>Feature sequence001 1364 894 gene locus_tag LOCUS_00010 gene ilvN 1364 894 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_00010 1479 1403 gene locus_tag LOCUS_t00010 1479 1403 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2480 1575 gene locus_tag LOCUS_00020 2480 1575 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940307.1 protein_id gnl|my_center|LOCUS_00020 2614 3165 gene locus_tag LOCUS_00030 2614 3165 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_00030 5244 3448 gene locus_tag LOCUS_00040 5244 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7296 5410 gene locus_tag LOCUS_00050 7296 5410 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_00050 11102 7398 gene locus_tag LOCUS_00060 11102 7398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 11279 12340 gene locus_tag LOCUS_00070 11279 12340 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_00070 12416 12910 gene locus_tag LOCUS_00080 12416 12910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 13000 13326 gene locus_tag LOCUS_00090 13000 13326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 14735 13362 gene locus_tag LOCUS_00100 14735 13362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 17043 14815 gene locus_tag LOCUS_00110 17043 14815 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083633.1 protein_id gnl|my_center|LOCUS_00110 17178 17516 gene locus_tag LOCUS_00120 17178 17516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 17523 17906 gene locus_tag LOCUS_00130 17523 17906 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036026449.1 protein_id gnl|my_center|LOCUS_00130 18080 19162 gene locus_tag LOCUS_00140 gene recA 18080 19162 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_00140 19644 19204 gene locus_tag LOCUS_00150 19644 19204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19595 20098 gene locus_tag LOCUS_00160 19595 20098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21562 20177 gene locus_tag LOCUS_00170 gene astB 21562 20177 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192611.1 protein_id gnl|my_center|LOCUS_00170 23012 21612 gene locus_tag LOCUS_00180 gene astD 23012 21612 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418134.1 protein_id gnl|my_center|LOCUS_00180 24060 23059 gene locus_tag LOCUS_00190 24060 23059 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947433.1 protein_id gnl|my_center|LOCUS_00190 25307 24126 gene locus_tag LOCUS_00200 25307 24126 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947432.1 protein_id gnl|my_center|LOCUS_00200 28476 25492 gene locus_tag LOCUS_00210 28476 25492 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275340.1 protein_id gnl|my_center|LOCUS_00210 28566 29816 gene locus_tag LOCUS_00220 28566 29816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 30842 29817 gene locus_tag LOCUS_00230 30842 29817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 31006 32601 gene locus_tag LOCUS_00240 31006 32601 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_00240 32618 33841 gene locus_tag LOCUS_00250 32618 33841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 34930 33854 gene locus_tag LOCUS_00260 34930 33854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 35988 34927 gene locus_tag LOCUS_00270 35988 34927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 36778 36032 gene locus_tag LOCUS_00280 36778 36032 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144228759.1 protein_id gnl|my_center|LOCUS_00280 37696 36863 gene locus_tag LOCUS_00290 37696 36863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 38903 37788 gene locus_tag LOCUS_00300 38903 37788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 39899 39108 gene locus_tag LOCUS_00310 39899 39108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 41139 39925 gene locus_tag LOCUS_00320 41139 39925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 43822 41201 gene locus_tag LOCUS_00330 43822 41201 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390312.1 protein_id gnl|my_center|LOCUS_00330 >Feature sequence002 <1 1044 gene locus_tag LOCUS_00340 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223782.1:LacI family DNA-binding transcriptional regulator 1127 2473 gene locus_tag LOCUS_00350 gene xylA 1127 2473 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118969.1 protein_id gnl|my_center|LOCUS_00350 2699 6802 gene locus_tag LOCUS_00360 2699 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 8455 6950 gene locus_tag LOCUS_00370 8455 6950 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_00370 9113 8514 gene locus_tag LOCUS_00380 9113 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 9191 10267 gene locus_tag LOCUS_00390 9191 10267 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_00390 10288 11070 gene locus_tag LOCUS_00400 gene radC 10288 11070 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298959.1 protein_id gnl|my_center|LOCUS_00400 11135 11220 gene locus_tag LOCUS_t00020 11135 11220 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 12127 11267 gene locus_tag LOCUS_00410 12127 11267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120857.1 protein_id gnl|my_center|LOCUS_00410 13102 12479 gene locus_tag LOCUS_00420 gene clpP 13102 12479 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545892.1 protein_id gnl|my_center|LOCUS_00420 14595 13249 gene locus_tag LOCUS_00430 gene tig 14595 13249 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093116.1 protein_id gnl|my_center|LOCUS_00430 14704 15396 gene locus_tag LOCUS_00440 14704 15396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 15393 16544 gene locus_tag LOCUS_00450 gene alr 15393 16544 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_00450 17706 16585 gene locus_tag LOCUS_00460 17706 16585 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_00460 18454 17870 gene locus_tag LOCUS_00470 18454 17870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 19575 18451 gene locus_tag LOCUS_00480 19575 18451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 20768 19575 gene locus_tag LOCUS_00490 20768 19575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 21438 20770 gene locus_tag LOCUS_00500 21438 20770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 21905 21435 gene locus_tag LOCUS_00510 21905 21435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 22420 21902 gene locus_tag LOCUS_00520 22420 21902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 22863 22417 gene locus_tag LOCUS_00530 gene gspG 22863 22417 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465191.1 protein_id gnl|my_center|LOCUS_00530 23507 22902 gene locus_tag LOCUS_00540 23507 22902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 24522 23527 gene locus_tag LOCUS_00550 24522 23527 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_00550 24521 25198 gene locus_tag LOCUS_00560 24521 25198 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035528.1 protein_id gnl|my_center|LOCUS_00560 26282 25203 gene locus_tag LOCUS_00570 26282 25203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 26281 27084 gene locus_tag LOCUS_00580 26281 27084 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624136.1 protein_id gnl|my_center|LOCUS_00580 29271 27115 gene locus_tag LOCUS_00590 29271 27115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 29955 29362 gene locus_tag LOCUS_00600 29955 29362 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185660149.1 protein_id gnl|my_center|LOCUS_00600 31106 29964 gene locus_tag LOCUS_00610 31106 29964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 31981 31475 gene locus_tag LOCUS_00620 31981 31475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 32100 32639 gene locus_tag LOCUS_00630 gene sufT 32100 32639 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_00630 35547 32740 gene locus_tag LOCUS_00640 35547 32740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 36157 35552 gene locus_tag LOCUS_00650 36157 35552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 38118 36154 gene locus_tag LOCUS_00660 38118 36154 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_00660 >Feature sequence003 1610 807 gene locus_tag LOCUS_00670 1610 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 2688 1909 gene locus_tag LOCUS_00680 2688 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 2834 3247 gene locus_tag LOCUS_00690 2834 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 4116 3262 gene locus_tag LOCUS_00700 4116 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 5861 4113 gene locus_tag LOCUS_00710 5861 4113 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460552.1 protein_id gnl|my_center|LOCUS_00710 6682 5867 gene locus_tag LOCUS_00720 6682 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 7540 6824 gene locus_tag LOCUS_00730 7540 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 8478 7585 gene locus_tag LOCUS_00740 8478 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 9204 8488 gene locus_tag LOCUS_00750 9204 8488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 10679 9219 gene locus_tag LOCUS_00760 10679 9219 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_00760 12160 10676 gene locus_tag LOCUS_00770 12160 10676 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030742.1 protein_id gnl|my_center|LOCUS_00770 13695 12157 gene locus_tag LOCUS_00780 13695 12157 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296611.1 protein_id gnl|my_center|LOCUS_00780 13856 13692 gene locus_tag LOCUS_00790 13856 13692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 13976 14407 gene locus_tag LOCUS_00800 13976 14407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 14421 15860 gene locus_tag LOCUS_00810 14421 15860 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296611.1 protein_id gnl|my_center|LOCUS_00810 16055 18574 gene locus_tag LOCUS_00820 16055 18574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 18729 19253 gene locus_tag LOCUS_00830 18729 19253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 19316 19849 gene locus_tag LOCUS_00840 19316 19849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 20615 19887 gene locus_tag LOCUS_00850 20615 19887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 20966 21901 gene locus_tag LOCUS_00860 20966 21901 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061538724.1 protein_id gnl|my_center|LOCUS_00860 21931 23013 gene locus_tag LOCUS_00870 21931 23013 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082923.1 protein_id gnl|my_center|LOCUS_00870 23052 24365 gene locus_tag LOCUS_00880 23052 24365 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_00880 25840 24407 gene locus_tag LOCUS_00890 25840 24407 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384821.1 protein_id gnl|my_center|LOCUS_00890 26665 25868 gene locus_tag LOCUS_00900 26665 25868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 26951 27475 gene locus_tag LOCUS_00910 26951 27475 CDS product DUF2165 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947981.1 protein_id gnl|my_center|LOCUS_00910 27529 28899 gene locus_tag LOCUS_00920 27529 28899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 29712 28924 gene locus_tag LOCUS_00930 29712 28924 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389333.1 protein_id gnl|my_center|LOCUS_00930 30523 29732 gene locus_tag LOCUS_00940 30523 29732 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384594.1 protein_id gnl|my_center|LOCUS_00940 32211 30520 gene locus_tag LOCUS_00950 32211 30520 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025269720.1 protein_id gnl|my_center|LOCUS_00950 33641 32211 gene locus_tag LOCUS_00960 33641 32211 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_00960 33767 34435 gene locus_tag LOCUS_00970 33767 34435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 34450 35232 gene locus_tag LOCUS_00980 34450 35232 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 protein_id gnl|my_center|LOCUS_00980 35376 35963 gene locus_tag LOCUS_00990 35376 35963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706253.1 protein_id gnl|my_center|LOCUS_00990 >Feature sequence004 2233 3975 gene locus_tag LOCUS_01000 2233 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 4021 6363 gene locus_tag LOCUS_01010 4021 6363 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_01010 6408 7799 gene locus_tag LOCUS_01020 6408 7799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 7995 9368 gene locus_tag LOCUS_01030 7995 9368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 9414 10802 gene locus_tag LOCUS_01040 9414 10802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 12835 11270 gene locus_tag LOCUS_01050 12835 11270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 13102 15093 gene locus_tag LOCUS_01060 13102 15093 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767036.1 protein_id gnl|my_center|LOCUS_01060 15184 16599 gene locus_tag LOCUS_01070 15184 16599 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_01070 16607 18340 gene locus_tag LOCUS_01080 16607 18340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 18397 19812 gene locus_tag LOCUS_01090 18397 19812 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225147.1 protein_id gnl|my_center|LOCUS_01090 20104 28182 gene locus_tag LOCUS_01100 20104 28182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 28837 33870 gene locus_tag LOCUS_01110 28837 33870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 33919 34566 gene locus_tag LOCUS_01120 33919 34566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 >Feature sequence005 1872 295 gene locus_tag LOCUS_01130 1872 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 4391 2169 gene locus_tag LOCUS_01140 gene katG 4391 2169 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400805.1 protein_id gnl|my_center|LOCUS_01140 4588 5475 gene locus_tag LOCUS_01150 4588 5475 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225080.1 protein_id gnl|my_center|LOCUS_01150 5611 7461 gene locus_tag LOCUS_01160 5611 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 8033 7494 gene locus_tag LOCUS_01170 8033 7494 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485846.1 protein_id gnl|my_center|LOCUS_01170 8032 8538 gene locus_tag LOCUS_01180 8032 8538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 8552 9175 gene locus_tag LOCUS_01190 8552 9175 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927004.1 protein_id gnl|my_center|LOCUS_01190 9235 9612 gene locus_tag LOCUS_01200 9235 9612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 10859 9801 gene locus_tag LOCUS_01210 10859 9801 CDS product NUP-family purine nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265508.1 protein_id gnl|my_center|LOCUS_01210 11862 10933 gene locus_tag LOCUS_01220 11862 10933 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_01220 12363 12031 gene locus_tag LOCUS_01230 12363 12031 CDS product high-potential iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197194.1 protein_id gnl|my_center|LOCUS_01230 13112 12450 gene locus_tag LOCUS_01240 13112 12450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 14444 13269 gene locus_tag LOCUS_01250 gene tgt 14444 13269 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_01250 14331 15488 gene locus_tag LOCUS_01260 14331 15488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 15544 16332 gene locus_tag LOCUS_01270 15544 16332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 16329 17300 gene locus_tag LOCUS_01280 gene prmB 16329 17300 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192731.1 protein_id gnl|my_center|LOCUS_01280 18491 17313 gene locus_tag LOCUS_01290 18491 17313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 19108 18629 gene locus_tag LOCUS_01300 gene mlaD 19108 18629 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938540.1 protein_id gnl|my_center|LOCUS_01300 19989 19141 gene locus_tag LOCUS_01310 19989 19141 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921523.1 protein_id gnl|my_center|LOCUS_01310 20776 20000 gene locus_tag LOCUS_01320 20776 20000 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938542.1 protein_id gnl|my_center|LOCUS_01320 20928 21461 gene locus_tag LOCUS_01330 gene rsmD 20928 21461 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037534.1 protein_id gnl|my_center|LOCUS_01330 22531 21458 gene locus_tag LOCUS_01340 22531 21458 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466931.1 protein_id gnl|my_center|LOCUS_01340 23986 22616 gene locus_tag LOCUS_01350 23986 22616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 25368 24025 gene locus_tag LOCUS_01360 25368 24025 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_01360 25448 26005 gene locus_tag LOCUS_01370 25448 26005 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776788.1 protein_id gnl|my_center|LOCUS_01370 26054 26734 gene locus_tag LOCUS_01380 26054 26734 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_01380 26771 27739 gene locus_tag LOCUS_01390 gene trpS 26771 27739 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120916.1 protein_id gnl|my_center|LOCUS_01390 29871 28744 gene locus_tag LOCUS_01400 29871 28744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 31850 29868 gene locus_tag LOCUS_01410 31850 29868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 <32568 31847 gene locus_tag LOCUS_01420 <32568 31847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479661.1:response regulator transcription factor >Feature sequence006 1008 604 gene locus_tag LOCUS_01430 1008 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 2129 1005 gene locus_tag LOCUS_01440 2129 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 2354 3877 gene locus_tag LOCUS_01450 2354 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 5057 3906 gene locus_tag LOCUS_01460 5057 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 6808 5054 gene locus_tag LOCUS_01470 6808 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 7992 6805 gene locus_tag LOCUS_01480 7992 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 8884 8000 gene locus_tag LOCUS_01490 8884 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 9759 8881 gene locus_tag LOCUS_01500 9759 8881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 10955 9756 gene locus_tag LOCUS_01510 10955 9756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 12268 10952 gene locus_tag LOCUS_01520 12268 10952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 13529 12288 gene locus_tag LOCUS_01530 13529 12288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 14638 13526 gene locus_tag LOCUS_01540 14638 13526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 15543 14635 gene locus_tag LOCUS_01550 15543 14635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 16688 15543 gene locus_tag LOCUS_01560 16688 15543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 17640 16711 gene locus_tag LOCUS_01570 17640 16711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 18540 17653 gene locus_tag LOCUS_01580 18540 17653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 19408 18533 gene locus_tag LOCUS_01590 19408 18533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 20508 19405 gene locus_tag LOCUS_01600 20508 19405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 21539 20505 gene locus_tag LOCUS_01610 21539 20505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 22699 21536 gene locus_tag LOCUS_01620 22699 21536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 23619 22696 gene locus_tag LOCUS_01630 23619 22696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 24554 23616 gene locus_tag LOCUS_01640 24554 23616 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_01640 25822 24551 gene locus_tag LOCUS_01650 25822 24551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 27089 25836 gene locus_tag LOCUS_01660 27089 25836 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_01660 27957 27100 gene locus_tag LOCUS_01670 27957 27100 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_01670 28520 27969 gene locus_tag LOCUS_01680 28520 27969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 28651 30054 gene locus_tag LOCUS_01690 28651 30054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 31011 30082 gene locus_tag LOCUS_01700 gene ftsY 31011 30082 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443981.1 protein_id gnl|my_center|LOCUS_01700 31014 31244 gene locus_tag LOCUS_01710 31014 31244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 31529 31149 gene locus_tag LOCUS_01720 31529 31149 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_01720 32035 31577 gene locus_tag LOCUS_01730 gene nusB 32035 31577 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_01730 >Feature sequence007 360 1646 gene locus_tag LOCUS_01740 gene hemL 360 1646 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_01740 1917 3869 gene locus_tag LOCUS_01750 1917 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 3929 4183 gene locus_tag LOCUS_01760 3929 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 6112 4523 gene locus_tag LOCUS_01770 6112 4523 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922119.1 protein_id gnl|my_center|LOCUS_01770 7596 6109 gene locus_tag LOCUS_01780 7596 6109 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919304.1 protein_id gnl|my_center|LOCUS_01780 7699 9258 gene locus_tag LOCUS_01790 7699 9258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 11643 9424 gene locus_tag LOCUS_01800 11643 9424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 13423 11927 gene locus_tag LOCUS_01810 13423 11927 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918680.1 protein_id gnl|my_center|LOCUS_01810 15143 14088 gene locus_tag LOCUS_01820 15143 14088 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324978.1 protein_id gnl|my_center|LOCUS_01820 17266 15806 gene locus_tag LOCUS_01830 17266 15806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 17367 18338 gene locus_tag LOCUS_01840 17367 18338 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_01840 18354 19571 gene locus_tag LOCUS_01850 18354 19571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 19546 21855 gene locus_tag LOCUS_01860 19546 21855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 22994 21852 gene locus_tag LOCUS_01870 gene mnmA 22994 21852 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089522426.1 protein_id gnl|my_center|LOCUS_01870 23337 24155 gene locus_tag LOCUS_01880 23337 24155 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_01880 24205 25371 gene locus_tag LOCUS_01890 24205 25371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 25368 26222 gene locus_tag LOCUS_01900 25368 26222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 26392 28878 gene locus_tag LOCUS_01910 26392 28878 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038016.1 protein_id gnl|my_center|LOCUS_01910 28903 30072 gene locus_tag LOCUS_01920 28903 30072 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 protein_id gnl|my_center|LOCUS_01920 30135 31532 gene locus_tag LOCUS_01930 30135 31532 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_01930 >Feature sequence008 1900 695 gene locus_tag LOCUS_01940 1900 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 1925 2233 gene locus_tag LOCUS_01950 1925 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 2303 3427 gene locus_tag LOCUS_01960 2303 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 3424 5625 gene locus_tag LOCUS_01970 gene flhA 3424 5625 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198639.1 protein_id gnl|my_center|LOCUS_01970 5639 6661 gene locus_tag LOCUS_01980 5639 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 6658 7005 gene locus_tag LOCUS_01990 6658 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 7031 7825 gene locus_tag LOCUS_02000 7031 7825 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873529.1 protein_id gnl|my_center|LOCUS_02000 7850 8713 gene locus_tag LOCUS_02010 gene motA 7850 8713 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546161.1 protein_id gnl|my_center|LOCUS_02010 8765 9526 gene locus_tag LOCUS_02020 8765 9526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 9523 9789 gene locus_tag LOCUS_02030 9523 9789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 10036 10782 gene locus_tag LOCUS_02040 gene flgG 10036 10782 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946438.1 protein_id gnl|my_center|LOCUS_02040 10799 11581 gene locus_tag LOCUS_02050 gene flgG 10799 11581 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_02050 11589 12305 gene locus_tag LOCUS_02060 11589 12305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 12319 12945 gene locus_tag LOCUS_02070 12319 12945 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 protein_id gnl|my_center|LOCUS_02070 12951 14048 gene locus_tag LOCUS_02080 12951 14048 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_02080 14056 14409 gene locus_tag LOCUS_02090 14056 14409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 14406 14936 gene locus_tag LOCUS_02100 14406 14936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 14951 16372 gene locus_tag LOCUS_02110 gene flgK 14951 16372 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_02110 16399 17295 gene locus_tag LOCUS_02120 gene flgL 16399 17295 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943668.1 protein_id gnl|my_center|LOCUS_02120 17328 17771 gene locus_tag LOCUS_02130 gene fliW 17328 17771 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156273801.1 protein_id gnl|my_center|LOCUS_02130 17784 18035 gene locus_tag LOCUS_02140 17784 18035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 18055 18933 gene locus_tag LOCUS_02150 18055 18933 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668950.1 protein_id gnl|my_center|LOCUS_02150 19140 22742 gene locus_tag LOCUS_02160 19140 22742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 22739 25081 gene locus_tag LOCUS_02170 22739 25081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 25228 26895 gene locus_tag LOCUS_02180 25228 26895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 26950 28971 gene locus_tag LOCUS_02190 26950 28971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 29781 28984 gene locus_tag LOCUS_02200 29781 28984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 >Feature sequence009 3499 3320 gene locus_tag LOCUS_02210 3499 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 3456 4688 gene locus_tag LOCUS_02220 3456 4688 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_02220 4716 6290 gene locus_tag LOCUS_02230 4716 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 7542 6301 gene locus_tag LOCUS_02240 7542 6301 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_02240 8490 7915 gene locus_tag LOCUS_02250 8490 7915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043125671.1 protein_id gnl|my_center|LOCUS_02250 9094 8789 gene locus_tag LOCUS_02260 9094 8789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 10036 9116 gene locus_tag LOCUS_02270 10036 9116 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584146.1 protein_id gnl|my_center|LOCUS_02270 13113 10378 gene locus_tag LOCUS_02280 13113 10378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 14497 13163 gene locus_tag LOCUS_02290 14497 13163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 15368 14565 gene locus_tag LOCUS_02300 15368 14565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 17780 15627 gene locus_tag LOCUS_02310 17780 15627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 18295 21186 gene locus_tag LOCUS_02320 18295 21186 CDS product ligand-binding sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036705.1 protein_id gnl|my_center|LOCUS_02320 21212 21859 gene locus_tag LOCUS_02330 21212 21859 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_02330 21980 22783 gene locus_tag LOCUS_02340 21980 22783 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144228759.1 protein_id gnl|my_center|LOCUS_02340 22901 23701 gene locus_tag LOCUS_02350 22901 23701 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144228759.1 protein_id gnl|my_center|LOCUS_02350 24133 25164 gene locus_tag LOCUS_02360 24133 25164 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583040.1 protein_id gnl|my_center|LOCUS_02360 26932 25358 gene locus_tag LOCUS_02370 26932 25358 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918459.1 protein_id gnl|my_center|LOCUS_02370 29484 26950 gene locus_tag LOCUS_02380 29484 26950 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256961.1 protein_id gnl|my_center|LOCUS_02380 30095 29574 gene locus_tag LOCUS_02390 30095 29574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 30718 31080 gene locus_tag LOCUS_02400 30718 31080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 >Feature sequence010 383 667 gene locus_tag LOCUS_02410 383 667 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677634.1 protein_id gnl|my_center|LOCUS_02410 664 972 gene locus_tag LOCUS_02420 664 972 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071008.1 protein_id gnl|my_center|LOCUS_02420 1284 2558 gene locus_tag LOCUS_02430 1284 2558 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035889.1 protein_id gnl|my_center|LOCUS_02430 2565 3236 gene locus_tag LOCUS_02440 2565 3236 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 protein_id gnl|my_center|LOCUS_02440 3622 4194 gene locus_tag LOCUS_02450 3622 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 4191 4505 gene locus_tag LOCUS_02460 4191 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 4685 6295 gene locus_tag LOCUS_02470 4685 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 6640 7500 gene locus_tag LOCUS_02480 6640 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 9682 7505 gene locus_tag LOCUS_02490 9682 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 10895 10434 gene locus_tag LOCUS_02500 10895 10434 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390210.1 protein_id gnl|my_center|LOCUS_02500 11942 11004 gene locus_tag LOCUS_02510 11942 11004 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528532.1 protein_id gnl|my_center|LOCUS_02510 12750 12100 gene locus_tag LOCUS_02520 12750 12100 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_02520 13872 12802 gene locus_tag LOCUS_02530 13872 12802 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_02530 15133 13922 gene locus_tag LOCUS_02540 15133 13922 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870366.1 protein_id gnl|my_center|LOCUS_02540 16032 15232 gene locus_tag LOCUS_02550 16032 15232 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_02550 16774 16115 gene locus_tag LOCUS_02560 16774 16115 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388643.1 protein_id gnl|my_center|LOCUS_02560 16873 18759 gene locus_tag LOCUS_02570 16873 18759 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_02570 18756 20639 gene locus_tag LOCUS_02580 18756 20639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827098.1 protein_id gnl|my_center|LOCUS_02580 20798 21067 gene locus_tag LOCUS_02590 20798 21067 CDS product SWIB/MDM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814592.1 protein_id gnl|my_center|LOCUS_02590 21683 21171 gene locus_tag LOCUS_02600 gene bcp 21683 21171 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142372.1 protein_id gnl|my_center|LOCUS_02600 21776 22588 gene locus_tag LOCUS_02610 21776 22588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 22585 23454 gene locus_tag LOCUS_02620 22585 23454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 23502 24746 gene locus_tag LOCUS_02630 23502 24746 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876625.1 protein_id gnl|my_center|LOCUS_02630 25331 24759 gene locus_tag LOCUS_02640 25331 24759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 25767 25438 gene locus_tag LOCUS_02650 25767 25438 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 protein_id gnl|my_center|LOCUS_02650 25864 26832 gene locus_tag LOCUS_02660 25864 26832 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388043.1 protein_id gnl|my_center|LOCUS_02660 26898 27251 gene locus_tag LOCUS_02670 26898 27251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 27315 28598 gene locus_tag LOCUS_02680 27315 28598 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_02680 28755 29831 gene locus_tag LOCUS_02690 28755 29831 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225122.1 protein_id gnl|my_center|LOCUS_02690 >Feature sequence011 709 3069 gene locus_tag LOCUS_02700 709 3069 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265970.1 protein_id gnl|my_center|LOCUS_02700 3170 4750 gene locus_tag LOCUS_02710 3170 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 4747 6051 gene locus_tag LOCUS_02720 4747 6051 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933604.1 protein_id gnl|my_center|LOCUS_02720 6090 7445 gene locus_tag LOCUS_02730 6090 7445 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551559.1 protein_id gnl|my_center|LOCUS_02730 7442 8635 gene locus_tag LOCUS_02740 7442 8635 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728503.1 protein_id gnl|my_center|LOCUS_02740 8720 10006 gene locus_tag LOCUS_02750 8720 10006 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527954.1 protein_id gnl|my_center|LOCUS_02750 10095 11102 gene locus_tag LOCUS_02760 10095 11102 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921231.1 protein_id gnl|my_center|LOCUS_02760 11369 12154 gene locus_tag LOCUS_02770 11369 12154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 12219 13238 gene locus_tag LOCUS_02780 12219 13238 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029972.1 protein_id gnl|my_center|LOCUS_02780 13271 14695 gene locus_tag LOCUS_02790 13271 14695 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527331.1 protein_id gnl|my_center|LOCUS_02790 14744 16120 gene locus_tag LOCUS_02800 14744 16120 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_02800 16086 16490 gene locus_tag LOCUS_02810 16086 16490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 16687 17520 gene locus_tag LOCUS_02820 16687 17520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 17717 20104 gene locus_tag LOCUS_02830 17717 20104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 20205 22856 gene locus_tag LOCUS_02840 20205 22856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 22941 24446 gene locus_tag LOCUS_02850 22941 24446 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530049.1 protein_id gnl|my_center|LOCUS_02850 24461 25123 gene locus_tag LOCUS_02860 24461 25123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 25650 27134 gene locus_tag LOCUS_02870 25650 27134 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167274874.1 protein_id gnl|my_center|LOCUS_02870 27450 29132 gene locus_tag LOCUS_02880 27450 29132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109095.1 protein_id gnl|my_center|LOCUS_02880 29345 30178 gene locus_tag LOCUS_02890 29345 30178 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_02890 30384 30073 gene locus_tag LOCUS_02900 30384 30073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 30460 30696 gene locus_tag LOCUS_02910 30460 30696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence012 938 129 gene locus_tag LOCUS_02920 938 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 1728 955 gene locus_tag LOCUS_02930 1728 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 2217 2065 gene locus_tag LOCUS_02940 2217 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 2514 2245 gene locus_tag LOCUS_02950 2514 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 2456 3802 gene locus_tag LOCUS_02960 2456 3802 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313130.1 protein_id gnl|my_center|LOCUS_02960 3835 4401 gene locus_tag LOCUS_02970 3835 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 4423 6150 gene locus_tag LOCUS_02980 4423 6150 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_02980 6166 8265 gene locus_tag LOCUS_02990 6166 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 8258 9265 gene locus_tag LOCUS_03000 8258 9265 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066267.1 protein_id gnl|my_center|LOCUS_03000 9438 10880 gene locus_tag LOCUS_03010 gene atpD 9438 10880 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 protein_id gnl|my_center|LOCUS_03010 10870 11259 gene locus_tag LOCUS_03020 10870 11259 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022411.1 protein_id gnl|my_center|LOCUS_03020 11252 11611 gene locus_tag LOCUS_03030 11252 11611 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022410.1 protein_id gnl|my_center|LOCUS_03030 11604 11894 gene locus_tag LOCUS_03040 11604 11894 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022409.1 protein_id gnl|my_center|LOCUS_03040 11884 12588 gene locus_tag LOCUS_03050 11884 12588 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022408.1 protein_id gnl|my_center|LOCUS_03050 12581 12877 gene locus_tag LOCUS_03060 12581 12877 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022407.1 protein_id gnl|my_center|LOCUS_03060 12882 13664 gene locus_tag LOCUS_03070 12882 13664 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 protein_id gnl|my_center|LOCUS_03070 13661 15256 gene locus_tag LOCUS_03080 13661 15256 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022405.1 protein_id gnl|my_center|LOCUS_03080 15263 15619 gene locus_tag LOCUS_03090 15263 15619 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365451.1 protein_id gnl|my_center|LOCUS_03090 15634 16650 gene locus_tag LOCUS_03100 15634 16650 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022404.1 protein_id gnl|my_center|LOCUS_03100 17916 17584 gene locus_tag LOCUS_03110 17916 17584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 18540 17920 gene locus_tag LOCUS_03120 18540 17920 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962861.1 protein_id gnl|my_center|LOCUS_03120 19823 19176 gene locus_tag LOCUS_03130 19823 19176 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122034.1 protein_id gnl|my_center|LOCUS_03130 20701 19820 gene locus_tag LOCUS_03140 20701 19820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 22410 20698 gene locus_tag LOCUS_03150 22410 20698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 23685 22777 gene locus_tag LOCUS_03160 23685 