center|LOCUS_00460 51887 52300 gene locus_tag LOCUS_00470 gene spx 51887 52300 CDS product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263835.1 protein_id gnl|my_center|LOCUS_00470 52293 52571 gene locus_tag LOCUS_00480 52293 52571 CDS product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279684.1 protein_id gnl|my_center|LOCUS_00480 52540 53319 gene locus_tag LOCUS_00490 52540 53319 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262204.1 protein_id gnl|my_center|LOCUS_00490 53575 54417 gene locus_tag LOCUS_00500 53575 54417 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265494.1 protein_id gnl|my_center|LOCUS_00500 54427 55362 gene locus_tag LOCUS_00510 gene pstC 54427 55362 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262207.1 protein_id gnl|my_center|LOCUS_00510 55352 56236 gene locus_tag LOCUS_00520 gene pstA 55352 56236 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895770.1 protein_id gnl|my_center|LOCUS_00520 56249 57052 gene locus_tag LOCUS_00530 gene pstB 56249 57052 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002940866.1 protein_id gnl|my_center|LOCUS_00530 57063 57821 gene locus_tag LOCUS_00540 gene pstB 57063 57821 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193363.1 protein_id gnl|my_center|LOCUS_00540 57856 58509 gene locus_tag LOCUS_00550 gene phoU 57856 58509 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922357.1 protein_id gnl|my_center|LOCUS_00550 58543 61086 gene locus_tag LOCUS_00560 58543 61086 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262212.1 protein_id gnl|my_center|LOCUS_00560 61779 61129 gene locus_tag LOCUS_00570 61779 61129 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263659.1 protein_id gnl|my_center|LOCUS_00570 62216 61776 gene locus_tag LOCUS_00580 62216 61776 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264322.1 protein_id gnl|my_center|LOCUS_00580 62491 62760 gene locus_tag LOCUS_00590 62491 62760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 62809 63480 gene locus_tag LOCUS_00600 gene ciaR 62809 63480 CDS product three-component system response regulator CiaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262214.1 protein_id gnl|my_center|LOCUS_00600 63473 64786 gene locus_tag LOCUS_00610 gene ciaH 63473 64786 CDS product three-component system sensor histidine kinase CiaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262215.1 protein_id gnl|my_center|LOCUS_00610 65140 64904 gene locus_tag LOCUS_00620 gene rpsT 65140 64904 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935285.1 protein_id gnl|my_center|LOCUS_00620 66128 65208 gene locus_tag LOCUS_00630 gene coaA 66128 65208 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262217.1 protein_id gnl|my_center|LOCUS_00630 66176 66832 gene locus_tag LOCUS_00640 66176 66832 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061759014.1 protein_id gnl|my_center|LOCUS_00640 66798 68096 gene locus_tag LOCUS_00650 66798 68096 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262219.1 protein_id gnl|my_center|LOCUS_00650 68112 68774 gene locus_tag LOCUS_00660 gene deoC 68112 68774 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262220.1 protein_id gnl|my_center|LOCUS_00660 68797 69183 gene locus_tag LOCUS_00670 68797 69183 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262221.1 protein_id gnl|my_center|LOCUS_00670 69272 70321 gene locus_tag LOCUS_00680 69272 70321 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262222.1 protein_id gnl|my_center|LOCUS_00680 70438 71970 gene locus_tag LOCUS_00690 70438 71970 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262223.1 protein_id gnl|my_center|LOCUS_00690 71963 73030 gene locus_tag LOCUS_00700 71963 73030 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036988.1 protein_id gnl|my_center|LOCUS_00700 73027 73983 gene locus_tag LOCUS_00710 73027 73983 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922349.1 protein_id gnl|my_center|LOCUS_00710 74175 75548 gene locus_tag LOCUS_00720 74175 75548 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262226.1 protein_id gnl|my_center|LOCUS_00720 76637 75648 gene locus_tag LOCUS_00730 76637 75648 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127487.1 protein_id gnl|my_center|LOCUS_00730 76820 79279 gene locus_tag LOCUS_00740 gene gyrA 76820 79279 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197090491.1 protein_id gnl|my_center|LOCUS_00740 79287 80027 gene locus_tag LOCUS_00750 79287 80027 CDS product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262230.1 protein_id gnl|my_center|LOCUS_00750 80072 80476 gene locus_tag LOCUS_00760 80072 80476 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262231.1 protein_id gnl|my_center|LOCUS_00760 81223 80501 gene locus_tag LOCUS_00770 81223 80501 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_00770 81366 82328 gene locus_tag LOCUS_00780 81366 82328 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289313.1 protein_id gnl|my_center|LOCUS_00780 82779 82357 gene locus_tag LOCUS_00790 82779 82357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 82947 83447 gene locus_tag LOCUS_00800 82947 83447 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837205.1 protein_id gnl|my_center|LOCUS_00800 83585 84436 gene locus_tag LOCUS_00810 83585 84436 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262272.1 protein_id gnl|my_center|LOCUS_00810 84433 85221 gene locus_tag LOCUS_00820 84433 85221 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262273.1 protein_id gnl|my_center|LOCUS_00820 85485 87323 gene locus_tag LOCUS_00830 85485 87323 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164733.1 protein_id gnl|my_center|LOCUS_00830 87395 88021 gene locus_tag LOCUS_00840 87395 88021 CDS product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531723.1 protein_id gnl|my_center|LOCUS_00840 89629 88073 gene locus_tag LOCUS_00850 gene guaA 89629 88073 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129872.1 protein_id gnl|my_center|LOCUS_00850 89810 90508 gene locus_tag LOCUS_00860 89810 90508 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262275.1 protein_id gnl|my_center|LOCUS_00860 90524 91156 gene locus_tag LOCUS_00870 90524 91156 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262276.1 protein_id gnl|my_center|LOCUS_00870 91309 92517 gene locus_tag LOCUS_00880 91309 92517 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262277.1 protein_id gnl|my_center|LOCUS_00880 92527 94245 gene locus_tag LOCUS_00890 92527 94245 CDS product ABC transporter permease/substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262278.1 protein_id gnl|my_center|LOCUS_00890 94328 94660 gene locus_tag LOCUS_00900 94328 94660 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262279.1 protein_id gnl|my_center|LOCUS_00900 94685 96253 gene locus_tag LOCUS_00910 gene ffh 94685 96253 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262280.1 protein_id gnl|my_center|LOCUS_00910 96401 97072 gene locus_tag LOCUS_00920 96401 97072 CDS product SatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262282.1 protein_id gnl|my_center|LOCUS_00920 97065 97835 gene locus_tag LOCUS_00930 97065 97835 CDS product DUF3307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922396.1 protein_id gnl|my_center|LOCUS_00930 98008 99159 gene locus_tag LOCUS_00940 98008 99159 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262422.1 protein_id gnl|my_center|LOCUS_00940 99159 99794 gene locus_tag LOCUS_00950 99159 99794 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262423.1 protein_id gnl|my_center|LOCUS_00950 99796 100719 gene locus_tag LOCUS_00960 99796 100719 CDS product osmoprotectant ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914798.1 protein_id gnl|my_center|LOCUS_00960 100716 101381 gene locus_tag LOCUS_00970 100716 101381 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262425.1 protein_id gnl|my_center|LOCUS_00970 101887 102849 gene locus_tag LOCUS_00980 101887 102849 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359995.1 protein_id gnl|my_center|LOCUS_00980 103008 103265 gene locus_tag LOCUS_00990 103008 103265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 103699 104769 gene locus_tag LOCUS_01000 gene xerS 103699 104769 CDS product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262304.1 protein_id gnl|my_center|LOCUS_01000 105757 104807 gene locus_tag LOCUS_01010 105757 104807 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263236.1 protein_id gnl|my_center|LOCUS_01010 106425 105754 gene locus_tag LOCUS_01020 106425 105754 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263237.1 protein_id gnl|my_center|LOCUS_01020 108430 106469 gene locus_tag LOCUS_01030 108430 106469 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775105.1 protein_id gnl|my_center|LOCUS_01030 109184 108432 gene locus_tag LOCUS_01040 109184 108432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922409.1 protein_id gnl|my_center|LOCUS_01040 110329 109388 gene locus_tag LOCUS_01050 110329 109388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 110355 110558 gene locus_tag LOCUS_01060 110355 110558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 110859 111338 gene locus_tag LOCUS_01070 110859 111338 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922334.1 protein_id gnl|my_center|LOCUS_01070 115597 111395 gene locus_tag LOCUS_01080 gene gtfC 115597 111395 CDS product glucosyltransferase GtfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352269.1 protein_id gnl|my_center|LOCUS_01080 117106 115775 gene locus_tag LOCUS_01090 gene trmFO 117106 115775 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922319.1 protein_id gnl|my_center|LOCUS_01090 119487 117370 gene locus_tag LOCUS_01100 gene topA 119487 117370 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262866.1 protein_id gnl|my_center|LOCUS_01100 120424 119582 gene locus_tag LOCUS_01110 gene dprA 120424 119582 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262865.1 protein_id gnl|my_center|LOCUS_01110 121420 120473 gene locus_tag LOCUS_01120 121420 120473 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948840.1 protein_id gnl|my_center|LOCUS_01120 121983 121435 gene locus_tag LOCUS_01130 121983 121435 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922479.1 protein_id gnl|my_center|LOCUS_01130 122777 122010 gene locus_tag LOCUS_01140 122777 122010 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922484.1 protein_id gnl|my_center|LOCUS_01140 123615 122764 gene locus_tag LOCUS_01150 gene ylqF 123615 122764 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922485.1 protein_id gnl|my_center|LOCUS_01150 124071 123733 gene locus_tag LOCUS_01160 124071 123733 CDS product ATP cone domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262855.1 protein_id gnl|my_center|LOCUS_01160 124705 124202 gene locus_tag LOCUS_01170 124705 124202 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228963.1 protein_id gnl|my_center|LOCUS_01170 125635 124751 gene locus_tag LOCUS_01180 gene dapA 125635 124751 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262854.1 protein_id gnl|my_center|LOCUS_01180 126733 125657 gene locus_tag LOCUS_01190 126733 125657 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836981.1 protein_id gnl|my_center|LOCUS_01190 128562 127039 gene locus_tag LOCUS_01200 gene cls 128562 127039 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262851.1 protein_id gnl|my_center|LOCUS_01200 130037 128712 gene locus_tag LOCUS_01210 130037 128712 CDS product collagen binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262850.1 protein_id gnl|my_center|LOCUS_01210 130801 130310 gene locus_tag LOCUS_01220 130801 130310 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586895.1 protein_id gnl|my_center|LOCUS_01220 132526 130853 gene locus_tag LOCUS_01230 132526 130853 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775633.1 protein_id gnl|my_center|LOCUS_01230 132837 133199 gene locus_tag LOCUS_01240 132837 133199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 133255 133941 gene locus_tag LOCUS_01250 133255 133941 CDS product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262266.1 protein_id gnl|my_center|LOCUS_01250 133934 134479 gene locus_tag LOCUS_01260 gene coaC 133934 134479 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595814.1 protein_id gnl|my_center|LOCUS_01260 134472 135044 gene locus_tag LOCUS_01270 134472 135044 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262264.1 protein_id gnl|my_center|LOCUS_01270 135119 136837 gene locus_tag LOCUS_01280 135119 136837 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222553.1 protein_id gnl|my_center|LOCUS_01280 137488 136883 gene locus_tag LOCUS_01290 137488 136883 CDS product lysozyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262260.1 protein_id gnl|my_center|LOCUS_01290 138464 137490 gene locus_tag LOCUS_01300 138464 137490 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968655.1 protein_id gnl|my_center|LOCUS_01300 139725 138466 gene locus_tag LOCUS_01310 139725 138466 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262258.1 protein_id gnl|my_center|LOCUS_01310 140327 139740 gene locus_tag LOCUS_01320 140327 139740 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262257.1 protein_id gnl|my_center|LOCUS_01320 141150 140320 gene locus_tag LOCUS_01330 gene prmC 141150 140320 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262256.1 protein_id gnl|my_center|LOCUS_01330 142229 141150 gene locus_tag LOCUS_01340 gene prfA 142229 141150 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897584.1 protein_id gnl|my_center|LOCUS_01340 142819 142226 gene locus_tag LOCUS_01350 142819 142226 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068109.1 protein_id gnl|my_center|LOCUS_01350 142964 143149 gene locus_tag LOCUS_01360 142964 143149 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262253.1 protein_id gnl|my_center|LOCUS_01360 143189 144127 gene locus_tag LOCUS_01370 143189 144127 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262252.1 protein_id gnl|my_center|LOCUS_01370 144305 145786 gene locus_tag LOCUS_01380 144305 145786 CDS product LPXTG cell wall anchor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262249.1 protein_id gnl|my_center|LOCUS_01380 147092 145827 gene locus_tag LOCUS_01390 147092 145827 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671521.1 protein_id gnl|my_center|LOCUS_01390 147676 147095 gene locus_tag LOCUS_01400 147676 147095 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984677.1 protein_id gnl|my_center|LOCUS_01400 148779 147796 gene locus_tag LOCUS_01410 gene guaC 148779 147796 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922299.1 protein_id gnl|my_center|LOCUS_01410 149024 150493 gene locus_tag LOCUS_01420 149024 150493 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262247.1 protein_id gnl|my_center|LOCUS_01420 150507 151178 gene locus_tag LOCUS_01430 150507 151178 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262246.1 protein_id gnl|my_center|LOCUS_01430 152403 151984 gene locus_tag LOCUS_01440 152403 151984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263729.1 protein_id gnl|my_center|LOCUS_01440 152709 152494 gene locus_tag LOCUS_01450 152709 152494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 153005 152748 gene locus_tag LOCUS_01460 153005 152748 CDS product Blp family class II bacteriocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263727.1 protein_id gnl|my_center|LOCUS_01460 154887 153370 gene locus_tag LOCUS_01470 154887 153370 CDS product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262245.1 protein_id gnl|my_center|LOCUS_01470 155609 154884 gene locus_tag LOCUS_01480 155609 154884 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262244.1 protein_id gnl|my_center|LOCUS_01480 156070 155621 gene locus_tag LOCUS_01490 156070 155621 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262243.1 protein_id gnl|my_center|LOCUS_01490 157031 156072 gene locus_tag LOCUS_01500 157031 156072 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262242.1 protein_id gnl|my_center|LOCUS_01500 158058 157210 gene locus_tag LOCUS_01510 158058 157210 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603534.1 protein_id gnl|my_center|LOCUS_01510 158144 158881 gene locus_tag LOCUS_01520 158144 158881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984687.1 protein_id gnl|my_center|LOCUS_01520 159728 158892 gene locus_tag LOCUS_01530 159728 158892 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262299.1 protein_id gnl|my_center|LOCUS_01530 160492 159740 gene locus_tag LOCUS_01540 160492 159740 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262298.1 protein_id gnl|my_center|LOCUS_01540 160625 161371 gene locus_tag LOCUS_01550 160625 161371 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262297.1 protein_id gnl|my_center|LOCUS_01550 161368 162978 gene locus_tag LOCUS_01560 161368 162978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262296.1 protein_id gnl|my_center|LOCUS_01560 164024 163032 gene locus_tag LOCUS_01570 gene pta 164024 163032 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922296.1 protein_id gnl|my_center|LOCUS_01570 164930 164040 gene locus_tag LOCUS_01580 164930 164040 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667475.1 protein_id gnl|my_center|LOCUS_01580 165760 164927 gene locus_tag LOCUS_01590 165760 164927 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262293.1 protein_id gnl|my_center|LOCUS_01590 166406 165735 gene locus_tag LOCUS_01600 166406 165735 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262292.1 protein_id gnl|my_center|LOCUS_01600 166501 167064 gene locus_tag LOCUS_01610 166501 167064 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262290.1 protein_id gnl|my_center|LOCUS_01610 168921 167122 gene locus_tag LOCUS_01620 168921 167122 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287647.1 protein_id gnl|my_center|LOCUS_01620 169095 170069 gene locus_tag LOCUS_01630 169095 170069 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263830.1 protein_id gnl|my_center|LOCUS_01630 170081 171196 gene locus_tag LOCUS_01640 170081 171196 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639605.1 protein_id gnl|my_center|LOCUS_01640 171199 171555 gene locus_tag LOCUS_01650 171199 171555 CDS product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262287.1 protein_id gnl|my_center|LOCUS_01650 171687 172331 gene locus_tag LOCUS_01660 171687 172331 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262286.1 protein_id gnl|my_center|LOCUS_01660 172343 173041 gene locus_tag LOCUS_01670 172343 173041 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262285.1 protein_id gnl|my_center|LOCUS_01670 173718 173038 gene locus_tag LOCUS_01680 gene radC 173718 173038 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262284.1 protein_id gnl|my_center|LOCUS_01680 174894 173779 gene locus_tag LOCUS_01690 174894 173779 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262240.1 protein_id gnl|my_center|LOCUS_01690 176425 174989 gene locus_tag LOCUS_01700 176425 174989 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262239.1 protein_id gnl|my_center|LOCUS_01700 177028 176429 gene locus_tag LOCUS_01710 177028 176429 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262237.1 protein_id gnl|my_center|LOCUS_01710 177637 177041 gene locus_tag LOCUS_01720 177637 177041 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262236.1 protein_id gnl|my_center|LOCUS_01720 178391 177768 gene locus_tag LOCUS_01730 178391 177768 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267815.1 protein_id gnl|my_center|LOCUS_01730 179236 178427 gene locus_tag LOCUS_01740 179236 178427 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262234.1 protein_id gnl|my_center|LOCUS_01740 181829 179580 gene locus_tag LOCUS_01750 181829 179580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 182052 182963 gene locus_tag LOCUS_01760 182052 182963 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074572.1 protein_id gnl|my_center|LOCUS_01760 184071 182998 gene locus_tag LOCUS_01770 184071 182998 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984738.1 protein_id gnl|my_center|LOCUS_01770 184840 184064 gene locus_tag LOCUS_01780 184840 184064 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262839.1 protein_id gnl|my_center|LOCUS_01780 185631 184837 gene locus_tag LOCUS_01790 185631 184837 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262838.1 protein_id gnl|my_center|LOCUS_01790 186769 185615 gene locus_tag LOCUS_01800 186769 185615 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262837.1 protein_id gnl|my_center|LOCUS_01800 187689 186787 gene locus_tag LOCUS_01810 gene murB 187689 186787 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262836.1 protein_id gnl|my_center|LOCUS_01810 188289 187801 gene locus_tag LOCUS_01820 gene folK 188289 187801 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262835.1 protein_id gnl|my_center|LOCUS_01820 188648 188286 gene locus_tag LOCUS_01830 gene folB 188648 188286 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262834.1 protein_id gnl|my_center|LOCUS_01830 189455 188655 gene locus_tag LOCUS_01840 gene folP 189455 188655 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922282.1 protein_id gnl|my_center|LOCUS_01840 190027 189467 gene locus_tag LOCUS_01850 gene folE 190027 189467 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133588.1 protein_id gnl|my_center|LOCUS_01850 191326 190067 gene locus_tag LOCUS_01860 191326 190067 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262831.1 protein_id gnl|my_center|LOCUS_01860 192248 191361 gene locus_tag LOCUS_01870 gene rarD 192248 191361 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224293.1 protein_id gnl|my_center|LOCUS_01870 193104 192235 gene locus_tag LOCUS_01880 gene thrB 193104 192235 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262830.1 protein_id gnl|my_center|LOCUS_01880 194392 193106 gene locus_tag LOCUS_01890 194392 193106 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262829.1 protein_id gnl|my_center|LOCUS_01890 194498 195388 gene locus_tag LOCUS_01900 194498 195388 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262828.1 protein_id gnl|my_center|LOCUS_01900 195591 195409 gene locus_tag LOCUS_01910 195591 195409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 196470 195709 gene locus_tag LOCUS_01920 196470 195709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 197410 196640 gene locus_tag LOCUS_01930 197410 196640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 198992 197508 gene locus_tag LOCUS_01940 198992 197508 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931832.1 protein_id gnl|my_center|LOCUS_01940 200264 199335 gene locus_tag LOCUS_01950 200264 199335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 201200 200376 gene locus_tag LOCUS_01960 201200 200376 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774938.1 protein_id gnl|my_center|LOCUS_01960 202754 201273 gene locus_tag LOCUS_01970 202754 201273 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546652.1 protein_id gnl|my_center|LOCUS_01970 203177 202794 gene locus_tag LOCUS_01980 203177 202794 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016864.1 protein_id gnl|my_center|LOCUS_01980 203382 203720 gene locus_tag LOCUS_01990 203382 203720 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200772684.1 protein_id gnl|my_center|LOCUS_01990 205675 203762 gene locus_tag LOCUS_02000 205675 203762 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262843.1 protein_id gnl|my_center|LOCUS_02000 206702 205866 gene locus_tag LOCUS_02010 206702 205866 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264303.1 protein_id gnl|my_center|LOCUS_02010 207888 206902 gene locus_tag LOCUS_02020 207888 206902 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803888.1 protein_id gnl|my_center|LOCUS_02020 209172 208045 gene locus_tag LOCUS_02030 209172 208045 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836412.1 protein_id gnl|my_center|LOCUS_02030 209762 209394 gene locus_tag LOCUS_02040 gene rplL 209762 209394 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262825.1 protein_id gnl|my_center|LOCUS_02040 210331 209828 gene locus_tag LOCUS_02050 gene rplJ 210331 209828 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262824.1 protein_id gnl|my_center|LOCUS_02050 210740 212845 gene locus_tag LOCUS_02060 210740 212845 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262823.1 protein_id gnl|my_center|LOCUS_02060 213425 212892 gene locus_tag LOCUS_02070 213425 212892 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262822.1 protein_id gnl|my_center|LOCUS_02070 214263 213394 gene locus_tag LOCUS_02080 214263 213394 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262821.1 protein_id gnl|my_center|LOCUS_02080 214362 215621 gene locus_tag LOCUS_02090 214362 215621 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263804.1 protein_id gnl|my_center|LOCUS_02090 216586 215636 gene locus_tag LOCUS_02100 gene mmuM 216586 215636 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262819.1 protein_id gnl|my_center|LOCUS_02100 217972 216596 gene locus_tag LOCUS_02110 217972 216596 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427485.1 protein_id gnl|my_center|LOCUS_02110 218661 218074 gene locus_tag LOCUS_02120 gene yihA 218661 218074 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262817.1 protein_id gnl|my_center|LOCUS_02120 219904 218672 gene locus_tag LOCUS_02130 gene clpX 219904 218672 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262816.1 protein_id gnl|my_center|LOCUS_02130 219876 220046 gene locus_tag LOCUS_02140 219876 220046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 220617 220117 gene locus_tag LOCUS_02150 220617 220117 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262814.1 protein_id gnl|my_center|LOCUS_02150 221540 220701 gene locus_tag LOCUS_02160 221540 220701 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263663.1 protein_id gnl|my_center|LOCUS_02160 221759 222946 gene locus_tag LOCUS_02170 221759 222946 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266471.1 protein_id gnl|my_center|LOCUS_02170 222933 224225 gene locus_tag LOCUS_02180 222933 224225 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074567.1 protein_id gnl|my_center|LOCUS_02180 225254 224247 gene locus_tag LOCUS_02190 gene fni 225254 224247 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263658.1 protein_id gnl|my_center|LOCUS_02190 226251 225241 gene locus_tag LOCUS_02200 226251 225241 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263657.1 protein_id gnl|my_center|LOCUS_02200 227186 226254 gene locus_tag LOCUS_02210 gene mvaD 227186 226254 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836442.1 protein_id gnl|my_center|LOCUS_02210 227998 227168 gene locus_tag LOCUS_02220 gene mvk 227998 227168 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836441.1 protein_id gnl|my_center|LOCUS_02220 229169 228162 gene locus_tag LOCUS_02230 229169 228162 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079769.1 protein_id gnl|my_center|LOCUS_02230 230133 229171 gene locus_tag LOCUS_02240 230133 229171 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978084.1 protein_id gnl|my_center|LOCUS_02240 230290 230135 gene locus_tag LOCUS_02250 230290 230135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 230775 230290 gene locus_tag LOCUS_02260 230775 230290 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083908.1 protein_id gnl|my_center|LOCUS_02260 231030 230794 gene locus_tag LOCUS_02270 231030 230794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 231628 231116 gene locus_tag LOCUS_02280 231628 231116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02280 232541 231777 gene locus_tag LOCUS_02290 232541 231777 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263655.1 protein_id gnl|my_center|LOCUS_02290 233225 232551 gene locus_tag LOCUS_02300 233225 232551 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263654.1 protein_id gnl|my_center|LOCUS_02300 233928 233236 gene locus_tag LOCUS_02310 233928 233236 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263653.1 protein_id gnl|my_center|LOCUS_02310 234795 233938 gene locus_tag LOCUS_02320 234795 233938 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263652.1 protein_id gnl|my_center|LOCUS_02320 235812 234808 gene locus_tag LOCUS_02330 235812 234808 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263651.1 protein_id gnl|my_center|LOCUS_02330 237139 236000 gene locus_tag LOCUS_02340 237139 236000 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263589.1 protein_id gnl|my_center|LOCUS_02340 237370 238281 gene locus_tag LOCUS_02350 237370 238281 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263650.1 protein_id gnl|my_center|LOCUS_02350 238344 238700 gene locus_tag LOCUS_02360 238344 238700 CDS product DUF1304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263648.1 protein_id gnl|my_center|LOCUS_02360 239980 238745 gene locus_tag LOCUS_02370 239980 238745 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289573.1 protein_id gnl|my_center|LOCUS_02370 240671 239970 gene locus_tag LOCUS_02380 240671 239970 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263646.1 protein_id gnl|my_center|LOCUS_02380 241297 240668 gene locus_tag LOCUS_02390 241297 240668 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263645.1 protein_id gnl|my_center|LOCUS_02390 241881 241402 gene locus_tag LOCUS_02400 gene tpx 241881 241402 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263295.1 protein_id gnl|my_center|LOCUS_02400 243834 242077 gene locus_tag LOCUS_02410 243834 242077 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263294.1 protein_id gnl|my_center|LOCUS_02410 245626 243824 gene locus_tag LOCUS_02420 245626 243824 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263293.1 protein_id gnl|my_center|LOCUS_02420 246074 245610 gene locus_tag LOCUS_02430 246074 245610 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431166.1 protein_id gnl|my_center|LOCUS_02430 246222 246028 gene locus_tag LOCUS_02440 246222 246028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 246653 246516 gene locus_tag LOCUS_02450 246653 246516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 248282 246933 gene locus_tag LOCUS_02460 gene gdhA 248282 246933 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263849.1 protein_id gnl|my_center|LOCUS_02460 248409 248245 gene locus_tag LOCUS_02470 248409 248245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 248792 248421 gene locus_tag LOCUS_02480 248792 248421 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369612.1 protein_id gnl|my_center|LOCUS_02480 248931 249440 gene locus_tag LOCUS_02490 248931 249440 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262901.1 protein_id gnl|my_center|LOCUS_02490 253935 249493 gene locus_tag LOCUS_02500 253935 249493 CDS product glycoside hydrolase family 70 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352262.1 protein_id gnl|my_center|LOCUS_02500 255108 254188 gene locus_tag LOCUS_02510 255108 254188 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262899.1 protein_id gnl|my_center|LOCUS_02510 256946 255174 gene locus_tag LOCUS_02520 256946 255174 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262898.1 protein_id gnl|my_center|LOCUS_02520 258690 256951 gene locus_tag LOCUS_02530 258690 256951 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262897.1 protein_id gnl|my_center|LOCUS_02530 259181 258708 gene locus_tag LOCUS_02540 259181 258708 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836468.1 protein_id gnl|my_center|LOCUS_02540 261055 259181 gene locus_tag LOCUS_02550 261055 259181 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279326.1 protein_id gnl|my_center|LOCUS_02550 262212 261052 gene locus_tag LOCUS_02560 262212 261052 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262894.1 protein_id gnl|my_center|LOCUS_02560 263024 262257 gene locus_tag LOCUS_02570 gene dapB 263024 262257 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262893.1 protein_id gnl|my_center|LOCUS_02570 263879 263037 gene locus_tag LOCUS_02580 263879 263037 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262892.1 protein_id gnl|my_center|LOCUS_02580 264258 263884 gene locus_tag LOCUS_02590 264258 263884 CDS product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262891.1 protein_id gnl|my_center|LOCUS_02590 264848 264327 gene locus_tag LOCUS_02600 264848 264327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178080.1 protein_id gnl|my_center|LOCUS_02600 267045 265213 gene locus_tag LOCUS_02610 267045 265213 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262022.1 protein_id gnl|my_center|LOCUS_02610 269295 267058 gene locus_tag LOCUS_02620 gene metE 269295 267058 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262021.1 protein_id gnl|my_center|LOCUS_02620 271490 269541 gene locus_tag LOCUS_02630 271490 269541 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701411.1 protein_id gnl|my_center|LOCUS_02630 272398 271487 gene locus_tag LOCUS_02640 gene pfkB 272398 271487 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262019.1 protein_id gnl|my_center|LOCUS_02640 273108 272395 gene locus_tag LOCUS_02650 273108 272395 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266239.1 protein_id gnl|my_center|LOCUS_02650 274298 273288 gene locus_tag LOCUS_02660 274298 273288 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262017.1 protein_id gnl|my_center|LOCUS_02660 275086 274370 gene locus_tag LOCUS_02670 gene trmD 275086 274370 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922154.1 protein_id gnl|my_center|LOCUS_02670 275591 275073 gene locus_tag LOCUS_02680 gene rimM 275591 275073 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922346.1 protein_id gnl|my_center|LOCUS_02680 275913 275674 gene locus_tag LOCUS_02690 275913 275674 