22777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 25531 24113 gene locus_tag LOCUS_03170 25531 24113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 26436 25597 gene locus_tag LOCUS_03180 26436 25597 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943577.1 protein_id gnl|my_center|LOCUS_03180 26534 27871 gene locus_tag LOCUS_03190 26534 27871 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143713.1 protein_id gnl|my_center|LOCUS_03190 27988 29412 gene locus_tag LOCUS_03200 27988 29412 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920960.1 protein_id gnl|my_center|LOCUS_03200 29503 29841 gene locus_tag LOCUS_03210 gene glnB 29503 29841 CDS product nitrogen regulator P-II GlnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880011.1 protein_id gnl|my_center|LOCUS_03210 >Feature sequence013 1287 2321 gene locus_tag LOCUS_03220 1287 2321 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056272.1 protein_id gnl|my_center|LOCUS_03220 4118 2349 gene locus_tag LOCUS_03230 gene polX 4118 2349 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551361.1 protein_id gnl|my_center|LOCUS_03230 4239 4670 gene locus_tag LOCUS_03240 4239 4670 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056339.1 protein_id gnl|my_center|LOCUS_03240 4688 5368 gene locus_tag LOCUS_03250 4688 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 5939 5397 gene locus_tag LOCUS_03260 5939 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 6161 6086 gene locus_tag LOCUS_t00030 6161 6086 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6258 7205 gene locus_tag LOCUS_03270 6258 7205 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920127.1 protein_id gnl|my_center|LOCUS_03270 8819 7386 gene locus_tag LOCUS_03280 8819 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 8976 12506 gene locus_tag LOCUS_03290 8976 12506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 12529 13983 gene locus_tag LOCUS_03300 12529 13983 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_03300 14001 14615 gene locus_tag LOCUS_03310 14001 14615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 16698 14593 gene locus_tag LOCUS_03320 16698 14593 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_03320 17026 18867 gene locus_tag LOCUS_03330 17026 18867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 18969 19904 gene locus_tag LOCUS_03340 18969 19904 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507354.1 protein_id gnl|my_center|LOCUS_03340 20019 21191 gene locus_tag LOCUS_03350 gene carA 20019 21191 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660544.1 protein_id gnl|my_center|LOCUS_03350 21224 21829 gene locus_tag LOCUS_03360 21224 21829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207794.1 protein_id gnl|my_center|LOCUS_03360 22707 21841 gene locus_tag LOCUS_03370 22707 21841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 22789 23238 gene locus_tag LOCUS_03380 22789 23238 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887547.1 protein_id gnl|my_center|LOCUS_03380 23868 23638 gene locus_tag LOCUS_03390 23868 23638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 24238 23855 gene locus_tag LOCUS_03400 24238 23855 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942008.1 protein_id gnl|my_center|LOCUS_03400 25188 24220 gene locus_tag LOCUS_03410 25188 24220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 25294 25965 gene locus_tag LOCUS_03420 gene modB 25294 25965 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367643.1 protein_id gnl|my_center|LOCUS_03420 25980 26549 gene locus_tag LOCUS_03430 25980 26549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 26641 27495 gene locus_tag LOCUS_03440 26641 27495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 27492 28526 gene locus_tag LOCUS_03450 gene hemA 27492 28526 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_03450 29250 28558 gene locus_tag LOCUS_03460 29250 28558 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707237.1 protein_id gnl|my_center|LOCUS_03460 <30349 29267 gene locus_tag LOCUS_03470 <30349 29267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191984.1:lipoprotein-releasing ABC transporter permease subunit >Feature sequence014 1016 285 gene locus_tag LOCUS_03480 1016 285 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094011.1 protein_id gnl|my_center|LOCUS_03480 2549 1077 gene locus_tag LOCUS_03490 2549 1077 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118443.1 protein_id gnl|my_center|LOCUS_03490 2698 3693 gene locus_tag LOCUS_03500 2698 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 4365 3835 gene locus_tag LOCUS_03510 4365 3835 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940818.1 protein_id gnl|my_center|LOCUS_03510 4961 4362 gene locus_tag LOCUS_03520 gene pgsA 4961 4362 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869392.1 protein_id gnl|my_center|LOCUS_03520 5110 5646 gene locus_tag LOCUS_03530 gene coaD 5110 5646 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704185.1 protein_id gnl|my_center|LOCUS_03530 6373 5672 gene locus_tag LOCUS_03540 6373 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 7161 6430 gene locus_tag LOCUS_03550 gene pgl 7161 6430 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_03550 8152 7166 gene locus_tag LOCUS_03560 8152 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 9696 8158 gene locus_tag LOCUS_03570 gene zwf 9696 8158 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_03570 10326 9793 gene locus_tag LOCUS_03580 10326 9793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 10409 12592 gene locus_tag LOCUS_03590 10409 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 12681 13433 gene locus_tag LOCUS_03600 12681 13433 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246039.1 protein_id gnl|my_center|LOCUS_03600 14404 13475 gene locus_tag LOCUS_03610 14404 13475 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103928.1 protein_id gnl|my_center|LOCUS_03610 15040 14444 gene locus_tag LOCUS_03620 15040 14444 CDS product DUF2937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388036.1 protein_id gnl|my_center|LOCUS_03620 15146 15853 gene locus_tag LOCUS_03630 15146 15853 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971485.1 protein_id gnl|my_center|LOCUS_03630 17200 15884 gene locus_tag LOCUS_03640 17200 15884 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039292.1 protein_id gnl|my_center|LOCUS_03640 17342 18295 gene locus_tag LOCUS_03650 17342 18295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 18402 19238 gene locus_tag LOCUS_03660 18402 19238 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258710.1 protein_id gnl|my_center|LOCUS_03660 19281 19664 gene locus_tag LOCUS_03670 19281 19664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 21172 19739 gene locus_tag LOCUS_03680 gene hemN 21172 19739 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881391.1 protein_id gnl|my_center|LOCUS_03680 21344 22306 gene locus_tag LOCUS_03690 21344 22306 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_03690 22712 22918 gene locus_tag LOCUS_03700 22712 22918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 23760 22915 gene locus_tag LOCUS_03710 23760 22915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 23884 25473 gene locus_tag LOCUS_03720 23884 25473 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966945.1 protein_id gnl|my_center|LOCUS_03720 25503 26801 gene locus_tag LOCUS_03730 25503 26801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 26881 29745 gene locus_tag LOCUS_03740 26881 29745 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_03740 29993 29906 gene locus_tag LOCUS_t00040 29993 29906 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence015 <1 1259 gene locus_tag LOCUS_03750 <1 1259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036521.1:cyclopropane-fatty-acyl-phospholipid synthase family protein 1358 1582 gene locus_tag LOCUS_03760 1358 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 1712 2137 gene locus_tag LOCUS_03770 1712 2137 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_03770 2838 2407 gene locus_tag LOCUS_03780 2838 2407 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017285767.1 protein_id gnl|my_center|LOCUS_03780 3122 2853 gene locus_tag LOCUS_03790 3122 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 4025 3342 gene locus_tag LOCUS_03800 4025 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 7235 4029 gene locus_tag LOCUS_03810 7235 4029 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962208.1 protein_id gnl|my_center|LOCUS_03810 8716 7313 gene locus_tag LOCUS_03820 gene yjjJ 8716 7313 CDS product type II toxin-antitoxin system HipA family toxin YjjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035780.1 protein_id gnl|my_center|LOCUS_03820 10853 9006 gene locus_tag LOCUS_03830 10853 9006 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_03830 11144 12205 gene locus_tag LOCUS_03840 11144 12205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 12223 14124 gene locus_tag LOCUS_03850 12223 14124 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975395.1 protein_id gnl|my_center|LOCUS_03850 14121 15011 gene locus_tag LOCUS_03860 14121 15011 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_03860 15028 17166 gene locus_tag LOCUS_03870 15028 17166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 17296 18051 gene locus_tag LOCUS_03880 17296 18051 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144228759.1 protein_id gnl|my_center|LOCUS_03880 18059 18748 gene locus_tag LOCUS_03890 18059 18748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 18801 19634 gene locus_tag LOCUS_03900 18801 19634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 19637 20338 gene locus_tag LOCUS_03910 19637 20338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 21233 20454 gene locus_tag LOCUS_03920 21233 20454 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705502.1 protein_id gnl|my_center|LOCUS_03920 22321 21254 gene locus_tag LOCUS_03930 22321 21254 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256271.1 protein_id gnl|my_center|LOCUS_03930 23905 22430 gene locus_tag LOCUS_03940 23905 22430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 28171 23972 gene locus_tag LOCUS_03950 28171 23972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 <29985 28408 gene locus_tag LOCUS_03960 <29985 28408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202630.1:glycoside hydrolase family 2 TIM barrel-domain containing protein >Feature sequence016 2393 1488 gene locus_tag LOCUS_03970 gene cysD 2393 1488 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002735002.1 protein_id gnl|my_center|LOCUS_03970 3047 2436 gene locus_tag LOCUS_03980 gene cysC 3047 2436 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202511.1 protein_id gnl|my_center|LOCUS_03980 4154 3126 gene locus_tag LOCUS_03990 4154 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 4917 4243 gene locus_tag LOCUS_04000 gene infC 4917 4243 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008036.1 protein_id gnl|my_center|LOCUS_04000 5801 5109 gene locus_tag LOCUS_04010 5801 5109 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583790.1 protein_id gnl|my_center|LOCUS_04010 7122 5977 gene locus_tag LOCUS_04020 7122 5977 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085624.1 protein_id gnl|my_center|LOCUS_04020 7248 8018 gene locus_tag LOCUS_04030 7248 8018 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528539.1 protein_id gnl|my_center|LOCUS_04030 8421 7990 gene locus_tag LOCUS_04040 8421 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 8599 9171 gene locus_tag LOCUS_04050 8599 9171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 9180 9497 gene locus_tag LOCUS_04060 9180 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 9515 12475 gene locus_tag LOCUS_04070 9515 12475 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084982.1 protein_id gnl|my_center|LOCUS_04070 12513 14609 gene locus_tag LOCUS_04080 12513 14609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 14621 16378 gene locus_tag LOCUS_04090 14621 16378 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205226061.1 protein_id gnl|my_center|LOCUS_04090 16397 20587 gene locus_tag LOCUS_04100 16397 20587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 20584 22155 gene locus_tag LOCUS_04110 20584 22155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 22152 23255 gene locus_tag LOCUS_04120 22152 23255 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939356.1 protein_id gnl|my_center|LOCUS_04120 23264 24115 gene locus_tag LOCUS_04130 gene cheR 23264 24115 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091728.1 protein_id gnl|my_center|LOCUS_04130 24127 24501 gene locus_tag LOCUS_04140 24127 24501 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772151.1 protein_id gnl|my_center|LOCUS_04140 27356 24774 gene locus_tag LOCUS_04150 27356 24774 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_04150 28515 27430 gene locus_tag LOCUS_04160 28515 27430 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328432.1 protein_id gnl|my_center|LOCUS_04160 >Feature sequence017 2126 1077 gene locus_tag LOCUS_04170 2126 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 3082 2123 gene locus_tag LOCUS_04180 3082 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 3861 3079 gene locus_tag LOCUS_04190 3861 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 3973 4416 gene locus_tag LOCUS_04200 3973 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 4416 5480 gene locus_tag LOCUS_04210 4416 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528272.1 protein_id gnl|my_center|LOCUS_04210 5485 6597 gene locus_tag LOCUS_04220 5485 6597 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392878.1 protein_id gnl|my_center|LOCUS_04220 6607 7575 gene locus_tag LOCUS_04230 6607 7575 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_04230 7563 8264 gene locus_tag LOCUS_04240 7563 8264 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122393.1 protein_id gnl|my_center|LOCUS_04240 8269 9954 gene locus_tag LOCUS_04250 8269 9954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 9951 11126 gene locus_tag LOCUS_04260 9951 11126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 11123 12151 gene locus_tag LOCUS_04270 11123 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 12194 13165 gene locus_tag LOCUS_04280 12194 13165 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881131.1 protein_id gnl|my_center|LOCUS_04280 13174 13632 gene locus_tag LOCUS_04290 13174 13632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 13622 14857 gene locus_tag LOCUS_04300 13622 14857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 16187 14841 gene locus_tag LOCUS_04310 16187 14841 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167274874.1 protein_id gnl|my_center|LOCUS_04310 16420 18504 gene locus_tag LOCUS_04320 16420 18504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 18737 19393 gene locus_tag LOCUS_04330 18737 19393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 19588 19394 gene locus_tag LOCUS_04340 gene rpmI 19588 19394 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872221.1 protein_id gnl|my_center|LOCUS_04340 19863 19645 gene locus_tag LOCUS_04350 19863 19645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 20110 21225 gene locus_tag LOCUS_04360 20110 21225 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811750.1 protein_id gnl|my_center|LOCUS_04360 22403 21891 gene locus_tag LOCUS_04370 22403 21891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 >Feature sequence018 1469 543 gene locus_tag LOCUS_04380 1469 543 CDS product lactate/malate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118931.1 protein_id gnl|my_center|LOCUS_04380 2565 1498 gene locus_tag LOCUS_04390 2565 1498 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324364.1 protein_id gnl|my_center|LOCUS_04390 2881 2579 gene locus_tag LOCUS_04400 2881 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 3156 2887 gene locus_tag LOCUS_04410 3156 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 4671 3187 gene locus_tag LOCUS_04420 4671 3187 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333579.1 protein_id gnl|my_center|LOCUS_04420 4982 4671 gene locus_tag LOCUS_04430 4982 4671 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324359.1 protein_id gnl|my_center|LOCUS_04430 5322 5008 gene locus_tag LOCUS_04440 gene pduA 5322 5008 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183614.1 protein_id gnl|my_center|LOCUS_04440 6550 5357 gene locus_tag LOCUS_04450 6550 5357 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118936.1 protein_id gnl|my_center|LOCUS_04450 6968 6678 gene locus_tag LOCUS_04460 6968 6678 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004146125.1 protein_id gnl|my_center|LOCUS_04460 7273 7004 gene locus_tag LOCUS_04470 7273 7004 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357513.1 protein_id gnl|my_center|LOCUS_04470 8011 7337 gene locus_tag LOCUS_04480 8011 7337 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333582.1 protein_id gnl|my_center|LOCUS_04480 8242 11166 gene locus_tag LOCUS_04490 gene gcvP 8242 11166 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140250.1 protein_id gnl|my_center|LOCUS_04490 11983 11195 gene locus_tag LOCUS_04500 11983 11195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 13271 12147 gene locus_tag LOCUS_04510 gene dnaN 13271 12147 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725022.1 protein_id gnl|my_center|LOCUS_04510 13224 13457 gene locus_tag LOCUS_04520 13224 13457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 14480 13596 gene locus_tag LOCUS_04530 gene pssA 14480 13596 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770492.1 protein_id gnl|my_center|LOCUS_04530 14852 14499 gene locus_tag LOCUS_04540 14852 14499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 15083 17356 gene locus_tag LOCUS_04550 15083 17356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 17422 18222 gene locus_tag LOCUS_04560 17422 18222 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525205.1 protein_id gnl|my_center|LOCUS_04560 18269 20614 gene locus_tag LOCUS_04570 18269 20614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 21695 20601 gene locus_tag LOCUS_04580 21695 20601 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035548.1 protein_id gnl|my_center|LOCUS_04580 21768 22595 gene locus_tag LOCUS_04590 21768 22595 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_04590 22646 24070 gene locus_tag LOCUS_04600 gene mnmE 22646 24070 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944074.1 protein_id gnl|my_center|LOCUS_04600 24144 26117 gene locus_tag LOCUS_04610 gene mnmG 24144 26117 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427787.1 protein_id gnl|my_center|LOCUS_04610 >Feature sequence019 3121 2048 gene locus_tag LOCUS_04620 3121 2048 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525264.1 protein_id gnl|my_center|LOCUS_04620 4165 3146 gene locus_tag LOCUS_04630 4165 3146 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108909.1 protein_id gnl|my_center|LOCUS_04630 4987 4190 gene locus_tag LOCUS_04640 4987 4190 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991075.1 protein_id gnl|my_center|LOCUS_04640 6202 5102 gene locus_tag LOCUS_04650 6202 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 8559 6211 gene locus_tag LOCUS_04660 8559 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 10299 8677 gene locus_tag LOCUS_04670 10299 8677 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203704.1 protein_id gnl|my_center|LOCUS_04670 17729 10308 gene locus_tag LOCUS_04680 17729 10308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 17914 20244 gene locus_tag LOCUS_04690 17914 20244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 21384 20263 gene locus_tag LOCUS_04700 21384 20263 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973786.1 protein_id gnl|my_center|LOCUS_04700 23728 21410 gene locus_tag LOCUS_04710 gene yicI 23728 21410 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702944.1 protein_id gnl|my_center|LOCUS_04710 26400 23872 gene locus_tag LOCUS_04720 26400 23872 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_04720 >Feature sequence020 1577 294 gene locus_tag LOCUS_04730 gene purD 1577 294 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_04730 3529 1607 gene locus_tag LOCUS_04740 3529 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 3701 4504 gene locus_tag LOCUS_04750 gene fkpA 3701 4504 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704938.1 protein_id gnl|my_center|LOCUS_04750 6147 4639 gene locus_tag LOCUS_04760 gene rpoN 6147 4639 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546561.1 protein_id gnl|my_center|LOCUS_04760 7140 6205 gene locus_tag LOCUS_04770 7140 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 7283 7627 gene locus_tag LOCUS_04780 gene erpA 7283 7627 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551953.1 protein_id gnl|my_center|LOCUS_04780 8484 7789 gene locus_tag LOCUS_04790 gene ubiE 8484 7789 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_04790 8795 9103 gene locus_tag LOCUS_04800 8795 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 9264 10601 gene locus_tag LOCUS_04810 gene hisS 9264 10601 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_04810 10742 10936 gene locus_tag LOCUS_04820 10742 10936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 11017 11505 gene locus_tag LOCUS_04830 gene smpB 11017 11505 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942353.1 protein_id gnl|my_center|LOCUS_04830 11567 12511 gene locus_tag LOCUS_04840 gene thrB 11567 12511 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_04840 12536 13000 gene locus_tag LOCUS_04850 gene trmL 12536 13000 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_04850 13502 13008 gene locus_tag LOCUS_04860 13502 13008 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941953.1 protein_id gnl|my_center|LOCUS_04860 13679 15859 gene locus_tag LOCUS_04870 13679 15859 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940968.1 protein_id gnl|my_center|LOCUS_04870 15871 16737 gene locus_tag LOCUS_04880 15871 16737 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358679.1 protein_id gnl|my_center|LOCUS_04880 17328 16807 gene locus_tag LOCUS_04890 17328 16807 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868668.1 protein_id gnl|my_center|LOCUS_04890 18603 17332 gene locus_tag LOCUS_04900 18603 17332 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102481.1 protein_id gnl|my_center|LOCUS_04900 19729 18590 gene locus_tag LOCUS_04910 19729 18590 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938887.1 protein_id gnl|my_center|LOCUS_04910 20565 19735 gene locus_tag LOCUS_04920 20565 19735 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_04920 20783 21175 gene locus_tag LOCUS_04930 gene flgB 20783 21175 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_04930 21188 21616 gene locus_tag LOCUS_04940 gene flgC 21188 21616 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_04940 21651 21986 gene locus_tag LOCUS_04950 21651 21986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 22046 23614 gene locus_tag LOCUS_04960 22046 23614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 23664 24686 gene locus_tag LOCUS_04970 gene fliG 23664 24686 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082903.1 protein_id gnl|my_center|LOCUS_04970 24697 25281 gene locus_tag LOCUS_04980 24697 25281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 >Feature sequence021 2149 983 gene locus_tag LOCUS_04990 2149 983 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_04990 3004 2201 gene locus_tag LOCUS_05000 3004 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 3190 4179 gene locus_tag LOCUS_05010 3190 4179 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037924.1 protein_id gnl|my_center|LOCUS_05010 7129 4166 gene locus_tag LOCUS_05020 7129 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 7464 9125 gene locus_tag LOCUS_05030 gene fumA 7464 9125 CDS product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209418.1 protein_id gnl|my_center|LOCUS_05030 10659 9151 gene locus_tag LOCUS_05040 10659 9151 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031639.1 protein_id gnl|my_center|LOCUS_05040 10834 11505 gene locus_tag LOCUS_05050 10834 11505 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103182.1 protein_id gnl|my_center|LOCUS_05050 11526 12113 gene locus_tag LOCUS_05060 11526 12113 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087656.1 protein_id gnl|my_center|LOCUS_05060 12110 12823 gene locus_tag LOCUS_05070 gene mtnC 12110 12823 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704722.1 protein_id gnl|my_center|LOCUS_05070 12820 13920 gene locus_tag LOCUS_05080 gene mtnA 12820 13920 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_05080 15220 13940 gene locus_tag LOCUS_05090 15220 13940 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233175.1 protein_id gnl|my_center|LOCUS_05090 15421 16932 gene locus_tag LOCUS_05100 15421 16932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 17177 16902 gene locus_tag LOCUS_05110 17177 16902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 17207 18310 gene locus_tag LOCUS_05120 17207 18310 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_05120 18441 19145 gene locus_tag LOCUS_05130 18441 19145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 19333 20796 gene locus_tag LOCUS_05140 19333 20796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 20819 21775 gene locus_tag LOCUS_05150 20819 21775 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029553.1 protein_id gnl|my_center|LOCUS_05150 21772 22503 gene locus_tag LOCUS_05160 21772 22503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 23600 22584 gene locus_tag LOCUS_05170 gene fmt 23600 22584 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114642.1 protein_id gnl|my_center|LOCUS_05170 24610 23690 gene locus_tag LOCUS_05180 24610 23690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256034.1 protein_id gnl|my_center|LOCUS_05180 26198 24591 gene locus_tag LOCUS_05190 gene der 26198 24591 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_05190 >Feature sequence022 975 1787 gene locus_tag LOCUS_05200 975 1787 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_05200 1847 2626 gene locus_tag LOCUS_05210 1847 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 2636 3352 gene locus_tag LOCUS_05220 2636 3352 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_05220 3416 4423 gene locus_tag LOCUS_05230 3416 4423 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327241.1 protein_id gnl|my_center|LOCUS_05230 5594 4398 gene locus_tag LOCUS_05240 5594 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 5774 7126 gene locus_tag LOCUS_05250 5774 7126 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918160.1 protein_id gnl|my_center|LOCUS_05250 7220 9271 gene locus_tag LOCUS_05260 7220 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 10892 9258 gene locus_tag LOCUS_05270 10892 9258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 10989 11282 gene locus_tag LOCUS_05280 10989 11282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 11542 11297 gene locus_tag LOCUS_05290 11542 11297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 13021 11594 gene locus_tag LOCUS_05300 13021 11594 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727577.1 protein_id gnl|my_center|LOCUS_05300 13793 13113 gene locus_tag LOCUS_05310 gene phoU 13793 13113 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_05310 14806 13895 gene locus_tag LOCUS_05320 gene pstB 14806 13895 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_05320 15879 14800 gene locus_tag LOCUS_05330 15879 14800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 17520 15901 gene locus_tag LOCUS_05340 17520 15901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 18450 17638 gene locus_tag LOCUS_05350 18450 17638 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803239.1 protein_id gnl|my_center|LOCUS_05350 19472 18567 gene locus_tag LOCUS_05360 19472 18567 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257650.1 protein_id gnl|my_center|LOCUS_05360 19576 20562 gene locus_tag LOCUS_05370 19576 20562 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_05370 21365 20526 gene locus_tag LOCUS_05380 21365 20526 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_05380 21354 22703 gene locus_tag LOCUS_05390 21354 22703 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_05390 22801 23691 gene locus_tag LOCUS_05400 22801 23691 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563083.1 protein_id gnl|my_center|LOCUS_05400 23893 24843 gene locus_tag LOCUS_05410 23893 24843 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583299.1 protein_id gnl|my_center|LOCUS_05410 24843 25634 gene locus_tag LOCUS_05420 24843 25634 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_05420 >Feature sequence023 278 2164 gene locus_tag LOCUS_05430 278 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 2161 4002 gene locus_tag LOCUS_05440 2161 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 3999 5492 gene locus_tag LOCUS_05450 3999 5492 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_05450 5489 6760 gene locus_tag LOCUS_05460 5489 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 8721 6703 gene locus_tag LOCUS_05470 8721 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 8787 10004 gene locus_tag LOCUS_05480 8787 10004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 10001 12331 gene locus_tag LOCUS_05490 10001 12331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 13772 14257 gene locus_tag LOCUS_05500 13772 14257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 14254 15183 gene locus_tag LOCUS_05510 14254 15183 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_05510 16412 15216 gene locus_tag LOCUS_05520 16412 15216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 16999 16421 gene locus_tag LOCUS_05530 16999 16421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 18171 16996 gene locus_tag LOCUS_05540 18171 16996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 19987 18188 gene locus_tag LOCUS_05550 gene ilvB 19987 18188 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942556.1 protein_id gnl|my_center|LOCUS_05550 21524 20010 gene locus_tag LOCUS_05560 21524 20010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 22606 21521 gene locus_tag LOCUS_05570 22606 21521 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160648704.1 protein_id gnl|my_center|LOCUS_05570 22667 23416 gene locus_tag LOCUS_05580 22667 23416 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523383.1 protein_id gnl|my_center|LOCUS_05580 25430 23385 gene locus_tag LOCUS_05590 25430 23385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 >Feature sequence024 <1 2241 gene locus_tag LOCUS_05600 <1 2241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402897.1:heavy metal translocating P-type ATPase 2854 2273 gene locus_tag LOCUS_05610 gene pdxH 2854 2273 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918802.1 protein_id gnl|my_center|LOCUS_05610 2968 4692 gene locus_tag LOCUS_05620 2968 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 4705 5895 gene locus_tag LOCUS_05630 4705 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 6021 6989 gene locus_tag LOCUS_05640 gene moaA 6021 6989 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257065.1 protein_id gnl|my_center|LOCUS_05640 7062 7739 gene locus_tag LOCUS_05650 7062 7739 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462033.1 protein_id gnl|my_center|LOCUS_05650 7736 7975 gene locus_tag LOCUS_05660 gene moaD 7736 7975 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438518.1 protein_id gnl|my_center|LOCUS_05660 7975 8376 gene locus_tag LOCUS_05670 7975 8376 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257742.1 protein_id gnl|my_center|LOCUS_05670 8399 9568 gene locus_tag LOCUS_05680 8399 9568 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337145.1 protein_id gnl|my_center|LOCUS_05680 9591 10049 gene locus_tag LOCUS_05690 gene moaC 9591 10049 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383897.1 protein_id gnl|my_center|LOCUS_05690 10191 10664 gene locus_tag LOCUS_05700 gene mog 10191 10664 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002842823.1 protein_id gnl|my_center|LOCUS_05700 10708 11181 gene locus_tag LOCUS_05710 10708 11181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 11234 11791 gene locus_tag LOCUS_05720 11234 11791 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921285.1 protein_id gnl|my_center|LOCUS_05720 12551 11841 gene locus_tag LOCUS_05730 12551 11841 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403103.1 protein_id gnl|my_center|LOCUS_05730 13246 12548 gene locus_tag LOCUS_05740 13246 12548 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403102.1 protein_id gnl|my_center|LOCUS_05740 14745 13243 gene locus_tag LOCUS_05750 14745 13243 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_05750 15010 14798 gene locus_tag LOCUS_05760 15010 14798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 15354 15061 gene locus_tag LOCUS_05770 15354 15061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 16642 15347 gene locus_tag LOCUS_05780 16642 15347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922553.1 protein_id gnl|my_center|LOCUS_05780 17286 16639 gene locus_tag LOCUS_05790 17286 16639 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421545.1 protein_id gnl|my_center|LOCUS_05790 17824 17291 gene locus_tag LOCUS_05800 17824 17291 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_05800 19282 17846 gene locus_tag LOCUS_05810 gene nrfD 19282 17846 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_05810 22740 19282 gene locus_tag LOCUS_05820 22740 19282 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 protein_id gnl|my_center|LOCUS_05820 23412 22756 gene locus_tag LOCUS_05830 23412 22756 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_05830 23679 23449 gene locus_tag LOCUS_05840 23679 23449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 24638 23832 gene locus_tag LOCUS_05850 gene trpA 24638 23832 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338525.1 protein_id gnl|my_center|LOCUS_05850 >Feature sequence025 400 1284 gene locus_tag LOCUS_05860 400 1284 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805043.1 protein_id gnl|my_center|LOCUS_05860 1370 2476 gene locus_tag LOCUS_05870 1370 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 2548 3252 gene locus_tag LOCUS_05880 2548 3252 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975619.1 protein_id gnl|my_center|LOCUS_05880 3329 4363 gene locus_tag LOCUS_05890 3329 4363 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039181.1 protein_id gnl|my_center|LOCUS_05890 6779 4590 gene locus_tag LOCUS_05900 6779 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 7552 6824 gene locus_tag LOCUS_05910 7552 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 8353 7856 gene locus_tag LOCUS_05920 8353 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 9118 8423 gene locus_tag LOCUS_05930 9118 8423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 10839 9148 gene locus_tag LOCUS_05940 10839 9148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 12811 11093 gene locus_tag LOCUS_05950 12811 11093 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269931.1 protein_id gnl|my_center|LOCUS_05950 15791 12846 gene locus_tag LOCUS_05960 15791 12846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 16771 15854 gene locus_tag LOCUS_05970 16771 15854 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665981.1 protein_id gnl|my_center|LOCUS_05970 18439 16787 gene locus_tag LOCUS_05980 18439 16787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 18700 21084 gene locus_tag LOCUS_05990 18700 21084 CDS product N,N'-diacetylchitobiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583018.1 protein_id gnl|my_center|LOCUS_05990 21205 22683 gene locus_tag LOCUS_06000 21205 22683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 22829 23896 gene locus_tag LOCUS_06010 22829 23896 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760615.1 protein_id gnl|my_center|LOCUS_06010 >Feature sequence026 549 193 gene locus_tag LOCUS_06020 549 193 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123903.1 protein_id gnl|my_center|LOCUS_06020 1412 642 gene locus_tag LOCUS_06030 gene rfbF 1412 642 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257101.1 protein_id gnl|my_center|LOCUS_06030 3261 1636 gene locus_tag LOCUS_06040 3261 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 4369 3290 gene locus_tag LOCUS_06050 4369 3290 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_06050 4531 5115 gene locus_tag LOCUS_06060 gene hpt 4531 5115 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226700.1 protein_id gnl|my_center|LOCUS_06060 5861 5475 gene locus_tag LOCUS_06070 5861 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 8151 5923 gene locus_tag LOCUS_06080 gene glgB 8151 5923 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_06080 11051 8277 gene locus_tag LOCUS_06090 gene ppc 11051 8277 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_06090 11203 13338 gene locus_tag LOCUS_06100 11203 13338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 13366 14613 gene locus_tag LOCUS_06110 13366 14613 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338236.1 protein_id gnl|my_center|LOCUS_06110 14610 15464 gene locus_tag LOCUS_06120 14610 15464 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_06120 15461 15733 gene locus_tag LOCUS_06130 15461 15733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 15776 16171 gene locus_tag LOCUS_06140 15776 16171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 16182 16505 gene locus_tag LOCUS_06150 gene trxA 16182 16505 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943892.1 protein_id gnl|my_center|LOCUS_06150 17223 16573 gene locus_tag LOCUS_06160 17223 16573 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339435.1 protein_id gnl|my_center|LOCUS_06160 18335 17238 gene locus_tag LOCUS_06170 18335 17238 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_06170 19397 18447 gene locus_tag LOCUS_06180 19397 18447 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057878.1 protein_id gnl|my_center|LOCUS_06180 19967 19482 gene locus_tag LOCUS_06190 19967 19482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 20529 21656 gene locus_tag LOCUS_06200 20529 21656 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_06200 21698 22762 gene locus_tag LOCUS_06210 21698 22762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 22807 23733 gene locus_tag LOCUS_06220 22807 23733 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229027.1 protein_id gnl|my_center|LOCUS_06220 >Feature sequence027 173 248 gene locus_tag LOCUS_t00050 173 248 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 312 701 gene locus_tag LOCUS_06230 312 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 688 1164 gene locus_tag LOCUS_06240 688 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 1161 1742 gene locus_tag LOCUS_06250 1161 1742 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133795409.1 protein_id gnl|my_center|LOCUS_06250 1777 3186 gene locus_tag LOCUS_06260 1777 3186 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056076.1 protein_id gnl|my_center|LOCUS_06260 3275 5536 gene locus_tag LOCUS_06270 gene ppk1 3275 5536 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225804.1 protein_id gnl|my_center|LOCUS_06270 6721 5621 gene locus_tag LOCUS_06280 gene ychF 6721 5621 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_06280 8102 6798 gene locus_tag LOCUS_06290 8102 6798 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112637.1 protein_id gnl|my_center|LOCUS_06290 9060 8209 gene locus_tag LOCUS_06300 9060 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803961.1 protein_id gnl|my_center|LOCUS_06300 9303 10475 gene locus_tag LOCUS_06310 9303 10475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 10543 10824 gene locus_tag LOCUS_06320 10543 10824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 10889 11569 gene locus_tag LOCUS_06330 gene trmD 10889 11569 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_06330 11583 11969 gene locus_tag LOCUS_06340 gene rplS 11583 11969 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068669.1 protein_id gnl|my_center|LOCUS_06340 12370 12185 gene locus_tag LOCUS_06350 12370 12185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 12275 14203 gene locus_tag LOCUS_06360 gene tkt 12275 14203 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193030.1 protein_id gnl|my_center|LOCUS_06360 14926 14279 gene locus_tag LOCUS_06370 gene can 14926 14279 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036740.1 protein_id gnl|my_center|LOCUS_06370 15311 15024 gene locus_tag LOCUS_06380 15311 15024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 17347 15386 gene locus_tag LOCUS_06390 17347 15386 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990002.1 protein_id gnl|my_center|LOCUS_06390 18786 17368 gene locus_tag LOCUS_06400 18786 17368 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_06400 19148 18861 gene locus_tag LOCUS_06410 19148 18861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 19269 20087 gene locus_tag LOCUS_06420 19269 20087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06420 20138 20905 gene locus_tag LOCUS_06430 20138 20905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 22278 20923 gene locus_tag LOCUS_06440 22278 20923 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084183.1 protein_id gnl|my_center|LOCUS_06440 23209 22349 gene locus_tag LOCUS_06450 gene hemC 23209 22349 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970392.1 protein_id gnl|my_center|LOCUS_06450 >Feature sequence028 1533 889 gene locus_tag LOCUS_06460 1533 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 2288 1530 gene locus_tag LOCUS_06470 2288 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 3502 2285 gene locus_tag LOCUS_06480 3502 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 4731 3499 gene locus_tag LOCUS_06490 4731 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 5672 4728 gene locus_tag LOCUS_06500 5672 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 7034 5949 gene locus_tag LOCUS_06510 7034 5949 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037174.1 protein_id gnl|my_center|LOCUS_06510 8228 7038 gene locus_tag LOCUS_06520 8228 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 8986 8225 gene locus_tag LOCUS_06530 8986 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 9942 8983 gene locus_tag LOCUS_06540 9942 8983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 11564 9942 gene locus_tag LOCUS_06550 11564 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 12382 11561 gene locus_tag LOCUS_06560 12382 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 12281 12568 gene locus_tag LOCUS_06570 12281 12568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 13530 12499 gene locus_tag LOCUS_06580 13530 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 14456 13527 gene locus_tag LOCUS_06590 14456 13527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 15043 14453 gene locus_tag LOCUS_06600 15043 14453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 16122 15040 gene locus_tag LOCUS_06610 16122 15040 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194788.1 protein_id gnl|my_center|LOCUS_06610 16988 16161 gene locus_tag LOCUS_06620 16988 16161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 18535 17324 gene locus_tag LOCUS_06630 18535 17324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 19467 18544 gene locus_tag LOCUS_06640 19467 18544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 20198 19464 gene locus_tag LOCUS_06650 20198 19464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 21511 20573 gene locus_tag LOCUS_06660 21511 20573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 22763 21576 gene locus_tag LOCUS_06670 gene glf 22763 21576 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401105.1 protein_id gnl|my_center|LOCUS_06670 <23607 22816 gene locus_tag LOCUS_06680 <23607 22816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942151.1:ABC transporter ATP-binding protein >Feature sequence029 <1 573 gene locus_tag LOCUS_06690 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104454.1:TonB-dependent receptor 608 1759 gene locus_tag LOCUS_06700 608 1759 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031837.1 protein_id gnl|my_center|LOCUS_06700 1880 2689 gene locus_tag LOCUS_06710 gene proC 1880 2689 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931771.1 protein_id gnl|my_center|LOCUS_06710 4050 2719 gene locus_tag LOCUS_06720 4050 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 4230 5264 gene locus_tag LOCUS_06730 4230 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 5369 5674 gene locus_tag LOCUS_06740 5369 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 5671 6090 gene locus_tag LOCUS_06750 5671 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 6297 7793 gene locus_tag LOCUS_06760 6297 7793 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797086.1 protein_id gnl|my_center|LOCUS_06760 7923 8306 gene locus_tag LOCUS_06770 7923 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 8434 8688 gene locus_tag LOCUS_06780 8434 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 8699 9121 gene locus_tag LOCUS_06790 8699 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 9081 9569 gene locus_tag LOCUS_06800 9081 9569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 9566 9937 gene locus_tag LOCUS_06810 9566 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 10062 11747 gene locus_tag LOCUS_06820 10062 11747 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390062.1 protein_id gnl|my_center|LOCUS_06820 11837 12358 gene locus_tag LOCUS_06830 11837 12358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 14225 12882 gene locus_tag LOCUS_06840 14225 12882 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583823.1 protein_id gnl|my_center|LOCUS_06840 14351 16141 gene locus_tag LOCUS_06850 gene argS 14351 16141 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225071.1 protein_id gnl|my_center|LOCUS_06850 16207 16971 gene locus_tag LOCUS_06860 16207 16971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 16982 18556 gene locus_tag LOCUS_06870 16982 18556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 18682 20382 gene locus_tag LOCUS_06880 18682 20382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 20478 20726 gene locus_tag LOCUS_06890 20478 20726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 20723 22354 gene locus_tag LOCUS_06900 20723 22354 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958458.1 protein_id gnl|my_center|LOCUS_06900 22392 22694 gene locus_tag LOCUS_06910 22392 22694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence030 10215 7927 gene locus_tag LOCUS_06920 10215 7927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 11975 10260 gene locus_tag LOCUS_06930 11975 10260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 12895 11972 gene locus_tag LOCUS_06940 12895 11972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 13133 15583 gene locus_tag LOCUS_06950 13133 15583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 16355 15555 gene locus_tag LOCUS_06960 16355 15555 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940460.1 protein_id gnl|my_center|LOCUS_06960 17877 16375 gene locus_tag LOCUS_06970 17877 16375 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_06970 19100 18126 gene locus_tag LOCUS_06980 19100 18126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 19486 19253 gene locus_tag LOCUS_06990 19486 19253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 19582 20154 gene locus_tag LOCUS_07000 19582 20154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 20225 20677 gene locus_tag LOCUS_07010 20225 20677 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_07010 20743 21162 gene locus_tag LOCUS_07020 20743 21162 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_07020 21297 23150 gene locus_tag LOCUS_07030 gene glsA 21297 23150 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087566.1 protein_id gnl|my_center|LOCUS_07030 >Feature sequence031 951 1682 gene locus_tag LOCUS_07040 951 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 2870 1998 gene locus_tag LOCUS_07050 2870 1998 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805043.1 protein_id gnl|my_center|LOCUS_07050 3702 2905 gene locus_tag LOCUS_07060 3702 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 5507 3699 gene locus_tag LOCUS_07070 5507 3699 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_07070 6743 5529 gene locus_tag LOCUS_07080 6743 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 7351 6782 gene locus_tag LOCUS_07090 gene pgiA 7351 6782 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147196.1 protein_id gnl|my_center|LOCUS_07090 8335 7376 gene locus_tag LOCUS_07100 8335 7376 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922076.1 protein_id gnl|my_center|LOCUS_07100 8429 9280 gene locus_tag LOCUS_07110 8429 9280 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815312.1 protein_id gnl|my_center|LOCUS_07110 10744 9287 gene locus_tag LOCUS_07120 10744 9287 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027550.1 protein_id gnl|my_center|LOCUS_07120 12210 10741 gene locus_tag LOCUS_07130 12210 10741 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976375.1 protein_id gnl|my_center|LOCUS_07130 13857 12271 gene locus_tag LOCUS_07140 13857 12271 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240529.1 protein_id gnl|my_center|LOCUS_07140 18451 13895 gene locus_tag LOCUS_07150 18451 13895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 21922 18455 gene locus_tag LOCUS_07160 21922 18455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 >Feature sequence032 1792 911 gene locus_tag LOCUS_07170 1792 911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141403.1 protein_id gnl|my_center|LOCUS_07170 2891 1854 gene locus_tag LOCUS_07180 2891 1854 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141359.1 protein_id gnl|my_center|LOCUS_07180 3814 2945 gene locus_tag LOCUS_07190 3814 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07190 3912 4337 gene locus_tag LOCUS_07200 gene aroQ 3912 4337 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932862.1 protein_id gnl|my_center|LOCUS_07200 4422 4496 gene locus_tag LOCUS_t00060 4422 4496 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5401 4538 gene locus_tag LOCUS_07210 5401 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 5453 6055 gene locus_tag LOCUS_07220 5453 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 7584 6181 gene locus_tag LOCUS_07230 7584 6181 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_07230 8572 7634 gene locus_tag LOCUS_07240 8572 7634 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705171.1 protein_id gnl|my_center|LOCUS_07240 11710 8615 gene locus_tag LOCUS_07250 11710 8615 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040502.1 protein_id gnl|my_center|LOCUS_07250 12876 11770 gene locus_tag LOCUS_07260 12876 11770 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391447.1 protein_id gnl|my_center|LOCUS_07260 13346 12966 gene locus_tag LOCUS_07270 gene gcvH 13346 12966 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899040.1 protein_id gnl|my_center|LOCUS_07270 14468 13368 gene locus_tag LOCUS_07280 gene gcvT 14468 13368 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_07280 15080 14571 gene locus_tag LOCUS_07290 15080 14571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 15198 16049 gene locus_tag LOCUS_07300 gene lgt 15198 16049 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481391.1 protein_id gnl|my_center|LOCUS_07300 16749 16027 gene locus_tag LOCUS_07310 gene pxpA 16749 16027 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935993.1 protein_id gnl|my_center|LOCUS_07310 18455 16746 gene locus_tag LOCUS_07320 gene pxpB 18455 16746 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480148.1 protein_id gnl|my_center|LOCUS_07320 18653 19285 gene locus_tag LOCUS_07330 18653 19285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 19376 20959 gene locus_tag LOCUS_07340 19376 20959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 >Feature sequence033 1220 132 gene locus_tag LOCUS_07350 gene rhaT 1220 132 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_07350 2673 1249 gene locus_tag LOCUS_07360 2673 1249 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976070.1 protein_id gnl|my_center|LOCUS_07360 2833 3741 gene locus_tag LOCUS_07370 2833 3741 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526198.1 protein_id gnl|my_center|LOCUS_07370 4090 5109 gene locus_tag LOCUS_07380 4090 5109 CDS product arabinose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210589.1 protein_id gnl|my_center|LOCUS_07380 5147 6670 gene locus_tag LOCUS_07390 gene araG 5147 6670 CDS product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705779.1 protein_id gnl|my_center|LOCUS_07390 6667 7653 gene locus_tag LOCUS_07400 gene araH 6667 7653 CDS product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705780.1 protein_id gnl|my_center|LOCUS_07400 8199 9560 gene locus_tag LOCUS_07410 gene ogl 8199 9560 CDS product oligogalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816209.1 protein_id gnl|my_center|LOCUS_07410 9637 10491 gene locus_tag LOCUS_07420 9637 10491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 10692 11813 gene locus_tag LOCUS_07430 10692 11813 CDS product WYL domain-containing transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582487.1 protein_id gnl|my_center|LOCUS_07430 11875 12075 gene locus_tag LOCUS_07440 11875 12075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 12235 12465 gene locus_tag LOCUS_07450 12235 12465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 12502 14895 gene locus_tag LOCUS_07460 12502 14895 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_07460 15094 15840 gene locus_tag LOCUS_07470 gene cas5c 15094 15840 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_07470 15837 17639 gene locus_tag LOCUS_07480 gene cas8c 15837 17639 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392033.1 protein_id gnl|my_center|LOCUS_07480 17685 18539 gene locus_tag LOCUS_07490 gene cas7c 17685 18539 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932804.1 protein_id gnl|my_center|LOCUS_07490 18580 18792 gene locus_tag LOCUS_07500 18580 18792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 19115 18789 gene locus_tag LOCUS_07510 19115 18789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 19002 19325 gene locus_tag LOCUS_07520 19002 19325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 19346 20014 gene locus_tag LOCUS_07530 gene cas4 19346 20014 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388587.1 protein_id gnl|my_center|LOCUS_07530 20078 21115 gene locus_tag LOCUS_07540 gene cas1c 20078 21115 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392030.1 protein_id gnl|my_center|LOCUS_07540 21131 21427 gene locus_tag LOCUS_07550 gene cas2 21131 21427 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932801.1 protein_id gnl|my_center|LOCUS_07550 21613 22006 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgccccggtcttcggatcggggcgcggattgaaac >Feature sequence034 576 2120 gene locus_tag LOCUS_07560 576 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 3237 2143 gene locus_tag LOCUS_07570 gene hisC 3237 2143 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_07570 3957 3283 gene locus_tag LOCUS_07580 3957 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 4990 3989 gene locus_tag LOCUS_07590 gene floA 4990 3989 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_07590 5509 5042 gene locus_tag LOCUS_07600 5509 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 6961 5519 gene locus_tag LOCUS_07610 6961 5519 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943068.1 protein_id gnl|my_center|LOCUS_07610 7072 8010 gene locus_tag LOCUS_07620 7072 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526695.1 protein_id gnl|my_center|LOCUS_07620 8036 8377 gene locus_tag LOCUS_07630 8036 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 8388 8930 gene locus_tag LOCUS_07640 8388 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 8990 10234 gene locus_tag LOCUS_07650 8990 10234 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_07650 10279 10608 gene locus_tag LOCUS_07660 10279 10608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 10673 12307 gene locus_tag LOCUS_07670 gene ubiB 10673 12307 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 protein_id gnl|my_center|LOCUS_07670 14301 12325 gene locus_tag LOCUS_07680 14301 12325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 16007 14352 gene locus_tag LOCUS_07690 16007 14352 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169351683.1 protein_id gnl|my_center|LOCUS_07690 16274 16897 gene locus_tag LOCUS_07700 16274 16897 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703862.1 protein_id gnl|my_center|LOCUS_07700 16951 17358 gene locus_tag LOCUS_07710 16951 17358 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076559.1 protein_id gnl|my_center|LOCUS_07710 17477 17839 gene locus_tag LOCUS_07720 17477 17839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 17941 18393 gene locus_tag LOCUS_07730 17941 18393 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263462.1 protein_id gnl|my_center|LOCUS_07730 18646 20937 gene locus_tag LOCUS_07740 18646 20937 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037676.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence035 950 474 gene locus_tag LOCUS_07750 950 474 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005919085.1 protein_id gnl|my_center|LOCUS_07750 1806 1099 gene locus_tag LOCUS_07760 1806 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 2973 1888 gene locus_tag LOCUS_07770 gene galK 2973 1888 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707767.1 protein_id gnl|my_center|LOCUS_07770 3360 3121 gene locus_tag LOCUS_07780 3360 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 4256 3357 gene locus_tag LOCUS_07790 4256 3357 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479587.1 protein_id gnl|my_center|LOCUS_07790 4603 5673 gene locus_tag LOCUS_07800 4603 5673 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057409.1 protein_id gnl|my_center|LOCUS_07800 5777 6766 gene locus_tag LOCUS_07810 5777 6766 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119517.1 protein_id gnl|my_center|LOCUS_07810 8062 6854 gene locus_tag LOCUS_07820 8062 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 8855 8154 gene locus_tag LOCUS_07830 8855 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 8918 9754 gene locus_tag LOCUS_07840 8918 9754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 11161 9773 gene locus_tag LOCUS_07850 11161 9773 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919252.1 protein_id gnl|my_center|LOCUS_07850 12056 11238 gene locus_tag LOCUS_07860 12056 11238 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968304.1 protein_id gnl|my_center|LOCUS_07860 12623 12132 gene locus_tag LOCUS_07870 12623 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 13753 12713 gene locus_tag LOCUS_07880 13753 12713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 13856 14800 gene locus_tag LOCUS_07890 13856 14800 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_07890 14850 15875 gene locus_tag LOCUS_07900 14850 15875 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_07900 15900 16625 gene locus_tag LOCUS_07910 15900 16625 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804151.1 protein_id gnl|my_center|LOCUS_07910 16857 16645 gene locus_tag LOCUS_07920 16857 16645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 17497 16838 gene locus_tag LOCUS_07930 17497 16838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 17822 17676 gene locus_tag LOCUS_07940 17822 17676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 17959 19437 gene locus_tag LOCUS_07950 17959 19437 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056829.1 protein_id gnl|my_center|LOCUS_07950 19543 20493 gene locus_tag LOCUS_07960 19543 20493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 20572 21138 gene locus_tag LOCUS_07970 20572 21138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence036 <1 826 gene locus_tag LOCUS_07980 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942903.1:Gfo/Idh/MocA family oxidoreductase 884 2032 gene locus_tag LOCUS_07990 gene lpxB 884 2032 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_07990 2824 2750 gene locus_tag LOCUS_t00070 2824 2750 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4677 2923 gene locus_tag LOCUS_08000 4677 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 6287 4674 gene locus_tag LOCUS_08010 6287 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 6844 6284 gene locus_tag LOCUS_08020 6844 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 8877 6889 gene locus_tag LOCUS_08030 8877 6889 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973426.1 protein_id gnl|my_center|LOCUS_08030 9202 10131 gene locus_tag LOCUS_08040 9202 10131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 11460 10300 gene locus_tag LOCUS_08050 gene dinB 11460 10300 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_08050 11830 11507 gene locus_tag LOCUS_08060 11830 11507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 13428 11965 gene locus_tag LOCUS_08070 13428 11965 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921402.1 protein_id gnl|my_center|LOCUS_08070 13950 13534 gene locus_tag LOCUS_08080 13950 13534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 14219 13947 gene locus_tag LOCUS_08090 14219 13947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 14421 17183 gene locus_tag LOCUS_08100 14421 17183 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943088.1 protein_id gnl|my_center|LOCUS_08100 17289 18512 gene locus_tag LOCUS_08110 gene odhB 17289 18512 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918229.1 protein_id gnl|my_center|LOCUS_08110 18625 20013 gene locus_tag LOCUS_08120 gene lpdA 18625 20013 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083281.1 protein_id gnl|my_center|LOCUS_08120 20116 20253 gene locus_tag LOCUS_08130 20116 20253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 20355 20765 gene locus_tag LOCUS_08140 20355 20765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 20755 21054 gene locus_tag LOCUS_08150 20755 21054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence037 <1 996 gene locus_tag LOCUS_08160 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000428021.1:chromosomal replication initiator protein DnaA 1153 1737 gene locus_tag LOCUS_08170 1153 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1862 3874 gene locus_tag LOCUS_08180 1862 3874 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080037.1 protein_id gnl|my_center|LOCUS_08180 4195 3905 gene locus_tag LOCUS_08190 4195 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 7797 4516 gene locus_tag LOCUS_08200 7797 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 9360 7813 gene locus_tag LOCUS_08210 9360 7813 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_08210 10455 9511 gene locus_tag LOCUS_08220 gene fba 10455 9511 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_08220 11554 10619 gene locus_tag LOCUS_08230 11554 10619 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118908.1 protein_id gnl|my_center|LOCUS_08230 12697 11681 gene locus_tag LOCUS_08240 gene gmd 12697 11681 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941289.1 protein_id gnl|my_center|LOCUS_08240 12841 13383 gene locus_tag LOCUS_08250 12841 13383 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085781.1 protein_id gnl|my_center|LOCUS_08250 13380 13664 gene locus_tag LOCUS_08260 13380 13664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 14091 13753 gene locus_tag LOCUS_08270 14091 13753 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_08270 15581 14130 gene locus_tag LOCUS_08280 15581 14130 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163308.1 protein_id gnl|my_center|LOCUS_08280 20778 15913 gene locus_tag LOCUS_08290 20778 15913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence038 <1 762 gene locus_tag LOCUS_08300 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868238.1:radical SAM protein 759 962 gene locus_tag LOCUS_08310 759 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 1033 2586 gene locus_tag LOCUS_08320 1033 2586 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143249.1 protein_id gnl|my_center|LOCUS_08320 3566 2583 gene locus_tag LOCUS_08330 3566 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 3772 4242 gene locus_tag LOCUS_08340 3772 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 4380 4580 gene locus_tag LOCUS_08350 4380 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 4592 5485 gene locus_tag LOCUS_08360 4592 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 5482 6249 gene locus_tag LOCUS_08370 5482 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 6246 7301 gene locus_tag LOCUS_08380 6246 7301 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173990.1 protein_id gnl|my_center|LOCUS_08380 7879 12321 gene locus_tag LOCUS_08390 7879 12321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 12947 12516 gene locus_tag LOCUS_08400 12947 12516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 13249 12944 gene locus_tag LOCUS_08410 13249 12944 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 protein_id gnl|my_center|LOCUS_08410 13981 13532 gene locus_tag LOCUS_08420 13981 13532 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173892.1 protein_id gnl|my_center|LOCUS_08420 14863 14075 gene locus_tag LOCUS_08430 14863 14075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 15978 14860 gene locus_tag LOCUS_08440 15978 14860 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121410.1 protein_id gnl|my_center|LOCUS_08440 16626 15988 gene locus_tag LOCUS_08450 16626 15988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 17609 16992 gene locus_tag LOCUS_08460 17609 16992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 18373 17795 gene locus_tag LOCUS_08470 18373 17795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 19922 18465 gene locus_tag LOCUS_08480 19922 18465 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226386.1 protein_id gnl|my_center|LOCUS_08480 <20817 19939 gene locus_tag LOCUS_08490 <20817 19939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003099345.1:malate dehydrogenase (quinone) >Feature sequence039 70 627 gene locus_tag LOCUS_08500 70 627 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142491.1 protein_id gnl|my_center|LOCUS_08500 653 1771 gene locus_tag LOCUS_08510 653 1771 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_08510 1833 4946 gene locus_tag LOCUS_08520 1833 4946 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943409.1 protein_id gnl|my_center|LOCUS_08520 4962 6350 gene locus_tag LOCUS_08530 4962 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 6553 6269 gene locus_tag LOCUS_08540 6553 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 6465 9410 gene locus_tag LOCUS_08550 6465 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 9803 9471 gene locus_tag LOCUS_08560 9803 9471 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929420.1 protein_id gnl|my_center|LOCUS_08560 9869 10096 gene locus_tag LOCUS_08570 9869 10096 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151363.1 protein_id gnl|my_center|LOCUS_08570 10109 11140 gene locus_tag LOCUS_08580 10109 11140 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_08580 11137 14394 gene locus_tag LOCUS_08590 11137 14394 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_08590 14466 14762 gene locus_tag LOCUS_08600 14466 14762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 14837 15028 gene locus_tag LOCUS_08610 14837 15028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 15834 15046 gene locus_tag LOCUS_08620 gene ymdB 15834 15046 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_08620 17118 15913 gene locus_tag LOCUS_08630 17118 15913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 18463 17156 gene locus_tag LOCUS_08640 18463 17156 CDS product DUF2029 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838851.1 protein_id gnl|my_center|LOCUS_08640 19971 18460 gene locus_tag LOCUS_08650 19971 18460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 20102 20503 gene locus_tag LOCUS_08660 20102 20503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence040 54 4085 gene locus_tag LOCUS_08670 54 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 4312 5280 gene locus_tag LOCUS_08680 4312 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 5453 6214 gene locus_tag LOCUS_08690 gene gldF 5453 6214 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_08690 6323 7795 gene locus_tag LOCUS_08700 6323 7795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 7905 9851 gene locus_tag LOCUS_08710 7905 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 9942 12710 gene locus_tag LOCUS_08720 9942 12710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 12772 16308 gene locus_tag LOCUS_08730 12772 16308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 17261 16323 gene locus_tag LOCUS_08740 gene miaA 17261 16323 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224257.1 protein_id gnl|my_center|LOCUS_08740 17346 18536 gene locus_tag LOCUS_08750 17346 18536 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_08750 18545 19495 gene locus_tag LOCUS_08760 18545 19495 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_08760 19562 20413 gene locus_tag LOCUS_08770 19562 20413 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_08770 >Feature sequence041 <1 1779 gene locus_tag LOCUS_08780 <1 1779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202510.1:glycoside hydrolase family 2 TIM barrel-domain containing protein 2442 1795 gene locus_tag LOCUS_08790 2442 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 5001 2662 gene locus_tag LOCUS_08800 5001 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 7053 5113 gene locus_tag LOCUS_08810 7053 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 9387 7069 gene locus_tag LOCUS_08820 9387 7069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 9494 10669 gene locus_tag LOCUS_08830 9494 10669 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427756.1 protein_id gnl|my_center|LOCUS_08830 11389 10676 gene locus_tag LOCUS_08840 11389 10676 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880976.1 protein_id gnl|my_center|LOCUS_08840 13236 11428 gene locus_tag LOCUS_08850 13236 11428 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084504.1 protein_id gnl|my_center|LOCUS_08850 13379 14665 gene locus_tag LOCUS_08860 13379 14665 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_08860 14659 15165 gene locus_tag LOCUS_08870 14659 15165 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038821.1 protein_id gnl|my_center|LOCUS_08870 16786 15230 gene locus_tag LOCUS_08880 16786 15230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 16922 17722 gene locus_tag LOCUS_08890 16922 17722 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_08890 18297 17764 gene locus_tag LOCUS_08900 18297 17764 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039192.1 protein_id gnl|my_center|LOCUS_08900 19354 18401 gene locus_tag LOCUS_08910 19354 18401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 20591 19425 gene locus_tag LOCUS_08920 20591 19425 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071740.