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262014.1 protein_id gnl|my_center|LOCUS_02690 276192 275920 gene locus_tag LOCUS_02700 gene rpsP 276192 275920 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985074.1 protein_id gnl|my_center|LOCUS_02700 277913 276621 gene locus_tag LOCUS_02710 277913 276621 CDS product ISLre2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453221.1 protein_id gnl|my_center|LOCUS_02710 278322 278083 gene locus_tag LOCUS_02720 278322 278083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 278887 278405 gene locus_tag LOCUS_02730 278887 278405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 279718 278921 gene locus_tag LOCUS_02740 279718 278921 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241731.1 protein_id gnl|my_center|LOCUS_02740 280612 279758 gene locus_tag LOCUS_02750 280612 279758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 281115 280816 gene locus_tag LOCUS_02760 281115 280816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 281570 281127 gene locus_tag LOCUS_02770 281570 281127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02770 282377 281733 gene locus_tag LOCUS_02780 282377 281733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02780 284017 282389 gene locus_tag LOCUS_02790 284017 282389 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774278.1 protein_id gnl|my_center|LOCUS_02790 284357 283989 gene locus_tag LOCUS_02800 284357 283989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 285021 284722 gene locus_tag LOCUS_02810 285021 284722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 288279 285073 gene locus_tag LOCUS_02820 288279 285073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 290363 288315 gene locus_tag LOCUS_02830 290363 288315 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069653754.1 protein_id gnl|my_center|LOCUS_02830 290854 290363 gene locus_tag LOCUS_02840 290854 290363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 291657 290875 gene locus_tag LOCUS_02850 291657 290875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 291929 291657 gene locus_tag LOCUS_02860 291929 291657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 292559 291948 gene locus_tag LOCUS_02870 292559 291948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002395055.1 protein_id gnl|my_center|LOCUS_02870 295264 292580 gene locus_tag LOCUS_02880 295264 292580 CDS product phage tail tip lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656702.1 protein_id gnl|my_center|LOCUS_02880 297649 295289 gene locus_tag LOCUS_02890 297649 295289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109621.1 protein_id gnl|my_center|LOCUS_02890 297980 297627 gene locus_tag LOCUS_02900 297980 297627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 298813 298064 gene locus_tag LOCUS_02910 298813 298064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 299457 298885 gene locus_tag LOCUS_02920 299457 298885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 299778 299551 gene locus_tag LOCUS_02930 299778 299551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 300122 299862 gene locus_tag LOCUS_02940 300122 299862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 302165 300144 gene locus_tag LOCUS_02950 302165 300144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 302935 302228 gene locus_tag LOCUS_02960 gene prgC 302935 302228 CDS product pheromone response LPXTG-anchored adhesin PrgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367673.1 protein_id gnl|my_center|LOCUS_02960 303255 302932 gene locus_tag LOCUS_02970 303255 302932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 303869 303537 gene locus_tag LOCUS_02980 gene ssb 303869 303537 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905962.1 protein_id gnl|my_center|LOCUS_02980 304199 303921 gene locus_tag LOCUS_02990 304199 303921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134670.1 protein_id gnl|my_center|LOCUS_02990 304424 304242 gene locus_tag LOCUS_03000 304424 304242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 305410 304436 gene locus_tag LOCUS_03010 305410 304436 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775512.1 protein_id gnl|my_center|LOCUS_03010 305594 305415 gene locus_tag LOCUS_03020 305594 305415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 306259 305642 gene locus_tag LOCUS_03030 306259 305642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 306451 306299 gene locus_tag LOCUS_03040 306451 306299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 307269 306466 gene locus_tag LOCUS_03050 307269 306466 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773261.1 protein_id gnl|my_center|LOCUS_03050 307799 307395 gene locus_tag LOCUS_03060 307799 307395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 308082 307801 gene locus_tag LOCUS_03070 308082 307801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310784.1 protein_id gnl|my_center|LOCUS_03070 308541 308110 gene locus_tag LOCUS_03080 308541 308110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03080 309236 308538 gene locus_tag LOCUS_03090 309236 308538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03090 309914 309432 gene locus_tag LOCUS_03100 309914 309432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 310101 309931 gene locus_tag LOCUS_03110 310101 309931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 310222 310091 gene locus_tag LOCUS_03120 310222 310091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 310603 310232 gene locus_tag LOCUS_03130 310603 310232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 >Feature sequence02 <1 1134 gene locus_tag LOCUS_03140 <1 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262879.1:galactokinase 1139 2623 gene locus_tag LOCUS_03150 gene galT 1139 2623 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352255.1 protein_id gnl|my_center|LOCUS_03150 2624 3625 gene locus_tag LOCUS_03160 gene galE 2624 3625 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262881.1 protein_id gnl|my_center|LOCUS_03160 3802 4116 gene locus_tag LOCUS_03170 3802 4116 CDS product PTS cellobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262789.1 protein_id gnl|my_center|LOCUS_03170 4156 6123 gene locus_tag LOCUS_03180 4156 6123 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352342.1 protein_id gnl|my_center|LOCUS_03180 6130 6444 gene locus_tag LOCUS_03190 6130 6444 CDS product PTS cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262791.1 protein_id gnl|my_center|LOCUS_03190 6986 8344 gene locus_tag LOCUS_03200 gene celB 6986 8344 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262793.1 protein_id gnl|my_center|LOCUS_03200 8490 9074 gene locus_tag LOCUS_03210 8490 9074 CDS product CDP-archaeol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262795.1 protein_id gnl|my_center|LOCUS_03210 9077 11503 gene locus_tag LOCUS_03220 9077 11503 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836865.1 protein_id gnl|my_center|LOCUS_03220 11507 12121 gene locus_tag LOCUS_03230 11507 12121 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836866.1 protein_id gnl|my_center|LOCUS_03230 12115 12990 gene locus_tag LOCUS_03240 12115 12990 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836867.1 protein_id gnl|my_center|LOCUS_03240 12974 13876 gene locus_tag LOCUS_03250 12974 13876 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002906717.1 protein_id gnl|my_center|LOCUS_03250 13873 16293 gene locus_tag LOCUS_03260 13873 16293 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836868.1 protein_id gnl|my_center|LOCUS_03260 16286 17356 gene locus_tag LOCUS_03270 16286 17356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836869.1 protein_id gnl|my_center|LOCUS_03270 18465 17386 gene locus_tag LOCUS_03280 18465 17386 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262796.1 protein_id gnl|my_center|LOCUS_03280 18627 19628 gene locus_tag LOCUS_03290 gene ccpA 18627 19628 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262797.1 protein_id gnl|my_center|LOCUS_03290 19715 21181 gene locus_tag LOCUS_03300 19715 21181 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263876.1 protein_id gnl|my_center|LOCUS_03300 21256 22263 gene locus_tag LOCUS_03310 21256 22263 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262799.1 protein_id gnl|my_center|LOCUS_03310 22265 23599 gene locus_tag LOCUS_03320 22265 23599 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262800.1 protein_id gnl|my_center|LOCUS_03320 23711 24076 gene locus_tag LOCUS_03330 23711 24076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 24900 25292 gene locus_tag LOCUS_03340 24900 25292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 25295 25654 gene locus_tag LOCUS_03350 25295 25654 CDS product MazG-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775219.1 protein_id gnl|my_center|LOCUS_03350 25701 27713 gene locus_tag LOCUS_03360 gene thrS 25701 27713 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837214.1 protein_id gnl|my_center|LOCUS_03360 27939 29273 gene locus_tag LOCUS_03370 27939 29273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 29379 29927 gene locus_tag LOCUS_03380 29379 29927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 30021 31055 gene locus_tag LOCUS_03390 30021 31055 CDS product DUF3114 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352238.1 protein_id gnl|my_center|LOCUS_03390 31121 31927 gene locus_tag LOCUS_03400 31121 31927 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352239.1 protein_id gnl|my_center|LOCUS_03400 31924 32745 gene locus_tag LOCUS_03410 31924 32745 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263635.1 protein_id gnl|my_center|LOCUS_03410 32747 34084 gene locus_tag LOCUS_03420 gene ftsY 32747 34084 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263634.1 protein_id gnl|my_center|LOCUS_03420 35469 34108 gene locus_tag LOCUS_03430 35469 34108 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263633.1 protein_id gnl|my_center|LOCUS_03430 36349 35534 gene locus_tag LOCUS_03440 36349 35534 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263632.1 protein_id gnl|my_center|LOCUS_03440 37251 36349 gene locus_tag LOCUS_03450 37251 36349 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263631.1 protein_id gnl|my_center|LOCUS_03450 37389 37255 gene locus_tag LOCUS_03460 37389 37255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 37522 38565 gene locus_tag LOCUS_03470 37522 38565 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571059.1 protein_id gnl|my_center|LOCUS_03470 38666 40792 gene locus_tag LOCUS_03480 38666 40792 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263864.1 protein_id gnl|my_center|LOCUS_03480 40779 41216 gene locus_tag LOCUS_03490 40779 41216 CDS product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922020.1 protein_id gnl|my_center|LOCUS_03490 41274 41591 gene locus_tag LOCUS_03500 41274 41591 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263628.1 protein_id gnl|my_center|LOCUS_03500 41828 43873 gene locus_tag LOCUS_03510 41828 43873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 43873 44112 gene locus_tag LOCUS_03520 43873 44112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965331.1 protein_id gnl|my_center|LOCUS_03520 44277 44597 gene locus_tag LOCUS_03530 44277 44597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 44654 44959 gene locus_tag LOCUS_03540 44654 44959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 45075 46010 gene locus_tag LOCUS_03550 gene hprK 45075 46010 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263627.1 protein_id gnl|my_center|LOCUS_03550 46003 46785 gene locus_tag LOCUS_03560 gene lgt 46003 46785 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609732.1 protein_id gnl|my_center|LOCUS_03560 46807 47211 gene locus_tag LOCUS_03570 46807 47211 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263625.1 protein_id gnl|my_center|LOCUS_03570 47204 47659 gene locus_tag LOCUS_03580 47204 47659 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263624.1 protein_id gnl|my_center|LOCUS_03580 48062 47775 gene locus_tag LOCUS_03590 48062 47775 CDS product DUF3270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263623.1 protein_id gnl|my_center|LOCUS_03590 48213 49142 gene locus_tag LOCUS_03600 48213 49142 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411174.1 protein_id gnl|my_center|LOCUS_03600 49198 50484 gene locus_tag LOCUS_03610 49198 50484 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073157.1 protein_id gnl|my_center|LOCUS_03610 50591 51151 gene locus_tag LOCUS_03620 gene ahpC 50591 51151 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263620.1 protein_id gnl|my_center|LOCUS_03620 51163 52695 gene locus_tag LOCUS_03630 gene ahpF 51163 52695 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263619.1 protein_id gnl|my_center|LOCUS_03630 53071 52757 gene locus_tag LOCUS_03640 53071 52757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261922.1 protein_id gnl|my_center|LOCUS_03640 53168 53380 gene locus_tag LOCUS_03650 53168 53380 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261923.1 protein_id gnl|my_center|LOCUS_03650 53923 53384 gene locus_tag LOCUS_03660 53923 53384 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837199.1 protein_id gnl|my_center|LOCUS_03660 55338 53986 gene locus_tag LOCUS_03670 55338 53986 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261924.1 protein_id gnl|my_center|LOCUS_03670 57190 55703 gene locus_tag LOCUS_03680 gene lysS 57190 55703 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261927.1 protein_id gnl|my_center|LOCUS_03680 57338 58240 gene locus_tag LOCUS_03690 57338 58240 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633102.1 protein_id gnl|my_center|LOCUS_03690 58916 58266 gene locus_tag LOCUS_03700 58916 58266 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263325.1 protein_id gnl|my_center|LOCUS_03700 59472 58993 gene locus_tag LOCUS_03710 59472 58993 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038843.1 protein_id gnl|my_center|LOCUS_03710 60311 59469 gene locus_tag LOCUS_03720 60311 59469 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263322.1 protein_id gnl|my_center|LOCUS_03720 61319 60357 gene locus_tag LOCUS_03730 61319 60357 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074540.1 protein_id gnl|my_center|LOCUS_03730 61926 61372 gene locus_tag LOCUS_03740 gene thiT 61926 61372 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263320.1 protein_id gnl|my_center|LOCUS_03740 61814 62017 gene locus_tag LOCUS_03750 61814 62017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 62925 62113 gene locus_tag LOCUS_03760 62925 62113 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263319.1 protein_id gnl|my_center|LOCUS_03760 63129 63641 gene locus_tag LOCUS_03770 63129 63641 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263318.1 protein_id gnl|my_center|LOCUS_03770 63625 64008 gene locus_tag LOCUS_03780 63625 64008 CDS product DUF4430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263317.1 protein_id gnl|my_center|LOCUS_03780 64149 66845 gene locus_tag LOCUS_03790 gene ppc 64149 66845 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263316.1 protein_id gnl|my_center|LOCUS_03790 66951 68222 gene locus_tag LOCUS_03800 66951 68222 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263315.1 protein_id gnl|my_center|LOCUS_03800 68298 68801 gene locus_tag LOCUS_03810 68298 68801 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922077.1 protein_id gnl|my_center|LOCUS_03810 68785 69738 gene locus_tag LOCUS_03820 68785 69738 CDS product sigma factor regulator N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598067.1 protein_id gnl|my_center|LOCUS_03820 69866 71062 gene locus_tag LOCUS_03830 gene tuf 69866 71062 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263314.1 protein_id gnl|my_center|LOCUS_03830 71411 71220 gene locus_tag LOCUS_03840 71411 71220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 71574 71404 gene locus_tag LOCUS_03850 71574 71404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 72187 71624 gene locus_tag LOCUS_03860 72187 71624 CDS product DUF3796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060648.1 protein_id gnl|my_center|LOCUS_03860 72482 73240 gene locus_tag LOCUS_03870 gene tpiA 72482 73240 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922080.1 protein_id gnl|my_center|LOCUS_03870 75342 74110 gene locus_tag LOCUS_03880 75342 74110 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263312.1 protein_id gnl|my_center|LOCUS_03880 76556 75342 gene locus_tag LOCUS_03890 76556 75342 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263311.1 protein_id gnl|my_center|LOCUS_03890 77365 76556 gene locus_tag LOCUS_03900 gene yidA 77365 76556 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200668.1 protein_id gnl|my_center|LOCUS_03900 78924 77611 gene locus_tag LOCUS_03910 78924 77611 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263309.1 protein_id gnl|my_center|LOCUS_03910 79016 79408 gene locus_tag LOCUS_03920 79016 79408 CDS product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922083.1 protein_id gnl|my_center|LOCUS_03920 79626 82310 gene locus_tag LOCUS_03930 79626 82310 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922034.1 protein_id gnl|my_center|LOCUS_03930 82378 83097 gene locus_tag LOCUS_03940 82378 83097 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261903.1 protein_id gnl|my_center|LOCUS_03940 83150 84118 gene locus_tag LOCUS_03950 83150 84118 CDS product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261897.1 protein_id gnl|my_center|LOCUS_03950 84118 85932 gene locus_tag LOCUS_03960 gene pepF 84118 85932 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261896.1 protein_id gnl|my_center|LOCUS_03960 85929 86546 gene locus_tag LOCUS_03970 85929 86546 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261895.1 protein_id gnl|my_center|LOCUS_03970 86904 87536 gene locus_tag LOCUS_03980 86904 87536 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230399.1 protein_id gnl|my_center|LOCUS_03980 87598 88584 gene locus_tag LOCUS_03990 gene prsA 87598 88584 CDS product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261893.1 protein_id gnl|my_center|LOCUS_03990 88821 89321 gene locus_tag LOCUS_04000 88821 89321 CDS product LURP-one-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261892.1 protein_id gnl|my_center|LOCUS_04000 89345 91963 gene locus_tag LOCUS_04010 gene alaS 89345 91963 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261891.1 protein_id gnl|my_center|LOCUS_04010 92050 92415 gene locus_tag LOCUS_04020 92050 92415 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263324.1 protein_id gnl|my_center|LOCUS_04020 92560 92730 gene locus_tag LOCUS_04030 92560 92730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 92734 92952 gene locus_tag LOCUS_04040 92734 92952 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261880.1 protein_id gnl|my_center|LOCUS_04040 92942 93697 gene locus_tag LOCUS_04050 92942 93697 CDS product DUF3169 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922423.1 protein_id gnl|my_center|LOCUS_04050 93716 94405 gene locus_tag LOCUS_04060 93716 94405 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261879.1 protein_id gnl|my_center|LOCUS_04060 94526 95548 gene locus_tag LOCUS_04070 gene argC 94526 95548 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261878.1 protein_id gnl|my_center|LOCUS_04070 95558 96751 gene locus_tag LOCUS_04080 gene argJ 95558 96751 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261877.1 protein_id gnl|my_center|LOCUS_04080 96754 97491 gene locus_tag LOCUS_04090 gene argB 96754 97491 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261876.1 protein_id gnl|my_center|LOCUS_04090 97499 98629 gene locus_tag LOCUS_04100 97499 98629 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261875.1 protein_id gnl|my_center|LOCUS_04100 99560 98700 gene locus_tag LOCUS_04110 99560 98700 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002281358.1 protein_id gnl|my_center|LOCUS_04110 99665 100789 gene locus_tag LOCUS_04120 gene queG 99665 100789 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287738.1 protein_id gnl|my_center|LOCUS_04120 100942 101931 gene locus_tag LOCUS_04130 gene prfB 100942 101931 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100198625.1 protein_id gnl|my_center|LOCUS_04130 101958 102650 gene locus_tag LOCUS_04140 gene ftsE 101958 102650 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263537.1 protein_id gnl|my_center|LOCUS_04140 102643 103578 gene locus_tag LOCUS_04150 gene ftsX 102643 103578 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263538.1 protein_id gnl|my_center|LOCUS_04150 104240 103605 gene locus_tag LOCUS_04160 104240 103605 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263539.1 protein_id gnl|my_center|LOCUS_04160 104442 105620 gene locus_tag LOCUS_04170 104442 105620 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_04170 105632 106384 gene locus_tag LOCUS_04180 105632 106384 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289836.1 protein_id gnl|my_center|LOCUS_04180 107249 106419 gene locus_tag LOCUS_04190 107249 106419 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263714.1 protein_id gnl|my_center|LOCUS_04190 107400 109865 gene locus_tag LOCUS_04200 107400 109865 CDS product bifunctional DnaQ family exonuclease/ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002274023.1 protein_id gnl|my_center|LOCUS_04200 109919 111100 gene locus_tag LOCUS_04210 109919 111100 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777789.1 protein_id gnl|my_center|LOCUS_04210 111121 112461 gene locus_tag LOCUS_04220 gene asnS 111121 112461 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376912.1 protein_id gnl|my_center|LOCUS_04220 112580 112963 gene locus_tag LOCUS_04230 112580 112963 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140422.1 protein_id gnl|my_center|LOCUS_04230 112982 113707 gene locus_tag LOCUS_04240 112982 113707 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263720.1 protein_id gnl|my_center|LOCUS_04240 113915 115756 gene locus_tag LOCUS_04250 113915 115756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 115764 116660 gene locus_tag LOCUS_04260 115764 116660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 116674 118509 gene locus_tag LOCUS_04270 116674 118509 CDS product DUF2194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964051.1 protein_id gnl|my_center|LOCUS_04270 118518 119921 gene locus_tag LOCUS_04280 gene pelF 118518 119921 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964052.1 protein_id gnl|my_center|LOCUS_04280 119909 121360 gene locus_tag LOCUS_04290 gene pelG 119909 121360 CDS product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964053.1 protein_id gnl|my_center|LOCUS_04290 121357 123141 gene locus_tag LOCUS_04300 121357 123141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 123128 123856 gene locus_tag LOCUS_04310 123128 123856 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006715.1 protein_id gnl|my_center|LOCUS_04310 123901 124572 gene locus_tag LOCUS_04320 123901 124572 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_04320 124601 125971 gene locus_tag LOCUS_04330 124601 125971 CDS product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262908.1 protein_id gnl|my_center|LOCUS_04330 126097 126987 gene locus_tag LOCUS_04340 gene rapZ 126097 126987 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263721.1 protein_id gnl|my_center|LOCUS_04340 126984 127958 gene locus_tag LOCUS_04350 126984 127958 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263722.1 protein_id gnl|my_center|LOCUS_04350 127958 128869 gene locus_tag LOCUS_04360 gene whiA 127958 128869 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263723.1 protein_id gnl|my_center|LOCUS_04360 129165 130673 gene locus_tag LOCUS_04370 129165 130673 CDS product zinc ABC transporter substrate-binding protein AdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263144.1 protein_id gnl|my_center|LOCUS_04370 130831 131181 gene locus_tag LOCUS_04380 130831 131181 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352309.1 protein_id gnl|my_center|LOCUS_04380 131171 131476 gene locus_tag LOCUS_04390 131171 131476 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263147.1 protein_id gnl|my_center|LOCUS_04390 131760 131518 gene locus_tag LOCUS_04400 131760 131518 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012997715.1 protein_id gnl|my_center|LOCUS_04400 132227 132778 gene locus_tag LOCUS_04410 132227 132778 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235430.1 protein_id gnl|my_center|LOCUS_04410 133748 132798 gene locus_tag LOCUS_04420 133748 132798 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263149.1 protein_id gnl|my_center|LOCUS_04420 133908 133750 gene locus_tag LOCUS_04430 133908 133750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 134763 133972 gene locus_tag LOCUS_04440 gene yghU 134763 133972 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263150.1 protein_id gnl|my_center|LOCUS_04440 134873 135892 gene locus_tag LOCUS_04450 gene add 134873 135892 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074606.1 protein_id gnl|my_center|LOCUS_04450 135953 136396 gene locus_tag LOCUS_04460 135953 136396 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263152.1 protein_id gnl|my_center|LOCUS_04460 136462 137160 gene locus_tag LOCUS_04470 136462 137160 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263154.1 protein_id gnl|my_center|LOCUS_04470 137233 137508 gene locus_tag LOCUS_04480 137233 137508 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900255.1 protein_id gnl|my_center|LOCUS_04480 137505 138728 gene locus_tag LOCUS_04490 137505 138728 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263156.1 protein_id gnl|my_center|LOCUS_04490 138847 139194 gene locus_tag LOCUS_04500 gene rplS 138847 139194 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921928.1 protein_id gnl|my_center|LOCUS_04500 139346 139419 gene locus_tag LOCUS_t00040 139346 139419 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 139534 140523 gene locus_tag LOCUS_04510 gene dhaK 139534 140523 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720682.1 protein_id gnl|my_center|LOCUS_04510 140533 141111 gene locus_tag LOCUS_04520 gene dhaL 140533 141111 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453282.1 protein_id gnl|my_center|LOCUS_04520 141108 141482 gene locus_tag LOCUS_04530 gene dhaM 141108 141482 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023942554.1 protein_id gnl|my_center|LOCUS_04530 141922 141497 gene locus_tag LOCUS_04540 141922 141497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 142076 143299 gene locus_tag LOCUS_04550 142076 143299 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263164.1 protein_id gnl|my_center|LOCUS_04550 143328 143939 gene locus_tag LOCUS_04560 143328 143939 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263166.1 protein_id gnl|my_center|LOCUS_04560 143950 145905 gene locus_tag LOCUS_04570 gene gyrB 143950 145905 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263167.1 protein_id gnl|my_center|LOCUS_04570 145999 147720 gene locus_tag LOCUS_04580 gene ezrA 145999 147720 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263873.1 protein_id gnl|my_center|LOCUS_04580 148127 149176 gene locus_tag LOCUS_04590 gene hisC 148127 149176 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263171.1 protein_id gnl|my_center|LOCUS_04590 149173 150147 gene locus_tag LOCUS_04600 149173 150147 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263172.1 protein_id gnl|my_center|LOCUS_04600 150144 150791 gene locus_tag LOCUS_04610 gene hisG 150144 150791 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263173.1 protein_id gnl|my_center|LOCUS_04610 150788 152071 gene locus_tag LOCUS_04620 gene hisD 150788 152071 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263174.1 protein_id gnl|my_center|LOCUS_04620 152058 152702 gene locus_tag LOCUS_04630 gene serB 152058 152702 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263175.1 protein_id gnl|my_center|LOCUS_04630 152705 154210 gene locus_tag LOCUS_04640 152705 154210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 154207 154791 gene locus_tag LOCUS_04650 gene hisB 154207 154791 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263176.1 protein_id gnl|my_center|LOCUS_04650 154793 155398 gene locus_tag LOCUS_04660 gene hisH 154793 155398 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263178.1 protein_id gnl|my_center|LOCUS_04660 155454 156173 gene locus_tag LOCUS_04670 gene hisA 155454 156173 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263872.1 protein_id gnl|my_center|LOCUS_04670 156177 156935 gene locus_tag LOCUS_04680 gene hisF 156177 156935 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263180.1 protein_id gnl|my_center|LOCUS_04680 156932 157261 gene locus_tag LOCUS_04690 gene hisI 156932 157261 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263181.1 protein_id gnl|my_center|LOCUS_04690 157277 157591 gene locus_tag LOCUS_04700 gene hisE 157277 157591 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265591.1 protein_id gnl|my_center|LOCUS_04700 158257 157604 gene locus_tag LOCUS_04710 158257 157604 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263190.1 protein_id gnl|my_center|LOCUS_04710 158348 159472 gene locus_tag LOCUS_04720 158348 159472 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263192.1 protein_id gnl|my_center|LOCUS_04720 160116 159655 gene locus_tag LOCUS_04730 160116 159655 CDS product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263193.1 protein_id gnl|my_center|LOCUS_04730 160265 160900 gene locus_tag LOCUS_04740 160265 160900 CDS product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263195.1 protein_id gnl|my_center|LOCUS_04740 161023 162321 gene locus_tag LOCUS_04750 gene eno 161023 162321 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263196.1 protein_id gnl|my_center|LOCUS_04750 162436 165219 gene locus_tag LOCUS_04760 162436 165219 CDS product GBS Bsp-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263335.1 protein_id gnl|my_center|LOCUS_04760 165241 165804 gene locus_tag LOCUS_04770 165241 165804 CDS product DUF6287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263334.1 protein_id gnl|my_center|LOCUS_04770 165881 167107 gene locus_tag LOCUS_04780 gene pepT 165881 167107 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263333.1 protein_id gnl|my_center|LOCUS_04780 167161 167652 gene locus_tag LOCUS_04790 167161 167652 CDS product EbsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263332.1 protein_id gnl|my_center|LOCUS_04790 167833 167639 gene locus_tag LOCUS_04800 167833 167639 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263331.1 protein_id gnl|my_center|LOCUS_04800 167879 168337 gene locus_tag LOCUS_04810 167879 168337 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263330.1 protein_id gnl|my_center|LOCUS_04810 168303 169031 gene locus_tag LOCUS_04820 gene cmk 168303 169031 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775570.1 protein_id gnl|my_center|LOCUS_04820 169195 169725 gene locus_tag LOCUS_04830 gene infC 169195 169725 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691023.1 protein_id gnl|my_center|LOCUS_04830 169762 169962 gene locus_tag LOCUS_04840 gene rpmI 169762 169962 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263327.1 protein_id gnl|my_center|LOCUS_04840 170010 170369 gene locus_tag LOCUS_04850 gene rplT 170010 170369 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124830.1 protein_id gnl|my_center|LOCUS_04850 170627 177220 gene locus_tag LOCUS_04860 170627 177220 CDS product pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925492.1 protein_id gnl|my_center|LOCUS_04860 179413 177272 gene locus_tag LOCUS_04870 179413 177272 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261929.1 protein_id gnl|my_center|LOCUS_04870 179549 180709 gene locus_tag LOCUS_04880 179549 180709 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263895.1 protein_id gnl|my_center|LOCUS_04880 180710 181387 gene locus_tag LOCUS_04890 gene aroD 180710 181387 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261931.1 protein_id gnl|my_center|LOCUS_04890 181377 182243 gene locus_tag LOCUS_04900 181377 182243 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261932.1 protein_id gnl|my_center|LOCUS_04900 182252 183319 gene locus_tag LOCUS_04910 gene aroB 182252 183319 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920829.1 protein_id gnl|my_center|LOCUS_04910 183320 184486 gene locus_tag LOCUS_04920 gene aroC 183320 184486 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261934.1 protein_id gnl|my_center|LOCUS_04920 184486 185319 gene locus_tag LOCUS_04930 184486 185319 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906392.1 protein_id gnl|my_center|LOCUS_04930 185320 185703 gene locus_tag LOCUS_04940 185320 185703 CDS product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700872.1 protein_id gnl|my_center|LOCUS_04940 185713 186819 gene locus_tag LOCUS_04950 185713 186819 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261935.1 protein_id gnl|my_center|LOCUS_04950 186831 187169 gene locus_tag LOCUS_04960 186831 187169 CDS product YlbF/YmcA family competence regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261936.1 protein_id gnl|my_center|LOCUS_04960 187280 188566 gene locus_tag LOCUS_04970 gene aroA 187280 188566 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261938.1 protein_id gnl|my_center|LOCUS_04970 188559 189050 gene locus_tag LOCUS_04980 188559 189050 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261939.1 protein_id gnl|my_center|LOCUS_04980 189041 189865 gene locus_tag LOCUS_04990 gene pheA 189041 189865 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261940.1 protein_id gnl|my_center|LOCUS_04990 189892 191295 gene locus_tag LOCUS_05000 189892 191295 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261941.1 protein_id gnl|my_center|LOCUS_05000 191354 192715 gene locus_tag LOCUS_05010 gene rlmD 191354 192715 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902654.1 protein_id gnl|my_center|LOCUS_05010 192926 193093 gene locus_tag LOCUS_05020 192926 193093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775511.1 protein_id gnl|my_center|LOCUS_05020 193096 193914 gene locus_tag LOCUS_05030 193096 193914 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105158881.1 protein_id gnl|my_center|LOCUS_05030 194063 195418 gene locus_tag LOCUS_05040 gene dcm 194063 195418 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775513.1 protein_id gnl|my_center|LOCUS_05040 195402 195830 gene locus_tag LOCUS_05050 195402 195830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922469.1 protein_id gnl|my_center|LOCUS_05050 195841 196224 gene locus_tag LOCUS_05060 195841 196224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775514.1 protein_id gnl|my_center|LOCUS_05060 196233 196466 gene locus_tag LOCUS_05070 196233 196466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005708.1 protein_id gnl|my_center|LOCUS_05070 196469 197053 gene locus_tag LOCUS_05080 196469 197053 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619432.1 protein_id gnl|my_center|LOCUS_05080 197131 197619 gene locus_tag LOCUS_05090 197131 197619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936460.1 protein_id gnl|my_center|LOCUS_05090 197619 199436 gene locus_tag LOCUS_05100 197619 199436 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775517.1 protein_id gnl|my_center|LOCUS_05100 199454 199696 gene locus_tag LOCUS_05110 199454 199696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072182.1 protein_id gnl|my_center|LOCUS_05110 199715 200569 gene locus_tag LOCUS_05120 199715 200569 CDS product conjugal transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775518.1 protein_id gnl|my_center|LOCUS_05120 200631 200984 gene locus_tag LOCUS_05130 200631 200984 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775123.1 protein_id gnl|my_center|LOCUS_05130 >Feature sequence03 611 1507 gene locus_tag LOCUS_05140 611 1507 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905602.1 protein_id gnl|my_center|LOCUS_05140 2544 1531 gene locus_tag LOCUS_05150 2544 1531 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040804636.1 protein_id gnl|my_center|LOCUS_05150 2682 3422 gene locus_tag LOCUS_05160 2682 3422 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500205.1 protein_id gnl|my_center|LOCUS_05160 3512 4174 gene locus_tag LOCUS_05170 3512 4174 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261916.1 protein_id gnl|my_center|LOCUS_05170 4167 6398 gene locus_tag LOCUS_05180 4167 6398 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261915.1 protein_id gnl|my_center|LOCUS_05180 6539 7288 gene locus_tag LOCUS_05190 6539 7288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 7349 7948 gene locus_tag LOCUS_05200 7349 7948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 8055 9092 gene locus_tag LOCUS_05210 gene holA 8055 9092 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922435.1 protein_id gnl|my_center|LOCUS_05210 9164 9769 gene locus_tag LOCUS_05220 gene sodA 9164 9769 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028394.1 protein_id gnl|my_center|LOCUS_05220 9911 10969 gene locus_tag LOCUS_05230 9911 10969 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074536.1 protein_id gnl|my_center|LOCUS_05230 11242 11787 gene locus_tag LOCUS_05240 11242 11787 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263248.1 protein_id gnl|my_center|LOCUS_05240 12842 11814 gene locus_tag LOCUS_05250 gene queA 12842 11814 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922429.1 protein_id gnl|my_center|LOCUS_05250 12962 13663 gene locus_tag LOCUS_05260 gene nagB 12962 13663 CDS product glucosamine-6-phosphate deaminase NagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261905.1 protein_id gnl|my_center|LOCUS_05260 13763 14503 gene locus_tag LOCUS_05270 13763 14503 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279795.1 protein_id gnl|my_center|LOCUS_05270 15572 14613 gene locus_tag LOCUS_05280 gene nrdF 15572 14613 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261874.1 protein_id gnl|my_center|LOCUS_05280 17784 15625 gene locus_tag LOCUS_05290 gene nrdE 17784 15625 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261873.1 protein_id gnl|my_center|LOCUS_05290 18093 17869 gene locus_tag LOCUS_05300 18093 17869 CDS product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261872.1 protein_id gnl|my_center|LOCUS_05300 18353 21022 gene locus_tag LOCUS_05310 gene acnA 18353 21022 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261871.1 protein_id gnl|my_center|LOCUS_05310 21019 22137 gene locus_tag LOCUS_05320 21019 22137 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261870.1 protein_id gnl|my_center|LOCUS_05320 22139 23329 gene locus_tag LOCUS_05330 gene icd 22139 23329 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603126.1 protein_id gnl|my_center|LOCUS_05330 23503 23766 gene locus_tag LOCUS_05340 23503 23766 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146945.1 protein_id gnl|my_center|LOCUS_05340 23769 25496 gene locus_tag LOCUS_05350 gene ptsP 23769 25496 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138135.1 protein_id gnl|my_center|LOCUS_05350 25666 27105 gene locus_tag LOCUS_05360 25666 27105 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922418.1 protein_id gnl|my_center|LOCUS_05360 27221 28855 gene locus_tag LOCUS_05370 27221 28855 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262712.1 protein_id gnl|my_center|LOCUS_05370 29978 28890 gene locus_tag LOCUS_05380 29978 28890 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922416.1 protein_id gnl|my_center|LOCUS_05380 30955 29975 gene locus_tag LOCUS_05390 30955 29975 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262710.1 protein_id gnl|my_center|LOCUS_05390 31047 31673 gene locus_tag LOCUS_05400 gene udk 31047 31673 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262709.1 protein_id gnl|my_center|LOCUS_05400 31968 33530 gene locus_tag LOCUS_05410 31968 33530 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262708.1 protein_id gnl|my_center|LOCUS_05410 33545 34582 gene locus_tag LOCUS_05420 gene leuB 33545 34582 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262707.1 protein_id gnl|my_center|LOCUS_05420 34569 34853 gene locus_tag LOCUS_05430 34569 34853 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571501.1 protein_id gnl|my_center|LOCUS_05430 34850 36235 gene locus_tag LOCUS_05440 gene leuC 34850 36235 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836839.1 protein_id gnl|my_center|LOCUS_05440 36247 36837 gene locus_tag LOCUS_05450 gene leuD 36247 36837 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410624.1 protein_id gnl|my_center|LOCUS_05450 36891 37457 gene locus_tag LOCUS_05460 36891 37457 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263641.1 protein_id gnl|my_center|LOCUS_05460 37457 38083 gene locus_tag LOCUS_05470 37457 38083 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836849.1 protein_id gnl|my_center|LOCUS_05470 38111 38731 gene locus_tag LOCUS_05480 38111 38731 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836850.1 protein_id gnl|my_center|LOCUS_05480 38846 39262 gene locus_tag LOCUS_05490 38846 39262 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861830.1 protein_id gnl|my_center|LOCUS_05490 39265 39987 gene locus_tag LOCUS_05500 39265 39987 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681925.1 protein_id gnl|my_center|LOCUS_05500 39990 40721 gene locus_tag LOCUS_05510 39990 40721 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956797.1 protein_id gnl|my_center|LOCUS_05510 40804 41301 gene locus_tag LOCUS_05520 40804 41301 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836852.1 protein_id gnl|my_center|LOCUS_05520 41301 42968 gene locus_tag LOCUS_05530 gene dnaX 41301 42968 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262806.1 protein_id gnl|my_center|LOCUS_05530 43039 43209 gene locus_tag LOCUS_05540 43039 43209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 44125 43190 gene locus_tag LOCUS_05550 gene birA 44125 43190 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262808.1 protein_id gnl|my_center|LOCUS_05550 44435 45631 gene locus_tag LOCUS_05560 gene metK 44435 45631 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837180.1 protein_id gnl|my_center|LOCUS_05560 45720 48194 gene locus_tag LOCUS_05570 45720 48194 CDS product GBS Bsp-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836393.1 protein_id gnl|my_center|LOCUS_05570 48321 49580 gene locus_tag LOCUS_05580 48321 49580 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262980.1 protein_id gnl|my_center|LOCUS_05580 50805 49672 gene locus_tag LOCUS_05590 gene ugpC 50805 49672 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262979.1 protein_id gnl|my_center|LOCUS_05590 51660 50824 gene locus_tag LOCUS_05600 51660 50824 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262978.1 protein_id gnl|my_center|LOCUS_05600 53021 51660 gene locus_tag LOCUS_05610 53021 51660 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262977.1 protein_id gnl|my_center|LOCUS_05610 54333 53086 gene locus_tag LOCUS_05620 54333 53086 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262976.1 protein_id gnl|my_center|LOCUS_05620 54562 56304 gene locus_tag LOCUS_05630 54562 56304 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379398.1 protein_id gnl|my_center|LOCUS_05630 56379 57404 gene locus_tag LOCUS_05640 56379 57404 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262975.1 protein_id gnl|my_center|LOCUS_05640 57504 59018 gene locus_tag LOCUS_05650 gene malQ 57504 59018 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262974.1 protein_id gnl|my_center|LOCUS_05650 59005 61281 gene locus_tag LOCUS_05660 59005 61281 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262973.1 protein_id gnl|my_center|LOCUS_05660 61392 61946 gene locus_tag LOCUS_05670 61392 61946 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262968.1 protein_id gnl|my_center|LOCUS_05670 61939 63222 gene locus_tag LOCUS_05680 gene spxR 61939 63222 CDS product CBS-HotDog domain-containing transcription factor SpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262967.1 protein_id gnl|my_center|LOCUS_05680 63239 64099 gene locus_tag LOCUS_05690 63239 64099 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262966.1 protein_id gnl|my_center|LOCUS_05690 64108 65031 gene locus_tag LOCUS_05700 64108 65031 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262965.1 protein_id gnl|my_center|LOCUS_05700 65219 66097 gene locus_tag LOCUS_05710 65219 66097 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027604.1 protein_id gnl|my_center|LOCUS_05710 66094 66825 gene locus_tag LOCUS_05720 66094 66825 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262960.1 protein_id gnl|my_center|LOCUS_05720 66827 67912 gene locus_tag LOCUS_05730 66827 67912 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791349.1 protein_id gnl|my_center|LOCUS_05730 67914 68510 gene locus_tag LOCUS_05740 67914 68510 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262958.1 protein_id gnl|my_center|LOCUS_05740 68990 68538 gene locus_tag LOCUS_05750 68990 68538 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262957.1 protein_id gnl|my_center|LOCUS_05750 69114 69623 gene locus_tag LOCUS_05760 69114 69623 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027540.1 protein_id gnl|my_center|LOCUS_05760 69721 71679 gene locus_tag LOCUS_05770 gene ligA 69721 71679 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002268549.1 protein_id gnl|my_center|LOCUS_05770 71691 72728 gene locus_tag LOCUS_05780 71691 72728 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262954.1 protein_id gnl|my_center|LOCUS_05780 72734 75049 gene locus_tag LOCUS_05790 gene pulA 72734 75049 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002273870.1 protein_id gnl|my_center|LOCUS_05790 75144 77021 gene locus_tag LOCUS_05800 gene glgB 75144 77021 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262951.1 protein_id gnl|my_center|LOCUS_05800 77049 78188 gene locus_tag LOCUS_05810 77049 78188 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262950.1 protein_id gnl|my_center|LOCUS_05810 78178 79311 gene locus_tag LOCUS_05820 gene glgD 78178 79311 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262949.1 protein_id gnl|my_center|LOCUS_05820 79308 80738 gene locus_tag LOCUS_05830 gene glgA 79308 80738 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262948.1 protein_id gnl|my_center|LOCUS_05830 80765 83161 gene locus_tag LOCUS_05840 80765 83161 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262947.1 protein_id gnl|my_center|LOCUS_05840 83363 83566 gene locus_tag LOCUS_05850 83363 83566 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262946.1 protein_id gnl|my_center|LOCUS_05850 83605 84318 gene locus_tag LOCUS_05860 gene atpB 83605 84318 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262945.1 protein_id gnl|my_center|LOCUS_05860 84336 84836 gene locus_tag LOCUS_05870 gene atpF 84336 84836 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262944.1 protein_id gnl|my_center|LOCUS_05870 84833 85372 gene locus_tag LOCUS_05880 84833 85372 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262943.1 protein_id gnl|my_center|LOCUS_05880 85388 86893 gene locus_tag LOCUS_05890 gene atpA 85388 86893 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262942.1 protein_id gnl|my_center|LOCUS_05890 86911 87789 gene locus_tag LOCUS_05900 86911 87789 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262941.1 protein_id gnl|my_center|LOCUS_05900 87811 89217 gene locus_tag LOCUS_05910 gene atpD 87811 89217 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262940.1 protein_id gnl|my_center|LOCUS_05910 89227 89649 gene locus_tag LOCUS_05920 89227 89649 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262939.1 protein_id gnl|my_center|LOCUS_05920 89792 90028 gene locus_tag LOCUS_05930 89792 90028 CDS product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262938.1 protein_id gnl|my_center|LOCUS_05930 90073 91344 gene locus_tag LOCUS_05940 gene murA 90073 91344 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262937.1 protein_id gnl|my_center|LOCUS_05940 91347 91535 gene locus_tag LOCUS_05950 91347 91535 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262936.1 protein_id gnl|my_center|LOCUS_05950 91576 92454 gene locus_tag LOCUS_05960 91576 92454 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262935.1 protein_id gnl|my_center|LOCUS_05960 93138 92488 gene locus_tag LOCUS_05970 93138 92488 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262934.1 protein_id gnl|my_center|LOCUS_05970 93857 93153 gene locus_tag LOCUS_05980 93857 93153 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262933.1 protein_id gnl|my_center|LOCUS_05980 94690 93875 gene locus_tag LOCUS_05990 94690 93875 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262932.1 protein_id gnl|my_center|LOCUS_05990 95469 94687 gene locus_tag LOCUS_06000 95469 94687 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262931.1 protein_id gnl|my_center|LOCUS_06000 95725 96432 gene locus_tag LOCUS_06010 gene yycF 95725 96432 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262930.1 protein_id gnl|my_center|LOCUS_06010 96425 97774 gene locus_tag LOCUS_06020 gene vicK 96425 97774 CDS product cell wall metabolism sensor histidine kinase VicK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262929.1 protein_id gnl|my_center|LOCUS_06020 97776 98579 gene locus_tag LOCUS_06030 97776 98579 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837210.1 protein_id gnl|my_center|LOCUS_06030 98682 99377 gene locus_tag LOCUS_06040 gene rnc 98682 99377 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262927.1 protein_id gnl|my_center|LOCUS_06040 99380 102925 gene locus_tag LOCUS_06050 gene smc 99380 102925 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262926.1 protein_id gnl|my_center|LOCUS_06050 103769 103011 gene locus_tag LOCUS_06060 103769 103011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 104087 105130 gene locus_tag LOCUS_06070 gene pheS 104087 105130 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262925.1 protein_id gnl|my_center|LOCUS_06070 105127 105660 gene locus_tag LOCUS_06080 105127 105660 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775170.1 protein_id gnl|my_center|LOCUS_06080 105654 108059 gene locus_tag LOCUS_06090 gene pheT 105654 108059 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352339.1 protein_id gnl|my_center|LOCUS_06090 108112 108489 gene locus_tag LOCUS_06100 108112 108489 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002993028.1 protein_id gnl|my_center|LOCUS_06100 109406 108498 gene locus_tag LOCUS_06110 109406 108498 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775292.1 protein_id gnl|my_center|LOCUS_06110 109555 110538 gene locus_tag LOCUS_06120 109555 110538 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263669.1 protein_id gnl|my_center|LOCUS_06120 110725 113508 gene locus_tag LOCUS_06130 gene cas3 110725 113508 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440412.1 protein_id gnl|my_center|LOCUS_06130 113505 115181 gene locus_tag LOCUS_06140 113505 115181 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994024.1 protein_id gnl|my_center|LOCUS_06140 115191 115787 gene locus_tag LOCUS_06150 gene casB 115191 115787 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003586648.1 protein_id gnl|my_center|LOCUS_06150 115777 116850 gene locus_tag LOCUS_06160 gene cas7e 115777 116850 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 protein_id gnl|my_center|LOCUS_06160 116860 117582 gene locus_tag LOCUS_06170 gene cas5e 116860 117582 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994022.1 protein_id gnl|my_center|LOCUS_06170 117587 118237 gene locus_tag LOCUS_06180 gene cas6e 117587 118237 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112674.1 protein_id gnl|my_center|LOCUS_06180 118231 119172 gene locus_tag LOCUS_06190 gene cas1e 118231 119172 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440418.1 protein_id gnl|my_center|LOCUS_06190 119174 120076 gene locus_tag LOCUS_06200 gene cas2e 119174 120076 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674076.1 protein_id gnl|my_center|LOCUS_06200 120100 123121 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttacccgcacacgcgggggtgatcct 123364 126603 gene locus_tag LOCUS_06210 gene rexB 123364 126603 CDS product ATP-dependent nuclease subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262920.1 protein_id gnl|my_center|LOCUS_06210 126596 130237 gene locus_tag LOCUS_06220 gene addA 126596 130237 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262919.1 protein_id gnl|my_center|LOCUS_06220 130234 130893 gene locus_tag LOCUS_06230 130234 130893 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027148.1 protein_id gnl|my_center|LOCUS_06230 131874 131191 gene locus_tag LOCUS_06240 131874 131191 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922094.1 protein_id gnl|my_center|LOCUS_06240 133134 131989 gene locus_tag LOCUS_06250 133134 131989 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263061.1 protein_id gnl|my_center|LOCUS_06250 133286 134020 gene locus_tag LOCUS_06260 133286 134020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263062.1 protein_id gnl|my_center|LOCUS_06260 134184 135014 gene locus_tag LOCUS_06270 134184 135014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 135067 135603 gene locus_tag LOCUS_06280 135067 135603 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002273839.1 protein_id gnl|my_center|LOCUS_06280 135607 136329 gene locus_tag LOCUS_06290 135607 136329 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263066.1 protein_id gnl|my_center|LOCUS_06290 136244 136711 gene locus_tag LOCUS_06300 136244 136711 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261902.1 protein_id gnl|my_center|LOCUS_06300 137940 136837 gene locus_tag LOCUS_06310 gene ald 137940 136837 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219405.1 protein_id gnl|my_center|LOCUS_06310 138117 139097 gene locus_tag LOCUS_06320 138117 139097 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909407.1 protein_id gnl|my_center|LOCUS_06320 139157 139522 gene locus_tag LOCUS_06330 139157 139522 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616225.1 protein_id gnl|my_center|LOCUS_06330 140016 140429 gene locus_tag LOCUS_06340 140016 140429 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836423.1 protein_id gnl|my_center|LOCUS_06340 140422 141003 gene locus_tag LOCUS_06350 140422 141003 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836424.1 protein_id gnl|my_center|LOCUS_06350 140996 141751 gene locus_tag LOCUS_06360 140996 141751 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836425.1 protein_id gnl|my_center|LOCUS_06360 141781 142413 gene locus_tag LOCUS_06370 141781 142413 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476288.1 protein_id gnl|my_center|LOCUS_06370 142588 143106 gene locus_tag LOCUS_06380 142588 143106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775348.1 protein_id gnl|my_center|LOCUS_06380 143420 144046 gene locus_tag LOCUS_06390 143420 144046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 144124 144642 gene locus_tag LOCUS_06400 144124 144642 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476518.1 protein_id gnl|my_center|LOCUS_06400 144661 146178 gene locus_tag LOCUS_06410 gene cls 144661 146178 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_06410 146190 146543 gene locus_tag LOCUS_06420 146190 146543 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775272.1 protein_id gnl|my_center|LOCUS_06420 146543 147748 gene locus_tag LOCUS_06430 146543 147748 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476649.1 protein_id gnl|my_center|LOCUS_06430 147735 148490 gene locus_tag LOCUS_06440 147735 148490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 148793 148617 gene locus_tag LOCUS_06450 148793 148617 CDS product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263068.1 protein_id gnl|my_center|LOCUS_06450 148953 149840 gene locus_tag LOCUS_06460 gene miaA 148953 149840 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226482.1 protein_id gnl|my_center|LOCUS_06460 150067 151305 gene locus_tag LOCUS_06470 gene hflX 150067 151305 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263070.1 protein_id gnl|my_center|LOCUS_06470 151298 151936 gene locus_tag LOCUS_06480 151298 151936 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263071.1 protein_id gnl|my_center|LOCUS_06480 151964 152893 gene locus_tag LOCUS_06490 gene rnz 151964 152893 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263072.1 protein_id gnl|my_center|LOCUS_06490 152890 153669 gene locus_tag LOCUS_06500 152890 153669 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263858.1 protein_id gnl|my_center|LOCUS_06500 153666 155879 gene locus_tag LOCUS_06510 gene recJ 153666 155879 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263074.1 protein_id gnl|my_center|LOCUS_06510 156003 156905 gene locus_tag LOCUS_06520 156003 156905 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263075.1 protein_id gnl|my_center|LOCUS_06520 157038 157670 gene locus_tag LOCUS_06530 157038 157670 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267179.1 protein_id gnl|my_center|LOCUS_06530 157670 157882 gene locus_tag LOCUS_06540 157670 157882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06540 157869 158180 gene locus_tag LOCUS_06550 157869 158180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06550 158324 158836 gene locus_tag LOCUS_06560 158324 158836 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897341.1 protein_id gnl|my_center|LOCUS_06560 158944 159888 gene locus_tag LOCUS_06570 gene metA 158944 159888 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263079.1 protein_id gnl|my_center|LOCUS_06570 159897 160586 gene locus_tag LOCUS_06580 159897 160586 CDS product DnaD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263080.1 protein_id gnl|my_center|LOCUS_06580 160588 161235 gene locus_tag LOCUS_06590 gene nth 160588 161235 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922193.1 protein_id gnl|my_center|LOCUS_06590 161222 161920 gene locus_tag LOCUS_06600 161222 161920 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775203.1 protein_id gnl|my_center|LOCUS_06600 161898 162686 gene locus_tag LOCUS_06610 161898 162686 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263082.1 protein_id gnl|my_center|LOCUS_06610 162688 163779 gene locus_tag LOCUS_06620 162688 163779 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049552700.1 protein_id gnl|my_center|LOCUS_06620 163844 164713 gene locus_tag LOCUS_06630 gene rfbA 163844 164713 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904719.1 protein_id gnl|my_center|LOCUS_06630 164713 165306 gene locus_tag LOCUS_06640 164713 165306 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027248.1 protein_id gnl|my_center|LOCUS_06640 165306 165791 gene locus_tag LOCUS_06650 165306 165791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937118.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence04 375 695 gene locus_tag LOCUS_06660 375 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549327.1 protein_id gnl|my_center|LOCUS_06660 695 1780 gene locus_tag LOCUS_06670 695 1780 CDS product type IV secretion system DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837675.1 protein_id gnl|my_center|LOCUS_06670 1780 2391 gene locus_tag LOCUS_06680 1780 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006268963.1 protein_id gnl|my_center|LOCUS_06680 2520 3116 gene locus_tag LOCUS_06690 2520 3116 CDS product replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919940.1 protein_id gnl|my_center|LOCUS_06690 3109 3363 gene locus_tag LOCUS_06700 3109 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 3360 4511 gene locus_tag LOCUS_06710 3360 4511 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007697.1 protein_id gnl|my_center|LOCUS_06710 4590 4889 gene locus_tag LOCUS_06720 4590 4889 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262625.1 protein_id gnl|my_center|LOCUS_06720 6331 4961 gene locus_tag LOCUS_06730 6331 4961 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009910561.1 protein_id gnl|my_center|LOCUS_06730 6983 6333 gene locus_tag LOCUS_06740 6983 6333 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936279.1 protein_id gnl|my_center|LOCUS_06740 7224 7919 gene locus_tag LOCUS_06750 7224 7919 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028427.1 protein_id gnl|my_center|LOCUS_06750 8018 8848 gene locus_tag LOCUS_06760 8018 8848 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775045.1 protein_id gnl|my_center|LOCUS_06760 9911 8955 gene locus_tag LOCUS_06770 9911 8955 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922180.1 protein_id gnl|my_center|LOCUS_06770 10496 9984 gene locus_tag LOCUS_06780 10496 9984 CDS product DUF536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262626.1 protein_id gnl|my_center|LOCUS_06780 10615 11793 gene locus_tag LOCUS_06790 10615 11793 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009880895.1 protein_id gnl|my_center|LOCUS_06790 11965 12390 gene locus_tag LOCUS_06800 11965 12390 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002272932.1 protein_id gnl|my_center|LOCUS_06800 12736 12413 gene locus_tag LOCUS_06810 12736 12413 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262629.1 protein_id gnl|my_center|LOCUS_06810 13290 12733 gene locus_tag LOCUS_06820 13290 12733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 14369 13359 gene locus_tag LOCUS_06830 gene tsaD 14369 13359 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262631.1 protein_id gnl|my_center|LOCUS_06830 14796 14383 gene locus_tag LOCUS_06840 gene rimI 14796 14383 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262632.1 protein_id gnl|my_center|LOCUS_06840 15499 14813 gene locus_tag LOCUS_06850 gene tsaB 15499 14813 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262633.1 protein_id gnl|my_center|LOCUS_06850 15688 15918 gene locus_tag LOCUS_06860 15688 15918 CDS product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836427.1 protein_id gnl|my_center|LOCUS_06860 15920 17599 gene locus_tag LOCUS_06870 gene rnjA 15920 17599 CDS product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310842.1 protein_id gnl|my_center|LOCUS_06870 18274 17642 gene locus_tag LOCUS_06880 18274 17642 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264906.1 protein_id gnl|my_center|LOCUS_06880 19897 18458 gene locus_tag LOCUS_06890 19897 18458 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262483.1 protein_id gnl|my_center|LOCUS_06890 24416 19899 gene locus_tag LOCUS_06900 gene gltB 24416 19899 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279635.1 protein_id gnl|my_center|LOCUS_06900 25937 24591 gene locus_tag LOCUS_06910 gene glnA 25937 24591 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262485.1 protein_id gnl|my_center|LOCUS_06910 26351 25992 gene locus_tag LOCUS_06920 26351 25992 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262486.1 protein_id gnl|my_center|LOCUS_06920 26976 26440 gene locus_tag LOCUS_06930 26976 26440 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119916.1 protein_id gnl|my_center|LOCUS_06930 28683 27487 gene locus_tag LOCUS_06940 28683 27487 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096743.1 protein_id gnl|my_center|LOCUS_06940 29830 28820 gene locus_tag LOCUS_06950 gene gap 29830 28820 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260685.1 protein_id gnl|my_center|LOCUS_06950 32113 30032 gene locus_tag LOCUS_06960 gene fusA 32113 30032 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905422.1 protein_id gnl|my_center|LOCUS_06960 32921 32451 gene locus_tag LOCUS_06970 gene rpsG 32921 32451 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087842.1 protein_id gnl|my_center|LOCUS_06970 33351 32938 gene locus_tag LOCUS_06980 gene rpsL 33351 32938 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986049.1 protein_id gnl|my_center|LOCUS_06980 34442 33618 gene locus_tag LOCUS_06990 gene purR 34442 33618 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262493.1 protein_id gnl|my_center|LOCUS_06990 35479 34535 gene locus_tag LOCUS_07000 35479 34535 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262494.1 protein_id gnl|my_center|LOCUS_07000 36743 35469 gene locus_tag LOCUS_07010 36743 35469 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960187.1 protein_id gnl|my_center|LOCUS_07010 37377 36745 gene locus_tag LOCUS_07020 37377 36745 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921882.1 protein_id gnl|my_center|LOCUS_07020 38029 37370 gene locus_tag LOCUS_07030 gene rpe 38029 37370 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992061.1 protein_id gnl|my_center|LOCUS_07030 38908 38036 gene locus_tag LOCUS_07040 gene rsgA 38908 38036 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921881.1 protein_id gnl|my_center|LOCUS_07040 39010 39094 gene locus_tag LOCUS_t00050 39010 39094 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 40006 39134 gene locus_tag LOCUS_07050 gene rsmA 40006 39134 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775362.1 protein_id gnl|my_center|LOCUS_07050 40704 40090 gene locus_tag LOCUS_07060 40704 40090 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289703.1 protein_id gnl|my_center|LOCUS_07060 40805 41119 gene locus_tag LOCUS_07070 40805 41119 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265780.1 protein_id gnl|my_center|LOCUS_07070 41743 41222 gene locus_tag LOCUS_07080 41743 41222 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279256.1 protein_id gnl|my_center|LOCUS_07080 42333 41761 gene locus_tag LOCUS_07090 gene rnmV 42333 41761 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775700.1 protein_id gnl|my_center|LOCUS_07090 43310 42510 gene locus_tag LOCUS_07100 43310 42510 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267315.1 protein_id gnl|my_center|LOCUS_07100 45302 43521 gene locus_tag LOCUS_07110 45302 43521 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673967.1 protein_id gnl|my_center|LOCUS_07110 45466 46005 gene locus_tag LOCUS_07120 45466 46005 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262077.1 protein_id gnl|my_center|LOCUS_07120 46530 46396 gene locus_tag LOCUS_07130 gene rpmH 46530 46396 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262507.1 protein_id gnl|my_center|LOCUS_07130 47026 46631 gene locus_tag LOCUS_07140 47026 46631 CDS product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263700.1 protein_id gnl|my_center|LOCUS_07140 47490 47035 gene locus_tag LOCUS_07150 47490 47035 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548931.1 protein_id gnl|my_center|LOCUS_07150 48449 47604 gene locus_tag LOCUS_07160 48449 47604 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880500.1 protein_id gnl|my_center|LOCUS_07160 49306 48446 gene locus_tag LOCUS_07170 49306 48446 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548928.1 protein_id gnl|my_center|LOCUS_07170 50320 49454 gene locus_tag LOCUS_07180 50320 49454 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310832.1 protein_id gnl|my_center|LOCUS_07180 51148 50333 gene locus_tag LOCUS_07190 gene yidC1 51148 50333 CDS product membrane protein insertase YidC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264887.1 protein_id gnl|my_center|LOCUS_07190 51491 51132 gene locus_tag LOCUS_07200 gene rnpA 51491 51132 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262511.1 protein_id gnl|my_center|LOCUS_07200 52959 51583 gene locus_tag