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence042 2535 1021 gene locus_tag LOCUS_08930 2535 1021 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073366.1 protein_id gnl|my_center|LOCUS_08930 3920 2562 gene locus_tag LOCUS_08940 3920 2562 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120382.1 protein_id gnl|my_center|LOCUS_08940 5475 3955 gene locus_tag LOCUS_08950 5475 3955 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073366.1 protein_id gnl|my_center|LOCUS_08950 6878 5496 gene locus_tag LOCUS_08960 6878 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 7788 6895 gene locus_tag LOCUS_08970 7788 6895 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_08970 9845 7827 gene locus_tag LOCUS_08980 9845 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 13187 9966 gene locus_tag LOCUS_08990 13187 9966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 16149 13192 gene locus_tag LOCUS_09000 16149 13192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 16436 16281 gene locus_tag LOCUS_09010 16436 16281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 16688 18805 gene locus_tag LOCUS_09020 16688 18805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 19306 18830 gene locus_tag LOCUS_09030 19306 18830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence043 1 693 gene locus_tag LOCUS_09040 1 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 852 2150 gene locus_tag LOCUS_09050 852 2150 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_09050 3275 2163 gene locus_tag LOCUS_09060 gene moeB 3275 2163 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404770.1 protein_id gnl|my_center|LOCUS_09060 4026 3301 gene locus_tag LOCUS_09070 4026 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 4153 4863 gene locus_tag LOCUS_09080 gene pdxJ 4153 4863 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818969.1 protein_id gnl|my_center|LOCUS_09080 4875 5270 gene locus_tag LOCUS_09090 gene acpS 4875 5270 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871448.1 protein_id gnl|my_center|LOCUS_09090 5282 6751 gene locus_tag LOCUS_09100 5282 6751 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142234.1 protein_id gnl|my_center|LOCUS_09100 6828 7955 gene locus_tag LOCUS_09110 gene dprA 6828 7955 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_09110 8671 7961 gene locus_tag LOCUS_09120 gene rsmG 8671 7961 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036454143.1 protein_id gnl|my_center|LOCUS_09120 9017 8679 gene locus_tag LOCUS_09130 9017 8679 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_09130 9682 9029 gene locus_tag LOCUS_09140 9682 9029 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775976.1 protein_id gnl|my_center|LOCUS_09140 10955 9891 gene locus_tag LOCUS_09150 gene lpxD 10955 9891 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939642.1 protein_id gnl|my_center|LOCUS_09150 11830 11072 gene locus_tag LOCUS_09160 11830 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 12669 11884 gene locus_tag LOCUS_09170 12669 11884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 13435 12761 gene locus_tag LOCUS_09180 13435 12761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 15943 13490 gene locus_tag LOCUS_09190 gene bamA 15943 13490 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_09190 17441 15924 gene locus_tag LOCUS_09200 gene dnaB 17441 15924 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546182.1 protein_id gnl|my_center|LOCUS_09200 18029 17502 gene locus_tag LOCUS_09210 gene rplI 18029 17502 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_09210 18603 18106 gene locus_tag LOCUS_09220 18603 18106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 18942 18643 gene locus_tag LOCUS_09230 18942 18643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 >Feature sequence044 1241 2089 gene locus_tag LOCUS_09240 gene tatC 1241 2089 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015780.1 protein_id gnl|my_center|LOCUS_09240 2693 2106 gene locus_tag LOCUS_09250 2693 2106 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_09250 2580 2789 gene locus_tag LOCUS_09260 2580 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 2786 4375 gene locus_tag LOCUS_09270 gene serA 2786 4375 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_09270 4506 5204 gene locus_tag LOCUS_09280 gene plsY 4506 5204 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016461.1 protein_id gnl|my_center|LOCUS_09280 5281 6582 gene locus_tag LOCUS_09290 5281 6582 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_09290 6722 7939 gene locus_tag LOCUS_09300 6722 7939 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545682.1 protein_id gnl|my_center|LOCUS_09300 8000 9361 gene locus_tag LOCUS_09310 gene thrC 8000 9361 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_09310 9386 9634 gene locus_tag LOCUS_09320 9386 9634 CDS product DUF3253 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035426.1 protein_id gnl|my_center|LOCUS_09320 9780 12437 gene locus_tag LOCUS_09330 9780 12437 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146858.1 protein_id gnl|my_center|LOCUS_09330 12458 13111 gene locus_tag LOCUS_09340 12458 13111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 13686 13186 gene locus_tag LOCUS_09350 13686 13186 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087459.1 protein_id gnl|my_center|LOCUS_09350 13755 14885 gene locus_tag LOCUS_09360 13755 14885 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087110.1 protein_id gnl|my_center|LOCUS_09360 17188 14951 gene locus_tag LOCUS_09370 gene vpsO 17188 14951 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_09370 17681 17208 gene locus_tag LOCUS_09380 17681 17208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 19061 17913 gene locus_tag LOCUS_09390 19061 17913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 >Feature sequence045 1367 366 gene locus_tag LOCUS_09400 1367 366 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084368.1 protein_id gnl|my_center|LOCUS_09400 1415 2557 gene locus_tag LOCUS_09410 1415 2557 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918523.1 protein_id gnl|my_center|LOCUS_09410 3266 2490 gene locus_tag LOCUS_09420 3266 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 3886 3311 gene locus_tag LOCUS_09430 3886 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 4577 3930 gene locus_tag LOCUS_09440 4577 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 4729 5655 gene locus_tag LOCUS_09450 4729 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 6109 5672 gene locus_tag LOCUS_09460 6109 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 6223 7305 gene locus_tag LOCUS_09470 6223 7305 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_09470 7990 7295 gene locus_tag LOCUS_09480 7990 7295 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819224.1 protein_id gnl|my_center|LOCUS_09480 8187 9596 gene locus_tag LOCUS_09490 8187 9596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 9620 9919 gene locus_tag LOCUS_09500 9620 9919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 9986 11659 gene locus_tag LOCUS_09510 9986 11659 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_09510 11656 12735 gene locus_tag LOCUS_09520 11656 12735 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218938748.1 protein_id gnl|my_center|LOCUS_09520 13357 12713 gene locus_tag LOCUS_09530 13357 12713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 13472 14506 gene locus_tag LOCUS_09540 gene aroF 13472 14506 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545770.1 protein_id gnl|my_center|LOCUS_09540 15557 14553 gene locus_tag LOCUS_09550 15557 14553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09550 18743 15630 gene locus_tag LOCUS_09560 18743 15630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence046 2581 467 gene locus_tag LOCUS_09570 2581 467 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620752.1 protein_id gnl|my_center|LOCUS_09570 2543 2812 gene locus_tag LOCUS_09580 2543 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 4405 3230 gene locus_tag LOCUS_09590 4405 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 6134 4572 gene locus_tag LOCUS_09600 6134 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 9365 6486 gene locus_tag LOCUS_09610 9365 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 9742 9969 gene locus_tag LOCUS_09620 9742 9969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 12996 9991 gene locus_tag LOCUS_09630 12996 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 15062 13077 gene locus_tag LOCUS_09640 15062 13077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 17582 15078 gene locus_tag LOCUS_09650 17582 15078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 <18914 17616 gene locus_tag LOCUS_09660 <18914 17616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036450.1:beta-galactosidase GalA >Feature sequence047 194 2512 gene locus_tag LOCUS_09670 194 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 2661 5210 gene locus_tag LOCUS_09680 2661 5210 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639999.1 protein_id gnl|my_center|LOCUS_09680 5253 6362 gene locus_tag LOCUS_09690 5253 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 6697 8124 gene locus_tag LOCUS_09700 6697 8124 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026984.1 protein_id gnl|my_center|LOCUS_09700 8149 10125 gene locus_tag LOCUS_09710 8149 10125 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108865.1 protein_id gnl|my_center|LOCUS_09710 10130 12013 gene locus_tag LOCUS_09720 10130 12013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 12077 14437 gene locus_tag LOCUS_09730 12077 14437 CDS product DUF5703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765773.1 protein_id gnl|my_center|LOCUS_09730 16401 14647 gene locus_tag LOCUS_09740 16401 14647 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482859.1 protein_id gnl|my_center|LOCUS_09740 17865 16477 gene locus_tag LOCUS_09750 17865 16477 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence048 <1 873 gene locus_tag LOCUS_09760 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776921.1:glycoside hydrolase family 27 protein 1350 937 gene locus_tag LOCUS_09770 1350 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1475 2500 gene locus_tag LOCUS_09780 1475 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 3771 2533 gene locus_tag LOCUS_09790 gene hemW 3771 2533 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_09790 3805 4722 gene locus_tag LOCUS_09800 3805 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 5665 4799 gene locus_tag LOCUS_09810 gene prmC 5665 4799 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886891.1 protein_id gnl|my_center|LOCUS_09810 6916 5789 gene locus_tag LOCUS_09820 gene prfA 6916 5789 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680455.1 protein_id gnl|my_center|LOCUS_09820 7080 8114 gene locus_tag LOCUS_09830 7080 8114 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658378.1 protein_id gnl|my_center|LOCUS_09830 8340 9722 gene locus_tag LOCUS_09840 8340 9722 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671775.1 protein_id gnl|my_center|LOCUS_09840 9912 10751 gene locus_tag LOCUS_09850 9912 10751 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_09850 11818 10967 gene locus_tag LOCUS_09860 11818 10967 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257299.1 protein_id gnl|my_center|LOCUS_09860 13395 11872 gene locus_tag LOCUS_09870 13395 11872 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460435.1 protein_id gnl|my_center|LOCUS_09870 14931 13441 gene locus_tag LOCUS_09880 14931 13441 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392501.1 protein_id gnl|my_center|LOCUS_09880 16985 15099 gene locus_tag LOCUS_09890 gene nuoL 16985 15099 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_09890 17472 17131 gene locus_tag LOCUS_09900 gene nuoK 17472 17131 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_09900 18045 17530 gene locus_tag LOCUS_09910 18045 17530 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061937.1 protein_id gnl|my_center|LOCUS_09910 <18753 18196 gene locus_tag LOCUS_09920 <18753 18196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103015646.1:NADH-quinone oxidoreductase subunit I >Feature sequence049 502 1065 gene locus_tag LOCUS_09930 502 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 2054 3070 gene locus_tag LOCUS_09940 2054 3070 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085206.1 protein_id gnl|my_center|LOCUS_09940 4071 3067 gene locus_tag LOCUS_09950 4071 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 4137 5918 gene locus_tag LOCUS_09960 4137 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 9998 5946 gene locus_tag LOCUS_09970 9998 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 13958 10089 gene locus_tag LOCUS_09980 13958 10089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 15497 14526 gene locus_tag LOCUS_09990 15497 14526 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061680.1 protein_id gnl|my_center|LOCUS_09990 16104 17069 gene locus_tag LOCUS_10000 16104 17069 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence050 3627 1630 gene locus_tag LOCUS_10010 gene rhgW 3627 1630 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_10010 7440 3631 gene locus_tag LOCUS_10020 7440 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 7628 8647 gene locus_tag LOCUS_10030 7628 8647 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385746.1 protein_id gnl|my_center|LOCUS_10030 9692 10480 gene locus_tag LOCUS_10040 9692 10480 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144228759.1 protein_id gnl|my_center|LOCUS_10040 10573 15717 gene locus_tag LOCUS_10050 10573 15717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 15743 17407 gene locus_tag LOCUS_10060 15743 17407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence051 <1 810 gene locus_tag LOCUS_10070 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_061474328.1:pectinesterase family protein 2433 811 gene locus_tag LOCUS_10080 2433 811 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055228983.1 protein_id gnl|my_center|LOCUS_10080 3331 2444 gene locus_tag LOCUS_10090 3331 2444 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389847.1 protein_id gnl|my_center|LOCUS_10090 4698 3328 gene locus_tag LOCUS_10100 4698 3328 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_10100 4981 6480 gene locus_tag LOCUS_10110 4981 6480 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109116.1 protein_id gnl|my_center|LOCUS_10110 6487 8166 gene locus_tag LOCUS_10120 6487 8166 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061474328.1 protein_id gnl|my_center|LOCUS_10120 8194 10365 gene locus_tag LOCUS_10130 8194 10365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 13621 10415 gene locus_tag LOCUS_10140 13621 10415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 13964 17542 gene locus_tag LOCUS_10150 13964 17542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence052 5162 3837 gene locus_tag LOCUS_10160 5162 3837 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_10160 7043 5343 gene locus_tag LOCUS_10170 7043 5343 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_10170 8172 7090 gene locus_tag LOCUS_10180 8172 7090 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_10180 9932 8208 gene locus_tag LOCUS_10190 9932 8208 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_10190 12015 9997 gene locus_tag LOCUS_10200 12015 9997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 12797 12198 gene locus_tag LOCUS_10210 gene coaE 12797 12198 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172233.1 protein_id gnl|my_center|LOCUS_10210 12858 13724 gene locus_tag LOCUS_10220 12858 13724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 13770 15305 gene locus_tag LOCUS_10230 13770 15305 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_10230 15331 16401 gene locus_tag LOCUS_10240 15331 16401 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651665.1 protein_id gnl|my_center|LOCUS_10240 16483 16737 gene locus_tag LOCUS_10250 16483 16737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence053 2258 327 gene locus_tag LOCUS_10260 2258 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 3166 2255 gene locus_tag LOCUS_10270 3166 2255 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_10270 3509 5533 gene locus_tag LOCUS_10280 3509 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 5547 6734 gene locus_tag LOCUS_10290 gene glf 5547 6734 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872005.1 protein_id gnl|my_center|LOCUS_10290 6744 10100 gene locus_tag LOCUS_10300 6744 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 10097 11806 gene locus_tag LOCUS_10310 10097 11806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 11832 13871 gene locus_tag LOCUS_10320 11832 13871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 13904 14620 gene locus_tag LOCUS_10330 13904 14620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 14727 15326 gene locus_tag LOCUS_10340 14727 15326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 15344 16885 gene locus_tag LOCUS_10350 15344 16885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence054 628 948 gene locus_tag LOCUS_10360 628 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 959 1348 gene locus_tag LOCUS_10370 959 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 2887 1799 gene locus_tag LOCUS_10380 2887 1799 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074249.1 protein_id gnl|my_center|LOCUS_10380 3912 2980 gene locus_tag LOCUS_10390 gene cysW 3912 2980 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 protein_id gnl|my_center|LOCUS_10390 4848 4021 gene locus_tag LOCUS_10400 gene cysT 4848 4021 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942000.1 protein_id gnl|my_center|LOCUS_10400 5934 4924 gene locus_tag LOCUS_10410 5934 4924 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941999.1 protein_id gnl|my_center|LOCUS_10410 7427 5982 gene locus_tag LOCUS_10420 7427 5982 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403196.1 protein_id gnl|my_center|LOCUS_10420 7759 7562 gene locus_tag LOCUS_10430 7759 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 8397 7798 gene locus_tag LOCUS_10440 8397 7798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 9260 8478 gene locus_tag LOCUS_10450 9260 8478 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_10450 9345 9698 gene locus_tag LOCUS_10460 9345 9698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 11337 9862 gene locus_tag LOCUS_10470 11337 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 12084 11350 gene locus_tag LOCUS_10480 12084 11350 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173744.1 protein_id gnl|my_center|LOCUS_10480 13001 12276 gene locus_tag LOCUS_10490 13001 12276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 13216 14547 gene locus_tag LOCUS_10500 13216 14547 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence055 423 1631 gene locus_tag LOCUS_10510 423 1631 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_10510 2546 1665 gene locus_tag LOCUS_10520 2546 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4502 2574 gene locus_tag LOCUS_10530 4502 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 8397 4528 gene locus_tag LOCUS_10540 8397 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 8620 11244 gene locus_tag LOCUS_10550 gene leuS 8620 11244 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_10550 11359 12201 gene locus_tag LOCUS_10560 11359 12201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 12280 13440 gene locus_tag LOCUS_10570 12280 13440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 13459 14118 gene locus_tag LOCUS_10580 13459 14118 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185660149.1 protein_id gnl|my_center|LOCUS_10580 14141 16309 gene locus_tag LOCUS_10590 gene vpsO 14141 16309 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_10590 >Feature sequence056 776 1606 gene locus_tag LOCUS_10600 776 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 1603 3249 gene locus_tag LOCUS_10610 1603 3249 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_10610 3246 5237 gene locus_tag LOCUS_10620 3246 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 7510 5555 gene locus_tag LOCUS_10630 7510 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 9153 7624 gene locus_tag LOCUS_10640 9153 7624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 13287 9253 gene locus_tag LOCUS_10650 13287 9253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 14362 13346 gene locus_tag LOCUS_10660 14362 13346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 15643 14582 gene locus_tag LOCUS_10670 15643 14582 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969219.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence057 3 1247 gene locus_tag LOCUS_10680 3 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943169.1 protein_id gnl|my_center|LOCUS_10680 1269 1685 gene locus_tag LOCUS_10690 1269 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1756 3210 gene locus_tag LOCUS_10700 1756 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 4689 3247 gene locus_tag LOCUS_10710 4689 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 6037 4700 gene locus_tag LOCUS_10720 gene glmM 6037 4700 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_10720 7092 6034 gene locus_tag LOCUS_10730 gene trpD 7092 6034 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057551.1 protein_id gnl|my_center|LOCUS_10730 7180 8181 gene locus_tag LOCUS_10740 gene bacA 7180 8181 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707770.1 protein_id gnl|my_center|LOCUS_10740 8334 8513 gene locus_tag LOCUS_10750 8334 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 8552 9658 gene locus_tag LOCUS_10760 gene plsX 8552 9658 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_10760 9676 10659 gene locus_tag LOCUS_10770 9676 10659 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258268.1 protein_id gnl|my_center|LOCUS_10770 10668 11726 gene locus_tag LOCUS_10780 10668 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 11757 12293 gene locus_tag LOCUS_10790 11757 12293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 12416 13084 gene locus_tag LOCUS_10800 gene rpe 12416 13084 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992061.1 protein_id gnl|my_center|LOCUS_10800 13105 13662 gene locus_tag LOCUS_10810 gene pyrR 13105 13662 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224613.1 protein_id gnl|my_center|LOCUS_10810 13759 14703 gene locus_tag LOCUS_10820 13759 14703 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_10820 14741 15127 gene locus_tag LOCUS_10830 14741 15127 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_10830 15214 16509 gene locus_tag LOCUS_10840 15214 16509 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence058 1695 1234 gene locus_tag LOCUS_10850 1695 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2083 3039 gene locus_tag LOCUS_10860 2083 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 4182 3262 gene locus_tag LOCUS_10870 4182 3262 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393325.1 protein_id gnl|my_center|LOCUS_10870 4294 5370 gene locus_tag LOCUS_10880 4294 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 5679 7064 gene locus_tag LOCUS_10890 5679 7064 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_10890 7197 8213 gene locus_tag LOCUS_10900 7197 8213 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 protein_id gnl|my_center|LOCUS_10900 8283 9173 gene locus_tag LOCUS_10910 8283 9173 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442682.1 protein_id gnl|my_center|LOCUS_10910 9261 10076 gene locus_tag LOCUS_10920 9261 10076 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324929.1 protein_id gnl|my_center|LOCUS_10920 10171 11442 gene locus_tag LOCUS_10930 10171 11442 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_10930 11612 13372 gene locus_tag LOCUS_10940 11612 13372 CDS product NirA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967420.1 protein_id gnl|my_center|LOCUS_10940 13376 15106 gene locus_tag LOCUS_10950 13376 15106 CDS product sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970681.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence059 <1 1254 gene locus_tag LOCUS_10960 <1 1254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546248.1:DNA-directed RNA polymerase subunit beta' 2553 2071 gene locus_tag LOCUS_10970 2553 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 5153 2586 gene locus_tag LOCUS_10980 5153 2586 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_10980 5677 5246 gene locus_tag LOCUS_10990 5677 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 5860 6405 gene locus_tag LOCUS_11000 5860 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 7290 6550 gene locus_tag LOCUS_11010 gene sodA 7290 6550 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887922.1 protein_id gnl|my_center|LOCUS_11010 7906 7370 gene locus_tag LOCUS_11020 7906 7370 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704795.1 protein_id gnl|my_center|LOCUS_11020 9417 7918 gene locus_tag LOCUS_11030 9417 7918 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044917.1 protein_id gnl|my_center|LOCUS_11030 9631 11688 gene locus_tag LOCUS_11040 9631 11688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 11705 12469 gene locus_tag LOCUS_11050 11705 12469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 16096 12587 gene locus_tag LOCUS_11060 16096 12587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence060 3982 3215 gene locus_tag LOCUS_11070 3982 3215 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11070 4070 4507 gene locus_tag LOCUS_11080 4070 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 4929 4531 gene locus_tag LOCUS_11090 gene apaG 4929 4531 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815381.1 protein_id gnl|my_center|LOCUS_11090 5076 5813 gene locus_tag LOCUS_11100 5076 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 5945 7492 gene locus_tag LOCUS_11110 gene purH 5945 7492 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932012.1 protein_id gnl|my_center|LOCUS_11110 8715 7525 gene locus_tag LOCUS_11120 8715 7525 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706445.1 protein_id gnl|my_center|LOCUS_11120 9006 8776 gene locus_tag LOCUS_11130 9006 8776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 10648 9119 gene locus_tag LOCUS_11140 10648 9119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 10752 11372 gene locus_tag LOCUS_11150 10752 11372 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_11150 11736 11431 gene locus_tag LOCUS_11160 11736 11431 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 protein_id gnl|my_center|LOCUS_11160 11906 11733 gene locus_tag LOCUS_11170 11906 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 14065 11909 gene locus_tag LOCUS_11180 gene feoB 14065 11909 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249665.1 protein_id gnl|my_center|LOCUS_11180 14469 14224 gene locus_tag LOCUS_11190 14469 14224 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722680.1 protein_id gnl|my_center|LOCUS_11190 14866 14603 gene locus_tag LOCUS_11200 14866 14603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 15267 14956 gene locus_tag LOCUS_11210 15267 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 <16340 15310 gene locus_tag LOCUS_11220 <16340 15310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140538.1:PD40 domain-containing protein >Feature sequence061 2444 4531 gene locus_tag LOCUS_11230 2444 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 4792 5703 gene locus_tag LOCUS_11240 4792 5703 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922152.1 protein_id gnl|my_center|LOCUS_11240 6991 5780 gene locus_tag LOCUS_11250 6991 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 7108 8901 gene locus_tag LOCUS_11260 7108 8901 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 protein_id gnl|my_center|LOCUS_11260 8926 10263 gene locus_tag LOCUS_11270 8926 10263 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929473.1 protein_id gnl|my_center|LOCUS_11270 12118 10325 gene locus_tag LOCUS_11280 gene aspS 12118 10325 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460332.1 protein_id gnl|my_center|LOCUS_11280 13415 12246 gene locus_tag LOCUS_11290 13415 12246 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_11290 14935 13478 gene locus_tag LOCUS_11300 14935 13478 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_11300 15661 15933 gene locus_tag LOCUS_11310 15661 15933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence062 80 7 gene locus_tag LOCUS_t00080 80 7 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 196 122 gene locus_tag LOCUS_t00090 196 122 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 339 265 gene locus_tag LOCUS_t00100 339 265 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 469 663 gene locus_tag LOCUS_11320 gene rpmI 469 663 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874083.1 protein_id gnl|my_center|LOCUS_11320 746 1129 gene locus_tag LOCUS_11330 gene rplT 746 1129 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300683.1 protein_id gnl|my_center|LOCUS_11330 1401 2444 gene locus_tag LOCUS_11340 gene pheS 1401 2444 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_11340 2572 5034 gene locus_tag LOCUS_11350 gene pheT 2572 5034 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498186.1 protein_id gnl|my_center|LOCUS_11350 5114 5401 gene locus_tag LOCUS_11360 gene gatC 5114 5401 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_11360 9888 5410 gene locus_tag LOCUS_11370 9888 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 10434 11906 gene locus_tag LOCUS_11380 gene gatA 10434 11906 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_11380 11970 13436 gene locus_tag LOCUS_11390 gene gatB 11970 13436 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence063 484 2562 gene locus_tag LOCUS_11400 484 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 2573 4366 gene locus_tag LOCUS_11410 2573 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 5303 4344 gene locus_tag LOCUS_11420 5303 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 7358 5490 gene locus_tag LOCUS_11430 7358 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 8853 7402 gene locus_tag LOCUS_11440 8853 7402 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_11440 10235 8886 gene locus_tag LOCUS_11450 10235 8886 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_11450 11795 10308 gene locus_tag LOCUS_11460 11795 10308 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555683.1 protein_id gnl|my_center|LOCUS_11460 <16041 11813 gene locus_tag LOCUS_11470 <16041 11813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030298.1:polysaccharide lyase 8 family protein >Feature sequence064 <1 1456 gene locus_tag LOCUS_11480 <1 1456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064327.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB 1535 1969 gene locus_tag LOCUS_11490 1535 1969 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146390657.1 protein_id gnl|my_center|LOCUS_11490 2093 2632 gene locus_tag LOCUS_11500 2093 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 2622 3263 gene locus_tag LOCUS_11510 gene gmk 2622 3263 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025239507.1 protein_id gnl|my_center|LOCUS_11510 3358 3747 gene locus_tag LOCUS_11520 3358 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 4158 3787 gene locus_tag LOCUS_11530 4158 3787 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920154.1 protein_id gnl|my_center|LOCUS_11530 4922 4272 gene locus_tag LOCUS_11540 4922 4272 CDS product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130512.1 protein_id gnl|my_center|LOCUS_11540 5553 4993 gene locus_tag LOCUS_11550 5553 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11550 6385 5585 gene locus_tag LOCUS_11560 gene panB 6385 5585 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443983.1 protein_id gnl|my_center|LOCUS_11560 6479 8257 gene locus_tag LOCUS_11570 6479 8257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 8229 9722 gene locus_tag LOCUS_11580 gene glpK 8229 9722 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229157.1 protein_id gnl|my_center|LOCUS_11580 9719 11209 gene locus_tag LOCUS_11590 9719 11209 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887662.1 protein_id gnl|my_center|LOCUS_11590 12700 11231 gene locus_tag LOCUS_11600 12700 11231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 12765 13232 gene locus_tag LOCUS_11610 12765 13232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 14580 13249 gene locus_tag LOCUS_11620 14580 13249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 15413 14679 gene locus_tag LOCUS_11630 15413 14679 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence065 499 6642 gene locus_tag LOCUS_11640 499 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 6681 7235 gene locus_tag LOCUS_11650 6681 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 7232 8335 gene locus_tag LOCUS_11660 7232 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 9435 8359 gene locus_tag LOCUS_11670 9435 8359 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_11670 10967 9465 gene locus_tag LOCUS_11680 10967 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 11184 12188 gene locus_tag LOCUS_11690 11184 12188 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529529.1 protein_id gnl|my_center|LOCUS_11690 12388 12140 gene locus_tag LOCUS_11700 12388 12140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 12324 13856 gene locus_tag LOCUS_11710 12324 13856 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922314.1 protein_id gnl|my_center|LOCUS_11710 13969 15039 gene locus_tag LOCUS_11720 13969 15039 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118199.1 protein_id gnl|my_center|LOCUS_11720 15776 15573 gene locus_tag LOCUS_11730 15776 15573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 >Feature sequence066 1 159 gene locus_tag LOCUS_11740 1 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 254 1237 gene locus_tag LOCUS_11750 254 1237 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970872.1 protein_id gnl|my_center|LOCUS_11750 1274 2002 gene locus_tag LOCUS_11760 1274 2002 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970873.1 protein_id gnl|my_center|LOCUS_11760 2072 2740 gene locus_tag LOCUS_11770 2072 2740 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115288.1 protein_id gnl|my_center|LOCUS_11770 2815 3243 gene locus_tag LOCUS_11780 gene folB 2815 3243 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227765.1 protein_id gnl|my_center|LOCUS_11780 3263 3751 gene locus_tag LOCUS_11790 gene folK 3263 3751 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_11790 3776 5092 gene locus_tag LOCUS_11800 gene pabB 3776 5092 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393598.1 protein_id gnl|my_center|LOCUS_11800 5248 6816 gene locus_tag LOCUS_11810 5248 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 6832 7689 gene locus_tag LOCUS_11820 6832 7689 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265901.1 protein_id gnl|my_center|LOCUS_11820 7816 9048 gene locus_tag LOCUS_11830 7816 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 9697 9194 gene locus_tag LOCUS_11840 9697 9194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 11859 9745 gene locus_tag LOCUS_11850 gene bamA 11859 9745 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039863.1 protein_id gnl|my_center|LOCUS_11850 15524 11856 gene locus_tag LOCUS_11860 15524 11856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence067 1149 2339 gene locus_tag LOCUS_11870 1149 2339 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616381.1 protein_id gnl|my_center|LOCUS_11870 2359 2769 gene locus_tag LOCUS_11880 2359 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 2852 5596 gene locus_tag LOCUS_11890 2852 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 7008 5593 gene locus_tag LOCUS_11900 gene uxaC 7008 5593 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_11900 7835 7062 gene locus_tag LOCUS_11910 7835 7062 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_11910 9014 7848 gene locus_tag LOCUS_11920 9014 7848 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_11920 9118 10200 gene locus_tag LOCUS_11930 9118 10200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 11446 10220 gene locus_tag LOCUS_11940 11446 10220 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_11940 11670 12083 gene locus_tag LOCUS_11950 11670 12083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 13062 12121 gene locus_tag LOCUS_11960 gene argF 13062 12121 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023243.1 protein_id gnl|my_center|LOCUS_11960 14406 13186 gene locus_tag LOCUS_11970 14406 13186 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_11970 15402 14488 gene locus_tag LOCUS_11980 gene argB 15402 14488 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence068 731 1747 gene locus_tag LOCUS_11990 731 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1863 2597 gene locus_tag LOCUS_12000 1863 2597 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364547.1 protein_id gnl|my_center|LOCUS_12000 2615 3142 gene locus_tag LOCUS_12010 2615 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 4858 3149 gene locus_tag LOCUS_12020 4858 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 6617 4872 gene locus_tag LOCUS_12030 6617 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 6735 7586 gene locus_tag LOCUS_12040 6735 7586 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084213.1 protein_id gnl|my_center|LOCUS_12040 7607 8968 gene locus_tag LOCUS_12050 gene aroA 7607 8968 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332883.1 protein_id gnl|my_center|LOCUS_12050 8983 9657 gene locus_tag LOCUS_12060 gene cmk 8983 9657 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_12060 9669 10334 gene locus_tag LOCUS_12070 9669 10334 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869529.1 protein_id gnl|my_center|LOCUS_12070 10492 10914 gene locus_tag LOCUS_12080 10492 10914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 13521 10927 gene locus_tag LOCUS_12090 13521 10927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 14058 13651 gene locus_tag LOCUS_12100 14058 13651 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597725.1 protein_id gnl|my_center|LOCUS_12100 15034 14069 gene locus_tag LOCUS_12110 gene pdxA 15034 14069 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974959.1 protein_id gnl|my_center|LOCUS_12110 <15590 15031 gene locus_tag LOCUS_12120 <15590 15031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546244.1:acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase >Feature sequence069 2012 2626 gene locus_tag LOCUS_12130 2012 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 3254 4144 gene locus_tag LOCUS_12140 3254 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 5128 4166 gene locus_tag LOCUS_12150 5128 4166 CDS product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848418.1 protein_id gnl|my_center|LOCUS_12150 6360 5431 gene locus_tag LOCUS_12160 6360 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 7774 6401 gene locus_tag LOCUS_12170 7774 6401 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112635.1 protein_id gnl|my_center|LOCUS_12170 9197 7860 gene locus_tag LOCUS_12180 9197 7860 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705187.1 protein_id gnl|my_center|LOCUS_12180 11890 9194 gene locus_tag LOCUS_12190 11890 9194 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727571.1 protein_id gnl|my_center|LOCUS_12190 12719 11880 gene locus_tag LOCUS_12200 12719 11880 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088901.1 protein_id gnl|my_center|LOCUS_12200 13529 13014 gene locus_tag LOCUS_12210 13529 13014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 <15512 13620 gene locus_tag LOCUS_12220 <15512 13620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004187807.1:aconitate hydratase AcnA >Feature sequence070 260 3310 gene locus_tag LOCUS_12230 260 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 3334 5055 gene locus_tag LOCUS_12240 3334 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109095.1 protein_id gnl|my_center|LOCUS_12240 6837 5161 gene locus_tag LOCUS_12250 6837 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 8312 6840 gene locus_tag LOCUS_12260 8312 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 9514 8309 gene locus_tag LOCUS_12270 9514 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 10321 9740 gene locus_tag LOCUS_12280 10321 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 11963 10551 gene locus_tag LOCUS_12290 11963 10551 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_12290 12598 12780 gene locus_tag LOCUS_12300 12598 12780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 13765 12872 gene locus_tag LOCUS_12310 13765 12872 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921650.1 protein_id gnl|my_center|LOCUS_12310 13882 14271 gene locus_tag LOCUS_12320 13882 14271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 14284 15219 gene locus_tag LOCUS_12330 14284 15219 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921278.