LOCUS_07210 gene argH 52959 51583 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262512.1 protein_id gnl|my_center|LOCUS_07210 54387 53188 gene locus_tag LOCUS_07220 54387 53188 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031921.1 protein_id gnl|my_center|LOCUS_07220 55042 54758 gene locus_tag LOCUS_07230 55042 54758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 55449 55060 gene locus_tag LOCUS_07240 55449 55060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 56672 55431 gene locus_tag LOCUS_07250 56672 55431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 57078 56674 gene locus_tag LOCUS_07260 57078 56674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 57649 57128 gene locus_tag LOCUS_07270 57649 57128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 58030 57653 gene locus_tag LOCUS_07280 58030 57653 CDS product DUF1310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836699.1 protein_id gnl|my_center|LOCUS_07280 58791 58132 gene locus_tag LOCUS_07290 58791 58132 CDS product WxcM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611754.1 protein_id gnl|my_center|LOCUS_07290 59237 58809 gene locus_tag LOCUS_07300 59237 58809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 59563 59441 gene locus_tag LOCUS_07310 59563 59441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 59945 59556 gene locus_tag LOCUS_07320 59945 59556 CDS product DUF1310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836699.1 protein_id gnl|my_center|LOCUS_07320 61378 60113 gene locus_tag LOCUS_07330 61378 60113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262514.1 protein_id gnl|my_center|LOCUS_07330 62014 61472 gene locus_tag LOCUS_07340 62014 61472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262515.1 protein_id gnl|my_center|LOCUS_07340 62611 62087 gene locus_tag LOCUS_07350 62611 62087 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262516.1 protein_id gnl|my_center|LOCUS_07350 64187 62730 gene locus_tag LOCUS_07360 gene gltX 64187 62730 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837577.1 protein_id gnl|my_center|LOCUS_07360 64981 64289 gene locus_tag LOCUS_07370 64981 64289 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262518.1 protein_id gnl|my_center|LOCUS_07370 65587 65093 gene locus_tag LOCUS_07380 65587 65093 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027915.1 protein_id gnl|my_center|LOCUS_07380 66943 65678 gene locus_tag LOCUS_07390 gene radA 66943 65678 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262520.1 protein_id gnl|my_center|LOCUS_07390 67344 67054 gene locus_tag LOCUS_07400 67344 67054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 67794 67348 gene locus_tag LOCUS_07410 67794 67348 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701987.1 protein_id gnl|my_center|LOCUS_07410 68383 68988 gene locus_tag LOCUS_07420 68383 68988 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262251.1 protein_id gnl|my_center|LOCUS_07420 69000 70226 gene locus_tag LOCUS_07430 69000 70226 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673640.1 protein_id gnl|my_center|LOCUS_07430 70298 71089 gene locus_tag LOCUS_07440 70298 71089 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263424.1 protein_id gnl|my_center|LOCUS_07440 72955 71159 gene locus_tag LOCUS_07450 72955 71159 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921865.1 protein_id gnl|my_center|LOCUS_07450 74666 72960 gene locus_tag LOCUS_07460 74666 72960 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028548.1 protein_id gnl|my_center|LOCUS_07460 74845 75876 gene locus_tag LOCUS_07470 74845 75876 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262523.1 protein_id gnl|my_center|LOCUS_07470 75866 76771 gene locus_tag LOCUS_07480 gene galU 75866 76771 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004298345.1 protein_id gnl|my_center|LOCUS_07480 77473 76802 gene locus_tag LOCUS_07490 77473 76802 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262525.1 protein_id gnl|my_center|LOCUS_07490 77966 77466 gene locus_tag LOCUS_07500 77966 77466 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002268013.1 protein_id gnl|my_center|LOCUS_07500 78848 78435 gene locus_tag LOCUS_07510 78848 78435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 80078 78945 gene locus_tag LOCUS_07520 80078 78945 CDS product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262527.1 protein_id gnl|my_center|LOCUS_07520 80856 80158 gene locus_tag LOCUS_07530 gene dapD 80856 80158 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262903.1 protein_id gnl|my_center|LOCUS_07530 81391 80939 gene locus_tag LOCUS_07540 81391 80939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 81890 81405 gene locus_tag LOCUS_07550 81890 81405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 82461 82096 gene locus_tag LOCUS_07560 82461 82096 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262905.1 protein_id gnl|my_center|LOCUS_07560 83468 82476 gene locus_tag LOCUS_07570 83468 82476 CDS product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262906.1 protein_id gnl|my_center|LOCUS_07570 84024 83482 gene locus_tag LOCUS_07580 84024 83482 CDS product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262907.1 protein_id gnl|my_center|LOCUS_07580 84515 84021 gene locus_tag LOCUS_07590 84515 84021 CDS product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262908.1 protein_id gnl|my_center|LOCUS_07590 86377 84512 gene locus_tag LOCUS_07600 86377 84512 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262909.1 protein_id gnl|my_center|LOCUS_07600 87196 86396 gene locus_tag LOCUS_07610 87196 86396 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262910.1 protein_id gnl|my_center|LOCUS_07610 88734 87382 gene locus_tag LOCUS_07620 88734 87382 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262911.1 protein_id gnl|my_center|LOCUS_07620 89481 88861 gene locus_tag LOCUS_07630 89481 88861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775380.1 protein_id gnl|my_center|LOCUS_07630 90274 89804 gene locus_tag LOCUS_07640 gene tadA 90274 89804 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262913.1 protein_id gnl|my_center|LOCUS_07640 91050 90274 gene locus_tag LOCUS_07650 91050 90274 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262914.1 protein_id gnl|my_center|LOCUS_07650 91704 91144 gene locus_tag LOCUS_07660 91704 91144 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262916.1 protein_id gnl|my_center|LOCUS_07660 92846 91704 gene locus_tag LOCUS_07670 gene tgt 92846 91704 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836333.1 protein_id gnl|my_center|LOCUS_07670 93405 92965 gene locus_tag LOCUS_07680 93405 92965 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262487.1 protein_id gnl|my_center|LOCUS_07680 95169 93466 gene locus_tag LOCUS_07690 95169 93466 CDS product GbpC/Spa domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262719.1 protein_id gnl|my_center|LOCUS_07690 96125 95415 gene locus_tag LOCUS_07700 gene deoC 96125 95415 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568456.1 protein_id gnl|my_center|LOCUS_07700 98921 96309 gene locus_tag LOCUS_07710 gene polA 98921 96309 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263533.1 protein_id gnl|my_center|LOCUS_07710 100316 99033 gene locus_tag LOCUS_07720 100316 99033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 101083 100316 gene locus_tag LOCUS_07730 101083 100316 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027858.1 protein_id gnl|my_center|LOCUS_07730 101571 101080 gene locus_tag LOCUS_07740 101571 101080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 103693 101717 gene locus_tag LOCUS_07750 gene tkt 103693 101717 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837536.1 protein_id gnl|my_center|LOCUS_07750 104943 103882 gene locus_tag LOCUS_07760 104943 103882 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643576.1 protein_id gnl|my_center|LOCUS_07760 106257 104998 gene locus_tag LOCUS_07770 106257 104998 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642908.1 protein_id gnl|my_center|LOCUS_07770 106584 106288 gene locus_tag LOCUS_07780 106584 106288 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642909.1 protein_id gnl|my_center|LOCUS_07780 107077 106601 gene locus_tag LOCUS_07790 107077 106601 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642910.1 protein_id gnl|my_center|LOCUS_07790 109044 107113 gene locus_tag LOCUS_07800 gene manR 109044 107113 CDS product mannose transport/utilization transcriptional regulator ManR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245617.1 protein_id gnl|my_center|LOCUS_07800 109313 111691 gene locus_tag LOCUS_07810 109313 111691 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288399.1 protein_id gnl|my_center|LOCUS_07810 112275 114821 gene locus_tag LOCUS_07820 gene mprF 112275 114821 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733236.1 protein_id gnl|my_center|LOCUS_07820 116261 114891 gene locus_tag LOCUS_07830 116261 114891 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921827.1 protein_id gnl|my_center|LOCUS_07830 116442 118700 gene locus_tag LOCUS_07840 gene gshAB 116442 118700 CDS product bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019318694.1 protein_id gnl|my_center|LOCUS_07840 119614 118736 gene locus_tag LOCUS_07850 119614 118736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 119767 120669 gene locus_tag LOCUS_07860 gene hslO 119767 120669 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921808.1 protein_id gnl|my_center|LOCUS_07860 120662 121639 gene locus_tag LOCUS_07870 gene dusB 120662 121639 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002987812.1 protein_id gnl|my_center|LOCUS_07870 124066 121679 gene locus_tag LOCUS_07880 124066 121679 CDS product glycoside hydrolase family 68 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262343.1 protein_id gnl|my_center|LOCUS_07880 126668 124227 gene locus_tag LOCUS_07890 126668 124227 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262344.1 protein_id gnl|my_center|LOCUS_07890 127125 126673 gene locus_tag LOCUS_07900 gene ctsR 127125 126673 CDS product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262345.1 protein_id gnl|my_center|LOCUS_07900 128317 127277 gene locus_tag LOCUS_07910 gene tsf 128317 127277 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808070.1 protein_id gnl|my_center|LOCUS_07910 129171 128383 gene locus_tag LOCUS_07920 gene rpsB 129171 128383 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262347.1 protein_id gnl|my_center|LOCUS_07920 129373 129443 gene locus_tag LOCUS_t00060 129373 129443 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 129502 130455 gene locus_tag LOCUS_07930 129502 130455 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262349.1 protein_id gnl|my_center|LOCUS_07930 132569 130674 gene locus_tag LOCUS_07940 132569 130674 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262350.1 protein_id gnl|my_center|LOCUS_07940 132780 133760 gene locus_tag LOCUS_07950 132780 133760 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774928.1 protein_id gnl|my_center|LOCUS_07950 133773 134447 gene locus_tag LOCUS_07960 133773 134447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456006.1 protein_id gnl|my_center|LOCUS_07960 135367 134522 gene locus_tag LOCUS_07970 135367 134522 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837501.1 protein_id gnl|my_center|LOCUS_07970 135452 136489 gene locus_tag LOCUS_07980 135452 136489 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837500.1 protein_id gnl|my_center|LOCUS_07980 138196 136574 gene locus_tag LOCUS_07990 gene treC 138196 136574 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921814.1 protein_id gnl|my_center|LOCUS_07990 140267 138261 gene locus_tag LOCUS_08000 gene treP 140267 138261 CDS product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262352.1 protein_id gnl|my_center|LOCUS_08000 140433 141143 gene locus_tag LOCUS_08010 gene treR 140433 141143 CDS product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002273717.1 protein_id gnl|my_center|LOCUS_08010 141748 141296 gene locus_tag LOCUS_08020 gene dtd 141748 141296 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922691.1 protein_id gnl|my_center|LOCUS_08020 143964 141745 gene locus_tag LOCUS_08030 143964 141745 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262356.1 protein_id gnl|my_center|LOCUS_08030 144139 146568 gene locus_tag LOCUS_08040 144139 146568 CDS product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033934.1 protein_id gnl|my_center|LOCUS_08040 146785 148644 gene locus_tag LOCUS_08050 146785 148644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 148807 149841 gene locus_tag LOCUS_08060 148807 149841 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775666.1 protein_id gnl|my_center|LOCUS_08060 150548 149892 gene locus_tag LOCUS_08070 gene pgmB 150548 149892 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476249.1 protein_id gnl|my_center|LOCUS_08070 152813 150558 gene locus_tag LOCUS_08080 152813 150558 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476250.1 protein_id gnl|my_center|LOCUS_08080 153828 152797 gene locus_tag LOCUS_08090 153828 152797 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224907.1 protein_id gnl|my_center|LOCUS_08090 154650 153829 gene locus_tag LOCUS_08100 154650 153829 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262357.1 protein_id gnl|my_center|LOCUS_08100 156890 154707 gene locus_tag LOCUS_08110 156890 154707 CDS product PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262358.1 protein_id gnl|my_center|LOCUS_08110 158017 157004 gene locus_tag LOCUS_08120 158017 157004 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703033.1 protein_id gnl|my_center|LOCUS_08120 158792 158040 gene locus_tag LOCUS_08130 158792 158040 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188235.1 protein_id gnl|my_center|LOCUS_08130 159746 158793 gene locus_tag LOCUS_08140 gene prmA 159746 158793 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775394.1 protein_id gnl|my_center|LOCUS_08140 160272 159799 gene locus_tag LOCUS_08150 160272 159799 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903456.1 protein_id gnl|my_center|LOCUS_08150 160691 160335 gene locus_tag LOCUS_08160 160691 160335 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027987.1 protein_id gnl|my_center|LOCUS_08160 161163 160693 gene locus_tag LOCUS_08170 161163 160693 CDS product DUF3013 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262363.1 protein_id gnl|my_center|LOCUS_08170 161300 162568 gene locus_tag LOCUS_08180 161300 162568 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262365.1 protein_id gnl|my_center|LOCUS_08180 162833 162906 gene locus_tag LOCUS_t00070 162833 162906 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence05 1299 442 gene locus_tag LOCUS_08190 gene cvfB 1299 442 CDS product RNA-binding virulence regulatory protein CvfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094275.1 protein_id gnl|my_center|LOCUS_08190 1962 1405 gene locus_tag LOCUS_08200 gene frr 1962 1405 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159519.1 protein_id gnl|my_center|LOCUS_08200 2704 1973 gene locus_tag LOCUS_08210 gene pyrH 2704 1973 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263605.1 protein_id gnl|my_center|LOCUS_08210 3510 2821 gene locus_tag LOCUS_08220 gene rplA 3510 2821 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352344.1 protein_id gnl|my_center|LOCUS_08220 4072 3647 gene locus_tag LOCUS_08230 gene rplK 4072 3647 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263607.1 protein_id gnl|my_center|LOCUS_08230 4292 4642 gene locus_tag LOCUS_08240 4292 4642 CDS product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266609.1 protein_id gnl|my_center|LOCUS_08240 5531 5037 gene locus_tag LOCUS_08250 5531 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 6044 5535 gene locus_tag LOCUS_08260 6044 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 6644 6159 gene locus_tag LOCUS_08270 6644 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 6865 6647 gene locus_tag LOCUS_08280 6865 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 7649 7230 gene locus_tag LOCUS_08290 7649 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 8476 8048 gene locus_tag LOCUS_08300 8476 8048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 9128 8550 gene locus_tag LOCUS_08310 9128 8550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 9684 9187 gene locus_tag LOCUS_08320 9684 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 11464 9686 gene locus_tag LOCUS_08330 11464 9686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 13895 11538 gene locus_tag LOCUS_08340 13895 11538 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352345.1 protein_id gnl|my_center|LOCUS_08340 13992 14762 gene locus_tag LOCUS_08350 13992 14762 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263610.1 protein_id gnl|my_center|LOCUS_08350 15086 14895 gene locus_tag LOCUS_08360 15086 14895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 15156 15833 gene locus_tag LOCUS_08370 15156 15833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08370 15827 16576 gene locus_tag LOCUS_08380 15827 16576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261889.1 protein_id gnl|my_center|LOCUS_08380 16599 17618 gene locus_tag LOCUS_08390 16599 17618 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261890.1 protein_id gnl|my_center|LOCUS_08390 18340 17651 gene locus_tag LOCUS_08400 18340 17651 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263611.1 protein_id gnl|my_center|LOCUS_08400 18663 18355 gene locus_tag LOCUS_08410 gene macP 18663 18355 CDS product cell wall synthase accessory phosphoprotein MacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263612.1 protein_id gnl|my_center|LOCUS_08410 19227 18676 gene locus_tag LOCUS_08420 19227 18676 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263613.1 protein_id gnl|my_center|LOCUS_08420 19429 19806 gene locus_tag LOCUS_08430 19429 19806 CDS product DUF3021 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263287.1 protein_id gnl|my_center|LOCUS_08430 21302 19914 gene locus_tag LOCUS_08440 gene glmU 21302 19914 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263614.1 protein_id gnl|my_center|LOCUS_08440 21723 21436 gene locus_tag LOCUS_08450 21723 21436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 22327 21875 gene locus_tag LOCUS_08460 22327 21875 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045611364.1 protein_id gnl|my_center|LOCUS_08460 23701 22406 gene locus_tag LOCUS_08470 23701 22406 CDS product AbiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207803.1 protein_id gnl|my_center|LOCUS_08470 24378 23698 gene locus_tag LOCUS_08480 24378 23698 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167117.1 protein_id gnl|my_center|LOCUS_08480 24625 24389 gene locus_tag LOCUS_08490 24625 24389 CDS product DUF2829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194840.1 protein_id gnl|my_center|LOCUS_08490 26845 24701 gene locus_tag LOCUS_08500 gene metG 26845 24701 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136757.1 protein_id gnl|my_center|LOCUS_08500 27677 26823 gene locus_tag LOCUS_08510 27677 26823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262700.1 protein_id gnl|my_center|LOCUS_08510 27929 28810 gene locus_tag LOCUS_08520 gene tehB 27929 28810 CDS product SAM-dependent methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262699.1 protein_id gnl|my_center|LOCUS_08520 28889 29716 gene locus_tag LOCUS_08530 28889 29716 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262695.1 protein_id gnl|my_center|LOCUS_08530 29860 30237 gene locus_tag LOCUS_08540 29860 30237 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625774.1 protein_id gnl|my_center|LOCUS_08540 30248 30667 gene locus_tag LOCUS_08550 30248 30667 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237569.1 protein_id gnl|my_center|LOCUS_08550 30778 31680 gene locus_tag LOCUS_08560 30778 31680 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922204.1 protein_id gnl|my_center|LOCUS_08560 32049 31696 gene locus_tag LOCUS_08570 32049 31696 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287944.1 protein_id gnl|my_center|LOCUS_08570 32551 32060 gene locus_tag LOCUS_08580 32551 32060 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262692.1 protein_id gnl|my_center|LOCUS_08580 33780 32599 gene locus_tag LOCUS_08590 33780 32599 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262691.1 protein_id gnl|my_center|LOCUS_08590 34400 33846 gene locus_tag LOCUS_08600 34400 33846 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262690.1 protein_id gnl|my_center|LOCUS_08600 34806 34372 gene locus_tag LOCUS_08610 34806 34372 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_08610 35897 34806 gene locus_tag LOCUS_08620 gene serC 35897 34806 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262688.1 protein_id gnl|my_center|LOCUS_08620 36027 36671 gene locus_tag LOCUS_08630 36027 36671 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603277.1 protein_id gnl|my_center|LOCUS_08630 37449 36721 gene locus_tag LOCUS_08640 37449 36721 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028519.1 protein_id gnl|my_center|LOCUS_08640 37882 37541 gene locus_tag LOCUS_08650 37882 37541 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262687.1 protein_id gnl|my_center|LOCUS_08650 39135 37900 gene locus_tag LOCUS_08660 39135 37900 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262686.1 protein_id gnl|my_center|LOCUS_08660 40173 39304 gene locus_tag LOCUS_08670 gene rsmI 40173 39304 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263897.1 protein_id gnl|my_center|LOCUS_08670 40494 40177 gene locus_tag LOCUS_08680 gene yabA 40494 40177 CDS product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262684.1 protein_id gnl|my_center|LOCUS_08680 41293 40487 gene locus_tag LOCUS_08690 gene ricT 41293 40487 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262683.1 protein_id gnl|my_center|LOCUS_08690 42165 41290 gene locus_tag LOCUS_08700 42165 41290 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262682.1 protein_id gnl|my_center|LOCUS_08700 42827 42162 gene locus_tag LOCUS_08710 gene tmk 42827 42162 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262681.1 protein_id gnl|my_center|LOCUS_08710 43554 42895 gene locus_tag LOCUS_08720 43554 42895 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262680.1 protein_id gnl|my_center|LOCUS_08720 44349 43639 gene locus_tag LOCUS_08730 44349 43639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894681.1 protein_id gnl|my_center|LOCUS_08730 45113 44349 gene locus_tag LOCUS_08740 45113 44349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262678.1 protein_id gnl|my_center|LOCUS_08740 46066 45113 gene locus_tag LOCUS_08750 46066 45113 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262677.1 protein_id gnl|my_center|LOCUS_08750 46939 46070 gene locus_tag LOCUS_08760 46939 46070 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262676.1 protein_id gnl|my_center|LOCUS_08760 48202 47027 gene locus_tag LOCUS_08770 48202 47027 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262675.1 protein_id gnl|my_center|LOCUS_08770 48550 48302 gene locus_tag LOCUS_08780 48550 48302 CDS product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262674.1 protein_id gnl|my_center|LOCUS_08780 48996 48544 gene locus_tag LOCUS_08790 48996 48544 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262673.1 protein_id gnl|my_center|LOCUS_08790 49634 49044 gene locus_tag LOCUS_08800 gene clpP 49634 49044 CDS product ATP-dependent Clp protease proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262672.1 protein_id gnl|my_center|LOCUS_08800 50382 49753 gene locus_tag LOCUS_08810 gene upp 50382 49753 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262598.1 protein_id gnl|my_center|LOCUS_08810 51644 50481 gene locus_tag LOCUS_08820 51644 50481 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027496.1 protein_id gnl|my_center|LOCUS_08820 52741 51647 gene locus_tag LOCUS_08830 52741 51647 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262596.1 protein_id gnl|my_center|LOCUS_08830 54515 52881 gene locus_tag LOCUS_08840 54515 52881 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264036.1 protein_id gnl|my_center|LOCUS_08840 54602 56047 gene locus_tag LOCUS_08850 54602 56047 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262594.1 protein_id gnl|my_center|LOCUS_08850 56288 57070 gene locus_tag LOCUS_08860 56288 57070 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018231.1 protein_id gnl|my_center|LOCUS_08860 57091 58041 gene locus_tag LOCUS_08870 57091 58041 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775038.1 protein_id gnl|my_center|LOCUS_08870 58058 59083 gene locus_tag LOCUS_08880 58058 59083 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775037.1 protein_id gnl|my_center|LOCUS_08880 59080 60081 gene locus_tag LOCUS_08890 59080 60081 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615138.1 protein_id gnl|my_center|LOCUS_08890 60623 60114 gene locus_tag LOCUS_08900 60623 60114 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262592.1 protein_id gnl|my_center|LOCUS_08900 61269 60649 gene locus_tag LOCUS_08910 61269 60649 CDS product SAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262591.1 protein_id gnl|my_center|LOCUS_08910 61862 61467 gene locus_tag LOCUS_08920 61862 61467 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837481.1 protein_id gnl|my_center|LOCUS_08920 62557 61982 gene locus_tag LOCUS_08930 62557 61982 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262589.1 protein_id gnl|my_center|LOCUS_08930 63544 62621 gene locus_tag LOCUS_08940 63544 62621 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262588.1 protein_id gnl|my_center|LOCUS_08940 64234 63584 gene locus_tag LOCUS_08950 64234 63584 CDS product DUF1803 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262587.1 protein_id gnl|my_center|LOCUS_08950 65051 64359 gene locus_tag LOCUS_08960 65051 64359 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296462.1 protein_id gnl|my_center|LOCUS_08960 66108 65062 gene locus_tag LOCUS_08970 66108 65062 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379839.1 protein_id gnl|my_center|LOCUS_08970 66671 66207 gene locus_tag LOCUS_08980 66671 66207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355960.1 protein_id gnl|my_center|LOCUS_08980 67616 66681 gene locus_tag LOCUS_08990 67616 66681 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837329.1 protein_id gnl|my_center|LOCUS_08990 68549 67755 gene locus_tag LOCUS_09000 gene pflA 68549 67755 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262580.1 protein_id gnl|my_center|LOCUS_09000 69991 68645 gene locus_tag LOCUS_09010 69991 68645 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262579.1 protein_id gnl|my_center|LOCUS_09010 71122 70028 gene locus_tag LOCUS_09020 71122 70028 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262578.1 protein_id gnl|my_center|LOCUS_09020 71198 71980 gene locus_tag LOCUS_09030 71198 71980 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262577.1 protein_id gnl|my_center|LOCUS_09030 74062 72002 gene locus_tag LOCUS_09040 74062 72002 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393084.1 protein_id gnl|my_center|LOCUS_09040 74325 74065 gene locus_tag LOCUS_09050 74325 74065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 74882 74322 gene locus_tag LOCUS_09060 74882 74322 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262576.1 protein_id gnl|my_center|LOCUS_09060 75811 74879 gene locus_tag LOCUS_09070 75811 74879 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262575.1 protein_id gnl|my_center|LOCUS_09070 76511 75855 gene locus_tag LOCUS_09080 76511 75855 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027610.1 protein_id gnl|my_center|LOCUS_09080 77082 76519 gene locus_tag LOCUS_09090 77082 76519 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264050.1 protein_id gnl|my_center|LOCUS_09090 77524 79518 gene locus_tag LOCUS_09100 77524 79518 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922439.1 protein_id gnl|my_center|LOCUS_09100 79709 79554 gene locus_tag LOCUS_09110 79709 79554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09110 80663 80142 gene locus_tag LOCUS_09120 80663 80142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 81291 80692 gene locus_tag LOCUS_09130 81291 80692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 81790 81284 gene locus_tag LOCUS_09140 81790 81284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 82472 81771 gene locus_tag LOCUS_09150 82472 81771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 83865 82483 gene locus_tag LOCUS_09160 83865 82483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 84199 83909 gene locus_tag LOCUS_09170 84199 83909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 84585 84406 gene locus_tag LOCUS_09180 84585 84406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 85472 84615 gene locus_tag LOCUS_09190 85472 84615 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388112.1 protein_id gnl|my_center|LOCUS_09190 85766 86092 gene locus_tag LOCUS_09200 85766 86092 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982104.1 protein_id gnl|my_center|LOCUS_09200 86079 86666 gene locus_tag LOCUS_09210 86079 86666 CDS product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837698.1 protein_id gnl|my_center|LOCUS_09210 86663 87490 gene locus_tag LOCUS_09220 86663 87490 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279626.1 protein_id gnl|my_center|LOCUS_09220 88057 87509 gene locus_tag LOCUS_09230 88057 87509 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019793.1 protein_id gnl|my_center|LOCUS_09230 88372 89727 gene locus_tag LOCUS_09240 gene trkA 88372 89727 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262566.1 protein_id gnl|my_center|LOCUS_09240 89731 91170 gene locus_tag LOCUS_09250 89731 91170 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262565.1 protein_id gnl|my_center|LOCUS_09250 91435 91193 gene locus_tag LOCUS_09260 gene yidD 91435 91193 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262564.1 protein_id gnl|my_center|LOCUS_09260 92157 91435 gene locus_tag LOCUS_09270 92157 91435 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222207.1 protein_id gnl|my_center|LOCUS_09270 92734 92147 gene locus_tag LOCUS_09280 gene scpB 92734 92147 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262562.1 protein_id gnl|my_center|LOCUS_09280 93435 92731 gene locus_tag LOCUS_09290 93435 92731 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262561.1 protein_id gnl|my_center|LOCUS_09290 94175 93435 gene locus_tag LOCUS_09300 gene xerD 94175 93435 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262560.1 protein_id gnl|my_center|LOCUS_09300 94633 94172 gene locus_tag LOCUS_09310 94633 94172 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262559.1 protein_id gnl|my_center|LOCUS_09310 95148 94630 gene locus_tag LOCUS_09320 95148 94630 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262558.1 protein_id gnl|my_center|LOCUS_09320 96125 95130 gene locus_tag LOCUS_09330 96125 95130 CDS product nucleoside-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262557.1 protein_id gnl|my_center|LOCUS_09330 96916 96122 gene locus_tag LOCUS_09340 gene racE 96916 96122 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837360.1 protein_id gnl|my_center|LOCUS_09340 97227 96967 gene locus_tag LOCUS_09350 97227 96967 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262555.1 protein_id gnl|my_center|LOCUS_09350 98570 97323 gene locus_tag LOCUS_09360 98570 97323 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027623.1 protein_id gnl|my_center|LOCUS_09360 99337 98645 gene locus_tag LOCUS_09370 99337 98645 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262553.1 protein_id gnl|my_center|LOCUS_09370 99860 99357 gene locus_tag LOCUS_09380 99860 99357 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262552.1 protein_id gnl|my_center|LOCUS_09380 100533 99895 gene locus_tag LOCUS_09390 100533 99895 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262551.1 protein_id gnl|my_center|LOCUS_09390 100667 100945 gene locus_tag LOCUS_09400 100667 100945 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262550.1 protein_id gnl|my_center|LOCUS_09400 101029 101970 gene locus_tag LOCUS_09410 gene yidC2 101029 101970 CDS product membrane protein insertase YidC2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262549.1 protein_id gnl|my_center|LOCUS_09410 102557 102075 gene locus_tag LOCUS_09420 gene greA 102557 102075 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262548.1 protein_id gnl|my_center|LOCUS_09420 104432 102624 gene locus_tag LOCUS_09430 gene mltG 104432 102624 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266860.1 protein_id gnl|my_center|LOCUS_09430 105020 104529 gene locus_tag LOCUS_09440 105020 104529 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262546.1 protein_id gnl|my_center|LOCUS_09440 106414 105083 gene locus_tag LOCUS_09450 gene murC 106414 105083 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262545.1 protein_id gnl|my_center|LOCUS_09450 107036 106425 gene locus_tag LOCUS_09460 107036 106425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262544.1 protein_id gnl|my_center|LOCUS_09460 110192 107100 gene locus_tag LOCUS_09470 110192 107100 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279629.1 protein_id gnl|my_center|LOCUS_09470 111077 110307 gene locus_tag LOCUS_09480 111077 110307 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262542.1 protein_id gnl|my_center|LOCUS_09480 111940 111074 gene locus_tag LOCUS_09490 gene accD 111940 111074 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002280638.1 protein_id gnl|my_center|LOCUS_09490 113314 111944 gene locus_tag LOCUS_09500 gene accC 113314 111944 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002271042.1 protein_id gnl|my_center|LOCUS_09500 113769 113347 gene locus_tag LOCUS_09510 gene fabZ 113769 113347 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279631.1 protein_id gnl|my_center|LOCUS_09510 114257 113766 gene locus_tag LOCUS_09520 gene accB 114257 113766 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262538.1 protein_id gnl|my_center|LOCUS_09520 115489 114257 gene locus_tag LOCUS_09530 gene fabF 115489 114257 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002269672.1 protein_id gnl|my_center|LOCUS_09530 116240 115506 gene locus_tag LOCUS_09540 gene fabG 116240 115506 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262536.1 protein_id gnl|my_center|LOCUS_09540 117170 116250 gene locus_tag LOCUS_09550 gene fabD 117170 116250 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262535.1 protein_id gnl|my_center|LOCUS_09550 118096 117194 gene locus_tag LOCUS_09560 gene fabK 118096 117194 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262534.1 protein_id gnl|my_center|LOCUS_09560 118482 118258 gene locus_tag LOCUS_09570 118482 118258 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262533.1 protein_id gnl|my_center|LOCUS_09570 119515 118541 gene locus_tag LOCUS_09580 119515 118541 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262532.1 protein_id gnl|my_center|LOCUS_09580 119949 119512 gene locus_tag LOCUS_09590 119949 119512 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262531.1 protein_id gnl|my_center|LOCUS_09590 120881 120090 gene locus_tag LOCUS_09600 120881 120090 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262530.1 protein_id gnl|my_center|LOCUS_09600 121683 121027 gene locus_tag LOCUS_09610 121683 121027 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262529.1 protein_id gnl|my_center|LOCUS_09610 121834 123189 gene locus_tag LOCUS_09620 121834 123189 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262528.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence06 <1 812 gene locus_tag LOCUS_09630 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002937117.1:dTDP-glucose 4,6-dehydratase 1055 864 gene locus_tag LOCUS_09640 1055 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 1201 1683 gene locus_tag LOCUS_09650 1201 1683 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922230.1 protein_id gnl|my_center|LOCUS_09650 1711 2886 gene locus_tag LOCUS_09660 1711 2886 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263090.1 protein_id gnl|my_center|LOCUS_09660 2870 4111 gene locus_tag LOCUS_09670 2870 4111 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289333.1 protein_id gnl|my_center|LOCUS_09670 4240 5916 gene locus_tag LOCUS_09680 gene alsS 4240 5916 CDS product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352333.1 protein_id gnl|my_center|LOCUS_09680 5936 6655 gene locus_tag LOCUS_09690 gene budA 5936 6655 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360301.1 protein_id gnl|my_center|LOCUS_09690 8035 6698 gene locus_tag LOCUS_09700 8035 6698 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263094.1 protein_id gnl|my_center|LOCUS_09700 9837 8173 gene locus_tag LOCUS_09710 9837 8173 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263095.1 protein_id gnl|my_center|LOCUS_09710 10207 11199 gene locus_tag LOCUS_09720 gene trpX 10207 11199 CDS product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263096.1 protein_id gnl|my_center|LOCUS_09720 11236 12105 gene locus_tag LOCUS_09730 11236 12105 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263097.1 protein_id gnl|my_center|LOCUS_09730 12102 12860 gene locus_tag LOCUS_09740 12102 12860 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263098.1 protein_id gnl|my_center|LOCUS_09740 12943 14148 gene locus_tag LOCUS_09750 12943 14148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 14341 16002 gene locus_tag LOCUS_09760 gene rnjB 14341 16002 CDS product ribonuclease J2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263099.1 protein_id gnl|my_center|LOCUS_09760 16442 17233 gene locus_tag LOCUS_09770 16442 17233 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263101.1 protein_id gnl|my_center|LOCUS_09770 17376 18086 gene locus_tag LOCUS_09780 17376 18086 CDS product M57 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263103.1 protein_id gnl|my_center|LOCUS_09780 18238 19392 gene locus_tag LOCUS_09790 gene wecB 18238 19392 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263104.1 protein_id gnl|my_center|LOCUS_09790 19392 20180 gene locus_tag LOCUS_09800 19392 20180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263105.1 protein_id gnl|my_center|LOCUS_09800 20194 20355 gene locus_tag LOCUS_09810 20194 20355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263106.1 protein_id gnl|my_center|LOCUS_09810 20327 21637 gene locus_tag LOCUS_09820 20327 21637 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267735.1 protein_id gnl|my_center|LOCUS_09820 21649 22755 gene locus_tag LOCUS_09830 21649 22755 CDS product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267197.1 protein_id gnl|my_center|LOCUS_09830 22777 24762 gene locus_tag LOCUS_09840 22777 24762 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922237.1 protein_id gnl|my_center|LOCUS_09840 24876 25727 gene locus_tag LOCUS_09850 24876 25727 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005589479.1 protein_id gnl|my_center|LOCUS_09850 26379 26029 gene locus_tag LOCUS_09860 26379 26029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 27519 26731 gene locus_tag LOCUS_09870 27519 26731 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263110.1 protein_id gnl|my_center|LOCUS_09870 28862 27519 gene locus_tag LOCUS_09880 28862 27519 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263111.1 protein_id gnl|my_center|LOCUS_09880 28973 29827 gene locus_tag LOCUS_09890 gene cdaA 28973 29827 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263112.1 protein_id gnl|my_center|LOCUS_09890 29820 30776 gene locus_tag LOCUS_09900 29820 30776 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263113.1 protein_id gnl|my_center|LOCUS_09900 30814 32166 gene locus_tag LOCUS_09910 gene glmM 30814 32166 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521427.1 protein_id gnl|my_center|LOCUS_09910 32786 32220 gene locus_tag LOCUS_09920 gene mdaB 32786 32220 CDS product NAD(P)H-dependent oxidoreductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263120.1 protein_id gnl|my_center|LOCUS_09920 33397 32783 gene locus_tag LOCUS_09930 33397 32783 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836300.1 protein_id gnl|my_center|LOCUS_09930 33623 34645 gene locus_tag LOCUS_09940 gene hemW 33623 34645 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027377.1 protein_id gnl|my_center|LOCUS_09940 34620 35378 gene locus_tag LOCUS_09950 34620 35378 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263557.1 protein_id gnl|my_center|LOCUS_09950 35388 36005 gene locus_tag LOCUS_09960 35388 36005 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935569.1 protein_id gnl|my_center|LOCUS_09960 36015 36788 gene locus_tag LOCUS_09970 36015 36788 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263555.1 protein_id gnl|my_center|LOCUS_09970 36778 37428 gene locus_tag LOCUS_09980 36778 37428 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653357.1 protein_id gnl|my_center|LOCUS_09980 37415 38581 gene locus_tag LOCUS_09990 37415 38581 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837692.1 protein_id gnl|my_center|LOCUS_09990 38716 39135 gene locus_tag LOCUS_10000 gene ndk 38716 39135 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438314.1 protein_id gnl|my_center|LOCUS_10000 40386 39502 gene locus_tag LOCUS_10010 40386 39502 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002270555.1 protein_id gnl|my_center|LOCUS_10010 40719 40955 gene locus_tag LOCUS_10020 40719 40955 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262720.1 protein_id gnl|my_center|LOCUS_10020 41118 42860 gene locus_tag LOCUS_10030 41118 42860 CDS product GbpC/Spa domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262719.1 protein_id gnl|my_center|LOCUS_10030 43186 45018 gene locus_tag LOCUS_10040 gene lepA 43186 45018 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019133.1 protein_id gnl|my_center|LOCUS_10040 45293 45039 gene locus_tag LOCUS_10050 45293 45039 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909865.1 protein_id gnl|my_center|LOCUS_10050 45581 47233 gene locus_tag LOCUS_10060 45581 47233 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387331.1 protein_id gnl|my_center|LOCUS_10060 47226 47525 gene locus_tag LOCUS_10070 47226 47525 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162435.1 protein_id gnl|my_center|LOCUS_10070 47641 48099 gene locus_tag LOCUS_10080 gene msrB 47641 48099 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475469.1 protein_id gnl|my_center|LOCUS_10080 48089 48559 gene locus_tag LOCUS_10090 48089 48559 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262715.1 protein_id gnl|my_center|LOCUS_10090 48638 49237 gene locus_tag LOCUS_10100 48638 49237 CDS product DUF6287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262714.1 protein_id gnl|my_center|LOCUS_10100 49895 49272 gene locus_tag LOCUS_10110 49895 49272 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262713.1 protein_id gnl|my_center|LOCUS_10110 50001 51209 gene locus_tag LOCUS_10120 50001 51209 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065321.1 protein_id gnl|my_center|LOCUS_10120 51311 52351 gene locus_tag LOCUS_10130 51311 52351 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861550.1 protein_id gnl|my_center|LOCUS_10130 52361 52750 gene locus_tag LOCUS_10140 52361 52750 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547676.1 protein_id gnl|my_center|LOCUS_10140 52756 53184 gene locus_tag LOCUS_10150 52756 53184 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296336.1 protein_id gnl|my_center|LOCUS_10150 53204 53524 gene locus_tag LOCUS_10160 53204 53524 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263342.1 protein_id gnl|my_center|LOCUS_10160 53714 54217 gene locus_tag LOCUS_10170 53714 54217 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249815.1 protein_id gnl|my_center|LOCUS_10170 54659 54297 gene locus_tag LOCUS_10180 54659 54297 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002993519.1 protein_id gnl|my_center|LOCUS_10180 54606 54950 gene locus_tag LOCUS_10190 54606 54950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 55139 55744 gene locus_tag LOCUS_10200 55139 55744 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775695.1 protein_id gnl|my_center|LOCUS_10200 55880 56575 gene locus_tag LOCUS_10210 55880 56575 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120609.1 protein_id gnl|my_center|LOCUS_10210 56609 58405 gene locus_tag LOCUS_10220 gene uvrC 56609 58405 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263201.1 protein_id gnl|my_center|LOCUS_10220 58545 58937 gene locus_tag LOCUS_10230 58545 58937 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266702.1 protein_id gnl|my_center|LOCUS_10230 59222 59923 gene locus_tag LOCUS_10240 59222 59923 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964843.1 protein_id gnl|my_center|LOCUS_10240 59935 62355 gene locus_tag LOCUS_10250 59935 62355 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964842.1 protein_id gnl|my_center|LOCUS_10250 62373 63149 gene locus_tag LOCUS_10260 62373 63149 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172947.1 protein_id gnl|my_center|LOCUS_10260 63136 71604 gene locus_tag LOCUS_10270 63136 71604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 71615 72325 gene locus_tag LOCUS_10280 71615 72325 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172947.1 protein_id gnl|my_center|LOCUS_10280 72340 73824 gene locus_tag LOCUS_10290 72340 73824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 73847 74485 gene locus_tag LOCUS_10300 73847 74485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 74670 75272 gene locus_tag LOCUS_10310 74670 75272 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263202.1 protein_id gnl|my_center|LOCUS_10310 75299 76708 gene locus_tag LOCUS_10320 gene pepV 75299 76708 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837027.1 protein_id gnl|my_center|LOCUS_10320 76783 77367 gene locus_tag LOCUS_10330 76783 77367 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895357.1 protein_id gnl|my_center|LOCUS_10330 78853 77465 gene locus_tag LOCUS_10340 gene mnmE 78853 77465 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264096.1 protein_id gnl|my_center|LOCUS_10340 78966 79643 gene locus_tag LOCUS_10350 gene rpiA 78966 79643 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263209.1 protein_id gnl|my_center|LOCUS_10350 79693 80904 gene locus_tag LOCUS_10360 79693 80904 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077187.1 protein_id gnl|my_center|LOCUS_10360 80907 81263 gene locus_tag LOCUS_10370 80907 81263 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027383.1 protein_id gnl|my_center|LOCUS_10370 81274 81648 gene locus_tag LOCUS_10380 81274 81648 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_10380 81744 82553 gene locus_tag LOCUS_10390 81744 82553 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935585.1 protein_id gnl|my_center|LOCUS_10390 82563 83270 gene locus_tag LOCUS_10400 82563 83270 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263214.1 protein_id gnl|my_center|LOCUS_10400 83556 84269 gene locus_tag LOCUS_10410 gene deoD 83556 84269 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027381.1 protein_id gnl|my_center|LOCUS_10410 84272 85030 gene locus_tag LOCUS_10420 84272 85030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074601.1 protein_id gnl|my_center|LOCUS_10420 85984 85076 gene locus_tag LOCUS_10430 85984 85076 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263217.1 protein_id gnl|my_center|LOCUS_10430 86220 86993 gene locus_tag LOCUS_10440 86220 86993 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263218.1 protein_id gnl|my_center|LOCUS_10440 87001 87933 gene locus_tag LOCUS_10450 87001 87933 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263219.1 protein_id gnl|my_center|LOCUS_10450 87926 88618 gene locus_tag LOCUS_10460 gene pyrF 87926 88618 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263220.1 protein_id gnl|my_center|LOCUS_10460 88618 88944 gene locus_tag LOCUS_10470 88618 88944 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922495.1 protein_id gnl|my_center|LOCUS_10470 88955 89584 gene locus_tag LOCUS_10480 gene pyrE 88955 89584 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263221.1 protein_id gnl|my_center|LOCUS_10480 89855 90097 gene locus_tag LOCUS_10490 89855 90097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 90149 90649 gene locus_tag LOCUS_10500 90149 90649 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263276.1 protein_id gnl|my_center|LOCUS_10500 90709 91362 gene locus_tag LOCUS_10510 90709 91362 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263271.1 protein_id gnl|my_center|LOCUS_10510 91373 92641 gene locus_tag LOCUS_10520 91373 92641 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352291.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence07 441 154 gene locus_tag LOCUS_10530 441 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1090 680 gene locus_tag LOCUS_10540 1090 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267997.1 protein_id gnl|my_center|LOCUS_10540 1478 1242 gene locus_tag LOCUS_10550 1478 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1962 1666 gene locus_tag LOCUS_10560 1962 1666 CDS product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162496604.1 protein_id gnl|my_center|LOCUS_10560 2183 1965 gene locus_tag LOCUS_10570 2183 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 2609 4759 gene locus_tag LOCUS_10580 2609 4759 CDS product peptide cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082313.1 protein_id gnl|my_center|LOCUS_10580 4769 5470 gene locus_tag LOCUS_10590 4769 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 5512 5661 gene locus_tag LOCUS_10600 5512 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 6988 5678 gene locus_tag LOCUS_10610 6988 5678 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262113.1 protein_id gnl|my_center|LOCUS_10610 7733 6990 gene locus_tag LOCUS_10620 7733 6990 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262114.1 protein_id gnl|my_center|LOCUS_10620 8077 7745 gene locus_tag LOCUS_10630 8077 7745 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682130.1 protein_id gnl|my_center|LOCUS_10630 9748 8246 gene locus_tag LOCUS_10640 gene glpK 9748 8246 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700771.1 protein_id gnl|my_center|LOCUS_10640 10484 9858 gene locus_tag LOCUS_10650 10484 9858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262116.1 protein_id gnl|my_center|LOCUS_10650 11932 10622 gene locus_tag LOCUS_10660 gene der 11932 10622 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262117.1 protein_id gnl|my_center|LOCUS_10660 12848 11943 gene locus_tag LOCUS_10670 gene dnaI 12848 11943 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262118.1 protein_id gnl|my_center|LOCUS_10670 14012 12849 gene locus_tag LOCUS_10680 14012 12849 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262119.1 protein_id gnl|my_center|LOCUS_10680 14493 13999 gene locus_tag LOCUS_10690 gene nrdR 14493 13999 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262120.1 protein_id gnl|my_center|LOCUS_10690 15279 14590 gene locus_tag LOCUS_10700 gene gcrR 15279 14590 CDS product response regulator GcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262121.1 protein_id gnl|my_center|LOCUS_10700 16147 15605 gene locus_tag LOCUS_10710 16147 15605 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262122.1 protein_id gnl|my_center|LOCUS_10710 16716 16147 gene locus_tag LOCUS_10720 16716 16147 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262123.1 protein_id gnl|my_center|LOCUS_10720 16814 17521 gene locus_tag LOCUS_10730 16814 17521 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262124.1 protein_id gnl|my_center|LOCUS_10730 17527 20136 gene locus_tag LOCUS_10740 17527 20136 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263841.1 protein_id gnl|my_center|LOCUS_10740 21172 20273 gene locus_tag LOCUS_10750 gene htpX 21172 20273 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262126.1 protein_id gnl|my_center|LOCUS_10750 21740 21174 gene locus_tag LOCUS_10760 21740 21174 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262127.1 protein_id gnl|my_center|LOCUS_10760 21830 22546 gene locus_tag LOCUS_10770 gene rsmG 21830 22546 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836617.1 protein_id gnl|my_center|LOCUS_10770 22622 24001 gene locus_tag LOCUS_10780 gene ktrB 22622 24001 CDS product potassium uptake transporter channel subunit KtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032459855.1 protein_id gnl|my_center|LOCUS_10780 24019 24690 gene locus_tag LOCUS_10790 24019 24690 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850144.1 protein_id gnl|my_center|LOCUS_10790 25554 24721 gene locus_tag LOCUS_10800 25554 24721 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262129.1 protein_id gnl|my_center|LOCUS_10800 27223 25547 gene locus_tag LOCUS_10810 27223 25547 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262130.1 protein_id gnl|my_center|LOCUS_10810 27795 27250 gene locus_tag LOCUS_10820 27795 27250 CDS product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262131.1 protein_id gnl|my_center|LOCUS_10820 28659 27814 gene locus_tag LOCUS_10830 28659 27814 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262132.1 protein_id gnl|my_center|LOCUS_10830 29398 28709 gene locus_tag LOCUS_10840 29398 28709 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262134.1 protein_id gnl|my_center|LOCUS_10840 30464 29400 gene locus_tag LOCUS_10850 30464 29400 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985970.1 protein_id gnl|my_center|LOCUS_10850 31830 30457 gene locus_tag LOCUS_10860 31830 30457 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262136.1 protein_id gnl|my_center|LOCUS_10860 32734 31892 gene locus_tag LOCUS_10870 32734 31892 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262137.1 protein_id gnl|my_center|LOCUS_10870 33704 32877 gene locus_tag LOCUS_10880 33704 32877 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262138.1 protein_id gnl|my_center|LOCUS_10880 33865 34032 gene locus_tag LOCUS_10890 33865 34032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 34016 34222 gene locus_tag LOCUS_10900 34016 34222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 35084 34290 gene locus_tag LOCUS_10910 35084 34290 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714621.1 protein_id gnl|my_center|LOCUS_10910 36820 35216 gene locus_tag LOCUS_10920 36820 35216 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716723.1 protein_id gnl|my_center|LOCUS_10920 36995 36837 gene locus_tag LOCUS_10930 36995 36837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 39828 37327 gene locus_tag LOCUS_10940 gene leuS 39828 37327 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775383.1 protein_id gnl|my_center|LOCUS_10940 40526 39918 gene locus_tag LOCUS_10950 40526 39918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 41752 40523 gene locus_tag LOCUS_10960 41752 40523 CDS product DUF3114 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836394.1 protein_id gnl|my_center|LOCUS_10960 42493 41954 gene locus_tag LOCUS_10970 gene nusG 42493 41954 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002987881.1 protein_id gnl|my_center|LOCUS_10970 42786 42610 gene locus_tag LOCUS_10980 42786 42610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 45269 42999 gene locus_tag LOCUS_10990 gene pbp2a 45269 42999 CDS product penicillin-binding protein PBP2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289690.1 protein_id gnl|my_center|LOCUS_10990 45392 46255 gene locus_tag LOCUS_11000 45392 46255 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262146.1 protein_id gnl|my_center|LOCUS_11000 47925 46264 gene locus_tag LOCUS_11010 47925 46264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262147.1 protein_id gnl|my_center|LOCUS_11010 49686 48055 gene locus_tag LOCUS_11020 gene groL 49686 48055 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262148.1 protein_id gnl|my_center|LOCUS_11020 49986 49702 gene locus_tag LOCUS_11030 gene groES 49986 49702 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352364.1 protein_id gnl|my_center|LOCUS_11030 50938 50135 gene locus_tag LOCUS_11040 50938 50135 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054430.1 protein_id gnl|my_center|LOCUS_11040 51838 50939 gene locus_tag LOCUS_11050 51838 50939 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884162.1 protein_id gnl|my_center|LOCUS_11050 52830 51871 gene locus_tag LOCUS_11060 52830 51871 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724426.1 protein_id gnl|my_center|LOCUS_11060 53525 53232 gene locus_tag LOCUS_11070 53525 53232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002928974.1 protein_id gnl|my_center|LOCUS_11070 54377 53541 gene locus_tag LOCUS_11080 54377 53541 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262151.1 protein_id gnl|my_center|LOCUS_11080 55230 54379 gene locus_tag LOCUS_11090 55230 54379 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262152.1 protein_id gnl|my_center|LOCUS_11090 55752 55258 gene locus_tag LOCUS_11100 55752 55258 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263460.1 protein_id gnl|my_center|LOCUS_11100 56215 55769 gene locus_tag LOCUS_11110 56215 55769 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263459.1 protein_id gnl|my_center|LOCUS_11110 57803 56496 gene locus_tag LOCUS_11120 57803 56496 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263458.1 protein_id gnl|my_center|LOCUS_11120 58477 57800 gene locus_tag LOCUS_11130 58477 57800 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263457.1 protein_id gnl|my_center|LOCUS_11130 59801 58452 gene locus_tag LOCUS_11140 59801 58452 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263456.1 protein_id gnl|my_center|LOCUS_11140 60766 59801 gene locus_tag LOCUS_11150 60766 59801 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263455.1 protein_id gnl|my_center|LOCUS_11150 61298 60903 gene locus_tag LOCUS_11160 61298 60903 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263454.1 protein_id gnl|my_center|LOCUS_11160 61994 61368 gene locus_tag LOCUS_11170 61994 61368 CDS product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903477.1 protein_id gnl|my_center|LOCUS_11170 62318 62001 gene locus_tag LOCUS_11180 62318 62001 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263450.1 protein_id gnl|my_center|LOCUS_11180 62556 62329 gene locus_tag LOCUS_11190 62556 62329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 62720 63784 gene locus_tag LOCUS_11200 gene pepA 62720 63784 CDS product glutamyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921806.1 protein_id gnl|my_center|LOCUS_11200 63797 64579 gene locus_tag LOCUS_11210 gene proC 63797 64579 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263447.1 protein_id gnl|my_center|LOCUS_11210 65287 64619 gene locus_tag LOCUS_11220 65287 64619 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263446.1 protein_id gnl|my_center|LOCUS_11220 66042 65338 gene locus_tag LOCUS_11230 66042 65338 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262478.1 protein_id gnl|my_center|LOCUS_11230 66868 66035 gene locus_tag LOCUS_11240 66868 66035 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262479.1 protein_id gnl|my_center|LOCUS_11240 67327 66878 gene locus_tag LOCUS_11250 67327 66878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263445.1 protein_id gnl|my_center|LOCUS_11250 67585 67388 gene locus_tag LOCUS_11260 67585 67388 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263444.1 protein_id gnl|my_center|LOCUS_11260 68913 67714 gene locus_tag LOCUS_11270 68913 67714 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047534.1 protein_id gnl|my_center|LOCUS_11270 69927 68971 gene locus_tag LOCUS_11280 69927 68971 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263442.1 protein_id gnl|my_center|LOCUS_11280 70372 69977 gene locus_tag LOCUS_11290 gene comGG 70372 69977 CDS product competence type IV pilus minor pilin ComGG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263441.1 protein_id gnl|my_center|LOCUS_11290 70790 70350 gene locus_tag LOCUS_11300 gene comGF 70790 70350 CDS product competence type IV pilus minor pilin ComGF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263440.1 protein_id gnl|my_center|LOCUS_11300 71046 70771 gene locus_tag LOCUS_11310 gene comGE 71046 70771 CDS product competence type IV pilus minor pilin ComGE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921722.1 protein_id gnl|my_center|LOCUS_11310 71485 71036 gene locus_tag LOCUS_11320 gene comGD 71485 71036 CDS product competence type IV pilus minor pilin ComGD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074677.1 protein_id gnl|my_center|LOCUS_11320 71750 71436 gene locus_tag LOCUS_11330 gene comGC 71750 71436 CDS product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263437.1 protein_id gnl|my_center|LOCUS_11330 72835 71747 gene locus_tag LOCUS_11340 gene comGB 72835 71747 CDS product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914479.1 protein_id gnl|my_center|LOCUS_11340 73658 72717 gene locus_tag LOCUS_11350 gene comGA 73658 72717 CDS product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263435.1 protein_id gnl|my_center|LOCUS_11350 75060 73711 gene locus_tag LOCUS_11360 75060 73711 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898853.1 protein_id gnl|my_center|LOCUS_11360 75715 75023 gene locus_tag LOCUS_11370 75715 75023 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699614.1 protein_id gnl|my_center|LOCUS_11370 76455 75859 gene locus_tag LOCUS_11380 76455 75859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 77062 76694 gene locus_tag LOCUS_11390 77062 76694 CDS product DUF1033 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263434.1 protein_id gnl|my_center|LOCUS_11390 80863 77228 gene locus_tag LOCUS_11400 gene rpoC 80863 77228 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074679.1 protein_id gnl|my_center|LOCUS_11400 84494 80931 gene locus_tag LOCUS_11410 gene rpoB 84494 80931 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263432.1 protein_id gnl|my_center|LOCUS_11410 87218 84753 gene locus_tag LOCUS_11420 gene pbp1b 87218 84753 CDS product penicillin-binding protein PBP1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263431.1 protein_id gnl|my_center|LOCUS_11420 87359 88615 gene locus_tag LOCUS_11430 gene tyrS 87359 88615 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263430.1 protein_id gnl|my_center|LOCUS_11430 89467 88655 gene locus_tag LOCUS_11440 89467 88655 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263429.1 protein_id gnl|my_center|LOCUS_11440 90167 89457 gene locus_tag LOCUS_11450 90167 89457 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269501.1 protein_id gnl|my_center|LOCUS_11450 90609 90169 gene locus_tag LOCUS_11460 90609 90169 CDS product zinc-dependent MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921790.1 protein_id gnl|my_center|LOCUS_11460 91545 90697 gene locus_tag LOCUS_11470 gene ispE 91545 90697 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352368.