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence071 3925 5061 gene locus_tag LOCUS_12340 3925 5061 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926879.1 protein_id gnl|my_center|LOCUS_12340 5062 5808 gene locus_tag LOCUS_12350 5062 5808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525001.1 protein_id gnl|my_center|LOCUS_12350 5831 6739 gene locus_tag LOCUS_12360 5831 6739 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932240.1 protein_id gnl|my_center|LOCUS_12360 6736 8145 gene locus_tag LOCUS_12370 6736 8145 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063680.1 protein_id gnl|my_center|LOCUS_12370 8155 8754 gene locus_tag LOCUS_12380 8155 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 8782 9357 gene locus_tag LOCUS_12390 8782 9357 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 protein_id gnl|my_center|LOCUS_12390 9350 9625 gene locus_tag LOCUS_12400 9350 9625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 9622 10263 gene locus_tag LOCUS_12410 9622 10263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 10687 10337 gene locus_tag LOCUS_12420 10687 10337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 11414 10746 gene locus_tag LOCUS_12430 11414 10746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 12189 11431 gene locus_tag LOCUS_12440 12189 11431 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031344.1 protein_id gnl|my_center|LOCUS_12440 13277 12186 gene locus_tag LOCUS_12450 gene recF 13277 12186 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940680.1 protein_id gnl|my_center|LOCUS_12450 13436 15226 gene locus_tag LOCUS_12460 13436 15226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence072 1351 293 gene locus_tag LOCUS_12470 1351 293 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583478.1 protein_id gnl|my_center|LOCUS_12470 1916 1401 gene locus_tag LOCUS_12480 1916 1401 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389735.1 protein_id gnl|my_center|LOCUS_12480 2066 2374 gene locus_tag LOCUS_12490 2066 2374 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359499.1 protein_id gnl|my_center|LOCUS_12490 2418 3014 gene locus_tag LOCUS_12500 gene recR 2418 3014 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228798.1 protein_id gnl|my_center|LOCUS_12500 3011 4708 gene locus_tag LOCUS_12510 3011 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 4774 4848 gene locus_tag LOCUS_t00110 4774 4848 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5271 4858 gene locus_tag LOCUS_12520 5271 4858 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391320.1 protein_id gnl|my_center|LOCUS_12520 5265 5435 gene locus_tag LOCUS_12530 5265 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 5448 6455 gene locus_tag LOCUS_12540 5448 6455 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 protein_id gnl|my_center|LOCUS_12540 7365 6418 gene locus_tag LOCUS_12550 7365 6418 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940569.1 protein_id gnl|my_center|LOCUS_12550 7464 8885 gene locus_tag LOCUS_12560 gene leuC 7464 8885 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173294.1 protein_id gnl|my_center|LOCUS_12560 8996 9601 gene locus_tag LOCUS_12570 gene leuD 8996 9601 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228533.1 protein_id gnl|my_center|LOCUS_12570 12708 9613 gene locus_tag LOCUS_12580 gene dnaE2 12708 9613 CDS product error-prone DNA polymerase DnaE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908228.1 protein_id gnl|my_center|LOCUS_12580 14168 12708 gene locus_tag LOCUS_12590 14168 12708 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928130.1 protein_id gnl|my_center|LOCUS_12590 14818 14165 gene locus_tag LOCUS_12600 14818 14165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence073 926 471 gene locus_tag LOCUS_12610 926 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1161 913 gene locus_tag LOCUS_12620 1161 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1387 1917 gene locus_tag LOCUS_12630 1387 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 4902 2185 gene locus_tag LOCUS_12640 4902 2185 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201935.1 protein_id gnl|my_center|LOCUS_12640 7362 4936 gene locus_tag LOCUS_12650 7362 4936 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583217.1 protein_id gnl|my_center|LOCUS_12650 7576 8727 gene locus_tag LOCUS_12660 7576 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 11503 9002 gene locus_tag LOCUS_12670 11503 9002 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225834.1 protein_id gnl|my_center|LOCUS_12670 13221 11698 gene locus_tag LOCUS_12680 13221 11698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 14833 13289 gene locus_tag LOCUS_12690 14833 13289 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261398.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence074 493 1998 gene locus_tag LOCUS_12700 493 1998 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118376.1 protein_id gnl|my_center|LOCUS_12700 2243 2902 gene locus_tag LOCUS_12710 2243 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 3176 3427 gene locus_tag LOCUS_12720 3176 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3981 3388 gene locus_tag LOCUS_12730 3981 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 4387 3938 gene locus_tag LOCUS_12740 4387 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 4767 4393 gene locus_tag LOCUS_12750 4767 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 4862 5404 gene locus_tag LOCUS_12760 4862 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 5764 5681 gene locus_tag LOCUS_t00120 5764 5681 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6665 6228 gene locus_tag LOCUS_12770 6665 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 8069 6942 gene locus_tag LOCUS_12780 8069 6942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 8569 8066 gene locus_tag LOCUS_12790 8569 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 9473 8637 gene locus_tag LOCUS_12800 gene menB 9473 8637 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058289.1 protein_id gnl|my_center|LOCUS_12800 9583 11496 gene locus_tag LOCUS_12810 9583 11496 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942985.1 protein_id gnl|my_center|LOCUS_12810 13194 11512 gene locus_tag LOCUS_12820 gene menD 13194 11512 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055985.1 protein_id gnl|my_center|LOCUS_12820 14746 13331 gene locus_tag LOCUS_12830 gene pchA 14746 13331 CDS product isochorismate synthase PchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114686.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence075 2374 146 gene locus_tag LOCUS_12840 2374 146 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038863.1 protein_id gnl|my_center|LOCUS_12840 2528 2782 gene locus_tag LOCUS_12850 2528 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 3533 2799 gene locus_tag LOCUS_12860 3533 2799 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705696.1 protein_id gnl|my_center|LOCUS_12860 4428 3559 gene locus_tag LOCUS_12870 4428 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 4567 6087 gene locus_tag LOCUS_12880 gene xylB 4567 6087 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267678.1 protein_id gnl|my_center|LOCUS_12880 6407 7180 gene locus_tag LOCUS_12890 6407 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 7310 7864 gene locus_tag LOCUS_12900 gene wcaF 7310 7864 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153583.1 protein_id gnl|my_center|LOCUS_12900 9635 7869 gene locus_tag LOCUS_12910 gene lnt 9635 7869 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391521.1 protein_id gnl|my_center|LOCUS_12910 10137 9904 gene locus_tag LOCUS_12920 10137 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 11429 10230 gene locus_tag LOCUS_12930 11429 10230 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_12930 11931 11443 gene locus_tag LOCUS_12940 11931 11443 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968070.1 protein_id gnl|my_center|LOCUS_12940 12075 13958 gene locus_tag LOCUS_12950 12075 13958 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640139.1 protein_id gnl|my_center|LOCUS_12950 14710 13985 gene locus_tag LOCUS_12960 14710 13985 CDS product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206288.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence076 302 1567 gene locus_tag LOCUS_12970 302 1567 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_12970 2717 1629 gene locus_tag LOCUS_12980 gene pheA 2717 1629 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_12980 3689 2736 gene locus_tag LOCUS_12990 3689 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 3746 4630 gene locus_tag LOCUS_13000 3746 4630 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195023.1 protein_id gnl|my_center|LOCUS_13000 4781 6598 gene locus_tag LOCUS_13010 gene typA 4781 6598 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_13010 7355 6702 gene locus_tag LOCUS_13020 7355 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 7416 9920 gene locus_tag LOCUS_13030 7416 9920 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920510.1 protein_id gnl|my_center|LOCUS_13030 9952 10836 gene locus_tag LOCUS_13040 9952 10836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 10833 11873 gene locus_tag LOCUS_13050 gene hpxD 10833 11873 CDS product molybdenum cofactor-independent xanthine hydroxylase subunit HpxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705426.1 protein_id gnl|my_center|LOCUS_13050 11884 12933 gene locus_tag LOCUS_13060 gene hpxD 11884 12933 CDS product molybdenum cofactor-independent xanthine hydroxylase subunit HpxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705426.1 protein_id gnl|my_center|LOCUS_13060 12930 13949 gene locus_tag LOCUS_13070 12930 13949 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384593.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence077 457 3720 gene locus_tag LOCUS_13080 457 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 4020 5018 gene locus_tag LOCUS_13090 4020 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 5015 5329 gene locus_tag LOCUS_13100 5015 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 5420 6712 gene locus_tag LOCUS_13110 gene dinB 5420 6712 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942261.1 protein_id gnl|my_center|LOCUS_13110 6829 7902 gene locus_tag LOCUS_13120 6829 7902 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387843.1 protein_id gnl|my_center|LOCUS_13120 8510 8307 gene locus_tag LOCUS_13130 8510 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 8448 11540 gene locus_tag LOCUS_13140 8448 11540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence078 1235 810 gene locus_tag LOCUS_13150 gene ruvX 1235 810 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058162.1 protein_id gnl|my_center|LOCUS_13150 2510 1266 gene locus_tag LOCUS_13160 2510 1266 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_13160 2509 2862 gene locus_tag LOCUS_13170 2509 2862 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329766.1 protein_id gnl|my_center|LOCUS_13170 3447 2887 gene locus_tag LOCUS_13180 3447 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 4884 3607 gene locus_tag LOCUS_13190 4884 3607 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_13190 5856 4900 gene locus_tag LOCUS_13200 5856 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 7290 5878 gene locus_tag LOCUS_13210 7290 5878 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403492.1 protein_id gnl|my_center|LOCUS_13210 8196 7465 gene locus_tag LOCUS_13220 gene fliR 8196 7465 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918960.1 protein_id gnl|my_center|LOCUS_13220 8522 8253 gene locus_tag LOCUS_13230 gene fliQ 8522 8253 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_13230 9310 8519 gene locus_tag LOCUS_13240 gene fliP 9310 8519 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_13240 9665 9291 gene locus_tag LOCUS_13250 9665 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 9997 9749 gene locus_tag LOCUS_13260 9997 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 11048 10023 gene locus_tag LOCUS_13270 gene fliM 11048 10023 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870065.1 protein_id gnl|my_center|LOCUS_13270 11637 11053 gene locus_tag LOCUS_13280 11637 11053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 12526 11651 gene locus_tag LOCUS_13290 gene flgG 12526 11651 CDS product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231968.1 protein_id gnl|my_center|LOCUS_13290 12972 12541 gene locus_tag LOCUS_13300 12972 12541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 14240 12981 gene locus_tag LOCUS_13310 14240 12981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 >Feature sequence079 561 109 gene locus_tag LOCUS_13320 561 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1912 647 gene locus_tag LOCUS_13330 1912 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 3367 2174 gene locus_tag LOCUS_13340 3367 2174 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142594.1 protein_id gnl|my_center|LOCUS_13340 3864 3508 gene locus_tag LOCUS_13350 3864 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 4119 5255 gene locus_tag LOCUS_13360 gene ugpC 4119 5255 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_13360 7640 5277 gene locus_tag LOCUS_13370 7640 5277 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391071.1 protein_id gnl|my_center|LOCUS_13370 7831 9108 gene locus_tag LOCUS_13380 7831 9108 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257569.1 protein_id gnl|my_center|LOCUS_13380 10357 9179 gene locus_tag LOCUS_13390 10357 9179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 11704 10367 gene locus_tag LOCUS_13400 11704 10367 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227872.1 protein_id gnl|my_center|LOCUS_13400 12614 11751 gene locus_tag LOCUS_13410 gene accD 12614 11751 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_13410 13403 12648 gene locus_tag LOCUS_13420 13403 12648 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_13420 14188 13400 gene locus_tag LOCUS_13430 gene truA 14188 13400 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence080 1012 491 gene locus_tag LOCUS_13440 1012 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1488 1009 gene locus_tag LOCUS_13450 1488 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 2210 1566 gene locus_tag LOCUS_13460 2210 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 3237 2194 gene locus_tag LOCUS_13470 3237 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 5988 4000 gene locus_tag LOCUS_13480 5988 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 6226 6825 gene locus_tag LOCUS_13490 6226 6825 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818863.1 protein_id gnl|my_center|LOCUS_13490 6836 8203 gene locus_tag LOCUS_13500 gene hflX 6836 8203 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_13500 8243 8316 gene locus_tag LOCUS_t00130 8243 8316 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8795 9247 gene locus_tag LOCUS_13510 8795 9247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 9584 9871 gene locus_tag LOCUS_13520 9584 9871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 9873 11192 gene locus_tag LOCUS_13530 9873 11192 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174384.1 protein_id gnl|my_center|LOCUS_13530 12782 11985 gene locus_tag LOCUS_13540 12782 11985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 12880 13950 gene locus_tag LOCUS_13550 12880 13950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence081 1810 455 gene locus_tag LOCUS_13560 1810 455 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966729.1 protein_id gnl|my_center|LOCUS_13560 3670 1946 gene locus_tag LOCUS_13570 3670 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 3808 4545 gene locus_tag LOCUS_13580 3808 4545 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975026.1 protein_id gnl|my_center|LOCUS_13580 5934 4804 gene locus_tag LOCUS_13590 5934 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 6273 7871 gene locus_tag LOCUS_13600 6273 7871 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037529.1 protein_id gnl|my_center|LOCUS_13600 7916 8992 gene locus_tag LOCUS_13610 7916 8992 CDS product DUF4380 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039215.1 protein_id gnl|my_center|LOCUS_13610 <14098 9150 gene locus_tag LOCUS_13620 <14098 9150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence082 641 1609 gene locus_tag LOCUS_13630 641 1609 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107223.1 protein_id gnl|my_center|LOCUS_13630 1768 3738 gene locus_tag LOCUS_13640 1768 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 4010 5209 gene locus_tag LOCUS_13650 4010 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 7231 5462 gene locus_tag LOCUS_13660 gene ptsP 7231 5462 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_13660 8231 7344 gene locus_tag LOCUS_13670 8231 7344 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968859.1 protein_id gnl|my_center|LOCUS_13670 8350 10827 gene locus_tag LOCUS_13680 8350 10827 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390312.1 protein_id gnl|my_center|LOCUS_13680 10940 11833 gene locus_tag LOCUS_13690 10940 11833 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390313.1 protein_id gnl|my_center|LOCUS_13690 13777 11846 gene locus_tag LOCUS_13700 13777 11846 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838081.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence083 <1 947 gene locus_tag LOCUS_13710 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001350463.1:YghX family hydrolase 1728 1036 gene locus_tag LOCUS_13720 1728 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 2071 1748 gene locus_tag LOCUS_13730 2071 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 2594 3505 gene locus_tag LOCUS_13740 2594 3505 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_13740 3568 4902 gene locus_tag LOCUS_13750 3568 4902 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_13750 5356 6048 gene locus_tag LOCUS_13760 5356 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 6071 10525 gene locus_tag LOCUS_13770 6071 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 10807 12348 gene locus_tag LOCUS_13780 10807 12348 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110815093.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence084 3758 609 gene locus_tag LOCUS_13790 3758 609 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_13790 5488 3755 gene locus_tag LOCUS_13800 5488 3755 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482859.1 protein_id gnl|my_center|LOCUS_13800 7653 5599 gene locus_tag LOCUS_13810 7653 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 9407 7764 gene locus_tag LOCUS_13820 9407 7764 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766268.1 protein_id gnl|my_center|LOCUS_13820 9585 10433 gene locus_tag LOCUS_13830 9585 10433 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974053.1 protein_id gnl|my_center|LOCUS_13830 <13885 10459 gene locus_tag LOCUS_13840 <13885 10459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107129.1:heparinase II/III family protein >Feature sequence085 118 981 gene locus_tag LOCUS_13850 gene rpsB 118 981 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223862.1 protein_id gnl|my_center|LOCUS_13850 1011 1607 gene locus_tag LOCUS_13860 gene tsf 1011 1607 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545220.1 protein_id gnl|my_center|LOCUS_13860 1687 2100 gene locus_tag LOCUS_13870 1687 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 2514 3725 gene locus_tag LOCUS_13880 2514 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 3777 3974 gene locus_tag LOCUS_13890 3777 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 3998 4366 gene locus_tag LOCUS_13900 3998 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 4781 4380 gene locus_tag LOCUS_13910 4781 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 5662 4778 gene locus_tag LOCUS_13920 5662 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 6166 5729 gene locus_tag LOCUS_13930 6166 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 6440 7471 gene locus_tag LOCUS_13940 6440 7471 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530581.1 protein_id gnl|my_center|LOCUS_13940 8106 7660 gene locus_tag LOCUS_13950 gene hisI 8106 7660 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088269.1 protein_id gnl|my_center|LOCUS_13950 8539 8234 gene locus_tag LOCUS_13960 8539 8234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 8649 8951 gene locus_tag LOCUS_13970 8649 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 9973 8936 gene locus_tag LOCUS_13980 9973 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 10104 11969 gene locus_tag LOCUS_13990 10104 11969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 11966 13486 gene locus_tag LOCUS_14000 11966 13486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence086 <1 1496 gene locus_tag LOCUS_14010 <1 1496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764376.1:glycoside hydrolase family protein 1542 4046 gene locus_tag LOCUS_14020 1542 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 4257 5750 gene locus_tag LOCUS_14030 4257 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 5812 7569 gene locus_tag LOCUS_14040 5812 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 7584 9881 gene locus_tag LOCUS_14050 7584 9881 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_14050 9878 11422 gene locus_tag LOCUS_14060 9878 11422 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_14060 11537 13264 gene locus_tag LOCUS_14070 11537 13264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence087 190 2511 gene locus_tag LOCUS_14080 190 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 2508 4553 gene locus_tag LOCUS_14090 2508 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14090 5679 4576 gene locus_tag LOCUS_14100 gene leuB 5679 4576 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943508.1 protein_id gnl|my_center|LOCUS_14100 7144 5759 gene locus_tag LOCUS_14110 gene rsmB 7144 5759 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_14110 7675 7190 gene locus_tag LOCUS_14120 7675 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 7866 9209 gene locus_tag LOCUS_14130 gene coxB 7866 9209 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161617907.1 protein_id gnl|my_center|LOCUS_14130 9287 11251 gene locus_tag LOCUS_14140 gene ctaD 9287 11251 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011371630.1 protein_id gnl|my_center|LOCUS_14140 11372 12223 gene locus_tag LOCUS_14150 11372 12223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 12266 12637 gene locus_tag LOCUS_14160 12266 12637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence088 <1 3159 gene locus_tag LOCUS_14170 <1 3159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224655.1:PQQ-dependent sugar dehydrogenase 4123 3320 gene locus_tag LOCUS_14180 4123 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 4958 4143 gene locus_tag LOCUS_14190 4958 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 7627 4991 gene locus_tag LOCUS_14200 7627 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 9992 7866 gene locus_tag LOCUS_14210 9992 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227787.1 protein_id gnl|my_center|LOCUS_14210 12030 10501 gene locus_tag LOCUS_14220 12030 10501 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_14220 12998 12123 gene locus_tag LOCUS_14230 12998 12123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence089 1753 836 gene locus_tag LOCUS_14240 1753 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2678 1791 gene locus_tag LOCUS_14250 2678 1791 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 protein_id gnl|my_center|LOCUS_14250 2874 3824 gene locus_tag LOCUS_14260 2874 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 4899 3835 gene locus_tag LOCUS_14270 4899 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 4986 6644 gene locus_tag LOCUS_14280 4986 6644 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584095.1 protein_id gnl|my_center|LOCUS_14280 6700 8214 gene locus_tag LOCUS_14290 gene araA 6700 8214 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477429.1 protein_id gnl|my_center|LOCUS_14290 8316 9020 gene locus_tag LOCUS_14300 gene araD 8316 9020 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169913.1 protein_id gnl|my_center|LOCUS_14300 9984 9244 gene locus_tag LOCUS_14310 9984 9244 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922137.1 protein_id gnl|my_center|LOCUS_14310 10117 10503 gene locus_tag LOCUS_14320 10117 10503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 10526 12586 gene locus_tag LOCUS_14330 10526 12586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence090 2022 196 gene locus_tag LOCUS_14340 2022 196 CDS product adenine deaminase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085949.1 protein_id gnl|my_center|LOCUS_14340 2179 4869 gene locus_tag LOCUS_14350 2179 4869 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265653.1 protein_id gnl|my_center|LOCUS_14350 8367 4903 gene locus_tag LOCUS_14360 8367 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 9112 8426 gene locus_tag LOCUS_14370 9112 8426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 9236 9829 gene locus_tag LOCUS_14380 9236 9829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 10586 9867 gene locus_tag LOCUS_14390 10586 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 10736 11053 gene locus_tag LOCUS_14400 10736 11053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence091 160 483 gene locus_tag LOCUS_14410 160 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1486 539 gene locus_tag LOCUS_14420 1486 539 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101262.1 protein_id gnl|my_center|LOCUS_14420 3136 1544 gene locus_tag LOCUS_14430 gene rny 3136 1544 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870004.1 protein_id gnl|my_center|LOCUS_14430 3264 6566 gene locus_tag LOCUS_14440 3264 6566 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043589137.1 protein_id gnl|my_center|LOCUS_14440 6677 7477 gene locus_tag LOCUS_14450 6677 7477 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_14450 7495 8694 gene locus_tag LOCUS_14460 7495 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 8691 9005 gene locus_tag LOCUS_14470 8691 9005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 9854 9006 gene locus_tag LOCUS_14480 9854 9006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 10828 9851 gene locus_tag LOCUS_14490 10828 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 11543 10845 gene locus_tag LOCUS_14500 11543 10845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 12545 11550 gene locus_tag LOCUS_14510 12545 11550 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229613.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence092 <1 1122 gene locus_tag LOCUS_14520 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037442.1:DNA mismatch repair endonuclease MutL 1223 1606 gene locus_tag LOCUS_14530 1223 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 1728 4643 gene locus_tag LOCUS_14540 1728 4643 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546856.1 protein_id gnl|my_center|LOCUS_14540 4640 6223 gene locus_tag LOCUS_14550 4640 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200386714.1 protein_id gnl|my_center|LOCUS_14550 6220 7452 gene locus_tag LOCUS_14560 6220 7452 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445149.1 protein_id gnl|my_center|LOCUS_14560 7454 8947 gene locus_tag LOCUS_14570 7454 8947 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_14570 11731 9020 gene locus_tag LOCUS_14580 gene uvrA 11731 9020 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389505.1 protein_id gnl|my_center|LOCUS_14580 12094 12633 gene locus_tag LOCUS_14590 12094 12633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence093 456 695 gene locus_tag LOCUS_14600 456 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 1052 630 gene locus_tag LOCUS_14610 1052 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1526 1107 gene locus_tag LOCUS_14620 1526 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 3117 1540 gene locus_tag LOCUS_14630 3117 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 4831 3155 gene locus_tag LOCUS_14640 4831 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 5923 4835 gene locus_tag LOCUS_14650 5923 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 10064 5949 gene locus_tag LOCUS_14660 10064 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 <12870 10061 gene locus_tag LOCUS_14670 <12870 10061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_204874017.1:helicase-related protein >Feature sequence094 168 386 gene locus_tag LOCUS_14680 168 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 404 727 gene locus_tag LOCUS_14690 404 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 856 1140 gene locus_tag LOCUS_14700 856 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1318 1734 gene locus_tag LOCUS_14710 1318 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 2683 1901 gene locus_tag LOCUS_14720 2683 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 4143 2896 gene locus_tag LOCUS_14730 4143 2896 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372834.1 protein_id gnl|my_center|LOCUS_14730 4745 4221 gene locus_tag LOCUS_14740 4745 4221 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785712.1 protein_id gnl|my_center|LOCUS_14740 5153 4752 gene locus_tag LOCUS_14750 5153 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 5276 6511 gene locus_tag LOCUS_14760 gene ftsA 5276 6511 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545961.1 protein_id gnl|my_center|LOCUS_14760 7250 6528 gene locus_tag LOCUS_14770 7250 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 8334 7330 gene locus_tag LOCUS_14780 8334 7330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 8787 8572 gene locus_tag LOCUS_14790 8787 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 9254 8784 gene locus_tag LOCUS_14800 9254 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 9928 10302 gene locus_tag LOCUS_14810 9928 10302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence095 <1 1273 gene locus_tag LOCUS_14820 <1 1273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921178.1:methyl-accepting chemotaxis protein 1283 3970 gene locus_tag LOCUS_14830 1283 3970 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 protein_id gnl|my_center|LOCUS_14830 5446 3995 gene locus_tag LOCUS_14840 5446 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 6981 5443 gene locus_tag LOCUS_14850 6981 5443 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_14850 7400 8647 gene locus_tag LOCUS_14860 7400 8647 CDS product nucleoside monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615753.1 protein_id gnl|my_center|LOCUS_14860 10480 8654 gene locus_tag LOCUS_14870 gene lepA 10480 8654 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871412.1 protein_id gnl|my_center|LOCUS_14870 11481 10558 gene locus_tag LOCUS_14880 gene fabD 11481 10558 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765648.1 protein_id gnl|my_center|LOCUS_14880 12674 11580 gene locus_tag LOCUS_14890 12674 11580 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880449.1 protein_id gnl|my_center|LOCUS_14890 >Feature sequence096 104 526 gene locus_tag LOCUS_14900 104 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 542 691 gene locus_tag LOCUS_14910 542 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 703 1119 gene locus_tag LOCUS_14920 703 1119 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390235.1 protein_id gnl|my_center|LOCUS_14920 1314 1757 gene locus_tag LOCUS_14930 1314 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 2318 2641 gene locus_tag LOCUS_14940 2318 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 2787 6050 gene locus_tag LOCUS_14950 2787 6050 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 protein_id gnl|my_center|LOCUS_14950 6186 6866 gene locus_tag LOCUS_14960 6186 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 6883 7533 gene locus_tag LOCUS_14970 6883 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 7553 9475 gene locus_tag LOCUS_14980 7553 9475 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_14980 9485 12508 gene locus_tag LOCUS_14990 9485 12508 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202280.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence097 393 1058 gene locus_tag LOCUS_15000 393 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1226 1900 gene locus_tag LOCUS_15010 1226 1900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226991426.1 protein_id gnl|my_center|LOCUS_15010 1897 3138 gene locus_tag LOCUS_15020 1897 3138 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400343.1 protein_id gnl|my_center|LOCUS_15020 3285 5321 gene locus_tag LOCUS_15030 3285 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 5525 8146 gene locus_tag LOCUS_15040 5525 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 8250 8663 gene locus_tag LOCUS_15050 8250 8663 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_15050 8793 11285 gene locus_tag LOCUS_15060 gene gyrA 8793 11285 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545423.1 protein_id gnl|my_center|LOCUS_15060 11758 11967 gene locus_tag LOCUS_15070 11758 11967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 12328 12585 gene locus_tag LOCUS_15080 12328 12585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence098 2846 2070 gene locus_tag LOCUS_15090 2846 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 4860 2992 gene locus_tag LOCUS_15100 4860 2992 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975395.1 protein_id gnl|my_center|LOCUS_15100 6071 4863 gene locus_tag LOCUS_15110 6071 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 7750 6086 gene locus_tag LOCUS_15120 7750 6086 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108604.1 protein_id gnl|my_center|LOCUS_15120 9476 7761 gene locus_tag LOCUS_15130 9476 7761 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108604.1 protein_id gnl|my_center|LOCUS_15130 10954 9545 gene locus_tag LOCUS_15140 10954 9545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 11391 11936 gene locus_tag LOCUS_15150 11391 11936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 12517 11867 gene locus_tag LOCUS_15160 12517 11867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence099 3699 1039 gene locus_tag LOCUS_15170 3699 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 4907 3807 gene locus_tag LOCUS_15180 gene hemH 4907 3807 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962227.1 protein_id gnl|my_center|LOCUS_15180 5022 5723 gene locus_tag LOCUS_15190 5022 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 5839 6765 gene locus_tag LOCUS_15200 gene xerC 5839 6765 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_15200 6966 7901 gene locus_tag LOCUS_15210 6966 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 9555 8065 gene locus_tag LOCUS_15220 gene oadA 9555 8065 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_15220 10376 9582 gene locus_tag LOCUS_15230 10376 9582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 10588 10421 gene locus_tag LOCUS_15240 10588 10421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 10812 10585 gene locus_tag LOCUS_15250 10812 10585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 12113 10809 gene locus_tag LOCUS_15260 12113 10809 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202275.1 protein_id gnl|my_center|LOCUS_15260 12560 12297 gene locus_tag LOCUS_15270 12560 12297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence100 2131 320 gene locus_tag LOCUS_15280 2131 320 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_15280 3572 2193 gene locus_tag LOCUS_15290 3572 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 4492 3644 gene locus_tag LOCUS_15300 gene yfeD 4492 3644 CDS product iron/manganese ABC transporter permease subunit YfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170116.1 protein_id gnl|my_center|LOCUS_15300 5364 4489 gene locus_tag LOCUS_15310 5364 4489 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067127.1 protein_id gnl|my_center|LOCUS_15310 6349 5441 gene locus_tag LOCUS_15320 gene yfeB 6349 5441 CDS product iron/manganese ABC transporter ATP-binding protein YfeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170112.1 protein_id gnl|my_center|LOCUS_15320 7275 6346 gene locus_tag LOCUS_15330 gene yfeA 7275 6346 CDS product iron/manganese ABC transporter substrate-binding protein YfeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170110.1 protein_id gnl|my_center|LOCUS_15330 7437 8411 gene locus_tag LOCUS_15340 gene cysK 7437 8411 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528637.1 protein_id gnl|my_center|LOCUS_15340 8518 10713 gene locus_tag LOCUS_15350 8518 10713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 11786 10725 gene locus_tag LOCUS_15360 11786 10725 CDS product NUP-family purine nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265508.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence101 257 1744 gene locus_tag LOCUS_15370 257 1744 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_15370 1772 2998 gene locus_tag LOCUS_15380 1772 2998 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550279.1 protein_id gnl|my_center|LOCUS_15380 5087 3069 gene locus_tag LOCUS_15390 5087 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 5225 5596 gene locus_tag LOCUS_15400 5225 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 5593 6495 gene locus_tag LOCUS_15410 5593 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 7528 6530 gene locus_tag LOCUS_15420 7528 6530 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 protein_id gnl|my_center|LOCUS_15420 7538 8083 gene locus_tag LOCUS_15430 7538 8083 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_15430 8091 10010 gene locus_tag LOCUS_15440 8091 10010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 10110 11204 gene locus_tag LOCUS_15450 10110 11204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 11307 12176 gene locus_tag LOCUS_15460 11307 12176 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence102 207 965 gene locus_tag LOCUS_15470 207 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1336 2325 gene locus_tag LOCUS_15480 1336 2325 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027278.1 protein_id gnl|my_center|LOCUS_15480 3100 2402 gene locus_tag LOCUS_15490 gene rnc 3100 2402 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938733.1 protein_id gnl|my_center|LOCUS_15490 3894 3097 gene locus_tag LOCUS_15500 3894 3097 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333289.1 protein_id gnl|my_center|LOCUS_15500 4837 4022 gene locus_tag LOCUS_15510 4837 4022 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333288.1 protein_id gnl|my_center|LOCUS_15510 5636 4854 gene locus_tag LOCUS_15520 5636 4854 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_15520 5688 6872 gene locus_tag LOCUS_15530 5688 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 7634 6879 gene locus_tag LOCUS_15540 7634 6879 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_15540 7718 8191 gene locus_tag LOCUS_15550 7718 8191 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439693.1 protein_id gnl|my_center|LOCUS_15550 8254 8835 gene locus_tag LOCUS_15560 8254 8835 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_15560 9729 9094 gene locus_tag LOCUS_15570 9729 9094 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921338.1 protein_id gnl|my_center|LOCUS_15570 11472 9784 gene locus_tag LOCUS_15580 gene ettA 11472 9784 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_15580 <12279 11702 gene locus_tag LOCUS_15590 <12279 11702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000767065.1:AAA family ATPase >Feature sequence103 595 1434 gene locus_tag LOCUS_15600 595 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532387.1 protein_id gnl|my_center|LOCUS_15600 1823 1431 gene locus_tag LOCUS_15610 1823 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 2557 2288 gene locus_tag LOCUS_15620 2557 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 3020 3445 gene locus_tag LOCUS_15630 3020 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 3504 4145 gene locus_tag LOCUS_15640 3504 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 5469 4279 gene locus_tag LOCUS_15650 gene gnfL 5469 4279 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_15650 7780 5540 gene locus_tag LOCUS_15660 7780 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 9944 7845 gene locus_tag LOCUS_15670 9944 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 10339 9941 gene locus_tag LOCUS_15680 10339 9941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence104 4391 1446 gene locus_tag LOCUS_15690 4391 1446 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680902.1 protein_id gnl|my_center|LOCUS_15690 5771 4776 gene locus_tag LOCUS_15700 5771 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 6325 5789 gene locus_tag LOCUS_15710 6325 5789 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842388.1 protein_id gnl|my_center|LOCUS_15710 9205 6611 gene locus_tag LOCUS_15720 9205 6611 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_15720 9634 9248 gene locus_tag LOCUS_15730 9634 9248 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939303.1 protein_id gnl|my_center|LOCUS_15730 10379 9669 gene locus_tag LOCUS_15740 10379 9669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_15740 10437 11138 gene locus_tag LOCUS_15750 10437 11138 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943052.