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence08 150 956 gene locus_tag LOCUS_11480 gene mreC 150 956 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263142.1 protein_id gnl|my_center|LOCUS_11480 1557 2834 gene locus_tag LOCUS_11490 1557 2834 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263140.1 protein_id gnl|my_center|LOCUS_11490 2957 3928 gene locus_tag LOCUS_11500 2957 3928 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263139.1 protein_id gnl|my_center|LOCUS_11500 4024 5199 gene locus_tag LOCUS_11510 4024 5199 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263138.1 protein_id gnl|my_center|LOCUS_11510 5189 5962 gene locus_tag LOCUS_11520 gene recO 5189 5962 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263137.1 protein_id gnl|my_center|LOCUS_11520 6054 7058 gene locus_tag LOCUS_11530 gene plsX 6054 7058 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263136.1 protein_id gnl|my_center|LOCUS_11530 7055 7297 gene locus_tag LOCUS_11540 7055 7297 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263135.1 protein_id gnl|my_center|LOCUS_11540 7415 8122 gene locus_tag LOCUS_11550 7415 8122 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043299.1 protein_id gnl|my_center|LOCUS_11550 8138 11863 gene locus_tag LOCUS_11560 8138 11863 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042256.1 protein_id gnl|my_center|LOCUS_11560 11866 13311 gene locus_tag LOCUS_11570 gene purF 11866 13311 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263130.1 protein_id gnl|my_center|LOCUS_11570 13404 14423 gene locus_tag LOCUS_11580 gene purM 13404 14423 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263128.1 protein_id gnl|my_center|LOCUS_11580 14423 14977 gene locus_tag LOCUS_11590 gene purN 14423 14977 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836289.1 protein_id gnl|my_center|LOCUS_11590 15042 16592 gene locus_tag LOCUS_11600 gene purH 15042 16592 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921652.1 protein_id gnl|my_center|LOCUS_11600 16844 17992 gene locus_tag LOCUS_11610 16844 17992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 18509 19375 gene locus_tag LOCUS_11620 18509 19375 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263382.1 protein_id gnl|my_center|LOCUS_11620 19564 20829 gene locus_tag LOCUS_11630 19564 20829 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972414.1 protein_id gnl|my_center|LOCUS_11630 20830 21441 gene locus_tag LOCUS_11640 20830 21441 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358972.1 protein_id gnl|my_center|LOCUS_11640 21685 22947 gene locus_tag LOCUS_11650 gene purD 21685 22947 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263387.1 protein_id gnl|my_center|LOCUS_11650 23546 23983 gene locus_tag LOCUS_11660 gene purE 23546 23983 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002274410.1 protein_id gnl|my_center|LOCUS_11660 23970 25052 gene locus_tag LOCUS_11670 gene purK 23970 25052 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263391.1 protein_id gnl|my_center|LOCUS_11670 25102 26754 gene locus_tag LOCUS_11680 25102 26754 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994298.1 protein_id gnl|my_center|LOCUS_11680 27152 28447 gene locus_tag LOCUS_11690 gene purB 27152 28447 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972422.1 protein_id gnl|my_center|LOCUS_11690 29409 28654 gene locus_tag LOCUS_11700 29409 28654 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263787.1 protein_id gnl|my_center|LOCUS_11700 29486 29857 gene locus_tag LOCUS_11710 29486 29857 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262420.1 protein_id gnl|my_center|LOCUS_11710 30375 29923 gene locus_tag LOCUS_11720 30375 29923 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_11720 31045 30461 gene locus_tag LOCUS_11730 gene tmrB 31045 30461 CDS product tunicamycin resistance ATP-binding TmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246258.1 protein_id gnl|my_center|LOCUS_11730 31152 31919 gene locus_tag LOCUS_11740 31152 31919 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263785.1 protein_id gnl|my_center|LOCUS_11740 32158 32679 gene locus_tag LOCUS_11750 32158 32679 CDS product HXXEE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037614501.1 protein_id gnl|my_center|LOCUS_11750 33351 32869 gene locus_tag LOCUS_11760 33351 32869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 34324 33365 gene locus_tag LOCUS_11770 34324 33365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 34875 34387 gene locus_tag LOCUS_11780 34875 34387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 35112 34885 gene locus_tag LOCUS_11790 35112 34885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11790 35863 35387 gene locus_tag LOCUS_11800 35863 35387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965335.1 protein_id gnl|my_center|LOCUS_11800 36219 35881 gene locus_tag LOCUS_11810 36219 35881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965336.1 protein_id gnl|my_center|LOCUS_11810 36710 36345 gene locus_tag LOCUS_11820 36710 36345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 38573 36711 gene locus_tag LOCUS_11830 38573 36711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 40118 38745 gene locus_tag LOCUS_11840 40118 38745 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323650.1 protein_id gnl|my_center|LOCUS_11840 41030 40203 gene locus_tag LOCUS_11850 41030 40203 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837697.1 protein_id gnl|my_center|LOCUS_11850 41793 41044 gene locus_tag LOCUS_11860 41793 41044 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837696.1 protein_id gnl|my_center|LOCUS_11860 42430 41909 gene locus_tag LOCUS_11870 42430 41909 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002910979.1 protein_id gnl|my_center|LOCUS_11870 42578 43438 gene locus_tag LOCUS_11880 42578 43438 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917983.1 protein_id gnl|my_center|LOCUS_11880 43596 44336 gene locus_tag LOCUS_11890 43596 44336 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922644.1 protein_id gnl|my_center|LOCUS_11890 44746 47538 gene locus_tag LOCUS_11900 44746 47538 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262972.1 protein_id gnl|my_center|LOCUS_11900 47566 48219 gene locus_tag LOCUS_11910 47566 48219 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262971.1 protein_id gnl|my_center|LOCUS_11910 48232 48891 gene locus_tag LOCUS_11920 48232 48891 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262970.1 protein_id gnl|my_center|LOCUS_11920 49539 50945 gene locus_tag LOCUS_11930 49539 50945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 52127 50973 gene locus_tag LOCUS_11940 52127 50973 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027975903.1 protein_id gnl|my_center|LOCUS_11940 52426 53598 gene locus_tag LOCUS_11950 52426 53598 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775668.1 protein_id gnl|my_center|LOCUS_11950 54461 53841 gene locus_tag LOCUS_11960 54461 53841 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836389.1 protein_id gnl|my_center|LOCUS_11960 55055 54543 gene locus_tag LOCUS_11970 55055 54543 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009880864.1 protein_id gnl|my_center|LOCUS_11970 55380 55673 gene locus_tag LOCUS_11980 55380 55673 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461958.1 protein_id gnl|my_center|LOCUS_11980 55740 56738 gene locus_tag LOCUS_11990 55740 56738 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462034.1 protein_id gnl|my_center|LOCUS_11990 56750 57031 gene locus_tag LOCUS_12000 56750 57031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 57015 57428 gene locus_tag LOCUS_12010 57015 57428 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462027.1 protein_id gnl|my_center|LOCUS_12010 57533 58090 gene locus_tag LOCUS_12020 57533 58090 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261995.1 protein_id gnl|my_center|LOCUS_12020 58175 58651 gene locus_tag LOCUS_12030 58175 58651 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775115.1 protein_id gnl|my_center|LOCUS_12030 58651 59421 gene locus_tag LOCUS_12040 58651 59421 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922437.1 protein_id gnl|my_center|LOCUS_12040 59436 61019 gene locus_tag LOCUS_12050 59436 61019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 61022 61174 gene locus_tag LOCUS_12060 61022 61174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 61282 62049 gene locus_tag LOCUS_12070 61282 62049 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027028.1 protein_id gnl|my_center|LOCUS_12070 62255 62677 gene locus_tag LOCUS_12080 gene lacA 62255 62677 CDS product galactose-6-phosphate isomerase subunit LacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027026.1 protein_id gnl|my_center|LOCUS_12080 62704 63219 gene locus_tag LOCUS_12090 gene lacB 62704 63219 CDS product galactose-6-phosphate isomerase subunit LacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027025.1 protein_id gnl|my_center|LOCUS_12090 63229 64161 gene locus_tag LOCUS_12100 gene lacC 63229 64161 CDS product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775547.1 protein_id gnl|my_center|LOCUS_12100 64163 65140 gene locus_tag LOCUS_12110 gene lacD 64163 65140 CDS product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775145.1 protein_id gnl|my_center|LOCUS_12110 65329 66162 gene locus_tag LOCUS_12120 65329 66162 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027022.1 protein_id gnl|my_center|LOCUS_12120 66194 66511 gene locus_tag LOCUS_12130 66194 66511 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003048451.1 protein_id gnl|my_center|LOCUS_12130 66511 68190 gene locus_tag LOCUS_12140 66511 68190 CDS product lactose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027021.1 protein_id gnl|my_center|LOCUS_12140 68363 69769 gene locus_tag LOCUS_12150 gene lacG 68363 69769 CDS product 6-phospho-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027020.1 protein_id gnl|my_center|LOCUS_12150 69854 70153 gene locus_tag LOCUS_12160 69854 70153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 71080 70241 gene locus_tag LOCUS_12170 71080 70241 CDS product DUF4238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484614.1 protein_id gnl|my_center|LOCUS_12170 72016 71438 gene locus_tag LOCUS_12180 72016 71438 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158435.1 protein_id gnl|my_center|LOCUS_12180 72124 72615 gene locus_tag LOCUS_12190 72124 72615 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368844.1 protein_id gnl|my_center|LOCUS_12190 72659 73060 gene locus_tag LOCUS_12200 72659 73060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 73332 73183 gene locus_tag LOCUS_12210 gene rpmG 73332 73183 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262412.1 protein_id gnl|my_center|LOCUS_12210 73530 73348 gene locus_tag LOCUS_12220 gene rpmF 73530 73348 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937589.1 protein_id gnl|my_center|LOCUS_12220 74720 73698 gene locus_tag LOCUS_12230 74720 73698 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673973.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence09 1020 88 gene locus_tag LOCUS_12240 1020 88 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138506.1 protein_id gnl|my_center|LOCUS_12240 2066 1020 gene locus_tag LOCUS_12250 2066 1020 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262737.1 protein_id gnl|my_center|LOCUS_12250 3109 2078 gene locus_tag LOCUS_12260 3109 2078 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262738.1 protein_id gnl|my_center|LOCUS_12260 4034 3120 gene locus_tag LOCUS_12270 4034 3120 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262739.1 protein_id gnl|my_center|LOCUS_12270 5809 4151 gene locus_tag LOCUS_12280 5809 4151 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262740.1 protein_id gnl|my_center|LOCUS_12280 5961 7295 gene locus_tag LOCUS_12290 gene pbp3 5961 7295 CDS product D-alanyl-D-alanine carboxypeptidase PBP3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002273614.1 protein_id gnl|my_center|LOCUS_12290 8126 7359 gene locus_tag LOCUS_12300 8126 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262742.1 protein_id gnl|my_center|LOCUS_12300 9666 8248 gene locus_tag LOCUS_12310 gene sufB 9666 8248 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289834.1 protein_id gnl|my_center|LOCUS_12310 10102 9659 gene locus_tag LOCUS_12320 10102 9659 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262744.1 protein_id gnl|my_center|LOCUS_12320 11321 10089 gene locus_tag LOCUS_12330 11321 10089 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262745.1 protein_id gnl|my_center|LOCUS_12330 12583 11321 gene locus_tag LOCUS_12340 gene sufD 12583 11321 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262746.1 protein_id gnl|my_center|LOCUS_12340 13391 12621 gene locus_tag LOCUS_12350 gene sufC 13391 12621 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262747.1 protein_id gnl|my_center|LOCUS_12350 14627 13470 gene locus_tag LOCUS_12360 gene rgpG 14627 13470 CDS product rhamnose-glucose polysaccharide biosynthesis protein RgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262748.1 protein_id gnl|my_center|LOCUS_12360 15348 14632 gene locus_tag LOCUS_12370 gene mecA 15348 14632 CDS product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262749.1 protein_id gnl|my_center|LOCUS_12370 16292 15441 gene locus_tag LOCUS_12380 16292 15441 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262750.1 protein_id gnl|my_center|LOCUS_12380 18233 16344 gene locus_tag LOCUS_12390 18233 16344 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289578.1 protein_id gnl|my_center|LOCUS_12390 18369 19922 gene locus_tag LOCUS_12400 18369 19922 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262752.1 protein_id gnl|my_center|LOCUS_12400 19922 20662 gene locus_tag LOCUS_12410 19922 20662 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310810.1 protein_id gnl|my_center|LOCUS_12410 20845 21450 gene locus_tag LOCUS_12420 20845 21450 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262754.1 protein_id gnl|my_center|LOCUS_12420 21582 22301 gene locus_tag LOCUS_12430 21582 22301 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262755.1 protein_id gnl|my_center|LOCUS_12430 22301 23431 gene locus_tag LOCUS_12440 22301 23431 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074494.1 protein_id gnl|my_center|LOCUS_12440 23456 24091 gene locus_tag LOCUS_12450 23456 24091 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262757.1 protein_id gnl|my_center|LOCUS_12450 25036 24140 gene locus_tag LOCUS_12460 25036 24140 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262758.1 protein_id gnl|my_center|LOCUS_12460 26329 25079 gene locus_tag LOCUS_12470 gene ilvA 26329 25079 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262759.1 protein_id gnl|my_center|LOCUS_12470 27460 26438 gene locus_tag LOCUS_12480 gene ilvC 27460 26438 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009910803.1 protein_id gnl|my_center|LOCUS_12480 28011 27535 gene locus_tag LOCUS_12490 gene ilvN 28011 27535 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262761.1 protein_id gnl|my_center|LOCUS_12490 29707 28004 gene locus_tag LOCUS_12500 29707 28004 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775336.1 protein_id gnl|my_center|LOCUS_12500 31705 30041 gene locus_tag LOCUS_12510 31705 30041 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992286.1 protein_id gnl|my_center|LOCUS_12510 32070 31705 gene locus_tag LOCUS_12520 32070 31705 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262764.1 protein_id gnl|my_center|LOCUS_12520 32355 32167 gene locus_tag LOCUS_12530 gene rpmB 32355 32167 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263485.1 protein_id gnl|my_center|LOCUS_12530 32572 32913 gene locus_tag LOCUS_12540 32572 32913 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262432.1 protein_id gnl|my_center|LOCUS_12540 34659 32944 gene locus_tag LOCUS_12550 gene ilvD 34659 32944 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262431.1 protein_id gnl|my_center|LOCUS_12550 35664 34783 gene locus_tag LOCUS_12560 35664 34783 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263577.1 protein_id gnl|my_center|LOCUS_12560 35902 35817 gene locus_tag LOCUS_t00080 35902 35817 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 36080 36457 gene locus_tag LOCUS_12570 36080 36457 CDS product DUF1761 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027789.1 protein_id gnl|my_center|LOCUS_12570 38103 36499 gene locus_tag LOCUS_12580 38103 36499 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263575.1 protein_id gnl|my_center|LOCUS_12580 38821 38237 gene locus_tag LOCUS_12590 gene rpoE 38821 38237 CDS product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263574.1 protein_id gnl|my_center|LOCUS_12590 40239 38956 gene locus_tag LOCUS_12600 gene tig 40239 38956 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263425.1 protein_id gnl|my_center|LOCUS_12600 40436 41293 gene locus_tag LOCUS_12610 40436 41293 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263423.1 protein_id gnl|my_center|LOCUS_12610 41876 41313 gene locus_tag LOCUS_12620 41876 41313 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263422.1 protein_id gnl|my_center|LOCUS_12620 42378 41911 gene locus_tag LOCUS_12630 42378 41911 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263421.1 protein_id gnl|my_center|LOCUS_12630 43129 42368 gene locus_tag LOCUS_12640 43129 42368 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837489.1 protein_id gnl|my_center|LOCUS_12640 43868 43119 gene locus_tag LOCUS_12650 gene truA 43868 43119 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263419.1 protein_id gnl|my_center|LOCUS_12650 44832 43954 gene locus_tag LOCUS_12660 44832 43954 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775370.1 protein_id gnl|my_center|LOCUS_12660 46049 44916 gene locus_tag LOCUS_12670 gene dnaJ 46049 44916 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263418.1 protein_id gnl|my_center|LOCUS_12670 48508 46682 gene locus_tag LOCUS_12680 gene dnaK 48508 46682 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922599.1 protein_id gnl|my_center|LOCUS_12680 49156 48605 gene locus_tag LOCUS_12690 gene grpE 49156 48605 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263416.1 protein_id gnl|my_center|LOCUS_12690 50208 49174 gene locus_tag LOCUS_12700 gene hrcA 50208 49174 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263415.1 protein_id gnl|my_center|LOCUS_12700 51968 50409 gene locus_tag LOCUS_12710 51968 50409 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263414.1 protein_id gnl|my_center|LOCUS_12710 56340 52054 gene locus_tag LOCUS_12720 56340 52054 CDS product GH32 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263413.1 protein_id gnl|my_center|LOCUS_12720 57184 56597 gene locus_tag LOCUS_12730 57184 56597 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263412.1 protein_id gnl|my_center|LOCUS_12730 57954 57184 gene locus_tag LOCUS_12740 57954 57184 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263411.1 protein_id gnl|my_center|LOCUS_12740 58649 57951 gene locus_tag LOCUS_12750 58649 57951 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263410.1 protein_id gnl|my_center|LOCUS_12750 59142 58732 gene locus_tag LOCUS_12760 59142 58732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 60494 59157 gene locus_tag LOCUS_12770 60494 59157 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921875.1 protein_id gnl|my_center|LOCUS_12770 60778 60512 gene locus_tag LOCUS_12780 60778 60512 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263408.1 protein_id gnl|my_center|LOCUS_12780 60927 61835 gene locus_tag LOCUS_12790 60927 61835 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833755.1 protein_id gnl|my_center|LOCUS_12790 61947 62633 gene locus_tag LOCUS_12800 61947 62633 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262342.1 protein_id gnl|my_center|LOCUS_12800 62871 62671 gene locus_tag LOCUS_12810 62871 62671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 63234 63395 gene locus_tag LOCUS_12820 63234 63395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 <64601 63609 gene locus_tag LOCUS_12830 <64601 63609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001245433.1:heavy metal translocating P-type ATPase >Feature sequence10 809 246 gene locus_tag LOCUS_12840 809 246 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262436.1 protein_id gnl|my_center|LOCUS_12840 939 3464 gene locus_tag LOCUS_12850 939 3464 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262435.1 protein_id gnl|my_center|LOCUS_12850 4270 3494 gene locus_tag LOCUS_12860 4270 3494 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363786.1 protein_id gnl|my_center|LOCUS_12860 4425 5702 gene locus_tag LOCUS_12870 gene hisS 4425 5702 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352373.1 protein_id gnl|my_center|LOCUS_12870 5776 7524 gene locus_tag LOCUS_12880 gene aspS 5776 7524 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830929.1 protein_id gnl|my_center|LOCUS_12880 7508 8458 gene locus_tag LOCUS_12890 7508 8458 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857771.1 protein_id gnl|my_center|LOCUS_12890 8482 9354 gene locus_tag LOCUS_12900 8482 9354 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991372.1 protein_id gnl|my_center|LOCUS_12900 9391 10266 gene locus_tag LOCUS_12910 9391 10266 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982164.1 protein_id gnl|my_center|LOCUS_12910 11997 10306 gene locus_tag LOCUS_12920 gene argS 11997 10306 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262405.1 protein_id gnl|my_center|LOCUS_12920 12162 12599 gene locus_tag LOCUS_12930 gene argR 12162 12599 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982171.1 protein_id gnl|my_center|LOCUS_12930 12626 12946 gene locus_tag LOCUS_12940 12626 12946 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264540.1 protein_id gnl|my_center|LOCUS_12940 12936 15485 gene locus_tag LOCUS_12950 gene mutS 12936 15485 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279585.1 protein_id gnl|my_center|LOCUS_12950 17052 15556 gene locus_tag LOCUS_12960 17052 15556 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967164.1 protein_id gnl|my_center|LOCUS_12960 18162 17053 gene locus_tag LOCUS_12970 18162 17053 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521482.1 protein_id gnl|my_center|LOCUS_12970 19298 18174 gene locus_tag LOCUS_12980 19298 18174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12980 19811 19332 gene locus_tag LOCUS_12990 19811 19332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12990 19995 21953 gene locus_tag LOCUS_13000 gene mutL 19995 21953 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262396.1 protein_id gnl|my_center|LOCUS_13000 22056 22646 gene locus_tag LOCUS_13010 gene ruvA 22056 22646 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262395.1 protein_id gnl|my_center|LOCUS_13010 22675 23232 gene locus_tag LOCUS_13020 22675 23232 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262394.1 protein_id gnl|my_center|LOCUS_13020 23394 24650 gene locus_tag LOCUS_13030 23394 24650 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262393.1 protein_id gnl|my_center|LOCUS_13030 24691 25842 gene locus_tag LOCUS_13040 gene recA 24691 25842 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262392.1 protein_id gnl|my_center|LOCUS_13040 25924 26322 gene locus_tag LOCUS_13050 gene spx 25924 26322 CDS product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591161.1 protein_id gnl|my_center|LOCUS_13050 26435 26863 gene locus_tag LOCUS_13060 26435 26863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262390.1 protein_id gnl|my_center|LOCUS_13060 26881 27507 gene locus_tag LOCUS_13070 26881 27507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 28029 27568 gene locus_tag LOCUS_13080 gene brsM 28029 27568 CDS product bacteriocin genes regulator BrsM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262388.1 protein_id gnl|my_center|LOCUS_13080 28474 28016 gene locus_tag LOCUS_13090 gene brsR 28474 28016 CDS product bacteriocin genes transcriptional regulator BrsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262387.1 protein_id gnl|my_center|LOCUS_13090 28647 28916 gene locus_tag LOCUS_13100 28647 28916 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262386.1 protein_id gnl|my_center|LOCUS_13100 28922 29332 gene locus_tag LOCUS_13110 gene ruvX 28922 29332 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262385.1 protein_id gnl|my_center|LOCUS_13110 29342 29641 gene locus_tag LOCUS_13120 29342 29641 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940932.1 protein_id gnl|my_center|LOCUS_13120 29887 31497 gene locus_tag LOCUS_13130 29887 31497 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074689.1 protein_id gnl|my_center|LOCUS_13130 31595 33796 gene locus_tag LOCUS_13140 gene nrdD 31595 33796 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263793.1 protein_id gnl|my_center|LOCUS_13140 33864 34016 gene locus_tag LOCUS_13150 33864 34016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902050.1 protein_id gnl|my_center|LOCUS_13150 34024 34536 gene locus_tag LOCUS_13160 34024 34536 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262379.1 protein_id gnl|my_center|LOCUS_13160 34529 35128 gene locus_tag LOCUS_13170 gene nrdG 34529 35128 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899261.1 protein_id gnl|my_center|LOCUS_13170 35872 35147 gene locus_tag LOCUS_13180 gene yaaA 35872 35147 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262377.1 protein_id gnl|my_center|LOCUS_13180 36676 35882 gene locus_tag LOCUS_13190 gene zupT 36676 35882 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262376.1 protein_id gnl|my_center|LOCUS_13190 36997 38769 gene locus_tag LOCUS_13200 36997 38769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 39275 40972 gene locus_tag LOCUS_13210 39275 40972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 43111 41048 gene locus_tag LOCUS_13220 43111 41048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 43297 44277 gene locus_tag LOCUS_13230 43297 44277 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775134.1 protein_id gnl|my_center|LOCUS_13230 47032 44312 gene locus_tag LOCUS_13240 47032 44312 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014636419.1 protein_id gnl|my_center|LOCUS_13240 47512 50157 gene locus_tag LOCUS_13250 47512 50157 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279588.1 protein_id gnl|my_center|LOCUS_13250 50177 51196 gene locus_tag LOCUS_13260 gene galE 50177 51196 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279589.1 protein_id gnl|my_center|LOCUS_13260 51329 51691 gene locus_tag LOCUS_13270 gene cidA 51329 51691 CDS product holin-like protein CidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262573.1 protein_id gnl|my_center|LOCUS_13270 51688 52383 gene locus_tag LOCUS_13280 gene cidB 51688 52383 CDS product antiholin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262574.1 protein_id gnl|my_center|LOCUS_13280 53072 52425 gene locus_tag LOCUS_13290 53072 52425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 53177 53623 gene locus_tag LOCUS_13300 53177 53623 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263191.1 protein_id gnl|my_center|LOCUS_13300 55046 53649 gene locus_tag LOCUS_13310 55046 53649 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293829.1 protein_id gnl|my_center|LOCUS_13310 55188 56456 gene locus_tag LOCUS_13320 gene celB 55188 56456 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748651.1 protein_id gnl|my_center|LOCUS_13320 56495 57220 gene locus_tag LOCUS_13330 56495 57220 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296966.1 protein_id gnl|my_center|LOCUS_13330 57291 58232 gene locus_tag LOCUS_13340 gene manA 57291 58232 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896007.1 protein_id gnl|my_center|LOCUS_13340 58460 60076 gene locus_tag LOCUS_13350 58460 60076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 60471 61691 gene locus_tag LOCUS_13360 60471 61691 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002269864.1 protein_id gnl|my_center|LOCUS_13360 62566 61706 gene locus_tag LOCUS_13370 62566 61706 CDS product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263840.1 protein_id gnl|my_center|LOCUS_13370 63149 62796 gene locus_tag LOCUS_13380 63149 62796 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267509.1 protein_id gnl|my_center|LOCUS_13380 >Feature sequence11 168 1115 gene locus_tag LOCUS_13390 168 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1137 1379 gene locus_tag LOCUS_13400 1137 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 2776 1502 gene locus_tag LOCUS_13410 gene serS 2776 1502 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263348.1 protein_id gnl|my_center|LOCUS_13410 3106 4197 gene locus_tag LOCUS_13420 3106 4197 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263349.1 protein_id gnl|my_center|LOCUS_13420 4584 4207 gene locus_tag LOCUS_13430 4584 4207 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920098.1 protein_id gnl|my_center|LOCUS_13430 5737 4826 gene locus_tag LOCUS_13440 5737 4826 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136858.1 protein_id gnl|my_center|LOCUS_13440 6568 5753 gene locus_tag LOCUS_13450 6568 5753 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983360.1 protein_id gnl|my_center|LOCUS_13450 7589 6600 gene locus_tag LOCUS_13460 7589 6600 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263355.1 protein_id gnl|my_center|LOCUS_13460 8716 7904 gene locus_tag LOCUS_13470 8716 7904 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262615.1 protein_id gnl|my_center|LOCUS_13470 8930 10390 gene locus_tag LOCUS_13480 8930 10390 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775676.1 protein_id gnl|my_center|LOCUS_13480 10496 10945 gene locus_tag LOCUS_13490 gene tsaE 10496 10945 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002272923.1 protein_id gnl|my_center|LOCUS_13490 10935 11459 gene locus_tag LOCUS_13500 10935 11459 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775687.1 protein_id gnl|my_center|LOCUS_13500 11496 12620 gene locus_tag LOCUS_13510 gene brpA 11496 12620 CDS product biofilm formation/cell division transcriptional regulator BrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262611.1 protein_id gnl|my_center|LOCUS_13510 12951 12646 gene locus_tag LOCUS_13520 12951 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 13367 12948 gene locus_tag LOCUS_13530 13367 12948 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262609.1 protein_id gnl|my_center|LOCUS_13530 13431 14156 gene locus_tag LOCUS_13540 13431 14156 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262608.1 protein_id gnl|my_center|LOCUS_13540 14156 15196 gene locus_tag LOCUS_13550 14156 15196 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279713.1 protein_id gnl|my_center|LOCUS_13550 15255 16037 gene locus_tag LOCUS_13560 15255 16037 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262606.1 protein_id gnl|my_center|LOCUS_13560 16047 16682 gene locus_tag LOCUS_13570 gene trmB 16047 16682 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262605.1 protein_id gnl|my_center|LOCUS_13570 16747 16833 gene locus_tag LOCUS_t00090 16747 16833 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 16878 17141 gene locus_tag LOCUS_13580 16878 17141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 17399 17611 gene locus_tag LOCUS_13590 17399 17611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 17832 18227 gene locus_tag LOCUS_13600 17832 18227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 18240 18977 gene locus_tag LOCUS_13610 18240 18977 CDS product WxcM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611754.1 protein_id gnl|my_center|LOCUS_13610 19001 19384 gene locus_tag LOCUS_13620 19001 19384 CDS product DUF1310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836699.1 protein_id gnl|my_center|LOCUS_13620 19385 20644 gene locus_tag LOCUS_13630 19385 20644 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416815.1 protein_id gnl|my_center|LOCUS_13630 20626 21015 gene locus_tag LOCUS_13640 20626 21015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 21033 21317 gene locus_tag LOCUS_13650 21033 21317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 21620 22096 gene locus_tag LOCUS_13660 gene rimP 21620 22096 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262604.1 protein_id gnl|my_center|LOCUS_13660 22144 23319 gene locus_tag LOCUS_13670 gene nusA 22144 23319 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262603.1 protein_id gnl|my_center|LOCUS_13670 23338 23634 gene locus_tag LOCUS_13680 23338 23634 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263922.1 protein_id gnl|my_center|LOCUS_13680 23627 23929 gene locus_tag LOCUS_13690 23627 23929 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262601.1 protein_id gnl|my_center|LOCUS_13690 23948 26710 gene locus_tag LOCUS_13700 gene infB 23948 26710 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262600.1 protein_id gnl|my_center|LOCUS_13700 26774 27130 gene locus_tag LOCUS_13710 gene rbfA 26774 27130 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262599.1 protein_id gnl|my_center|LOCUS_13710 27233 27670 gene locus_tag LOCUS_13720 27233 27670 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263708.1 protein_id gnl|my_center|LOCUS_13720 27667 29895 gene locus_tag LOCUS_13730 27667 29895 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263707.1 protein_id gnl|my_center|LOCUS_13730 29909 30109 gene locus_tag LOCUS_13740 gene copZ 29909 30109 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263706.1 protein_id gnl|my_center|LOCUS_13740 30217 31050 gene locus_tag LOCUS_13750 30217 31050 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263705.1 protein_id gnl|my_center|LOCUS_13750 31047 31928 gene locus_tag LOCUS_13760 31047 31928 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593336.1 protein_id gnl|my_center|LOCUS_13760 32603 32046 gene locus_tag LOCUS_13770 32603 32046 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895666.1 protein_id gnl|my_center|LOCUS_13770 32731 33576 gene locus_tag LOCUS_13780 32731 33576 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836880.1 protein_id gnl|my_center|LOCUS_13780 33735 34883 gene locus_tag LOCUS_13790 gene nagA 33735 34883 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074509.1 protein_id gnl|my_center|LOCUS_13790 34927 35337 gene locus_tag LOCUS_13800 34927 35337 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262080.1 protein_id gnl|my_center|LOCUS_13800 35607 36524 gene locus_tag LOCUS_13810 gene glyQ 35607 36524 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262081.1 protein_id gnl|my_center|LOCUS_13810 36524 38563 gene locus_tag LOCUS_13820 gene glyS 36524 38563 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262082.1 protein_id gnl|my_center|LOCUS_13820 38574 38828 gene locus_tag LOCUS_13830 38574 38828 CDS product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262083.1 protein_id gnl|my_center|LOCUS_13830 38930 41008 gene locus_tag LOCUS_13840 38930 41008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 40995 41345 gene locus_tag LOCUS_13850 40995 41345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 41433 41711 gene locus_tag LOCUS_13860 41433 41711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 41875 42684 gene locus_tag LOCUS_13870 gene proB 41875 42684 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265279.1 protein_id gnl|my_center|LOCUS_13870 42688 43938 gene locus_tag LOCUS_13880 42688 43938 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262086.1 protein_id gnl|my_center|LOCUS_13880 43993 44952 gene locus_tag LOCUS_13890 gene rsmH 43993 44952 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262087.1 protein_id gnl|my_center|LOCUS_13890 44961 45284 gene locus_tag LOCUS_13900 gene ftsL 44961 45284 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262088.1 protein_id gnl|my_center|LOCUS_13900 45288 47531 gene locus_tag LOCUS_13910 gene pbp2X 45288 47531 CDS product penicillin-binding protein PBP2X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262089.1 protein_id gnl|my_center|LOCUS_13910 47533 48552 gene locus_tag LOCUS_13920 gene mraY 47533 48552 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262090.1 protein_id gnl|my_center|LOCUS_13920 48631 49974 gene locus_tag LOCUS_13930 48631 49974 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027650.1 protein_id gnl|my_center|LOCUS_13930 50104 50922 gene locus_tag LOCUS_13940 50104 50922 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262092.1 protein_id gnl|my_center|LOCUS_13940 50941 51744 gene locus_tag LOCUS_13950 50941 51744 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262093.1 protein_id gnl|my_center|LOCUS_13950 51744 52487 gene locus_tag LOCUS_13960 51744 52487 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262094.1 protein_id gnl|my_center|LOCUS_13960 52534 52758 gene locus_tag LOCUS_13970 52534 52758 CDS product DUF4059 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262095.1 protein_id gnl|my_center|LOCUS_13970 52823 53737 gene locus_tag LOCUS_13980 gene trxB 52823 53737 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262096.1 protein_id gnl|my_center|LOCUS_13980 53840 55300 gene locus_tag LOCUS_13990 53840 55300 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262097.1 protein_id gnl|my_center|LOCUS_13990 55297 56121 gene locus_tag LOCUS_14000 gene nadE 55297 56121 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255352.1 protein_id gnl|my_center|LOCUS_14000 58487 56259 gene locus_tag LOCUS_14010 gene pbp1a 58487 56259 CDS product penicillin-binding protein PBP1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074515.1 protein_id gnl|my_center|LOCUS_14010 59076 58453 gene locus_tag LOCUS_14020 gene recU 59076 58453 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248792.1 protein_id gnl|my_center|LOCUS_14020 59153 59674 gene locus_tag LOCUS_14030 59153 59674 CDS product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263051.1 protein_id gnl|my_center|LOCUS_14030 59778 60104 gene locus_tag LOCUS_14040 gene gpsB 59778 60104 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263050.