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence105 2795 519 gene locus_tag LOCUS_15760 2795 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 4564 2843 gene locus_tag LOCUS_15770 4564 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 5388 4561 gene locus_tag LOCUS_15780 5388 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 7174 5456 gene locus_tag LOCUS_15790 7174 5456 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123986.1 protein_id gnl|my_center|LOCUS_15790 8508 7216 gene locus_tag LOCUS_15800 8508 7216 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530417.1 protein_id gnl|my_center|LOCUS_15800 8658 9710 gene locus_tag LOCUS_15810 8658 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 11357 9738 gene locus_tag LOCUS_15820 11357 9738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence106 350 1024 gene locus_tag LOCUS_15830 350 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1339 1539 gene locus_tag LOCUS_15840 1339 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1536 1940 gene locus_tag LOCUS_15850 1536 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 2213 4312 gene locus_tag LOCUS_15860 2213 4312 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_15860 4349 5077 gene locus_tag LOCUS_15870 4349 5077 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_15870 5089 5409 gene locus_tag LOCUS_15880 5089 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 7688 5670 gene locus_tag LOCUS_15890 gene acs 7688 5670 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228545.1 protein_id gnl|my_center|LOCUS_15890 7787 9340 gene locus_tag LOCUS_15900 7787 9340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 10286 9384 gene locus_tag LOCUS_15910 10286 9384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 10973 10509 gene locus_tag LOCUS_15920 10973 10509 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389455.1 protein_id gnl|my_center|LOCUS_15920 11653 11566 gene locus_tag LOCUS_t00140 11653 11566 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence107 452 126 gene locus_tag LOCUS_15930 452 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 2113 560 gene locus_tag LOCUS_15940 2113 560 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387812.1 protein_id gnl|my_center|LOCUS_15940 2549 2142 gene locus_tag LOCUS_15950 gene mce 2549 2142 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 protein_id gnl|my_center|LOCUS_15950 2733 4673 gene locus_tag LOCUS_15960 2733 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 4670 6847 gene locus_tag LOCUS_15970 gene scpA 4670 6847 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258367.1 protein_id gnl|my_center|LOCUS_15970 6851 7978 gene locus_tag LOCUS_15980 gene meaB 6851 7978 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_15980 8082 9488 gene locus_tag LOCUS_15990 8082 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 10292 9552 gene locus_tag LOCUS_16000 10292 9552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 11038 10331 gene locus_tag LOCUS_16010 11038 10331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 11768 11166 gene locus_tag LOCUS_16020 gene yihA 11768 11166 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_16020 >Feature sequence108 1553 2839 gene locus_tag LOCUS_16030 1553 2839 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144244.1 protein_id gnl|my_center|LOCUS_16030 2955 2870 gene locus_tag LOCUS_t00150 2955 2870 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3096 3959 gene locus_tag LOCUS_16040 gene purU 3096 3959 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524116.1 protein_id gnl|my_center|LOCUS_16040 4063 4812 gene locus_tag LOCUS_16050 4063 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 4983 5059 gene locus_tag LOCUS_t00160 4983 5059 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5168 5707 gene locus_tag LOCUS_16060 5168 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 5772 6380 gene locus_tag LOCUS_16070 5772 6380 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_16070 6420 7679 gene locus_tag LOCUS_16080 6420 7679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 7952 8761 gene locus_tag LOCUS_16090 7952 8761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_16090 8806 10791 gene locus_tag LOCUS_16100 8806 10791 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050920.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence109 1538 3220 gene locus_tag LOCUS_16110 1538 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 3217 5136 gene locus_tag LOCUS_16120 3217 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 5198 7339 gene locus_tag LOCUS_16130 5198 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 7336 9777 gene locus_tag LOCUS_16140 7336 9777 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203206.1 protein_id gnl|my_center|LOCUS_16140 9761 11170 gene locus_tag LOCUS_16150 9761 11170 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence110 <1 4202 gene locus_tag LOCUS_16160 <1 4202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein 4315 5013 gene locus_tag LOCUS_16170 4315 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 5296 7848 gene locus_tag LOCUS_16180 5296 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 7835 9541 gene locus_tag LOCUS_16190 7835 9541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence111 791 210 gene locus_tag LOCUS_16200 791 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1163 810 gene locus_tag LOCUS_16210 1163 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1325 2386 gene locus_tag LOCUS_16220 1325 2386 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_16220 2462 3289 gene locus_tag LOCUS_16230 2462 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 3289 3822 gene locus_tag LOCUS_16240 3289 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 3870 5780 gene locus_tag LOCUS_16250 gene mrdA 3870 5780 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_16250 6415 5777 gene locus_tag LOCUS_16260 6415 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 8395 6515 gene locus_tag LOCUS_16270 8395 6515 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014996.1 protein_id gnl|my_center|LOCUS_16270 8876 9829 gene locus_tag LOCUS_16280 8876 9829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 10565 10374 gene locus_tag LOCUS_16290 10565 10374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence112 567 1409 gene locus_tag LOCUS_16300 567 1409 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936832.1 protein_id gnl|my_center|LOCUS_16300 1406 1846 gene locus_tag LOCUS_16310 1406 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1933 2907 gene locus_tag LOCUS_16320 1933 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 3192 3419 gene locus_tag LOCUS_16330 3192 3419 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082243.1 protein_id gnl|my_center|LOCUS_16330 3900 3691 gene locus_tag LOCUS_16340 3900 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 4399 3908 gene locus_tag LOCUS_16350 4399 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 8403 4873 gene locus_tag LOCUS_16360 8403 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 9439 8510 gene locus_tag LOCUS_16370 9439 8510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 10491 9763 gene locus_tag LOCUS_16380 10491 9763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 11314 10556 gene locus_tag LOCUS_16390 11314 10556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence113 1689 4103 gene locus_tag LOCUS_16400 1689 4103 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919020.1 protein_id gnl|my_center|LOCUS_16400 4116 5612 gene locus_tag LOCUS_16410 gene gtfA 4116 5612 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974901.1 protein_id gnl|my_center|LOCUS_16410 5624 6865 gene locus_tag LOCUS_16420 5624 6865 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919017.1 protein_id gnl|my_center|LOCUS_16420 6865 7755 gene locus_tag LOCUS_16430 6865 7755 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_16430 8775 7768 gene locus_tag LOCUS_16440 8775 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 8946 9671 gene locus_tag LOCUS_16450 8946 9671 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720869.1 protein_id gnl|my_center|LOCUS_16450 9765 10622 gene locus_tag LOCUS_16460 9765 10622 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259049.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence114 284 1510 gene locus_tag LOCUS_16470 gene nusA 284 1510 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_16470 1558 4218 gene locus_tag LOCUS_16480 1558 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 4310 4690 gene locus_tag LOCUS_16490 gene rbfA 4310 4690 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931934.1 protein_id gnl|my_center|LOCUS_16490 4705 5709 gene locus_tag LOCUS_16500 4705 5709 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_16500 5706 6440 gene locus_tag LOCUS_16510 5706 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 6548 7492 gene locus_tag LOCUS_16520 6548 7492 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532363.1 protein_id gnl|my_center|LOCUS_16520 8554 7502 gene locus_tag LOCUS_16530 gene hprK 8554 7502 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062490.1 protein_id gnl|my_center|LOCUS_16530 9496 8720 gene locus_tag LOCUS_16540 gene lptB 9496 8720 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888765.1 protein_id gnl|my_center|LOCUS_16540 10140 9520 gene locus_tag LOCUS_16550 10140 9520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 10610 10137 gene locus_tag LOCUS_16560 10610 10137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 11197 10685 gene locus_tag LOCUS_16570 11197 10685 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766514.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence115 5355 535 gene locus_tag LOCUS_16580 5355 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 8206 5369 gene locus_tag LOCUS_16590 8206 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 9288 8452 gene locus_tag LOCUS_16600 9288 8452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 9514 10593 gene locus_tag LOCUS_16610 9514 10593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 10730 10653 gene locus_tag LOCUS_t00170 10730 10653 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence116 8886 7963 gene locus_tag LOCUS_16620 8886 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence117 941 2299 gene locus_tag LOCUS_16630 941 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 2358 3287 gene locus_tag LOCUS_16640 2358 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 3390 5141 gene locus_tag LOCUS_16650 3390 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071315.1 protein_id gnl|my_center|LOCUS_16650 5166 5579 gene locus_tag LOCUS_16660 5166 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 5641 6246 gene locus_tag LOCUS_16670 5641 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 6636 7832 gene locus_tag LOCUS_16680 6636 7832 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 protein_id gnl|my_center|LOCUS_16680 7981 8202 gene locus_tag LOCUS_16690 7981 8202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 8204 8506 gene locus_tag LOCUS_16700 8204 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 8615 9142 gene locus_tag LOCUS_16710 8615 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 9397 10596 gene locus_tag LOCUS_16720 9397 10596 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_16720 10693 10992 gene locus_tag LOCUS_16730 10693 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence118 2069 309 gene locus_tag LOCUS_16740 2069 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 3779 2121 gene locus_tag LOCUS_16750 3779 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 7236 4081 gene locus_tag LOCUS_16760 7236 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 9333 7507 gene locus_tag LOCUS_16770 9333 7507 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_16770 9775 9383 gene locus_tag LOCUS_16780 9775 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 10369 9797 gene locus_tag LOCUS_16790 gene pgiA 10369 9797 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147196.1 protein_id gnl|my_center|LOCUS_16790 <11022 10353 gene locus_tag LOCUS_16800 <11022 10353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922076.1:BadF/BadG/BcrA/BcrD ATPase family protein >Feature sequence119 490 215 gene locus_tag LOCUS_16810 490 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 564 2696 gene locus_tag LOCUS_16820 564 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 3084 5738 gene locus_tag LOCUS_16830 3084 5738 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_16830 7826 6111 gene locus_tag LOCUS_16840 7826 6111 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326733.1 protein_id gnl|my_center|LOCUS_16840 8074 8328 gene locus_tag LOCUS_16850 8074 8328 CDS product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056973.1 protein_id gnl|my_center|LOCUS_16850 8413 10692 gene locus_tag LOCUS_16860 8413 10692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence120 138 767 gene locus_tag LOCUS_16870 138 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 1744 932 gene locus_tag LOCUS_16880 1744 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 2037 1750 gene locus_tag LOCUS_16890 2037 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 2210 2034 gene locus_tag LOCUS_16900 2210 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 3303 2293 gene locus_tag LOCUS_16910 gene rnhC 3303 2293 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871354.1 protein_id gnl|my_center|LOCUS_16910 3389 4450 gene locus_tag LOCUS_16920 3389 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 4491 5018 gene locus_tag LOCUS_16930 4491 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 5096 5554 gene locus_tag LOCUS_16940 5096 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 5805 5638 gene locus_tag LOCUS_16950 gene rpmG 5805 5638 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933041.1 protein_id gnl|my_center|LOCUS_16950 7348 6077 gene locus_tag LOCUS_16960 7348 6077 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087526.1 protein_id gnl|my_center|LOCUS_16960 7431 7928 gene locus_tag LOCUS_16970 7431 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 8374 7862 gene locus_tag LOCUS_16980 8374 7862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 9564 8371 gene locus_tag LOCUS_16990 9564 8371 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_16990 10535 9567 gene locus_tag LOCUS_17000 10535 9567 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence121 1336 221 gene locus_tag LOCUS_17010 1336 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 2528 1524 gene locus_tag LOCUS_17020 2528 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 2764 2525 gene locus_tag LOCUS_17030 2764 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2961 2761 gene locus_tag LOCUS_17040 2961 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 4377 3190 gene locus_tag LOCUS_17050 4377 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 4467 4541 gene locus_tag LOCUS_t00180 4467 4541 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4982 4563 gene locus_tag LOCUS_17060 4982 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 5129 5788 gene locus_tag LOCUS_17070 5129 5788 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805069.1 protein_id gnl|my_center|LOCUS_17070 8175 5911 gene locus_tag LOCUS_17080 8175 5911 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202488.1 protein_id gnl|my_center|LOCUS_17080 8542 10485 gene locus_tag LOCUS_17090 8542 10485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence122 236 1237 gene locus_tag LOCUS_17100 236 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1576 2682 gene locus_tag LOCUS_17110 1576 2682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141728.1 protein_id gnl|my_center|LOCUS_17110 2725 3693 gene locus_tag LOCUS_17120 2725 3693 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965268.1 protein_id gnl|my_center|LOCUS_17120 3757 5256 gene locus_tag LOCUS_17130 3757 5256 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226378.1 protein_id gnl|my_center|LOCUS_17130 5253 7124 gene locus_tag LOCUS_17140 5253 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 7302 10523 gene locus_tag LOCUS_17150 7302 10523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 >Feature sequence123 3040 320 gene locus_tag LOCUS_17160 3040 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 4373 3087 gene locus_tag LOCUS_17170 gene waaA 4373 3087 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185503.1 protein_id gnl|my_center|LOCUS_17170 4497 7352 gene locus_tag LOCUS_17180 4497 7352 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073743.1 protein_id gnl|my_center|LOCUS_17180 8082 7399 gene locus_tag LOCUS_17190 8082 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 8209 10260 gene locus_tag LOCUS_17200 8209 10260 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031640.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence124 789 1670 gene locus_tag LOCUS_17210 789 1670 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_17210 1667 2524 gene locus_tag LOCUS_17220 1667 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 2592 3611 gene locus_tag LOCUS_17230 2592 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 4238 3681 gene locus_tag LOCUS_17240 gene efp 4238 3681 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699839.1 protein_id gnl|my_center|LOCUS_17240 4385 4780 gene locus_tag LOCUS_17250 4385 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 4889 6103 gene locus_tag LOCUS_17260 4889 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 6109 7245 gene locus_tag LOCUS_17270 6109 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 7238 10390 gene locus_tag LOCUS_17280 7238 10390 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142029.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence125 1024 560 gene locus_tag LOCUS_17290 1024 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1147 4149 gene locus_tag LOCUS_17300 gene secA 1147 4149 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_17300 4691 5074 gene locus_tag LOCUS_17310 gene rpsL 4691 5074 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_17310 5112 5585 gene locus_tag LOCUS_17320 gene rpsG 5112 5585 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081843.1 protein_id gnl|my_center|LOCUS_17320 5622 7805 gene locus_tag LOCUS_17330 gene fusA 5622 7805 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_17330 7826 8134 gene locus_tag LOCUS_17340 gene rpsJ 7826 8134 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909272.1 protein_id gnl|my_center|LOCUS_17340 8260 8910 gene locus_tag LOCUS_17350 gene rplC 8260 8910 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421173.1 protein_id gnl|my_center|LOCUS_17350 8926 9561 gene locus_tag LOCUS_17360 gene rplD 8926 9561 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869927.1 protein_id gnl|my_center|LOCUS_17360 9561 9842 gene locus_tag LOCUS_17370 gene rplW 9561 9842 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence126 803 27 gene locus_tag LOCUS_17380 gene fabG 803 27 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791492.1 protein_id gnl|my_center|LOCUS_17380 1711 890 gene locus_tag LOCUS_17390 1711 890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974506.1 protein_id gnl|my_center|LOCUS_17390 2695 1778 gene locus_tag LOCUS_17400 2695 1778 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974507.1 protein_id gnl|my_center|LOCUS_17400 3771 2692 gene locus_tag LOCUS_17410 3771 2692 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974508.1 protein_id gnl|my_center|LOCUS_17410 5063 3876 gene locus_tag LOCUS_17420 5063 3876 CDS product PotD/PotF family extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390763.1 protein_id gnl|my_center|LOCUS_17420 5593 5138 gene locus_tag LOCUS_17430 5593 5138 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326238.1 protein_id gnl|my_center|LOCUS_17430 6497 5595 gene locus_tag LOCUS_17440 gene cyoE 6497 5595 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_17440 7537 6494 gene locus_tag LOCUS_17450 7537 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 7625 8533 gene locus_tag LOCUS_17460 7625 8533 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837921.1 protein_id gnl|my_center|LOCUS_17460 8473 9495 gene locus_tag LOCUS_17470 8473 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence127 <1 2576 gene locus_tag LOCUS_17480 <1 2576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939213.1:isoleucine--tRNA ligase 2634 3797 gene locus_tag LOCUS_17490 2634 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 4012 4578 gene locus_tag LOCUS_17500 gene lspA 4012 4578 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071968.1 protein_id gnl|my_center|LOCUS_17500 4622 5563 gene locus_tag LOCUS_17510 4622 5563 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_17510 6515 5580 gene locus_tag LOCUS_17520 6515 5580 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388866.1 protein_id gnl|my_center|LOCUS_17520 7461 6583 gene locus_tag LOCUS_17530 7461 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 7849 7478 gene locus_tag LOCUS_17540 7849 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 8033 8461 gene locus_tag LOCUS_17550 8033 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 9576 8548 gene locus_tag LOCUS_17560 9576 8548 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126540609.1 protein_id gnl|my_center|LOCUS_17560 10069 9680 gene locus_tag LOCUS_17570 10069 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 10166 10369 gene locus_tag LOCUS_17580 10166 10369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence128 252 668 gene locus_tag LOCUS_17590 252 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 737 2014 gene locus_tag LOCUS_17600 737 2014 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807926.1 protein_id gnl|my_center|LOCUS_17600 3499 2039 gene locus_tag LOCUS_17610 3499 2039 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140537.1 protein_id gnl|my_center|LOCUS_17610 4525 3578 gene locus_tag LOCUS_17620 4525 3578 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056320.1 protein_id gnl|my_center|LOCUS_17620 6167 4566 gene locus_tag LOCUS_17630 6167 4566 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038505.1 protein_id gnl|my_center|LOCUS_17630 6620 6195 gene locus_tag LOCUS_17640 6620 6195 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721784.1 protein_id gnl|my_center|LOCUS_17640 7199 6642 gene locus_tag LOCUS_17650 7199 6642 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888275.1 protein_id gnl|my_center|LOCUS_17650 8396 7251 gene locus_tag LOCUS_17660 8396 7251 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 protein_id gnl|my_center|LOCUS_17660 9003 8437 gene locus_tag LOCUS_17670 gene def 9003 8437 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933121.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence129 1712 1227 gene locus_tag LOCUS_17680 1712 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 1809 2639 gene locus_tag LOCUS_17690 1809 2639 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_17690 2652 2870 gene locus_tag LOCUS_17700 2652 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 2883 3614 gene locus_tag LOCUS_17710 2883 3614 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061374.1 protein_id gnl|my_center|LOCUS_17710 3630 4403 gene locus_tag LOCUS_17720 3630 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 5371 4424 gene locus_tag LOCUS_17730 gene mmsR 5371 4424 CDS product MmsAB operon transcriptional regulator MmsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122160.1 protein_id gnl|my_center|LOCUS_17730 5422 8811 gene locus_tag LOCUS_17740 5422 8811 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202205.1 protein_id gnl|my_center|LOCUS_17740 8844 10382 gene locus_tag LOCUS_17750 8844 10382 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence130 457 1410 gene locus_tag LOCUS_17760 457 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1473 2843 gene locus_tag LOCUS_17770 1473 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 2840 3793 gene locus_tag LOCUS_17780 2840 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17780 3884 4999 gene locus_tag LOCUS_17790 3884 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 5047 5736 gene locus_tag LOCUS_17800 5047 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 5691 6923 gene locus_tag LOCUS_17810 5691 6923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 6934 8376 gene locus_tag LOCUS_17820 6934 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 8373 9506 gene locus_tag LOCUS_17830 8373 9506 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038940.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence131 435 3617 gene locus_tag LOCUS_17840 435 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 3647 3901 gene locus_tag LOCUS_17850 3647 3901 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015947.1 protein_id gnl|my_center|LOCUS_17850 4849 3902 gene locus_tag LOCUS_17860 4849 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 5739 4846 gene locus_tag LOCUS_17870 5739 4846 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 protein_id gnl|my_center|LOCUS_17870 6031 6486 gene locus_tag LOCUS_17880 6031 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 6519 8141 gene locus_tag LOCUS_17890 6519 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 8178 9422 gene locus_tag LOCUS_17900 8178 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence132 98 2242 gene locus_tag LOCUS_17910 98 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 2245 3144 gene locus_tag LOCUS_17920 gene kduI 2245 3144 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210829.1 protein_id gnl|my_center|LOCUS_17920 3304 4065 gene locus_tag LOCUS_17930 gene kduD 3304 4065 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_17930 4145 5383 gene locus_tag LOCUS_17940 4145 5383 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762841.1 protein_id gnl|my_center|LOCUS_17940 5604 5380 gene locus_tag LOCUS_17950 5604 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 5518 8151 gene locus_tag LOCUS_17960 5518 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 8356 9387 gene locus_tag LOCUS_17970 8356 9387 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_17970 9396 9905 gene locus_tag LOCUS_17980 9396 9905 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288258.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence133 1065 451 gene locus_tag LOCUS_17990 1065 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1285 1770 gene locus_tag LOCUS_18000 1285 1770 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078417.1 protein_id gnl|my_center|LOCUS_18000 1854 2234 gene locus_tag LOCUS_18010 1854 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 2245 3216 gene locus_tag LOCUS_18020 gene nadA 2245 3216 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_18020 5287 3233 gene locus_tag LOCUS_18030 gene uvrB 5287 3233 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_18030 5674 5357 gene locus_tag LOCUS_18040 gene mnhG 5674 5357 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902380.1 protein_id gnl|my_center|LOCUS_18040 5979 5674 gene locus_tag LOCUS_18050 5979 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 6369 5998 gene locus_tag LOCUS_18060 6369 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 7913 6366 gene locus_tag LOCUS_18070 7913 6366 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125097.1 protein_id gnl|my_center|LOCUS_18070 8296 7910 gene locus_tag LOCUS_18080 8296 7910 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 protein_id gnl|my_center|LOCUS_18080 <10277 8298 gene locus_tag LOCUS_18090 <10277 8298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338646.1:monovalent cation/H+ antiporter subunit A >Feature sequence134 346 1212 gene locus_tag LOCUS_18100 346 1212 CDS product DUF4465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667002.1 protein_id gnl|my_center|LOCUS_18100 1217 2386 gene locus_tag LOCUS_18110 1217 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 2383 3180 gene locus_tag LOCUS_18120 2383 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 3177 4100 gene locus_tag LOCUS_18130 3177 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 4103 5098 gene locus_tag LOCUS_18140 4103 5098 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883993.1 protein_id gnl|my_center|LOCUS_18140 5095 5826 gene locus_tag LOCUS_18150 5095 5826 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383524.1 protein_id gnl|my_center|LOCUS_18150 5918 6799 gene locus_tag LOCUS_18160 5918 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 7811 6837 gene locus_tag LOCUS_18170 7811 6837 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109290171.1 protein_id gnl|my_center|LOCUS_18170 8043 8579 gene locus_tag LOCUS_18180 8043 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 8614 10101 gene locus_tag LOCUS_18190 8614 10101 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142067.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence135 230 305 gene locus_tag LOCUS_t00190 230 305 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1182 358 gene locus_tag LOCUS_18200 gene kdsB 1182 358 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_18200 1181 1471 gene locus_tag LOCUS_18210 1181 1471 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812598.1 protein_id gnl|my_center|LOCUS_18210 2251 1556 gene locus_tag LOCUS_18220 2251 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 2403 2251 gene locus_tag LOCUS_18230 2403 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 3857 2400 gene locus_tag LOCUS_18240 gene ccoG 3857 2400 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120871.1 protein_id gnl|my_center|LOCUS_18240 4452 3913 gene locus_tag LOCUS_18250 4452 3913 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120870.1 protein_id gnl|my_center|LOCUS_18250 4620 4465 gene locus_tag LOCUS_18260 4620 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 6941 4632 gene locus_tag LOCUS_18270 6941 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 7327 6959 gene locus_tag LOCUS_18280 7327 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 7533 8099 gene locus_tag LOCUS_18290 7533 8099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 8934 8014 gene locus_tag LOCUS_18300 8934 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 9069 9353 gene locus_tag LOCUS_18310 9069 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 9367 9861 gene locus_tag LOCUS_18320 9367 9861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence136 833 2959 gene locus_tag LOCUS_18330 833 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 3608 3093 gene locus_tag LOCUS_18340 3608 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 4442 3690 gene locus_tag LOCUS_18350 4442 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 4775 4972 gene locus_tag LOCUS_18360 4775 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 5037 6059 gene locus_tag LOCUS_18370 5037 6059 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259009.1 protein_id gnl|my_center|LOCUS_18370 6529 6056 gene locus_tag LOCUS_18380 6529 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 7076 6543 gene locus_tag LOCUS_18390 7076 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 7419 7063 gene locus_tag LOCUS_18400 7419 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 9209 7419 gene locus_tag LOCUS_18410 9209 7419 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938640.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence137 487 3021 gene locus_tag LOCUS_18420 487 3021 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706264.1 protein_id gnl|my_center|LOCUS_18420 4197 3217 gene locus_tag LOCUS_18430 4197 3217 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707193.1 protein_id gnl|my_center|LOCUS_18430 5249 4263 gene locus_tag LOCUS_18440 5249 4263 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707194.1 protein_id gnl|my_center|LOCUS_18440 7551 5488 gene locus_tag LOCUS_18450 7551 5488 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706661.1 protein_id gnl|my_center|LOCUS_18450 8668 7604 gene locus_tag LOCUS_18460 8668 7604 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707196.1 protein_id gnl|my_center|LOCUS_18460 9828 8815 gene locus_tag LOCUS_18470 9828 8815 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418068.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence138 779 39 gene locus_tag LOCUS_18480 gene fabG 779 39 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008530.1 protein_id gnl|my_center|LOCUS_18480 2079 898 gene locus_tag LOCUS_18490 2079 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 2177 3055 gene locus_tag LOCUS_18500 2177 3055 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227785.1 protein_id gnl|my_center|LOCUS_18500 3088 3909 gene locus_tag LOCUS_18510 3088 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 4008 4877 gene locus_tag LOCUS_18520 gene folD 4008 4877 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_18520 4898 6037 gene locus_tag LOCUS_18530 4898 6037 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_18530 6034 8037 gene locus_tag LOCUS_18540 6034 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 9567 8038 gene locus_tag LOCUS_18550 9567 8038 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence139 6047 1575 gene locus_tag LOCUS_18560 6047 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 8091 6256 gene locus_tag LOCUS_18570 8091 6256 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_18570 9089 8175 gene locus_tag LOCUS_18580 9089 8175 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870464.1 protein_id gnl|my_center|LOCUS_18580 9886 9122 gene locus_tag LOCUS_18590 9886 9122 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532097.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence140 <1 1101 gene locus_tag LOCUS_18600 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036524.1:acyl-CoA desaturase 1221 2522 gene locus_tag LOCUS_18610 1221 2522 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768840.1 protein_id gnl|my_center|LOCUS_18610 5036 2556 gene locus_tag LOCUS_18620 5036 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 5147 6106 gene locus_tag LOCUS_18630 5147 6106 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_18630 6226 6840 gene locus_tag LOCUS_18640 6226 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 6891 8051 gene locus_tag LOCUS_18650 gene dnaJ 6891 8051 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157034.1 protein_id gnl|my_center|LOCUS_18650 8915 8061 gene locus_tag LOCUS_18660 8915 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 8996 9574 gene locus_tag LOCUS_18670 gene pyrE 8996 9574 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393616.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence141 2897 630 gene locus_tag LOCUS_18680 2897 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 3933 4256 gene locus_tag LOCUS_18690 3933 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 6408 6001 gene locus_tag LOCUS_18700 6408 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 6672 6926 gene locus_tag LOCUS_18710 6672 6926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 6923 7354 gene locus_tag LOCUS_18720 6923 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 9005 7674 gene locus_tag LOCUS_18730 9005 7674 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_18730 9874 9023 gene locus_tag LOCUS_18740 9874 9023 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944061.