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence12 199 2490 gene locus_tag LOCUS_14050 199 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 3208 2603 gene locus_tag LOCUS_14060 3208 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310807.1 protein_id gnl|my_center|LOCUS_14060 3619 3329 gene locus_tag LOCUS_14070 3619 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 3870 3619 gene locus_tag LOCUS_14080 3870 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 4433 3870 gene locus_tag LOCUS_14090 4433 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829082.1 protein_id gnl|my_center|LOCUS_14090 5846 4446 gene locus_tag LOCUS_14100 5846 4446 CDS product phage tail tip lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511832.1 protein_id gnl|my_center|LOCUS_14100 6613 5867 gene locus_tag LOCUS_14110 6613 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 8995 6677 gene locus_tag LOCUS_14120 8995 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310787.1 protein_id gnl|my_center|LOCUS_14120 11514 8995 gene locus_tag LOCUS_14130 11514 8995 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310789.1 protein_id gnl|my_center|LOCUS_14130 11920 11492 gene locus_tag LOCUS_14140 11920 11492 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310791.1 protein_id gnl|my_center|LOCUS_14140 12196 11966 gene locus_tag LOCUS_14150 12196 11966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 13152 12214 gene locus_tag LOCUS_14160 13152 12214 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310793.1 protein_id gnl|my_center|LOCUS_14160 13667 13188 gene locus_tag LOCUS_14170 13667 13188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 13992 13720 gene locus_tag LOCUS_14180 13992 13720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017154.1 protein_id gnl|my_center|LOCUS_14180 14404 14108 gene locus_tag LOCUS_14190 14404 14108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 14667 14401 gene locus_tag LOCUS_14200 14667 14401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310784.1 protein_id gnl|my_center|LOCUS_14200 14792 14664 gene locus_tag LOCUS_14210 14792 14664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 15175 14789 gene locus_tag LOCUS_14220 15175 14789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 16374 15175 gene locus_tag LOCUS_14230 16374 15175 CDS product replication initiation factor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006738730.1 protein_id gnl|my_center|LOCUS_14230 18327 16687 gene locus_tag LOCUS_14240 18327 16687 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074490.1 protein_id gnl|my_center|LOCUS_14240 18785 18333 gene locus_tag LOCUS_14250 18785 18333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062569.1 protein_id gnl|my_center|LOCUS_14250 19097 18798 gene locus_tag LOCUS_14260 19097 18798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808311.1 protein_id gnl|my_center|LOCUS_14260 20793 19174 gene locus_tag LOCUS_14270 20793 19174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 21332 21033 gene locus_tag LOCUS_14280 21332 21033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 21827 21381 gene locus_tag LOCUS_14290 21827 21381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 22052 21846 gene locus_tag LOCUS_14300 22052 21846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 22644 22429 gene locus_tag LOCUS_14310 22644 22429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 23094 22669 gene locus_tag LOCUS_14320 23094 22669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 23479 23240 gene locus_tag LOCUS_14330 23479 23240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 24153 24302 gene locus_tag LOCUS_14340 24153 24302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 24616 24960 gene locus_tag LOCUS_14350 24616 24960 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002268365.1 protein_id gnl|my_center|LOCUS_14350 24963 25385 gene locus_tag LOCUS_14360 24963 25385 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002268366.1 protein_id gnl|my_center|LOCUS_14360 25388 26200 gene locus_tag LOCUS_14370 25388 26200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 26631 26245 gene locus_tag LOCUS_14380 26631 26245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 27043 26885 gene locus_tag LOCUS_14390 27043 26885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 29203 27053 gene locus_tag LOCUS_14400 gene feoB 29203 27053 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263563.1 protein_id gnl|my_center|LOCUS_14400 29672 29193 gene locus_tag LOCUS_14410 29672 29193 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263564.1 protein_id gnl|my_center|LOCUS_14410 30505 29771 gene locus_tag LOCUS_14420 30505 29771 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263565.1 protein_id gnl|my_center|LOCUS_14420 31191 30505 gene locus_tag LOCUS_14430 31191 30505 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263566.1 protein_id gnl|my_center|LOCUS_14430 31535 31305 gene locus_tag LOCUS_14440 31535 31305 CDS product YkuJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983885.1 protein_id gnl|my_center|LOCUS_14440 32593 31613 gene locus_tag LOCUS_14450 gene argF 32593 31613 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263568.1 protein_id gnl|my_center|LOCUS_14450 32781 35030 gene locus_tag LOCUS_14460 32781 35030 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263569.1 protein_id gnl|my_center|LOCUS_14460 35156 35617 gene locus_tag LOCUS_14470 35156 35617 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074528.1 protein_id gnl|my_center|LOCUS_14470 35672 35971 gene locus_tag LOCUS_14480 35672 35971 CDS product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263571.1 protein_id gnl|my_center|LOCUS_14480 38914 36116 gene locus_tag LOCUS_14490 gene ileS 38914 36116 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262075.1 protein_id gnl|my_center|LOCUS_14490 39935 39153 gene locus_tag LOCUS_14500 39935 39153 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262074.1 protein_id gnl|my_center|LOCUS_14500 40735 39950 gene locus_tag LOCUS_14510 40735 39950 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074526.1 protein_id gnl|my_center|LOCUS_14510 40994 40737 gene locus_tag LOCUS_14520 40994 40737 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983869.1 protein_id gnl|my_center|LOCUS_14520 41581 41000 gene locus_tag LOCUS_14530 41581 41000 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262071.1 protein_id gnl|my_center|LOCUS_14530 42265 41594 gene locus_tag LOCUS_14540 42265 41594 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262070.1 protein_id gnl|my_center|LOCUS_14540 43572 42268 gene locus_tag LOCUS_14550 gene ftsZ 43572 42268 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263818.1 protein_id gnl|my_center|LOCUS_14550 44957 43596 gene locus_tag LOCUS_14560 gene ftsA 44957 43596 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262068.1 protein_id gnl|my_center|LOCUS_14560 46270 45101 gene locus_tag LOCUS_14570 46270 45101 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262067.1 protein_id gnl|my_center|LOCUS_14570 47346 46273 gene locus_tag LOCUS_14580 47346 46273 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262066.1 protein_id gnl|my_center|LOCUS_14580 48703 47339 gene locus_tag LOCUS_14590 gene murD 48703 47339 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262065.1 protein_id gnl|my_center|LOCUS_14590 49089 48847 gene locus_tag LOCUS_14600 49089 48847 CDS product DUF3165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262064.1 protein_id gnl|my_center|LOCUS_14600 50979 49135 gene locus_tag LOCUS_14610 gene typA 50979 49135 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061563670.1 protein_id gnl|my_center|LOCUS_14610 51556 51167 gene locus_tag LOCUS_14620 51556 51167 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262062.1 protein_id gnl|my_center|LOCUS_14620 52540 51566 gene locus_tag LOCUS_14630 52540 51566 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009880399.1 protein_id gnl|my_center|LOCUS_14630 52787 52515 gene locus_tag LOCUS_14640 52787 52515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 53371 52844 gene locus_tag LOCUS_14650 gene dpr 53371 52844 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262059.1 protein_id gnl|my_center|LOCUS_14650 53716 54126 gene locus_tag LOCUS_14660 53716 54126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence13 906 334 gene locus_tag LOCUS_14670 906 334 CDS product DUF3267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028280.1 protein_id gnl|my_center|LOCUS_14670 1832 918 gene locus_tag LOCUS_14680 1832 918 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939997.1 protein_id gnl|my_center|LOCUS_14680 4115 2100 gene locus_tag LOCUS_14690 gene recG 4115 2100 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263465.1 protein_id gnl|my_center|LOCUS_14690 5284 4181 gene locus_tag LOCUS_14700 gene alr 5284 4181 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263464.1 protein_id gnl|my_center|LOCUS_14700 5637 5281 gene locus_tag LOCUS_14710 gene acpS 5637 5281 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263463.1 protein_id gnl|my_center|LOCUS_14710 6717 5680 gene locus_tag LOCUS_14720 6717 5680 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311767.1 protein_id gnl|my_center|LOCUS_14720 7750 6719 gene locus_tag LOCUS_14730 7750 6719 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310594.1 protein_id gnl|my_center|LOCUS_14730 10286 7767 gene locus_tag LOCUS_14740 gene secA 10286 7767 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262654.1 protein_id gnl|my_center|LOCUS_14740 11336 10455 gene locus_tag LOCUS_14750 11336 10455 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262656.1 protein_id gnl|my_center|LOCUS_14750 13431 11488 gene locus_tag LOCUS_14760 13431 11488 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262657.1 protein_id gnl|my_center|LOCUS_14760 13619 15058 gene locus_tag LOCUS_14770 13619 15058 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262658.1 protein_id gnl|my_center|LOCUS_14770 15060 16022 gene locus_tag LOCUS_14780 15060 16022 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262659.1 protein_id gnl|my_center|LOCUS_14780 16475 16053 gene locus_tag LOCUS_14790 gene nusB 16475 16053 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204940.1 protein_id gnl|my_center|LOCUS_14790 16857 16468 gene locus_tag LOCUS_14800 16857 16468 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262661.1 protein_id gnl|my_center|LOCUS_14800 17452 16892 gene locus_tag LOCUS_14810 gene efp 17452 16892 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262662.1 protein_id gnl|my_center|LOCUS_14810 17994 17536 gene locus_tag LOCUS_14820 17994 17536 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262664.1 protein_id gnl|my_center|LOCUS_14820 19144 18083 gene locus_tag LOCUS_14830 19144 18083 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775324.1 protein_id gnl|my_center|LOCUS_14830 22142 19317 gene locus_tag LOCUS_14840 gene uvrA 22142 19317 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262666.1 protein_id gnl|my_center|LOCUS_14840 22278 23222 gene locus_tag LOCUS_14850 22278 23222 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262667.1 protein_id gnl|my_center|LOCUS_14850 23262 23939 gene locus_tag LOCUS_14860 23262 23939 CDS product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922629.1 protein_id gnl|my_center|LOCUS_14860 24022 24711 gene locus_tag LOCUS_14870 gene hdrM 24022 24711 CDS product hdrR negative regulator HdrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262670.1 protein_id gnl|my_center|LOCUS_14870 25003 24764 gene locus_tag LOCUS_14880 gene rpsR 25003 24764 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068664.1 protein_id gnl|my_center|LOCUS_14880 25597 25103 gene locus_tag LOCUS_14890 25597 25103 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261867.1 protein_id gnl|my_center|LOCUS_14890 25899 25609 gene locus_tag LOCUS_14900 gene rpsF 25899 25609 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983117.1 protein_id gnl|my_center|LOCUS_14900 26751 27902 gene locus_tag LOCUS_14910 gene mutY 26751 27902 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263365.1 protein_id gnl|my_center|LOCUS_14910 28234 27920 gene locus_tag LOCUS_14920 gene trxA 28234 27920 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263363.1 protein_id gnl|my_center|LOCUS_14920 30773 28443 gene locus_tag LOCUS_14930 30773 28443 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263362.1 protein_id gnl|my_center|LOCUS_14930 31359 30814 gene locus_tag LOCUS_14940 31359 30814 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263361.1 protein_id gnl|my_center|LOCUS_14940 31661 31359 gene locus_tag LOCUS_14950 31661 31359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263360.1 protein_id gnl|my_center|LOCUS_14950 31744 32685 gene locus_tag LOCUS_14960 gene rnhC 31744 32685 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002271343.1 protein_id gnl|my_center|LOCUS_14960 32694 33281 gene locus_tag LOCUS_14970 gene lepB 32694 33281 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263358.1 protein_id gnl|my_center|LOCUS_14970 33340 35691 gene locus_tag LOCUS_14980 33340 35691 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263357.1 protein_id gnl|my_center|LOCUS_14980 35791 36264 gene locus_tag LOCUS_14990 35791 36264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263356.1 protein_id gnl|my_center|LOCUS_14990 37407 36313 gene locus_tag LOCUS_15000 gene dinB 37407 36313 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262618.1 protein_id gnl|my_center|LOCUS_15000 37612 39939 gene locus_tag LOCUS_15010 gene pflB 37612 39939 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896602.1 protein_id gnl|my_center|LOCUS_15010 40031 40462 gene locus_tag LOCUS_15020 40031 40462 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262620.1 protein_id gnl|my_center|LOCUS_15020 41026 40484 gene locus_tag LOCUS_15030 41026 40484 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199111.1 protein_id gnl|my_center|LOCUS_15030 41970 41023 gene locus_tag LOCUS_15040 41970 41023 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262621.1 protein_id gnl|my_center|LOCUS_15040 42713 41967 gene locus_tag LOCUS_15050 42713 41967 CDS product CppA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262622.1 protein_id gnl|my_center|LOCUS_15050 43686 42832 gene locus_tag LOCUS_15060 43686 42832 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348128.1 protein_id gnl|my_center|LOCUS_15060 43802 46081 gene locus_tag LOCUS_15070 43802 46081 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262624.1 protein_id gnl|my_center|LOCUS_15070 46885 46112 gene locus_tag LOCUS_15080 46885 46112 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989141.1 protein_id gnl|my_center|LOCUS_15080 49264 47438 gene locus_tag LOCUS_15090 49264 47438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 51498 49273 gene locus_tag LOCUS_15100 51498 49273 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202292.1 protein_id gnl|my_center|LOCUS_15100 53264 51495 gene locus_tag LOCUS_15110 53264 51495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence14 530 135 gene locus_tag LOCUS_15120 530 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1012 701 gene locus_tag LOCUS_15130 1012 701 CDS product DUF4176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837102.1 protein_id gnl|my_center|LOCUS_15130 1533 1012 gene locus_tag LOCUS_15140 1533 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 2107 1553 gene locus_tag LOCUS_15150 2107 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 3549 2104 gene locus_tag LOCUS_15160 3549 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837662.1 protein_id gnl|my_center|LOCUS_15160 3945 3568 gene locus_tag LOCUS_15170 3945 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 8310 3961 gene locus_tag LOCUS_15180 gene essC 8310 3961 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001865532.1 protein_id gnl|my_center|LOCUS_15180 9537 8323 gene locus_tag LOCUS_15190 gene essB 9537 8323 CDS product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837666.1 protein_id gnl|my_center|LOCUS_15190 9774 9538 gene locus_tag LOCUS_15200 9774 9538 CDS product EsaB/YukD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894139.1 protein_id gnl|my_center|LOCUS_15200 10243 9788 gene locus_tag LOCUS_15210 10243 9788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 13357 10292 gene locus_tag LOCUS_15220 gene esaA 13357 10292 CDS product type VII secretion protein EsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828093.1 protein_id gnl|my_center|LOCUS_15220 13870 13574 gene locus_tag LOCUS_15230 13870 13574 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078283.1 protein_id gnl|my_center|LOCUS_15230 14895 13984 gene locus_tag LOCUS_15240 14895 13984 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917329.1 protein_id gnl|my_center|LOCUS_15240 15346 14879 gene locus_tag LOCUS_15250 gene lspA 15346 14879 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226253.1 protein_id gnl|my_center|LOCUS_15250 16261 15356 gene locus_tag LOCUS_15260 16261 15356 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262001.1 protein_id gnl|my_center|LOCUS_15260 16864 16355 gene locus_tag LOCUS_15270 16864 16355 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262000.1 protein_id gnl|my_center|LOCUS_15270 17247 16954 gene locus_tag LOCUS_15280 gene rpmA 17247 16954 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916503.1 protein_id gnl|my_center|LOCUS_15280 17605 17264 gene locus_tag LOCUS_15290 17605 17264 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261997.1 protein_id gnl|my_center|LOCUS_15290 17928 17614 gene locus_tag LOCUS_15300 gene rplU 17928 17614 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261996.1 protein_id gnl|my_center|LOCUS_15300 20070 18307 gene locus_tag LOCUS_15310 20070 18307 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836960.1 protein_id gnl|my_center|LOCUS_15310 21390 20209 gene locus_tag LOCUS_15320 21390 20209 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074555.1 protein_id gnl|my_center|LOCUS_15320 22682 21468 gene locus_tag LOCUS_15330 gene thiI 22682 21468 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200061.1 protein_id gnl|my_center|LOCUS_15330 23828 22686 gene locus_tag LOCUS_15340 23828 22686 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638895.1 protein_id gnl|my_center|LOCUS_15340 23959 24375 gene locus_tag LOCUS_15350 23959 24375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261990.1 protein_id gnl|my_center|LOCUS_15350 25802 24450 gene locus_tag LOCUS_15360 gene gorA 25802 24450 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261988.1 protein_id gnl|my_center|LOCUS_15360 26765 25923 gene locus_tag LOCUS_15370 26765 25923 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261987.1 protein_id gnl|my_center|LOCUS_15370 28488 26857 gene locus_tag LOCUS_15380 28488 26857 CDS product GBS Bsp-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261986.1 protein_id gnl|my_center|LOCUS_15380 29525 28578 gene locus_tag LOCUS_15390 29525 28578 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261983.1 protein_id gnl|my_center|LOCUS_15390 30842 29580 gene locus_tag LOCUS_15400 30842 29580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074554.1 protein_id gnl|my_center|LOCUS_15400 33314 30852 gene locus_tag LOCUS_15410 33314 30852 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261981.1 protein_id gnl|my_center|LOCUS_15410 35062 33311 gene locus_tag LOCUS_15420 gene rgpF 35062 33311 CDS product rhamnose-glucose polysaccharide assembly protein RgpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261980.1 protein_id gnl|my_center|LOCUS_15420 36480 35059 gene locus_tag LOCUS_15430 36480 35059 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261979.1 protein_id gnl|my_center|LOCUS_15430 37727 36504 gene locus_tag LOCUS_15440 37727 36504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261978.1 protein_id gnl|my_center|LOCUS_15440 38530 37727 gene locus_tag LOCUS_15450 38530 37727 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261977.1 protein_id gnl|my_center|LOCUS_15450 39463 38531 gene locus_tag LOCUS_15460 39463 38531 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261976.1 protein_id gnl|my_center|LOCUS_15460 40607 39453 gene locus_tag LOCUS_15470 40607 39453 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002270459.1 protein_id gnl|my_center|LOCUS_15470 41644 40793 gene locus_tag LOCUS_15480 gene rfbD 41644 40793 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261974.1 protein_id gnl|my_center|LOCUS_15480 42103 41768 gene locus_tag LOCUS_15490 42103 41768 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261973.1 protein_id gnl|my_center|LOCUS_15490 43224 42115 gene locus_tag LOCUS_15500 gene rpoD 43224 42115 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261972.1 protein_id gnl|my_center|LOCUS_15500 45011 43233 gene locus_tag LOCUS_15510 gene dnaG 45011 43233 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074552.1 protein_id gnl|my_center|LOCUS_15510 46582 45116 gene locus_tag LOCUS_15520 46582 45116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261970.1 protein_id gnl|my_center|LOCUS_15520 46738 47109 gene locus_tag LOCUS_15530 gene mscL 46738 47109 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261969.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence15 383 132 gene locus_tag LOCUS_15540 383 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1085 2083 gene locus_tag LOCUS_15550 1085 2083 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081212.1 protein_id gnl|my_center|LOCUS_15550 2171 2728 gene locus_tag LOCUS_15560 2171 2728 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398700.1 protein_id gnl|my_center|LOCUS_15560 2819 3304 gene locus_tag LOCUS_15570 2819 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15570 3298 3600 gene locus_tag LOCUS_15580 3298 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15580 3999 4982 gene locus_tag LOCUS_15590 3999 4982 CDS product lipid II:glycine glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922337.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15590 5101 9504 gene locus_tag LOCUS_15600 5101 9504 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263483.1 protein_id gnl|my_center|LOCUS_15600 9515 9640 gene locus_tag LOCUS_15610 9515 9640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 9710 10144 gene locus_tag LOCUS_15620 9710 10144 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161940001.1 protein_id gnl|my_center|LOCUS_15620 10214 10765 gene locus_tag LOCUS_15630 10214 10765 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263481.1 protein_id gnl|my_center|LOCUS_15630 10975 11943 gene locus_tag LOCUS_15640 10975 11943 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074480.1 protein_id gnl|my_center|LOCUS_15640 11953 12960 gene locus_tag LOCUS_15650 11953 12960 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002942393.1 protein_id gnl|my_center|LOCUS_15650 13130 14515 gene locus_tag LOCUS_15660 13130 14515 CDS product dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922239.1 protein_id gnl|my_center|LOCUS_15660 14566 16317 gene locus_tag LOCUS_15670 gene lpdA 14566 16317 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922240.1 protein_id gnl|my_center|LOCUS_15670 16455 17444 gene locus_tag LOCUS_15680 16455 17444 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027737.1 protein_id gnl|my_center|LOCUS_15680 18381 17695 gene locus_tag LOCUS_15690 18381 17695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 19549 18935 gene locus_tag LOCUS_15700 gene def 19549 18935 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902258.1 protein_id gnl|my_center|LOCUS_15700 20267 19617 gene locus_tag LOCUS_15710 20267 19617 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263600.1 protein_id gnl|my_center|LOCUS_15710 20361 21524 gene locus_tag LOCUS_15720 20361 21524 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263893.1 protein_id gnl|my_center|LOCUS_15720 21666 21935 gene locus_tag LOCUS_15730 gene rpsO 21666 21935 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922677.1 protein_id gnl|my_center|LOCUS_15730 22080 21889 gene locus_tag LOCUS_15740 22080 21889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 22026 22685 gene locus_tag LOCUS_15750 22026 22685 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548243.1 protein_id gnl|my_center|LOCUS_15750 22678 23448 gene locus_tag LOCUS_15760 gene fetB 22678 23448 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254483.1 protein_id gnl|my_center|LOCUS_15760 23680 25851 gene locus_tag LOCUS_15770 gene pnp 23680 25851 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263007.1 protein_id gnl|my_center|LOCUS_15770 25841 26587 gene locus_tag LOCUS_15780 25841 26587 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263006.1 protein_id gnl|my_center|LOCUS_15780 26600 27184 gene locus_tag LOCUS_15790 gene cysE 26600 27184 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539954.1 protein_id gnl|my_center|LOCUS_15790 27242 27406 gene locus_tag LOCUS_15800 27242 27406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 27594 28127 gene locus_tag LOCUS_15810 27594 28127 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301974.1 protein_id gnl|my_center|LOCUS_15810 28124 29467 gene locus_tag LOCUS_15820 gene cysS 28124 29467 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027809.1 protein_id gnl|my_center|LOCUS_15820 29460 29858 gene locus_tag LOCUS_15830 29460 29858 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837513.1 protein_id gnl|my_center|LOCUS_15830 29828 30019 gene locus_tag LOCUS_15840 29828 30019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 30610 32814 gene locus_tag LOCUS_15850 30610 32814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 32935 33660 gene locus_tag LOCUS_15860 gene rlmB 32935 33660 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027787.1 protein_id gnl|my_center|LOCUS_15860 33675 34538 gene locus_tag LOCUS_15870 33675 34538 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262997.1 protein_id gnl|my_center|LOCUS_15870 34607 36361 gene locus_tag LOCUS_15880 34607 36361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 36523 38226 gene locus_tag LOCUS_15890 36523 38226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 38549 38995 gene locus_tag LOCUS_15900 gene rplM 38549 38995 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893769.1 protein_id gnl|my_center|LOCUS_15900 39016 39408 gene locus_tag LOCUS_15910 gene rpsI 39016 39408 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262992.1 protein_id gnl|my_center|LOCUS_15910 40732 39515 gene locus_tag LOCUS_15920 40732 39515 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205010568.1 protein_id gnl|my_center|LOCUS_15920 41060 40797 gene locus_tag LOCUS_15930 41060 40797 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196077.1 protein_id gnl|my_center|LOCUS_15930 42622 41255 gene locus_tag LOCUS_15940 42622 41255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 43340 42741 gene locus_tag LOCUS_15950 43340 42741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 44373 43408 gene locus_tag LOCUS_15960 44373 43408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 45009 45422 gene locus_tag LOCUS_15970 45009 45422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 46094 46315 gene locus_tag LOCUS_15980 46094 46315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence16 175 951 gene locus_tag LOCUS_15990 gene codY 175 951 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263472.1 protein_id gnl|my_center|LOCUS_15990 952 1503 gene locus_tag LOCUS_16000 952 1503 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263473.1 protein_id gnl|my_center|LOCUS_16000 1758 3509 gene locus_tag LOCUS_16010 gene aspS 1758 3509 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352359.1 protein_id gnl|my_center|LOCUS_16010 3557 3859 gene locus_tag LOCUS_16020 gene gatC 3557 3859 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263475.1 protein_id gnl|my_center|LOCUS_16020 3859 5325 gene locus_tag LOCUS_16030 gene gatA 3859 5325 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263829.1 protein_id gnl|my_center|LOCUS_16030 5325 6758 gene locus_tag LOCUS_16040 gene gatB 5325 6758 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263477.1 protein_id gnl|my_center|LOCUS_16040 6991 7911 gene locus_tag LOCUS_16050 6991 7911 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263499.1 protein_id gnl|my_center|LOCUS_16050 8664 7927 gene locus_tag LOCUS_16060 8664 7927 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911920.1 protein_id gnl|my_center|LOCUS_16060 10961 8661 gene locus_tag LOCUS_16070 10961 8661 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836618.1 protein_id gnl|my_center|LOCUS_16070 12237 10942 gene locus_tag LOCUS_16080 12237 10942 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836619.1 protein_id gnl|my_center|LOCUS_16080 12864 12256 gene locus_tag LOCUS_16090 12864 12256 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836620.1 protein_id gnl|my_center|LOCUS_16090 13081 13911 gene locus_tag LOCUS_16100 13081 13911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 14028 14324 gene locus_tag LOCUS_16110 14028 14324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 14431 14958 gene locus_tag LOCUS_16120 14431 14958 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263504.1 protein_id gnl|my_center|LOCUS_16120 14959 16065 gene locus_tag LOCUS_16130 gene yqeH 14959 16065 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263505.1 protein_id gnl|my_center|LOCUS_16130 16093 16401 gene locus_tag LOCUS_16140 gene yhbY 16093 16401 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263506.1 protein_id gnl|my_center|LOCUS_16140 16425 17057 gene locus_tag LOCUS_16150 16425 17057 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263507.1 protein_id gnl|my_center|LOCUS_16150 17054 17644 gene locus_tag LOCUS_16160 gene yqeK 17054 17644 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263508.1 protein_id gnl|my_center|LOCUS_16160 17646 17954 gene locus_tag LOCUS_16170 17646 17954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 17951 18466 gene locus_tag LOCUS_16180 17951 18466 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128173.1 protein_id gnl|my_center|LOCUS_16180 18463 18816 gene locus_tag LOCUS_16190 gene rsfS 18463 18816 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266441.1 protein_id gnl|my_center|LOCUS_16190 19022 19759 gene locus_tag LOCUS_16200 19022 19759 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263510.1 protein_id gnl|my_center|LOCUS_16200 19876 20484 gene locus_tag LOCUS_16210 19876 20484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 20494 20745 gene locus_tag LOCUS_16220 20494 20745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 20854 22194 gene locus_tag LOCUS_16230 20854 22194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 22314 22976 gene locus_tag LOCUS_16240 22314 22976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 22987 23736 gene locus_tag LOCUS_16250 22987 23736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 23785 24450 gene locus_tag LOCUS_16260 23785 24450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 24468 24611 gene locus_tag LOCUS_16270 24468 24611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 24615 25208 gene locus_tag LOCUS_16280 24615 25208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 25257 25913 gene locus_tag LOCUS_16290 25257 25913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 25922 27190 gene locus_tag LOCUS_16300 25922 27190 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044255.1 protein_id gnl|my_center|LOCUS_16300 27180 27623 gene locus_tag LOCUS_16310 27180 27623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 27624 27977 gene locus_tag LOCUS_16320 27624 27977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 28105 29208 gene locus_tag LOCUS_16330 28105 29208 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263513.1 protein_id gnl|my_center|LOCUS_16330 29460 30371 gene locus_tag LOCUS_16340 29460 30371 CDS product abortive infection system antitoxin AbiGi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090290936.1 protein_id gnl|my_center|LOCUS_16340 30371 31573 gene locus_tag LOCUS_16350 30371 31573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 31563 31844 gene locus_tag LOCUS_16360 31563 31844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 32166 32522 gene locus_tag LOCUS_16370 32166 32522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16370 32628 32768 gene locus_tag LOCUS_16380 32628 32768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16380 32758 32967 gene locus_tag LOCUS_16390 32758 32967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 33110 33520 gene locus_tag LOCUS_16400 33110 33520 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774977.1 protein_id gnl|my_center|LOCUS_16400 33666 34454 gene locus_tag LOCUS_16410 33666 34454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 34809 35525 gene locus_tag LOCUS_16420 34809 35525 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532903.1 protein_id gnl|my_center|LOCUS_16420 35622 35966 gene locus_tag LOCUS_16430 35622 35966 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263516.1 protein_id gnl|my_center|LOCUS_16430 36064 36408 gene locus_tag LOCUS_16440 gene yajC 36064 36408 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056607.1 protein_id gnl|my_center|LOCUS_16440 36555 37268 gene locus_tag LOCUS_16450 36555 37268 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263518.1 protein_id gnl|my_center|LOCUS_16450 37281 38075 gene locus_tag LOCUS_16460 37281 38075 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263519.1 protein_id gnl|my_center|LOCUS_16460 38099 39361 gene locus_tag LOCUS_16470 gene rseP 38099 39361 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900647.1 protein_id gnl|my_center|LOCUS_16470 39392 41242 gene locus_tag LOCUS_16480 39392 41242 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263521.