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence142 <1 666 gene locus_tag LOCUS_18750 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939847.1:response regulator transcription factor 687 2111 gene locus_tag LOCUS_18760 687 2111 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256316.1 protein_id gnl|my_center|LOCUS_18760 2108 3643 gene locus_tag LOCUS_18770 2108 3643 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256316.1 protein_id gnl|my_center|LOCUS_18770 3657 4646 gene locus_tag LOCUS_18780 3657 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18780 4643 7204 gene locus_tag LOCUS_18790 4643 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 7269 7817 gene locus_tag LOCUS_18800 gene frr 7269 7817 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056114.1 protein_id gnl|my_center|LOCUS_18800 7930 9033 gene locus_tag LOCUS_18810 gene proB 7930 9033 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence143 1486 362 gene locus_tag LOCUS_18820 1486 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1603 4134 gene locus_tag LOCUS_18830 1603 4134 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920510.1 protein_id gnl|my_center|LOCUS_18830 5418 4426 gene locus_tag LOCUS_18840 5418 4426 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_18840 9280 5642 gene locus_tag LOCUS_18850 gene nifJ 9280 5642 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_237703763.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence144 <1 1212 gene locus_tag LOCUS_18860 <1 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071149.1:PAS domain S-box protein 1306 2448 gene locus_tag LOCUS_18870 gene prfB 1306 2448 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_18870 2575 5028 gene locus_tag LOCUS_18880 2575 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 5197 6243 gene locus_tag LOCUS_18890 gene gap 5197 6243 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143315.1 protein_id gnl|my_center|LOCUS_18890 6366 7616 gene locus_tag LOCUS_18900 6366 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 7730 8500 gene locus_tag LOCUS_18910 gene tpiA 7730 8500 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902187.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence145 392 1477 gene locus_tag LOCUS_18920 392 1477 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668699.1 protein_id gnl|my_center|LOCUS_18920 2288 1488 gene locus_tag LOCUS_18930 2288 1488 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972698.1 protein_id gnl|my_center|LOCUS_18930 2447 3493 gene locus_tag LOCUS_18940 2447 3493 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_18940 3626 4786 gene locus_tag LOCUS_18950 3626 4786 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529510.1 protein_id gnl|my_center|LOCUS_18950 4851 6197 gene locus_tag LOCUS_18960 4851 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 6237 6818 gene locus_tag LOCUS_18970 6237 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 6901 7638 gene locus_tag LOCUS_18980 6901 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 8188 7694 gene locus_tag LOCUS_18990 8188 7694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 9579 8212 gene locus_tag LOCUS_19000 9579 8212 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence146 <1 764 gene locus_tag LOCUS_19010 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203206.1:PDZ domain-containing protein 798 2132 gene locus_tag LOCUS_19020 798 2132 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948839.1 protein_id gnl|my_center|LOCUS_19020 2167 3948 gene locus_tag LOCUS_19030 2167 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 4074 7097 gene locus_tag LOCUS_19040 4074 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 7174 9420 gene locus_tag LOCUS_19050 7174 9420 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence147 <1 2303 gene locus_tag LOCUS_19060 <1 2303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928589.1:M1 family metallopeptidase 2759 2346 gene locus_tag LOCUS_19070 2759 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 3262 2756 gene locus_tag LOCUS_19080 3262 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 4020 3259 gene locus_tag LOCUS_19090 4020 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 4984 4763 gene locus_tag LOCUS_19100 4984 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 4940 8542 gene locus_tag LOCUS_19110 4940 8542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 <9651 8608 gene locus_tag LOCUS_19120 <9651 8608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014878656.1:glutamate synthase large subunit >Feature sequence148 2101 791 gene locus_tag LOCUS_19130 2101 791 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118525.1 protein_id gnl|my_center|LOCUS_19130 2351 2995 gene locus_tag LOCUS_19140 2351 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 3013 4341 gene locus_tag LOCUS_19150 3013 4341 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_19150 5012 4347 gene locus_tag LOCUS_19160 gene gph 5012 4347 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532061.1 protein_id gnl|my_center|LOCUS_19160 5494 5288 gene locus_tag LOCUS_19170 5494 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 5666 6247 gene locus_tag LOCUS_19180 5666 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 6381 7478 gene locus_tag LOCUS_19190 6381 7478 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626382.1 protein_id gnl|my_center|LOCUS_19190 7482 8309 gene locus_tag LOCUS_19200 7482 8309 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390199.1 protein_id gnl|my_center|LOCUS_19200 8340 9359 gene locus_tag LOCUS_19210 8340 9359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence149 81 2108 gene locus_tag LOCUS_19220 81 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 3413 2184 gene locus_tag LOCUS_19230 gene uxuA 3413 2184 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438591.1 protein_id gnl|my_center|LOCUS_19230 4477 3506 gene locus_tag LOCUS_19240 4477 3506 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762343.1 protein_id gnl|my_center|LOCUS_19240 5982 4474 gene locus_tag LOCUS_19250 gene abfA 5982 4474 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_19250 6310 6567 gene locus_tag LOCUS_19260 6310 6567 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858446.1 protein_id gnl|my_center|LOCUS_19260 6702 7349 gene locus_tag LOCUS_19270 6702 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 7417 8385 gene locus_tag LOCUS_19280 7417 8385 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence150 308 232 gene locus_tag LOCUS_t00200 308 232 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 500 973 gene locus_tag LOCUS_19290 500 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 1127 2398 gene locus_tag LOCUS_19300 1127 2398 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_19300 3424 2405 gene locus_tag LOCUS_19310 3424 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 3534 4736 gene locus_tag LOCUS_19320 3534 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 4733 5047 gene locus_tag LOCUS_19330 gene rhaM 4733 5047 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099341.1 protein_id gnl|my_center|LOCUS_19330 5116 7833 gene locus_tag LOCUS_19340 5116 7833 CDS product Tat pathway signal sequence domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136207739.1 protein_id gnl|my_center|LOCUS_19340 7842 9188 gene locus_tag LOCUS_19350 7842 9188 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109136.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence151 2594 975 gene locus_tag LOCUS_19360 gene gpmI 2594 975 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435040.1 protein_id gnl|my_center|LOCUS_19360 2759 3628 gene locus_tag LOCUS_19370 2759 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 3657 5285 gene locus_tag LOCUS_19380 gene guaB 3657 5285 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081543.1 protein_id gnl|my_center|LOCUS_19380 5325 6095 gene locus_tag LOCUS_19390 5325 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 6158 6829 gene locus_tag LOCUS_19400 6158 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 6897 8459 gene locus_tag LOCUS_19410 6897 8459 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462314.1 protein_id gnl|my_center|LOCUS_19410 8652 8521 gene locus_tag LOCUS_19420 8652 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 <9430 8713 gene locus_tag LOCUS_19430 <9430 8713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720849.1:Tol-Pal system beta propeller repeat protein TolB >Feature sequence152 1842 4997 gene locus_tag LOCUS_19440 1842 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 6049 4994 gene locus_tag LOCUS_19450 gene arsB 6049 4994 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876533.1 protein_id gnl|my_center|LOCUS_19450 6507 6046 gene locus_tag LOCUS_19460 6507 6046 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_19460 7015 6524 gene locus_tag LOCUS_19470 7015 6524 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_19470 7413 7012 gene locus_tag LOCUS_19480 7413 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 9117 7510 gene locus_tag LOCUS_19490 9117 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19490 >Feature sequence153 447 1241 gene locus_tag LOCUS_19500 447 1241 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420904.1 protein_id gnl|my_center|LOCUS_19500 1367 2026 gene locus_tag LOCUS_19510 1367 2026 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_19510 2122 5733 gene locus_tag LOCUS_19520 gene uca 2122 5733 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140960.1 protein_id gnl|my_center|LOCUS_19520 5753 6889 gene locus_tag LOCUS_19530 5753 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 6986 7672 gene locus_tag LOCUS_19540 gene cysH 6986 7672 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080392.1 protein_id gnl|my_center|LOCUS_19540 8484 7747 gene locus_tag LOCUS_19550 8484 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence154 1756 1406 gene locus_tag LOCUS_19560 1756 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 2674 1808 gene locus_tag LOCUS_19570 2674 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 3685 2768 gene locus_tag LOCUS_19580 3685 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 4588 3734 gene locus_tag LOCUS_19590 4588 3734 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027435.1 protein_id gnl|my_center|LOCUS_19590 5286 4585 gene locus_tag LOCUS_19600 gene mtnP 5286 4585 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868192.1 protein_id gnl|my_center|LOCUS_19600 5248 6093 gene locus_tag LOCUS_19610 5248 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 6161 7132 gene locus_tag LOCUS_19620 gene trxB 6161 7132 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405370.1 protein_id gnl|my_center|LOCUS_19620 7318 7746 gene locus_tag LOCUS_19630 7318 7746 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_19630 7900 8664 gene locus_tag LOCUS_19640 gene sufC 7900 8664 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831944.1 protein_id gnl|my_center|LOCUS_19640 >Feature sequence155 1259 198 gene locus_tag LOCUS_19650 1259 198 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_19650 1694 1365 gene locus_tag LOCUS_19660 1694 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2132 1722 gene locus_tag LOCUS_19670 gene fliS 2132 1722 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704959.1 protein_id gnl|my_center|LOCUS_19670 2423 2139 gene locus_tag LOCUS_19680 2423 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 3209 2520 gene locus_tag LOCUS_19690 3209 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 4934 3213 gene locus_tag LOCUS_19700 4934 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 5228 6034 gene locus_tag LOCUS_19710 5228 6034 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965501.1 protein_id gnl|my_center|LOCUS_19710 6282 7082 gene locus_tag LOCUS_19720 6282 7082 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_19720 7223 8335 gene locus_tag LOCUS_19730 7223 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 <9112 8355 gene locus_tag LOCUS_19740 <9112 8355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083481.1:imidazole glycerol phosphate synthase subunit HisF >Feature sequence156 345 1451 gene locus_tag LOCUS_19750 345 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19750 1506 4214 gene locus_tag LOCUS_19760 1506 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19760 5498 4623 gene locus_tag LOCUS_19770 5498 4623 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258574.1 protein_id gnl|my_center|LOCUS_19770 5497 6456 gene locus_tag LOCUS_19780 5497 6456 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390879.1 protein_id gnl|my_center|LOCUS_19780 6473 7399 gene locus_tag LOCUS_19790 6473 7399 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088395.1 protein_id gnl|my_center|LOCUS_19790 7396 8535 gene locus_tag LOCUS_19800 7396 8535 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390877.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence157 2814 625 gene locus_tag LOCUS_19810 2814 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 4238 2886 gene locus_tag LOCUS_19820 4238 2886 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109132.1 protein_id gnl|my_center|LOCUS_19820 6412 4787 gene locus_tag LOCUS_19830 6412 4787 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929181.1 protein_id gnl|my_center|LOCUS_19830 7215 6409 gene locus_tag LOCUS_19840 gene mtnN 7215 6409 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217037.1 protein_id gnl|my_center|LOCUS_19840 7318 7785 gene locus_tag LOCUS_19850 7318 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 7801 8394 gene locus_tag LOCUS_19860 7801 8394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 >Feature sequence158 7882 293 gene locus_tag LOCUS_19870 7882 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 <8819 8140 gene locus_tag LOCUS_19880 <8819 8140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258815.1:pyruvate, phosphate dikinase >Feature sequence159 399 1367 gene locus_tag LOCUS_19890 399 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 1485 2252 gene locus_tag LOCUS_19900 1485 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 3047 2283 gene locus_tag LOCUS_19910 3047 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 4084 3044 gene locus_tag LOCUS_19920 4084 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 5472 4081 gene locus_tag LOCUS_19930 5472 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 6472 5507 gene locus_tag LOCUS_19940 6472 5507 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897409.1 protein_id gnl|my_center|LOCUS_19940 7746 6469 gene locus_tag LOCUS_19950 7746 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence160 1117 3990 gene locus_tag LOCUS_19960 1117 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence161 671 270 gene locus_tag LOCUS_19970 gene mutT 671 270 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932370.1 protein_id gnl|my_center|LOCUS_19970 789 1139 gene locus_tag LOCUS_19980 789 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2769 1087 gene locus_tag LOCUS_19990 2769 1087 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707241.1 protein_id gnl|my_center|LOCUS_19990 2943 4214 gene locus_tag LOCUS_20000 2943 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 4368 5096 gene locus_tag LOCUS_20010 4368 5096 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144228759.1 protein_id gnl|my_center|LOCUS_20010 5481 6896 gene locus_tag LOCUS_20020 gene gspE 5481 6896 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918063.1 protein_id gnl|my_center|LOCUS_20020 6942 7490 gene locus_tag LOCUS_20030 6942 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 7687 8523 gene locus_tag LOCUS_20040 gene rsbQ 7687 8523 CDS product sigma factor SigB/phosphatase RsbP regulator RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228292.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence162 <1 612 gene locus_tag LOCUS_20050 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545613.1:class I SAM-dependent DNA methyltransferase 2670 1096 gene locus_tag LOCUS_20060 gene metG 2670 1096 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545288.1 protein_id gnl|my_center|LOCUS_20060 2758 3828 gene locus_tag LOCUS_20070 2758 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 3870 4544 gene locus_tag LOCUS_20080 3870 4544 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_20080 5601 4708 gene locus_tag LOCUS_20090 5601 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 6464 5598 gene locus_tag LOCUS_20100 6464 5598 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113172.1 protein_id gnl|my_center|LOCUS_20100 6519 6872 gene locus_tag LOCUS_20110 gene raiA 6519 6872 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195219.1 protein_id gnl|my_center|LOCUS_20110 7187 7111 gene locus_tag LOCUS_t00210 7187 7111 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7356 7640 gene locus_tag LOCUS_20120 7356 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence163 1455 586 gene locus_tag LOCUS_20130 1455 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 3561 1522 gene locus_tag LOCUS_20140 gene speA 3561 1522 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144058.1 protein_id gnl|my_center|LOCUS_20140 3693 4031 gene locus_tag LOCUS_20150 gene yajC 3693 4031 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722646.1 protein_id gnl|my_center|LOCUS_20150 4194 6785 gene locus_tag LOCUS_20160 gene secD 4194 6785 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172795.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence164 66 965 gene locus_tag LOCUS_20170 gene dapA 66 965 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921565.1 protein_id gnl|my_center|LOCUS_20170 973 1704 gene locus_tag LOCUS_20180 973 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 1831 2445 gene locus_tag LOCUS_20190 gene ruvA 1831 2445 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_20190 3193 2465 gene locus_tag LOCUS_20200 3193 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 3756 3190 gene locus_tag LOCUS_20210 3756 3190 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_20210 3828 4142 gene locus_tag LOCUS_20220 3828 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 4924 4100 gene locus_tag LOCUS_20230 4924 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 5756 4914 gene locus_tag LOCUS_20240 5756 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 6755 5841 gene locus_tag LOCUS_20250 6755 5841 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_20250 7082 6804 gene locus_tag LOCUS_20260 7082 6804 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878321.1 protein_id gnl|my_center|LOCUS_20260 7252 7974 gene locus_tag LOCUS_20270 7252 7974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 8453 8377 gene locus_tag LOCUS_t00220 8453 8377 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence165 1484 417 gene locus_tag LOCUS_20280 gene rfbB 1484 417 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387761.1 protein_id gnl|my_center|LOCUS_20280 2362 1481 gene locus_tag LOCUS_20290 2362 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 2285 3193 gene locus_tag LOCUS_20300 2285 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 3190 4491 gene locus_tag LOCUS_20310 gene xseA 3190 4491 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705853.1 protein_id gnl|my_center|LOCUS_20310 6713 4488 gene locus_tag LOCUS_20320 6713 4488 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404295.1 protein_id gnl|my_center|LOCUS_20320 7181 6837 gene locus_tag LOCUS_20330 7181 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 8176 7178 gene locus_tag LOCUS_20340 8176 7178 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_20340 >Feature sequence166 111 1025 gene locus_tag LOCUS_20350 111 1025 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050911213.1 protein_id gnl|my_center|LOCUS_20350 1907 1053 gene locus_tag LOCUS_20360 1907 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 3354 1990 gene locus_tag LOCUS_20370 3354 1990 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_20370 3393 4913 gene locus_tag LOCUS_20380 3393 4913 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_20380 4961 5275 gene locus_tag LOCUS_20390 4961 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 5280 5714 gene locus_tag LOCUS_20400 5280 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 5846 6199 gene locus_tag LOCUS_20410 5846 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 >Feature sequence167 960 1214 gene locus_tag LOCUS_20420 960 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 1940 2431 gene locus_tag LOCUS_20430 1940 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 2837 3262 gene locus_tag LOCUS_20440 2837 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 3259 4380 gene locus_tag LOCUS_20450 3259 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 4742 5524 gene locus_tag LOCUS_20460 4742 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 6948 5506 gene locus_tag LOCUS_20470 gene glgA 6948 5506 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_20470 7850 6978 gene locus_tag LOCUS_20480 gene folP 7850 6978 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644433.1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence168 310 2793 gene locus_tag LOCUS_20490 310 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 4131 3130 gene locus_tag LOCUS_20500 4131 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 4417 5538 gene locus_tag LOCUS_20510 4417 5538 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_20510 7086 5611 gene locus_tag LOCUS_20520 7086 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 8298 7159 gene locus_tag LOCUS_20530 8298 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence169 <1 579 gene locus_tag LOCUS_20540 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036052.1:23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM 641 1483 gene locus_tag LOCUS_20550 641 1483 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957298.1 protein_id gnl|my_center|LOCUS_20550 1480 3393 gene locus_tag LOCUS_20560 gene msbA 1480 3393 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_20560 3393 4238 gene locus_tag LOCUS_20570 3393 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 4266 5414 gene locus_tag LOCUS_20580 4266 5414 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929502.1 protein_id gnl|my_center|LOCUS_20580 6321 5398 gene locus_tag LOCUS_20590 6321 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 8091 6358 gene locus_tag LOCUS_20600 8091 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 >Feature sequence170 3187 1454 gene locus_tag LOCUS_20610 3187 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 3276 4244 gene locus_tag LOCUS_20620 gene lpxI 3276 4244 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922990.1 protein_id gnl|my_center|LOCUS_20620 4359 4880 gene locus_tag LOCUS_20630 4359 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 5075 6154 gene locus_tag LOCUS_20640 5075 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 6165 6614 gene locus_tag LOCUS_20650 6165 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 7501 6671 gene locus_tag LOCUS_20660 gene metF 7501 6671 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_20660 8276 7743 gene locus_tag LOCUS_20670 8276 7743 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922618.1 protein_id gnl|my_center|LOCUS_20670 >Feature sequence171 1409 864 gene locus_tag LOCUS_20680 gene rplO 1409 864 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682039.1 protein_id gnl|my_center|LOCUS_20680 2075 1491 gene locus_tag LOCUS_20690 gene rpsE 2075 1491 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810132.1 protein_id gnl|my_center|LOCUS_20690 2448 2086 gene locus_tag LOCUS_20700 gene rplR 2448 2086 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130474831.1 protein_id gnl|my_center|LOCUS_20700 3038 2502 gene locus_tag LOCUS_20710 gene rplF 3038 2502 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088138.1 protein_id gnl|my_center|LOCUS_20710 3449 3057 gene locus_tag LOCUS_20720 gene rpsH 3449 3057 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904135.1 protein_id gnl|my_center|LOCUS_20720 3843 3538 gene locus_tag LOCUS_20730 gene rpsN 3843 3538 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226830.1 protein_id gnl|my_center|LOCUS_20730 4457 3861 gene locus_tag LOCUS_20740 gene rplE 4457 3861 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549036.1 protein_id gnl|my_center|LOCUS_20740 4872 4603 gene locus_tag LOCUS_20750 4872 4603 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139457464.1 protein_id gnl|my_center|LOCUS_20750 5239 4874 gene locus_tag LOCUS_20760 gene rplN 5239 4874 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869919.1 protein_id gnl|my_center|LOCUS_20760 5604 5263 gene locus_tag LOCUS_20770 5604 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 5827 5630 gene locus_tag LOCUS_20780 gene rpmC 5827 5630 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644737.1 protein_id gnl|my_center|LOCUS_20780 6273 5851 gene locus_tag LOCUS_20790 gene rplP 6273 5851 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215430.1 protein_id gnl|my_center|LOCUS_20790 6953 6324 gene locus_tag LOCUS_20800 gene rpsC 6953 6324 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_20800 7306 6965 gene locus_tag LOCUS_20810 gene rplV 7306 6965 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393932.1 protein_id gnl|my_center|LOCUS_20810 7722 7378 gene locus_tag LOCUS_20820 7722 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 8030 7755 gene locus_tag LOCUS_20830 gene rpsS 8030 7755 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_20830 8234 8049 gene locus_tag LOCUS_20840 8234 8049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 >Feature sequence172 <1 656 gene locus_tag LOCUS_20850 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040736.1:ABC transporter substrate-binding protein 670 1470 gene locus_tag LOCUS_20860 670 1470 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938538.1 protein_id gnl|my_center|LOCUS_20860 1652 2686 gene locus_tag LOCUS_20870 gene obgE 1652 2686 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_20870 2735 3244 gene locus_tag LOCUS_20880 2735 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 3287 4999 gene locus_tag LOCUS_20890 gene pilB 3287 4999 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_20890 5055 6314 gene locus_tag LOCUS_20900 5055 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence173 970 290 gene locus_tag LOCUS_20910 970 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 3556 1004 gene locus_tag LOCUS_20920 3556 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 3767 4369 gene locus_tag LOCUS_20930 3767 4369 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_20930 4476 6431 gene locus_tag LOCUS_20940 4476 6431 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198677105.1 protein_id gnl|my_center|LOCUS_20940 6562 7476 gene locus_tag LOCUS_20950 6562 7476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 >Feature sequence174 790 329 gene locus_tag LOCUS_20960 790 329 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141820.1 protein_id gnl|my_center|LOCUS_20960 1783 896 gene locus_tag LOCUS_20970 1783 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 1925 2416 gene locus_tag LOCUS_20980 gene msrB 1925 2416 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_20980 2499 3167 gene locus_tag LOCUS_20990 2499 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 3151 4080 gene locus_tag LOCUS_21000 3151 4080 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404105.1 protein_id gnl|my_center|LOCUS_21000 5024 4038 gene locus_tag LOCUS_21010 5024 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 7092 5101 gene locus_tag LOCUS_21020 7092 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 7208 7771 gene locus_tag LOCUS_21030 7208 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 >Feature sequence175 <1 744 gene locus_tag LOCUS_21040 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921539.1:FkbM family methyltransferase 806 1705 gene locus_tag LOCUS_21050 806 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 1720 2667 gene locus_tag LOCUS_21060 gene thiL 1720 2667 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113052.1 protein_id gnl|my_center|LOCUS_21060 2645 3094 gene locus_tag LOCUS_21070 2645 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 3593 5809 gene locus_tag LOCUS_21080 3593 5809 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119132.1 protein_id gnl|my_center|LOCUS_21080 5863 7263 gene locus_tag LOCUS_21090 5863 7263 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119131.1 protein_id gnl|my_center|LOCUS_21090 <8132 7542 gene locus_tag LOCUS_21100 <8132 7542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120572.1:inositol monophosphatase family protein >Feature sequence176 <1 701 gene locus_tag LOCUS_21110 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037512.1:LacI family DNA-binding transcriptional regulator 3883 1112 gene locus_tag LOCUS_21120 gene alaS 3883 1112 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_21120 4150 6486 gene locus_tag LOCUS_21130 4150 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 6599 6994 gene locus_tag LOCUS_21140 6599 6994 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_21140 >Feature sequence177 1118 1885 gene locus_tag LOCUS_21150 1118 1885 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776860.1 protein_id gnl|my_center|LOCUS_21150 1904 4588 gene locus_tag LOCUS_21160 1904 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 5062 4652 gene locus_tag LOCUS_21170 5062 4652 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 protein_id gnl|my_center|LOCUS_21170 6602 5187 gene locus_tag LOCUS_21180 gene atpD 6602 5187 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383730.1 protein_id gnl|my_center|LOCUS_21180 8064 6730 gene locus_tag LOCUS_21190 8064 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 >Feature sequence178 1252 263 gene locus_tag LOCUS_21200 1252 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 4489 1604 gene locus_tag LOCUS_21210 4489 1604 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266818.1 protein_id gnl|my_center|LOCUS_21210 4643 7465 gene locus_tag LOCUS_21220 gene glnD 4643 7465 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_21220 8018 7479 gene locus_tag LOCUS_21230 8018 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence179 1777 203 gene locus_tag LOCUS_21240 gene pap 1777 203 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_21240 4606 2459 gene locus_tag LOCUS_21250 4606 2459 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530052.1 protein_id gnl|my_center|LOCUS_21250 5813 4935 gene locus_tag LOCUS_21260 5813 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 6662 5952 gene locus_tag LOCUS_21270 6662 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 7901 6726 gene locus_tag LOCUS_21280 7901 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence180 3318 1615 gene locus_tag LOCUS_21290 3318 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 3200 3496 gene locus_tag LOCUS_21300 3200 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 3573 4001 gene locus_tag LOCUS_21310 3573 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 5871 4312 gene locus_tag LOCUS_21320 5871 4312 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083030.1 protein_id gnl|my_center|LOCUS_21320 6376 5861 gene locus_tag LOCUS_21330 6376 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 6545 7864 gene locus_tag LOCUS_21340 6545 7864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 >Feature sequence181 <7760 3924 gene locus_tag LOCUS_21350 <7760 3924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence182 2199 385 gene locus_tag LOCUS_21360 2199 385 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_21360 5325 2344 gene locus_tag LOCUS_21370 5325 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 6234 5467 gene locus_tag LOCUS_21380 6234 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 7170 6379 gene locus_tag LOCUS_21390 7170 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 >Feature sequence183 606 1478 gene locus_tag LOCUS_21400 606 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 2198 1521 gene locus_tag LOCUS_21410 2198 1521 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028120.1 protein_id gnl|my_center|LOCUS_21410 2433 4379 gene locus_tag LOCUS_21420 gene dnaK 2433 4379 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_21420 4510 4806 gene locus_tag LOCUS_21430 gene groES 4510 4806 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_21430 4857 6506 gene locus_tag LOCUS_21440 gene groL 4857 6506 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545192.1 protein_id gnl|my_center|LOCUS_21440 7506 7189 gene locus_tag LOCUS_21450 7506 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence184 4990 2366 gene locus_tag LOCUS_21460 4990 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 7475 5070 gene locus_tag LOCUS_21470 7475 5070 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_21470 >Feature sequence185 818 66 gene locus_tag LOCUS_21480 gene rsmI 818 66 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035951.1 protein_id gnl|my_center|LOCUS_21480 1086 895 gene locus_tag LOCUS_21490 1086 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 1840 1076 gene locus_tag LOCUS_21500 1840 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 3509 1941 gene locus_tag LOCUS_21510 3509 1941 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941965.1 protein_id gnl|my_center|LOCUS_21510 3733 3876 gene locus_tag LOCUS_21520 3733 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 4251 5147 gene locus_tag LOCUS_21530 4251 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 5251 6591 gene locus_tag LOCUS_21540 gene clpX 5251 6591 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056361.1 protein_id gnl|my_center|LOCUS_21540 6669 7412 gene locus_tag LOCUS_21550 gene modA 6669 7412 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836199.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence186 1517 966 gene locus_tag LOCUS_21560 1517 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2672 1530 gene locus_tag LOCUS_21570 2672 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2803 3822 gene locus_tag LOCUS_21580 2803 3822 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615392.1 protein_id gnl|my_center|LOCUS_21580 3992 4522 gene locus_tag LOCUS_21590 gene rpoE 3992 4522 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_21590 4519 5373 gene locus_tag LOCUS_21600 4519 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 6997 5408 gene locus_tag LOCUS_21610 6997 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085511.1 protein_id gnl|my_center|LOCUS_21610 <7572 6994 gene locus_tag LOCUS_21620 <7572 6994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000194414.1:cysteine hydrolase >Feature sequence187 351 3074 gene locus_tag LOCUS_21630 351 3074 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970308.1 protein_id gnl|my_center|LOCUS_21630 3151 4824 gene locus_tag LOCUS_21640 3151 4824 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151448733.1 protein_id gnl|my_center|LOCUS_21640 5009 7219 gene locus_tag LOCUS_21650 5009 7219 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970307.1 protein_id gnl|my_center|LOCUS_21650 >Feature sequence188 717 463 gene locus_tag LOCUS_21660 717 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 1193 2185 gene locus_tag LOCUS_21670 1193 2185 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225054.1 protein_id gnl|my_center|LOCUS_21670 2293 4257 gene locus_tag LOCUS_21680 2293 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 4317 5894 gene locus_tag LOCUS_21690 4317 5894 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_21690 6092 7123 gene locus_tag LOCUS_21700 6092 7123 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence189 676 329 gene locus_tag LOCUS_21710 676 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21710 1215 3089 gene locus_tag LOCUS_21720 gene atzF 1215 3089 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140963.1 protein_id gnl|my_center|LOCUS_21720 3212 4198 gene locus_tag LOCUS_21730 3212 4198 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206339.1 protein_id gnl|my_center|LOCUS_21730 4270 5322 gene locus_tag LOCUS_21740 4270 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 5349 6278 gene locus_tag LOCUS_21750 5349 6278 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206340.1 protein_id gnl|my_center|LOCUS_21750 6289 7098 gene locus_tag LOCUS_21760 6289 7098 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485703.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence190 835 524 gene locus_tag LOCUS_21770 835 524 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206082.1 protein_id gnl|my_center|LOCUS_21770 1255 953 gene locus_tag LOCUS_21780 1255 953 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857708.1 protein_id gnl|my_center|LOCUS_21780 2090 1374 gene locus_tag LOCUS_21790 gene urtE 2090 1374 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112317.1 protein_id gnl|my_center|LOCUS_21790 2868 2101 gene locus_tag LOCUS_21800 gene urtD 2868 2101 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 protein_id gnl|my_center|LOCUS_21800 4067 2895 gene locus_tag LOCUS_21810 gene urtC 4067 2895 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976303.1 protein_id gnl|my_center|LOCUS_21810 5765 4077 gene locus_tag LOCUS_21820 gene urtB 5765 4077 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105141.1 protein_id gnl|my_center|LOCUS_21820 7244 6018 gene locus_tag LOCUS_21830 gene urtA 7244 6018 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096636.