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence17 538 158 gene locus_tag LOCUS_16490 538 158 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936200.1 protein_id gnl|my_center|LOCUS_16490 2143 599 gene locus_tag LOCUS_16500 2143 599 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174832.1 protein_id gnl|my_center|LOCUS_16500 2943 2272 gene locus_tag LOCUS_16510 2943 2272 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836665.1 protein_id gnl|my_center|LOCUS_16510 4252 3005 gene locus_tag LOCUS_16520 4252 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263244.1 protein_id gnl|my_center|LOCUS_16520 5101 4265 gene locus_tag LOCUS_16530 5101 4265 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267360.1 protein_id gnl|my_center|LOCUS_16530 6575 5205 gene locus_tag LOCUS_16540 6575 5205 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777517.1 protein_id gnl|my_center|LOCUS_16540 7674 6628 gene locus_tag LOCUS_16550 7674 6628 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352219.1 protein_id gnl|my_center|LOCUS_16550 8323 7727 gene locus_tag LOCUS_16560 gene recR 8323 7727 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983939.1 protein_id gnl|my_center|LOCUS_16560 10411 8333 gene locus_tag LOCUS_16570 gene pbp2b 10411 8333 CDS product penicillin-binding protein PBP2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263251.1 protein_id gnl|my_center|LOCUS_16570 11221 10529 gene locus_tag LOCUS_16580 11221 10529 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240129.1 protein_id gnl|my_center|LOCUS_16580 11408 12343 gene locus_tag LOCUS_16590 11408 12343 CDS product dihydroorotate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263253.1 protein_id gnl|my_center|LOCUS_16590 12526 12374 gene locus_tag LOCUS_16600 12526 12374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 13023 12547 gene locus_tag LOCUS_16610 13023 12547 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263255.1 protein_id gnl|my_center|LOCUS_16610 13446 13171 gene locus_tag LOCUS_16620 13446 13171 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262099.1 protein_id gnl|my_center|LOCUS_16620 14142 13537 gene locus_tag LOCUS_16630 14142 13537 CDS product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262100.1 protein_id gnl|my_center|LOCUS_16630 14950 14114 gene locus_tag LOCUS_16640 14950 14114 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262101.1 protein_id gnl|my_center|LOCUS_16640 15782 14943 gene locus_tag LOCUS_16650 15782 14943 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262102.1 protein_id gnl|my_center|LOCUS_16650 17562 15895 gene locus_tag LOCUS_16660 gene recN 17562 15895 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262103.1 protein_id gnl|my_center|LOCUS_16660 18036 17578 gene locus_tag LOCUS_16670 18036 17578 CDS product ArgR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262104.1 protein_id gnl|my_center|LOCUS_16670 18850 18023 gene locus_tag LOCUS_16680 18850 18023 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262105.1 protein_id gnl|my_center|LOCUS_16680 19715 18843 gene locus_tag LOCUS_16690 19715 18843 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262106.1 protein_id gnl|my_center|LOCUS_16690 19931 19716 gene locus_tag LOCUS_16700 19931 19716 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262107.1 protein_id gnl|my_center|LOCUS_16700 21249 19906 gene locus_tag LOCUS_16710 gene xseA 21249 19906 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262108.1 protein_id gnl|my_center|LOCUS_16710 22356 21448 gene locus_tag LOCUS_16720 22356 21448 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905092.1 protein_id gnl|my_center|LOCUS_16720 22971 22438 gene locus_tag LOCUS_16730 22971 22438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 23729 22968 gene locus_tag LOCUS_16740 23729 22968 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794285.1 protein_id gnl|my_center|LOCUS_16740 24612 23755 gene locus_tag LOCUS_16750 24612 23755 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263020.1 protein_id gnl|my_center|LOCUS_16750 25397 24711 gene locus_tag LOCUS_16760 25397 24711 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355190.1 protein_id gnl|my_center|LOCUS_16760 25553 27298 gene locus_tag LOCUS_16770 gene lytS 25553 27298 CDS product two-component system sensor histidine kinase LytS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262109.1 protein_id gnl|my_center|LOCUS_16770 27279 28013 gene locus_tag LOCUS_16780 gene lytR 27279 28013 CDS product two-component system response regulator LytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262110.1 protein_id gnl|my_center|LOCUS_16780 28178 28645 gene locus_tag LOCUS_16790 gene lrgA 28178 28645 CDS product holin-like protein LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262111.1 protein_id gnl|my_center|LOCUS_16790 28647 29378 gene locus_tag LOCUS_16800 gene lrgB 28647 29378 CDS product antiholin-like protein LrgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263784.1 protein_id gnl|my_center|LOCUS_16800 30284 29430 gene locus_tag LOCUS_16810 30284 29430 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263560.1 protein_id gnl|my_center|LOCUS_16810 31059 30286 gene locus_tag LOCUS_16820 31059 30286 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902604.1 protein_id gnl|my_center|LOCUS_16820 31910 31056 gene locus_tag LOCUS_16830 31910 31056 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137498.1 protein_id gnl|my_center|LOCUS_16830 33207 32074 gene locus_tag LOCUS_16840 33207 32074 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905403.1 protein_id gnl|my_center|LOCUS_16840 33489 33259 gene locus_tag LOCUS_16850 33489 33259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 33734 33504 gene locus_tag LOCUS_16860 33734 33504 CDS product ASCH/PUA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002268342.1 protein_id gnl|my_center|LOCUS_16860 34549 34001 gene locus_tag LOCUS_16870 34549 34001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 34829 34542 gene locus_tag LOCUS_16880 34829 34542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994584.1 protein_id gnl|my_center|LOCUS_16880 35287 34829 gene locus_tag LOCUS_16890 35287 34829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 36194 35277 gene locus_tag LOCUS_16900 36194 35277 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence18 1018 668 gene locus_tag LOCUS_16910 1018 668 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921253.1 protein_id gnl|my_center|LOCUS_16910 1394 1122 gene locus_tag LOCUS_16920 gene sprV 1394 1122 CDS product transcriptional regulator SprV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262439.1 protein_id gnl|my_center|LOCUS_16920 2774 1410 gene locus_tag LOCUS_16930 gene dnaB 2774 1410 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262440.1 protein_id gnl|my_center|LOCUS_16930 3257 2805 gene locus_tag LOCUS_16940 gene rplI 3257 2805 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991410.1 protein_id gnl|my_center|LOCUS_16940 5229 3259 gene locus_tag LOCUS_16950 5229 3259 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819771.1 protein_id gnl|my_center|LOCUS_16950 7218 5323 gene locus_tag LOCUS_16960 gene mnmG 7218 5323 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922789.1 protein_id gnl|my_center|LOCUS_16960 7682 7221 gene locus_tag LOCUS_16970 7682 7221 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775411.1 protein_id gnl|my_center|LOCUS_16970 8445 7834 gene locus_tag LOCUS_16980 8445 7834 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623752.1 protein_id gnl|my_center|LOCUS_16980 9606 8485 gene locus_tag LOCUS_16990 gene mnmA 9606 8485 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282936.1 protein_id gnl|my_center|LOCUS_16990 10500 9847 gene locus_tag LOCUS_17000 gene phoU 10500 9847 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245781.1 protein_id gnl|my_center|LOCUS_17000 11276 10524 gene locus_tag LOCUS_17010 gene pstB 11276 10524 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536449.1 protein_id gnl|my_center|LOCUS_17010 12095 11280 gene locus_tag LOCUS_17020 gene pstA 12095 11280 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049767.1 protein_id gnl|my_center|LOCUS_17020 12948 12088 gene locus_tag LOCUS_17030 gene pstC 12948 12088 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595180.1 protein_id gnl|my_center|LOCUS_17030 13897 13025 gene locus_tag LOCUS_17040 13897 13025 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669493.1 protein_id gnl|my_center|LOCUS_17040 14901 14038 gene locus_tag LOCUS_17050 14901 14038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 15384 15130 gene locus_tag LOCUS_17060 15384 15130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 16076 15387 gene locus_tag LOCUS_17070 16076 15387 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166475.1 protein_id gnl|my_center|LOCUS_17070 16200 16799 gene locus_tag LOCUS_17080 16200 16799 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906104.1 protein_id gnl|my_center|LOCUS_17080 17451 16834 gene locus_tag LOCUS_17090 17451 16834 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262446.1 protein_id gnl|my_center|LOCUS_17090 18416 17625 gene locus_tag LOCUS_17100 18416 17625 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262447.1 protein_id gnl|my_center|LOCUS_17100 19334 18540 gene locus_tag LOCUS_17110 19334 18540 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262448.1 protein_id gnl|my_center|LOCUS_17110 20169 19327 gene locus_tag LOCUS_17120 20169 19327 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262449.1 protein_id gnl|my_center|LOCUS_17120 20987 20145 gene locus_tag LOCUS_17130 20987 20145 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262450.1 protein_id gnl|my_center|LOCUS_17130 21529 20987 gene locus_tag LOCUS_17140 gene pgsA 21529 20987 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262451.1 protein_id gnl|my_center|LOCUS_17140 22589 21540 gene locus_tag LOCUS_17150 22589 21540 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262452.1 protein_id gnl|my_center|LOCUS_17150 23938 22655 gene locus_tag LOCUS_17160 23938 22655 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352377.1 protein_id gnl|my_center|LOCUS_17160 25189 23942 gene locus_tag LOCUS_17170 25189 23942 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262454.1 protein_id gnl|my_center|LOCUS_17170 25269 25640 gene locus_tag LOCUS_17180 gene yaaA 25269 25640 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262455.1 protein_id gnl|my_center|LOCUS_17180 25643 26731 gene locus_tag LOCUS_17190 gene recF 25643 26731 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262456.1 protein_id gnl|my_center|LOCUS_17190 28354 26873 gene locus_tag LOCUS_17200 gene guaB 28354 26873 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262457.1 protein_id gnl|my_center|LOCUS_17200 29519 28497 gene locus_tag LOCUS_17210 gene trpS 29519 28497 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262458.1 protein_id gnl|my_center|LOCUS_17210 29630 30502 gene locus_tag LOCUS_17220 29630 30502 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775460.1 protein_id gnl|my_center|LOCUS_17220 30574 32193 gene locus_tag LOCUS_17230 30574 32193 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899531.1 protein_id gnl|my_center|LOCUS_17230 32244 34877 gene locus_tag LOCUS_17240 32244 34877 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074696.1 protein_id gnl|my_center|LOCUS_17240 34917 34842 gene locus_tag LOCUS_t00100 34917 34842 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 34994 34921 gene locus_tag LOCUS_t00110 34994 34921 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence19 1233 682 gene locus_tag LOCUS_17250 gene raiA 1233 682 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599094.1 protein_id gnl|my_center|LOCUS_17250 1972 1310 gene locus_tag LOCUS_17260 1972 1310 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263025.1 protein_id gnl|my_center|LOCUS_17260 3180 1972 gene locus_tag LOCUS_17270 3180 1972 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263026.1 protein_id gnl|my_center|LOCUS_17270 3289 3966 gene locus_tag LOCUS_17280 3289 3966 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263027.1 protein_id gnl|my_center|LOCUS_17280 4214 4011 gene locus_tag LOCUS_17290 4214 4011 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129735.1 protein_id gnl|my_center|LOCUS_17290 4444 5370 gene locus_tag LOCUS_17300 gene cysK 4444 5370 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263028.1 protein_id gnl|my_center|LOCUS_17300 5790 5434 gene locus_tag LOCUS_17310 5790 5434 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263034.1 protein_id gnl|my_center|LOCUS_17310 7187 5790 gene locus_tag LOCUS_17320 7187 5790 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263035.1 protein_id gnl|my_center|LOCUS_17320 7863 7222 gene locus_tag LOCUS_17330 7863 7222 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263036.1 protein_id gnl|my_center|LOCUS_17330 8860 7856 gene locus_tag LOCUS_17340 8860 7856 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263037.1 protein_id gnl|my_center|LOCUS_17340 9555 8857 gene locus_tag LOCUS_17350 gene liaF 9555 8857 CDS product cell wall-active antibiotics response protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263038.1 protein_id gnl|my_center|LOCUS_17350 11492 9660 gene locus_tag LOCUS_17360 gene pknB 11492 9660 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263039.1 protein_id gnl|my_center|LOCUS_17360 12250 11489 gene locus_tag LOCUS_17370 12250 11489 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263040.1 protein_id gnl|my_center|LOCUS_17370 13552 12272 gene locus_tag LOCUS_17380 gene rsmB 13552 12272 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263885.1 protein_id gnl|my_center|LOCUS_17380 14525 13590 gene locus_tag LOCUS_17390 gene fmt 14525 13590 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837405.1 protein_id gnl|my_center|LOCUS_17390 16970 14586 gene locus_tag LOCUS_17400 16970 14586 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263043.1 protein_id gnl|my_center|LOCUS_17400 17327 17010 gene locus_tag LOCUS_17410 17327 17010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 17975 17349 gene locus_tag LOCUS_17420 gene gmk 17975 17349 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922542.1 protein_id gnl|my_center|LOCUS_17420 19651 18044 gene locus_tag LOCUS_17430 19651 18044 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263046.1 protein_id gnl|my_center|LOCUS_17430 19794 20276 gene locus_tag LOCUS_17440 19794 20276 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905191.1 protein_id gnl|my_center|LOCUS_17440 21888 20350 gene locus_tag LOCUS_17450 21888 20350 CDS product cell division site-positioning protein MapZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263048.1 protein_id gnl|my_center|LOCUS_17450 23053 21902 gene locus_tag LOCUS_17460 23053 21902 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664849.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence20 862 482 gene locus_tag LOCUS_17470 862 482 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261952.1 protein_id gnl|my_center|LOCUS_17470 2118 877 gene locus_tag LOCUS_17480 2118 877 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244040.1 protein_id gnl|my_center|LOCUS_17480 2269 2403 gene locus_tag LOCUS_17490 2269 2403 CDS product DUF4044 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261953.1 protein_id gnl|my_center|LOCUS_17490 2457 3770 gene locus_tag LOCUS_17500 gene obgE 2457 3770 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922805.1 protein_id gnl|my_center|LOCUS_17500 4046 4222 gene locus_tag LOCUS_17510 4046 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 5767 4262 gene locus_tag LOCUS_17520 5767 4262 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261956.1 protein_id gnl|my_center|LOCUS_17520 5941 5795 gene locus_tag LOCUS_17530 5941 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 7004 6264 gene locus_tag LOCUS_17540 7004 6264 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984187.1 protein_id gnl|my_center|LOCUS_17540 9154 7004 gene locus_tag LOCUS_17550 9154 7004 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352242.1 protein_id gnl|my_center|LOCUS_17550 9316 11307 gene locus_tag LOCUS_17560 gene uvrB 9316 11307 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261961.1 protein_id gnl|my_center|LOCUS_17560 11397 11675 gene locus_tag LOCUS_17570 11397 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 11721 12308 gene locus_tag LOCUS_17580 11721 12308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 13418 12402 gene locus_tag LOCUS_17590 13418 12402 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262915.1 protein_id gnl|my_center|LOCUS_17590 13683 14729 gene locus_tag LOCUS_17600 13683 14729 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101497.1 protein_id gnl|my_center|LOCUS_17600 14874 15674 gene locus_tag LOCUS_17610 14874 15674 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261966.1 protein_id gnl|my_center|LOCUS_17610 15789 16943 gene locus_tag LOCUS_17620 15789 16943 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261967.1 protein_id gnl|my_center|LOCUS_17620 16976 17791 gene locus_tag LOCUS_17630 16976 17791 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261968.1 protein_id gnl|my_center|LOCUS_17630 18071 20548 gene locus_tag LOCUS_17640 18071 20548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 20674 20850 gene locus_tag LOCUS_17650 20674 20850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence21 260 646 gene locus_tag LOCUS_17660 260 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17660 916 1077 gene locus_tag LOCUS_17670 916 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 1007 1570 gene locus_tag LOCUS_17680 1007 1570 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_17680 1695 3470 gene locus_tag LOCUS_17690 1695 3470 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_17690 5122 3581 gene locus_tag LOCUS_17700 5122 3581 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025410.1 protein_id gnl|my_center|LOCUS_17700 6094 5264 gene locus_tag LOCUS_17710 6094 5264 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261950.1 protein_id gnl|my_center|LOCUS_17710 6542 6129 gene locus_tag LOCUS_17720 6542 6129 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264782.1 protein_id gnl|my_center|LOCUS_17720 7098 6598 gene locus_tag LOCUS_17730 7098 6598 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074563.1 protein_id gnl|my_center|LOCUS_17730 7497 8015 gene locus_tag LOCUS_17740 7497 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17740 8889 8290 gene locus_tag LOCUS_17750 8889 8290 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775494.1 protein_id gnl|my_center|LOCUS_17750 9861 9025 gene locus_tag LOCUS_17760 9861 9025 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921898.1 protein_id gnl|my_center|LOCUS_17760 10874 9870 gene locus_tag LOCUS_17770 10874 9870 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921897.1 protein_id gnl|my_center|LOCUS_17770 11380 10949 gene locus_tag LOCUS_17780 11380 10949 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774961.1 protein_id gnl|my_center|LOCUS_17780 11742 12116 gene locus_tag LOCUS_17790 11742 12116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193116.1 protein_id gnl|my_center|LOCUS_17790 13233 12295 gene locus_tag LOCUS_17800 13233 12295 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116069.1 protein_id gnl|my_center|LOCUS_17800 13605 13303 gene locus_tag LOCUS_17810 13605 13303 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641695.1 protein_id gnl|my_center|LOCUS_17810 14423 13782 gene locus_tag LOCUS_17820 14423 13782 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064094285.1 protein_id gnl|my_center|LOCUS_17820 15518 14712 gene locus_tag LOCUS_17830 15518 14712 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641543.1 protein_id gnl|my_center|LOCUS_17830 16069 15626 gene locus_tag LOCUS_17840 16069 15626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 16653 16108 gene locus_tag LOCUS_17850 16653 16108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 16990 16715 gene locus_tag LOCUS_17860 16990 16715 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809352.1 protein_id gnl|my_center|LOCUS_17860 17330 17067 gene locus_tag LOCUS_17870 17330 17067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 17959 17789 gene locus_tag LOCUS_17880 17959 17789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 18468 18043 gene locus_tag LOCUS_17890 18468 18043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 19075 18563 gene locus_tag LOCUS_17900 19075 18563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence22 1357 113 gene locus_tag LOCUS_17910 1357 113 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263860.1 protein_id gnl|my_center|LOCUS_17910 2087 1374 gene locus_tag LOCUS_17920 2087 1374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262011.1 protein_id gnl|my_center|LOCUS_17920 3296 2094 gene locus_tag LOCUS_17930 3296 2094 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044620.1 protein_id gnl|my_center|LOCUS_17930 6664 3485 gene locus_tag LOCUS_17940 gene carB 6664 3485 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262009.1 protein_id gnl|my_center|LOCUS_17940 7834 6755 gene locus_tag LOCUS_17950 7834 6755 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262008.1 protein_id gnl|my_center|LOCUS_17950 8804 7878 gene locus_tag LOCUS_17960 8804 7878 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262007.1 protein_id gnl|my_center|LOCUS_17960 10076 8814 gene locus_tag LOCUS_17970 10076 8814 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990245.1 protein_id gnl|my_center|LOCUS_17970 10613 10092 gene locus_tag LOCUS_17980 gene pyrR 10613 10092 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823056.1 protein_id gnl|my_center|LOCUS_17980 12365 10893 gene locus_tag LOCUS_17990 12365 10893 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043255.1 protein_id gnl|my_center|LOCUS_17990 12796 12551 gene locus_tag LOCUS_18000 12796 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 13502 12912 gene locus_tag LOCUS_18010 13502 12912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 15160 13508 gene locus_tag LOCUS_18020 15160 13508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 15713 15162 gene locus_tag LOCUS_18030 15713 15162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 16066 15797 gene locus_tag LOCUS_18040 16066 15797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 16612 16442 gene locus_tag LOCUS_18050 16612 16442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 17195 16800 gene locus_tag LOCUS_18060 17195 16800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 17679 17368 gene locus_tag LOCUS_18070 17679 17368 CDS product DUF4176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447709.1 protein_id gnl|my_center|LOCUS_18070 18361 17708 gene locus_tag LOCUS_18080 18361 17708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 <19569 18372 gene locus_tag LOCUS_18090 <19569 18372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000020814.1:T7SS effector LXG polymorphic toxin >Feature sequence23 2101 131 gene locus_tag LOCUS_18100 gene ftsH 2101 131 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310748.1 protein_id gnl|my_center|LOCUS_18100 2665 2123 gene locus_tag LOCUS_18110 gene hpt 2665 2123 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892188.1 protein_id gnl|my_center|LOCUS_18110 3840 2668 gene locus_tag LOCUS_18120 gene tilS 3840 2668 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262638.1 protein_id gnl|my_center|LOCUS_18120 5219 3933 gene locus_tag LOCUS_18130 5219 3933 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264627.1 protein_id gnl|my_center|LOCUS_18130 5711 5340 gene locus_tag LOCUS_18140 5711 5340 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262641.1 protein_id gnl|my_center|LOCUS_18140 5970 5698 gene locus_tag LOCUS_18150 5970 5698 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234967.1 protein_id gnl|my_center|LOCUS_18150 9591 6088 gene locus_tag LOCUS_18160 gene mfd 9591 6088 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002273921.1 protein_id gnl|my_center|LOCUS_18160 10153 9584 gene locus_tag LOCUS_18170 gene pth 10153 9584 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262644.1 protein_id gnl|my_center|LOCUS_18170 11334 10219 gene locus_tag LOCUS_18180 gene ychF 11334 10219 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218707.1 protein_id gnl|my_center|LOCUS_18180 11951 11427 gene locus_tag LOCUS_18190 11951 11427 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902024.1 protein_id gnl|my_center|LOCUS_18190 12237 12046 gene locus_tag LOCUS_18200 12237 12046 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262646.1 protein_id gnl|my_center|LOCUS_18200 13436 12300 gene locus_tag LOCUS_18210 gene dnaN 13436 12300 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262647.1 protein_id gnl|my_center|LOCUS_18210 14944 13589 gene locus_tag LOCUS_18220 gene dnaA 14944 13589 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262648.1 protein_id gnl|my_center|LOCUS_18220 15916 15146 gene locus_tag LOCUS_18230 15916 15146 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074697.1 protein_id gnl|my_center|LOCUS_18230 17187 15988 gene locus_tag LOCUS_18240 17187 15988 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262650.1 protein_id gnl|my_center|LOCUS_18240 17372 17851 gene locus_tag LOCUS_18250 gene rlmH 17372 17851 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837730.1 protein_id gnl|my_center|LOCUS_18250 17860 18534 gene locus_tag LOCUS_18260 17860 18534 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263399.1 protein_id gnl|my_center|LOCUS_18260 18547 19242 gene locus_tag LOCUS_18270 18547 19242 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262652.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence24 335 454 gene locus_tag LOCUS_18280 335 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 501 1211 gene locus_tag LOCUS_18290 501 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 1364 2074 gene locus_tag LOCUS_18300 1364 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 2064 3326 gene locus_tag LOCUS_18310 2064 3326 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653707.1 protein_id gnl|my_center|LOCUS_18310 3308 3730 gene locus_tag LOCUS_18320 3308 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 3732 4022 gene locus_tag LOCUS_18330 3732 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 4265 4579 gene locus_tag LOCUS_18340 4265 4579 CDS product PTS cellobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262789.1 protein_id gnl|my_center|LOCUS_18340 4639 4971 gene locus_tag LOCUS_18350 4639 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 6092 5256 gene locus_tag LOCUS_18360 6092 5256 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262870.1 protein_id gnl|my_center|LOCUS_18360 6199 8361 gene locus_tag LOCUS_18370 6199 8361 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262871.1 protein_id gnl|my_center|LOCUS_18370 8374 9636 gene locus_tag LOCUS_18380 gene msmE 8374 9636 CDS product sugar-binding protein MsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262872.1 protein_id gnl|my_center|LOCUS_18380 9649 10521 gene locus_tag LOCUS_18390 9649 10521 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262873.1 protein_id gnl|my_center|LOCUS_18390 10536 11369 gene locus_tag LOCUS_18400 10536 11369 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262874.1 protein_id gnl|my_center|LOCUS_18400 11531 12976 gene locus_tag LOCUS_18410 gene gtfA 11531 12976 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262875.1 protein_id gnl|my_center|LOCUS_18410 12992 14125 gene locus_tag LOCUS_18420 gene ugpC 12992 14125 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262876.1 protein_id gnl|my_center|LOCUS_18420 14194 15804 gene locus_tag LOCUS_18430 gene dexB 14194 15804 CDS product glucan 1,6-alpha-glucosidase DexB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262877.1 protein_id gnl|my_center|LOCUS_18430 17050 16052 gene locus_tag LOCUS_18440 17050 16052 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289652.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence25 221 730 gene locus_tag LOCUS_18450 gene msrA 221 730 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262768.1 protein_id gnl|my_center|LOCUS_18450 727 942 gene locus_tag LOCUS_18460 727 942 CDS product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985757.1 protein_id gnl|my_center|LOCUS_18460 1007 1966 gene locus_tag LOCUS_18470 1007 1966 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262770.1 protein_id gnl|my_center|LOCUS_18470 2108 2602 gene locus_tag LOCUS_18480 gene ybeY 2108 2602 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262771.1 protein_id gnl|my_center|LOCUS_18480 2586 2987 gene locus_tag LOCUS_18490 gene dagK 2586 2987 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262772.1 protein_id gnl|my_center|LOCUS_18490 3003 3902 gene locus_tag LOCUS_18500 gene era 3003 3902 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935752.1 protein_id gnl|my_center|LOCUS_18500 3954 4745 gene locus_tag LOCUS_18510 3954 4745 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461573.1 protein_id gnl|my_center|LOCUS_18510 4920 5741 gene locus_tag LOCUS_18520 gene mutM 4920 5741 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262776.1 protein_id gnl|my_center|LOCUS_18520 5738 6343 gene locus_tag LOCUS_18530 gene coaE 5738 6343 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837244.1 protein_id gnl|my_center|LOCUS_18530 6340 7812 gene locus_tag LOCUS_18540 6340 7812 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921977.1 protein_id gnl|my_center|LOCUS_18540 8311 8547 gene locus_tag LOCUS_18550 8311 8547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 8604 10946 gene locus_tag LOCUS_18560 gene rnr 8604 10946 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262782.1 protein_id gnl|my_center|LOCUS_18560 10909 11376 gene locus_tag LOCUS_18570 gene smpB 10909 11376 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238456.1 protein_id gnl|my_center|LOCUS_18570 12143 11481 gene locus_tag LOCUS_18580 12143 11481 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262787.1 protein_id gnl|my_center|LOCUS_18580 12344 13789 gene locus_tag LOCUS_18590 12344 13789 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262788.1 protein_id gnl|my_center|LOCUS_18590 13958 14272 gene locus_tag LOCUS_18600 13958 14272 CDS product PTS cellobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262789.1 protein_id gnl|my_center|LOCUS_18600 14332 14664 gene locus_tag LOCUS_18610 14332 14664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 14964 15620 gene locus_tag LOCUS_18620 14964 15620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 >Feature sequence26 161 1273 gene locus_tag LOCUS_18630 161 1273 CDS product vitamin B12 independent methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129660.1 protein_id gnl|my_center|LOCUS_18630 1612 2520 gene locus_tag LOCUS_18640 1612 2520 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263400.1 protein_id gnl|my_center|LOCUS_18640 2733 2912 gene locus_tag LOCUS_18650 2733 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 2954 3952 gene locus_tag LOCUS_18660 gene ruvB 2954 3952 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002271311.1 protein_id gnl|my_center|LOCUS_18660 4217 4654 gene locus_tag LOCUS_18670 4217 4654 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263403.1 protein_id gnl|my_center|LOCUS_18670 4698 5093 gene locus_tag LOCUS_18680 4698 5093 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074470.1 protein_id gnl|my_center|LOCUS_18680 5090 6874 gene locus_tag LOCUS_18690 5090 6874 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310757.1 protein_id gnl|my_center|LOCUS_18690 7070 9718 gene locus_tag LOCUS_18700 gene adhE 7070 9718 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763967.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence27 1294 74 gene locus_tag LOCUS_18710 1294 74 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836593.1 protein_id gnl|my_center|LOCUS_18710 1452 1904 gene locus_tag LOCUS_18720 1452 1904 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263469.1 protein_id gnl|my_center|LOCUS_18720 3316 1931 gene locus_tag LOCUS_18730 3316 1931 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074671.1 protein_id gnl|my_center|LOCUS_18730 3432 4349 gene locus_tag LOCUS_18740 3432 4349 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263467.1 protein_id gnl|my_center|LOCUS_18740 4764 4474 gene locus_tag LOCUS_18750 4764 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 5188 4766 gene locus_tag LOCUS_18760 5188 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 6429 5170 gene locus_tag LOCUS_18770 6429 5170 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653707.1 protein_id gnl|my_center|LOCUS_18770 7129 6419 gene locus_tag LOCUS_18780 7129 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 >Feature sequence28 1977 427 gene locus_tag LOCUS_18790 1977 427 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263748.1 protein_id gnl|my_center|LOCUS_18790 <5300 2164 gene locus_tag LOCUS_18800 <5300 2164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002352221.1:cell surface antigen I/II