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence191 1061 4345 gene locus_tag LOCUS_21840 1061 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 4714 4790 gene locus_tag LOCUS_t00230 4714 4790 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5312 4914 gene locus_tag LOCUS_21850 gene rpsI 5312 4914 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_21850 5777 5325 gene locus_tag LOCUS_21860 gene rplM 5777 5325 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_21860 6653 5901 gene locus_tag LOCUS_21870 6653 5901 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920508.1 protein_id gnl|my_center|LOCUS_21870 >Feature sequence192 938 1687 gene locus_tag LOCUS_21880 938 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 1750 3420 gene locus_tag LOCUS_21890 1750 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 3467 4408 gene locus_tag LOCUS_21900 3467 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 4436 6265 gene locus_tag LOCUS_21910 4436 6265 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840152.1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence193 <1 1172 gene locus_tag LOCUS_21920 <1 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173328348.1:adenylosuccinate lyase 1301 2083 gene locus_tag LOCUS_21930 1301 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 2145 4037 gene locus_tag LOCUS_21940 2145 4037 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706813.1 protein_id gnl|my_center|LOCUS_21940 4220 4723 gene locus_tag LOCUS_21950 4220 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 4859 6118 gene locus_tag LOCUS_21960 4859 6118 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence194 119 1144 gene locus_tag LOCUS_21970 119 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 1151 1858 gene locus_tag LOCUS_21980 1151 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 2941 1985 gene locus_tag LOCUS_21990 2941 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 3114 3425 gene locus_tag LOCUS_22000 3114 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 3425 3850 gene locus_tag LOCUS_22010 3425 3850 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876267.1 protein_id gnl|my_center|LOCUS_22010 3870 4919 gene locus_tag LOCUS_22020 3870 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 4974 5759 gene locus_tag LOCUS_22030 4974 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 5752 6276 gene locus_tag LOCUS_22040 5752 6276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence195 <1 1599 gene locus_tag LOCUS_22050 <1 1599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044884.1:PAS domain S-box protein 4241 1641 gene locus_tag LOCUS_22060 4241 1641 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 protein_id gnl|my_center|LOCUS_22060 4663 4238 gene locus_tag LOCUS_22070 4663 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 4874 4665 gene locus_tag LOCUS_22080 4874 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 5621 4923 gene locus_tag LOCUS_22090 gene deoC 5621 4923 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436656.1 protein_id gnl|my_center|LOCUS_22090 6601 5618 gene locus_tag LOCUS_22100 gene rbsK 6601 5618 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532180.1 protein_id gnl|my_center|LOCUS_22100 >Feature sequence196 139 864 gene locus_tag LOCUS_22110 139 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918209.1 protein_id gnl|my_center|LOCUS_22110 1900 902 gene locus_tag LOCUS_22120 1900 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 2894 1968 gene locus_tag LOCUS_22130 gene rlmF 2894 1968 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705227.1 protein_id gnl|my_center|LOCUS_22130 4592 2937 gene locus_tag LOCUS_22140 4592 2937 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143151.1 protein_id gnl|my_center|LOCUS_22140 4767 4901 gene locus_tag LOCUS_22150 4767 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 5004 6167 gene locus_tag LOCUS_22160 5004 6167 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929520.1 protein_id gnl|my_center|LOCUS_22160 <7043 6225 gene locus_tag LOCUS_22170 <7043 6225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258123.1:dipeptide ABC transporter ATP-binding protein >Feature sequence197 <1 714 gene locus_tag LOCUS_22180 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009873338.1:MBL fold metallo-hydrolase 845 2293 gene locus_tag LOCUS_22190 gene pyk 845 2293 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122699.1 protein_id gnl|my_center|LOCUS_22190 2471 3880 gene locus_tag LOCUS_22200 2471 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 3908 4837 gene locus_tag LOCUS_22210 3908 4837 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976373.1 protein_id gnl|my_center|LOCUS_22210 4876 5742 gene locus_tag LOCUS_22220 4876 5742 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729785.1 protein_id gnl|my_center|LOCUS_22220 <7014 5794 gene locus_tag LOCUS_22230 <7014 5794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224820.1:cell division protein FtsZ >Feature sequence198 1527 373 gene locus_tag LOCUS_22240 1527 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 1713 2024 gene locus_tag LOCUS_22250 1713 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2021 3817 gene locus_tag LOCUS_22260 2021 3817 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730352.1 protein_id gnl|my_center|LOCUS_22260 3864 5525 gene locus_tag LOCUS_22270 3864 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 5522 6094 gene locus_tag LOCUS_22280 5522 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 <6959 6081 gene locus_tag LOCUS_22290 <6959 6081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003426955.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase >Feature sequence199 620 937 gene locus_tag LOCUS_22300 620 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 986 2800 gene locus_tag LOCUS_22310 986 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 3235 2876 gene locus_tag LOCUS_22320 3235 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 3414 5036 gene locus_tag LOCUS_22330 3414 5036 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055228983.1 protein_id gnl|my_center|LOCUS_22330 5963 5229 gene locus_tag LOCUS_22340 5963 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence200 1051 146 gene locus_tag LOCUS_22350 1051 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 1604 1092 gene locus_tag LOCUS_22360 1604 1092 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030436.1 protein_id gnl|my_center|LOCUS_22360 2384 1620 gene locus_tag LOCUS_22370 gene xth 2384 1620 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243194.1 protein_id gnl|my_center|LOCUS_22370 2511 4046 gene locus_tag LOCUS_22380 2511 4046 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910561.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence201 759 1967 gene locus_tag LOCUS_22390 759 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 2012 3580 gene locus_tag LOCUS_22400 2012 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 3703 4935 gene locus_tag LOCUS_22410 3703 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 5739 4912 gene locus_tag LOCUS_22420 5739 4912 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106127.1 protein_id gnl|my_center|LOCUS_22420 6034 6118 gene locus_tag LOCUS_t00240 6034 6118 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6248 6757 gene locus_tag LOCUS_22430 6248 6757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence202 1083 460 gene locus_tag LOCUS_22440 1083 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1445 1119 gene locus_tag LOCUS_22450 1445 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 1656 2432 gene locus_tag LOCUS_22460 1656 2432 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_22460 2453 3559 gene locus_tag LOCUS_22470 2453 3559 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401241.1 protein_id gnl|my_center|LOCUS_22470 3948 4520 gene locus_tag LOCUS_22480 3948 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 4661 6028 gene locus_tag LOCUS_22490 gene accC 4661 6028 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259259.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence203 <1 1137 gene locus_tag LOCUS_22500 <1 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941564.1:DNA helicase RecQ 3141 1579 gene locus_tag LOCUS_22510 3141 1579 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256441.1 protein_id gnl|my_center|LOCUS_22510 3863 3375 gene locus_tag LOCUS_22520 3863 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 4605 3967 gene locus_tag LOCUS_22530 4605 3967 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185693707.1 protein_id gnl|my_center|LOCUS_22530 4766 4693 gene locus_tag LOCUS_t00250 4766 4693 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5004 4919 gene locus_tag LOCUS_t00260 5004 4919 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5180 5105 gene locus_tag LOCUS_t00270 5180 5105 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5338 5262 gene locus_tag LOCUS_t00280 5338 5262 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5417 5343 gene locus_tag LOCUS_t00290 5417 5343 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5580 5505 gene locus_tag LOCUS_t00300 5580 5505 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence204 3197 1086 gene locus_tag LOCUS_22540 3197 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 4147 3194 gene locus_tag LOCUS_22550 4147 3194 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521577.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22550 5619 4144 gene locus_tag LOCUS_22560 5619 4144 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_22560 >Feature sequence205 1400 384 gene locus_tag LOCUS_22570 gene hemB 1400 384 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_22570 1663 3084 gene locus_tag LOCUS_22580 gene cysS 1663 3084 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873400.1 protein_id gnl|my_center|LOCUS_22580 3247 3474 gene locus_tag LOCUS_22590 3247 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 3471 3866 gene locus_tag LOCUS_22600 3471 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 3934 5871 gene locus_tag LOCUS_22610 gene thrS 3934 5871 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329329.1 protein_id gnl|my_center|LOCUS_22610 <6649 5963 gene locus_tag LOCUS_22620 <6649 5963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869365.1:carbon starvation protein A >Feature sequence206 1135 302 gene locus_tag LOCUS_22630 1135 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 2259 1177 gene locus_tag LOCUS_22640 2259 1177 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975709.1 protein_id gnl|my_center|LOCUS_22640 3485 2262 gene locus_tag LOCUS_22650 3485 2262 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415928.1 protein_id gnl|my_center|LOCUS_22650 4717 3497 gene locus_tag LOCUS_22660 4717 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 5643 4714 gene locus_tag LOCUS_22670 5643 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 <6630 5863 gene locus_tag LOCUS_22680 <6630 5863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942151.1:ABC transporter ATP-binding protein >Feature sequence207 893 264 gene locus_tag LOCUS_22690 893 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 1059 2357 gene locus_tag LOCUS_22700 1059 2357 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 protein_id gnl|my_center|LOCUS_22700 2374 3648 gene locus_tag LOCUS_22710 2374 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 3726 4952 gene locus_tag LOCUS_22720 gene rodA 3726 4952 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence208 482 1477 gene locus_tag LOCUS_22730 482 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 1483 2415 gene locus_tag LOCUS_22740 1483 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 2483 5299 gene locus_tag LOCUS_22750 2483 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 >Feature sequence209 844 1209 gene locus_tag LOCUS_22760 gene tnpB 844 1209 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385717.1 protein_id gnl|my_center|LOCUS_22760 2373 1660 gene locus_tag LOCUS_22770 2373 1660 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883163.1 protein_id gnl|my_center|LOCUS_22770 2847 2434 gene locus_tag LOCUS_22780 2847 2434 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730224.1 protein_id gnl|my_center|LOCUS_22780 3167 3613 gene locus_tag LOCUS_22790 3167 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 3638 4285 gene locus_tag LOCUS_22800 3638 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 4306 4710 gene locus_tag LOCUS_22810 4306 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence210 1302 658 gene locus_tag LOCUS_22820 1302 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 5458 1424 gene locus_tag LOCUS_22830 5458 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 6292 5552 gene locus_tag LOCUS_22840 6292 5552 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144228759.1 protein_id gnl|my_center|LOCUS_22840 >Feature sequence211 547 1233 gene locus_tag LOCUS_22850 547 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 1424 2065 gene locus_tag LOCUS_22860 1424 2065 CDS product TIGR02466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_22860 2107 2319 gene locus_tag LOCUS_22870 2107 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 3444 2332 gene locus_tag LOCUS_22880 gene lptG 3444 2332 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942568.1 protein_id gnl|my_center|LOCUS_22880 3620 4567 gene locus_tag LOCUS_22890 3620 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 5632 4568 gene locus_tag LOCUS_22900 5632 4568 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143073.1 protein_id gnl|my_center|LOCUS_22900 >Feature sequence212 443 105 gene locus_tag LOCUS_22910 443 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 2496 655 gene locus_tag LOCUS_22920 2496 655 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250346.1 protein_id gnl|my_center|LOCUS_22920 3096 2848 gene locus_tag LOCUS_22930 3096 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 4545 3229 gene locus_tag LOCUS_22940 gene eno 4545 3229 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_22940 5499 4654 gene locus_tag LOCUS_22950 5499 4654 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082250.1 protein_id gnl|my_center|LOCUS_22950 5693 6268 gene locus_tag LOCUS_22960 5693 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence213 <1 873 gene locus_tag LOCUS_22970 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107211.1:glycoside hydrolase family 127 protein 1304 3604 gene locus_tag LOCUS_22980 1304 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 3595 4575 gene locus_tag LOCUS_22990 3595 4575 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083685838.1 protein_id gnl|my_center|LOCUS_22990 >Feature sequence214 1821 400 gene locus_tag LOCUS_23000 1821 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 5267 1863 gene locus_tag LOCUS_23010 5267 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 >Feature sequence215 >Feature sequence216 3982 77 gene locus_tag LOCUS_23020 3982 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 4777 4064 gene locus_tag LOCUS_23030 4777 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 4926 5954 gene locus_tag LOCUS_23040 4926 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 >Feature sequence217 <1 859 gene locus_tag LOCUS_23050 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094267720.1:4-alpha-glucanotransferase 1744 860 gene locus_tag LOCUS_23060 1744 860 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_23060 2785 1754 gene locus_tag LOCUS_23070 2785 1754 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922567.1 protein_id gnl|my_center|LOCUS_23070 3608 2790 gene locus_tag LOCUS_23080 3608 2790 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121724.1 protein_id gnl|my_center|LOCUS_23080 4100 3624 gene locus_tag LOCUS_23090 4100 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 <6424 4170 gene locus_tag LOCUS_23100 <6424 4170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141450.1:FG-GAP-like repeat-containing protein >Feature sequence218 925 1962 gene locus_tag LOCUS_23110 925 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 2658 1975 gene locus_tag LOCUS_23120 gene nth 2658 1975 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778932.1 protein_id gnl|my_center|LOCUS_23120 5299 2765 gene locus_tag LOCUS_23130 5299 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 6203 5346 gene locus_tag LOCUS_23140 6203 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 >Feature sequence219 630 373 gene locus_tag LOCUS_23150 630 373 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921431.1 protein_id gnl|my_center|LOCUS_23150 1917 673 gene locus_tag LOCUS_23160 1917 673 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325817.1 protein_id gnl|my_center|LOCUS_23160 2019 3017 gene locus_tag LOCUS_23170 gene galE 2019 3017 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615363.1 protein_id gnl|my_center|LOCUS_23170 3663 3247 gene locus_tag LOCUS_23180 gene ndk 3663 3247 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123449.1 protein_id gnl|my_center|LOCUS_23180 5898 3784 gene locus_tag LOCUS_23190 5898 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence220 58 149 gene locus_tag LOCUS_t00310 58 149 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 339 175 gene locus_tag LOCUS_23200 339 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 1720 716 gene locus_tag LOCUS_23210 1720 716 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463386.1 protein_id gnl|my_center|LOCUS_23210 3442 1823 gene locus_tag LOCUS_23220 gene murJ 3442 1823 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391285.1 protein_id gnl|my_center|LOCUS_23220 3594 4565 gene locus_tag LOCUS_23230 3594 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 5535 4633 gene locus_tag LOCUS_23240 5535 4633 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_23240 5614 6315 gene locus_tag LOCUS_23250 5614 6315 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728103.1 protein_id gnl|my_center|LOCUS_23250 >Feature sequence221 <1 2280 gene locus_tag LOCUS_23260 <1 2280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_076055503.1:glycoside hydrolase family 95 protein 2347 4659 gene locus_tag LOCUS_23270 2347 4659 CDS product DUF5703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765773.1 protein_id gnl|my_center|LOCUS_23270 4696 6243 gene locus_tag LOCUS_23280 4696 6243 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence222 1605 655 gene locus_tag LOCUS_23290 1605 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 2501 1602 gene locus_tag LOCUS_23300 2501 1602 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267092.1 protein_id gnl|my_center|LOCUS_23300 2688 3158 gene locus_tag LOCUS_23310 2688 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 3844 3230 gene locus_tag LOCUS_23320 gene lexA 3844 3230 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930566.1 protein_id gnl|my_center|LOCUS_23320 3987 5747 gene locus_tag LOCUS_23330 gene cysI 3987 5747 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243849.1 protein_id gnl|my_center|LOCUS_23330 >Feature sequence223 <1 1092 gene locus_tag LOCUS_23340 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888732.1:Fe-S cluster assembly protein SufD 1888 1142 gene locus_tag LOCUS_23350 1888 1142 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838137.1 protein_id gnl|my_center|LOCUS_23350 3081 1885 gene locus_tag LOCUS_23360 3081 1885 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838136.1 protein_id gnl|my_center|LOCUS_23360 4713 3427 gene locus_tag LOCUS_23370 4713 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 5935 4745 gene locus_tag LOCUS_23380 5935 4745 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028836.1 protein_id gnl|my_center|LOCUS_23380 >Feature sequence224 1498 275 gene locus_tag LOCUS_23390 gene ftsA 1498 275 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392368.1 protein_id gnl|my_center|LOCUS_23390 2453 1533 gene locus_tag LOCUS_23400 2453 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 3478 2537 gene locus_tag LOCUS_23410 3478 2537 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865083.1 protein_id gnl|my_center|LOCUS_23410 3720 3475 gene locus_tag LOCUS_23420 3720 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 6059 3729 gene locus_tag LOCUS_23430 6059 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 >Feature sequence225 1485 3269 gene locus_tag LOCUS_23440 gene sppA 1485 3269 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_23440 3284 3832 gene locus_tag LOCUS_23450 gene sufT 3284 3832 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_23450 3861 4979 gene locus_tag LOCUS_23460 3861 4979 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036173.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence226 2495 303 gene locus_tag LOCUS_23470 2495 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 3383 2544 gene locus_tag LOCUS_23480 3383 2544 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107014379.1 protein_id gnl|my_center|LOCUS_23480 3488 5155 gene locus_tag LOCUS_23490 3488 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence227 1168 542 gene locus_tag LOCUS_23500 1168 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 1232 1900 gene locus_tag LOCUS_23510 1232 1900 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402807.1 protein_id gnl|my_center|LOCUS_23510 1919 2527 gene locus_tag LOCUS_23520 1919 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 2631 3626 gene locus_tag LOCUS_23530 gene yhaM 2631 3626 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726638.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence228 2590 1472 gene locus_tag LOCUS_23540 2590 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941754.1 protein_id gnl|my_center|LOCUS_23540 2880 3668 gene locus_tag LOCUS_23550 2880 3668 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_23550 3980 3690 gene locus_tag LOCUS_23560 3980 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 5852 4092 gene locus_tag LOCUS_23570 5852 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence229 <1 544 gene locus_tag LOCUS_23580 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903274.1:DUF2071 domain-containing protein 5295 568 gene locus_tag LOCUS_23590 5295 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 >Feature sequence230 1307 2116 gene locus_tag LOCUS_23600 1307 2116 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144228759.1 protein_id gnl|my_center|LOCUS_23600 2335 4839 gene locus_tag LOCUS_23610 2335 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 5230 6033 gene locus_tag LOCUS_23620 5230 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence231 3479 2214 gene locus_tag LOCUS_23630 3479 2214 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707722.1 protein_id gnl|my_center|LOCUS_23630 4700 3612 gene locus_tag LOCUS_23640 4700 3612 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_23640 5018 5091 gene locus_tag LOCUS_t00320 5018 5091 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence232 <1 750 gene locus_tag LOCUS_23650 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393528.1:1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase 2182 752 gene locus_tag LOCUS_23660 2182 752 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938336.1 protein_id gnl|my_center|LOCUS_23660 3547 2201 gene locus_tag LOCUS_23670 3547 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 4420 3557 gene locus_tag LOCUS_23680 4420 3557 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_23680 5838 4399 gene locus_tag LOCUS_23690 5838 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 >Feature sequence233 1999 1067 gene locus_tag LOCUS_23700 1999 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 2486 2019 gene locus_tag LOCUS_23710 2486 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 4486 2588 gene locus_tag LOCUS_23720 4486 2588 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937364.1 protein_id gnl|my_center|LOCUS_23720 5471 4539 gene locus_tag LOCUS_23730 5471 4539 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence234 <1 1380 gene locus_tag LOCUS_23740 <1 1380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257913.1:polyribonucleotide nucleotidyltransferase 1738 2457 gene locus_tag LOCUS_23750 1738 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 2454 3320 gene locus_tag LOCUS_23760 2454 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 3505 3365 gene locus_tag LOCUS_23770 3505 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 3812 3495 gene locus_tag LOCUS_23780 3812 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 4659 3763 gene locus_tag LOCUS_23790 4659 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 4839 5594 gene locus_tag LOCUS_23800 4839 5594 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208271.1 protein_id gnl|my_center|LOCUS_23800 >Feature sequence235 3211 2087 gene locus_tag LOCUS_23810 gene rlmN 3211 2087 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450546.1 protein_id gnl|my_center|LOCUS_23810 3313 4449 gene locus_tag LOCUS_23820 gene lptF 3313 4449 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_23820 <5983 4509 gene locus_tag LOCUS_23830 <5983 4509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence236 1714 1193 gene locus_tag LOCUS_23840 1714 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 2496 1711 gene locus_tag LOCUS_23850 2496 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 4121 2496 gene locus_tag LOCUS_23860 4121 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 4128 4313 gene locus_tag LOCUS_23870 4128 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 <5962 4277 gene locus_tag LOCUS_23880 <5962 4277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228639.1:secretin N-terminal domain-containing protein >Feature sequence237 <1 1095 gene locus_tag LOCUS_23890 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384807.1:ABC transporter transmembrane domain-containing protein 1178 1927 gene locus_tag LOCUS_23900 1178 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2028 2231 gene locus_tag LOCUS_23910 2028 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 2241 2666 gene locus_tag LOCUS_23920 2241 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 2946 3488 gene locus_tag LOCUS_23930 2946 3488 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963161.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence238 1545 316 gene locus_tag LOCUS_23940 1545 316 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_23940 1636 2478 gene locus_tag LOCUS_23950 gene panC 1636 2478 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_23950 2475 4130 gene locus_tag LOCUS_23960 gene nadB 2475 4130 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_23960 4258 5544 gene locus_tag LOCUS_23970 4258 5544 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258147.1 protein_id gnl|my_center|LOCUS_23970 >Feature sequence239 1 324 gene locus_tag LOCUS_23980 1 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 428 1429 gene locus_tag LOCUS_23990 428 1429 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567511.1 protein_id gnl|my_center|LOCUS_23990 1593 2081 gene locus_tag LOCUS_24000 1593 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 2162 2434 gene locus_tag LOCUS_24010 2162 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 2537 4075 gene locus_tag LOCUS_24020 gene guaA 2537 4075 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_24020 4173 4937 gene locus_tag LOCUS_24030 4173 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 >Feature sequence240 868 146 gene locus_tag LOCUS_24040 868 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 1899 907 gene locus_tag LOCUS_24050 gene mgrA 1899 907 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_24050 4402 1931 gene locus_tag LOCUS_24060 4402 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 4821 4447 gene locus_tag LOCUS_24070 4821 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 4903 5661 gene locus_tag LOCUS_24080 4903 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 >Feature sequence241 1047 4721 gene locus_tag LOCUS_24090 1047 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 4784 5278 gene locus_tag LOCUS_24100 4784 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 >Feature sequence242 317 1435 gene locus_tag LOCUS_24110 317 1435 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944019.1 protein_id gnl|my_center|LOCUS_24110 1874 1575 gene locus_tag LOCUS_24120 1874 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24120 2341 1871 gene locus_tag LOCUS_24130 2341 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 3855 2740 gene locus_tag LOCUS_24140 gene rsgA 3855 2740 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143435.1 protein_id gnl|my_center|LOCUS_24140 4199 3894 gene locus_tag LOCUS_24150 4199 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 <5789 4250 gene locus_tag LOCUS_24160 <5789 4250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640158.1:TonB-dependent receptor >Feature sequence243 1664 252 gene locus_tag LOCUS_24170 1664 252 CDS product AtzE family amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965237.1 protein_id gnl|my_center|LOCUS_24170 2263 1661 gene locus_tag LOCUS_24180 2263 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 4783 2342 gene locus_tag LOCUS_24190 4783 2342 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920510.1 protein_id gnl|my_center|LOCUS_24190 4937 5752 gene locus_tag LOCUS_24200 4937 5752 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_24200 >Feature sequence244 3775 824 gene locus_tag LOCUS_24210 3775 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 4085 3900 gene locus_tag LOCUS_24220 4085 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 4661 4185 gene locus_tag LOCUS_24230 4661 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 >Feature sequence245 5345 2535 gene locus_tag LOCUS_24240 5345 2535 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201960.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence246 524 3010 gene locus_tag LOCUS_24250 524 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 3038 4600 gene locus_tag LOCUS_24260 3038 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 >Feature sequence247 645 496 gene locus_tag LOCUS_24270 645 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 683 937 gene locus_tag LOCUS_24280 683 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 1063 2019 gene locus_tag LOCUS_24290 1063 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 >Feature sequence248 1822 494 gene locus_tag LOCUS_24300 1822 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 1892 2605 gene locus_tag LOCUS_24310 1892 2605 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_24310 2623 2940 gene locus_tag LOCUS_24320 2623 2940 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038930.1 protein_id gnl|my_center|LOCUS_24320 2901 3647 gene locus_tag LOCUS_24330 2901 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 3644 5326 gene locus_tag LOCUS_24340 3644 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 >Feature sequence249 1106 1180 gene locus_tag LOCUS_t00330 1106 1180 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1434 2534 gene locus_tag LOCUS_24350 gene queA 1434 2534 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081288.1 protein_id gnl|my_center|LOCUS_24350 2639 5200 gene locus_tag LOCUS_24360 gene mutS 2639 5200 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_24360 >Feature sequence250 <1 2306 gene locus_tag LOCUS_24370 <1 2306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939521.1:Tex family protein 3220 2339 gene locus_tag LOCUS_24380 3220 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence251 207 698 gene locus_tag LOCUS_24390 207 698 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036969.1 protein_id gnl|my_center|LOCUS_24390 748 2436 gene locus_tag LOCUS_24400 748 2436 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_24400 3337 2672 gene locus_tag LOCUS_24410 3337 2672 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 protein_id gnl|my_center|LOCUS_24410 3534 4262 gene locus_tag LOCUS_24420 3534 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence252 2618 3859 gene locus_tag LOCUS_24430 2618 3859 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_24430 3920 4741 gene locus_tag LOCUS_24440 3920 4741 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067309.1 protein_id gnl|my_center|LOCUS_24440 4751 5593 gene locus_tag LOCUS_24450 4751 5593 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529754.1 protein_id gnl|my_center|LOCUS_24450 >Feature sequence253 1465 485 gene locus_tag LOCUS_24460 1465 485 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_24460 2629 1517 gene locus_tag LOCUS_24470 gene pdhA 2629 1517 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389634.1 protein_id gnl|my_center|LOCUS_24470 3281 2748 gene locus_tag LOCUS_24480 3281 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 3260 4015 gene locus_tag LOCUS_24490 3260 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 >Feature sequence254 520 876 gene locus_tag LOCUS_24500 520 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 1652 915 gene locus_tag LOCUS_24510 1652 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 2996 1701 gene locus_tag LOCUS_24520 2996 1701 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227203.1 protein_id gnl|my_center|LOCUS_24520 3821 3573 gene locus_tag LOCUS_24530 3821 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence255 2 145 gene locus_tag LOCUS_24540 2 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 815 417 gene locus_tag LOCUS_24550 815 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 1115 2074 gene locus_tag LOCUS_24560 1115 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 2071 2697 gene locus_tag LOCUS_24570 gene pnuC 2071 2697 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400615.1 protein_id gnl|my_center|LOCUS_24570 2694 3254 gene locus_tag LOCUS_24580 2694 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 3251 4063 gene locus_tag LOCUS_24590 gene tcdA 3251 4063 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190050.1 protein_id gnl|my_center|LOCUS_24590 4889 4035 gene locus_tag LOCUS_24600 4889 4035 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707415.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence256 <1 3015 gene locus_tag LOCUS_24610 <1 3015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037804.1:S8 family peptidase >Feature sequence257 881 144 gene locus_tag LOCUS_24620 gene pyrH 881 144 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965095.1 protein_id gnl|my_center|LOCUS_24620 1040 1744 gene locus_tag LOCUS_24630 1040 1744 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640345.1 protein_id gnl|my_center|LOCUS_24630 1800 2348 gene locus_tag LOCUS_24640 1800 2348 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_24640 2345 3088 gene locus_tag LOCUS_24650 2345 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 3167 3601 gene locus_tag LOCUS_24660 3167 3601 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472569.1 protein_id gnl|my_center|LOCUS_24660 3618 4073 gene locus_tag LOCUS_24670 3618 4073 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263462.1 protein_id gnl|my_center|LOCUS_24670 4060 4650 gene locus_tag LOCUS_24680 4060 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881788.1 protein_id gnl|my_center|LOCUS_24680 >Feature sequence258 1874 906 gene locus_tag LOCUS_24690 1874 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 2381 1938 gene locus_tag LOCUS_24700 2381 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 2972 2460 gene locus_tag LOCUS_24710 2972 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 3097 4278 gene locus_tag LOCUS_24720 gene sucC 3097 4278 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721255.1 protein_id gnl|my_center|LOCUS_24720 >Feature sequence259 946 314 gene locus_tag LOCUS_24730 946 314 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339235.1 protein_id gnl|my_center|LOCUS_24730 1599 1015 gene locus_tag LOCUS_24740 1599 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 1724 1996 gene locus_tag LOCUS_24750 gene infA 1724 1996 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553999.1 protein_id gnl|my_center|LOCUS_24750 2106 3098 gene locus_tag LOCUS_24760 gene xerD 2106 3098 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707046.1 protein_id gnl|my_center|LOCUS_24760 <5282 3141 gene locus_tag LOCUS_24770 <5282 3141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064243330.1:transglutaminase family protein >Feature sequence260 4229 96 gene locus_tag LOCUS_24780 gene purL 4229 96 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207387.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence261 <1 1005 gene locus_tag LOCUS_24790 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108909.1:zinc-binding alcohol dehydrogenase family protein 1126 1968 gene locus_tag LOCUS_24800 1126 1968 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922282.1 protein_id gnl|my_center|LOCUS_24800 3017 1953 gene locus_tag LOCUS_24810 3017 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 3438 3061 gene locus_tag LOCUS_24820 3438 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 4731 3463 gene locus_tag LOCUS_24830 gene serS 4731 3463 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404592.1 protein_id gnl|my_center|LOCUS_24830 4730 4900 gene locus_tag LOCUS_24840 4730 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence262 1170 1910 gene locus_tag LOCUS_24850 1170 1910 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083678.1 protein_id gnl|my_center|LOCUS_24850 2552 1914 gene locus_tag LOCUS_24860 2552 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 3076 2549 gene locus_tag LOCUS_24870 3076 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 3419 3171 gene locus_tag LOCUS_24880 3419 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 3682 3416 gene locus_tag LOCUS_24890 3682 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 4530 3679 gene locus_tag LOCUS_24900 gene rsmA 4530 3679 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_24900 <5205 4534 gene locus_tag LOCUS_24910 <5205 4534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943016.1:indole-3-glycerol phosphate synthase TrpC >Feature sequence263 2724 817 gene locus_tag LOCUS_24920 2724 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 3507 2740 gene locus_tag LOCUS_24930 3507 2740 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_24930 >Feature sequence264 3770 1542 gene locus_tag LOCUS_24940 3770 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence265 <1 1280 gene locus_tag LOCUS_24950 <1 1280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161270060.1:tetratricopeptide repeat protein 3077 1323 gene locus_tag LOCUS_24960 gene muiA 3077 1323 CDS product mucoidy inhibitor MuiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_24960 4013 3162 gene locus_tag LOCUS_24970 gene dapF 4013 3162 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_24970 <5166 4117 gene locus_tag LOCUS_24980 <5166 4117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003016286.1:cardiolipin synthase >Feature sequence266 512 3163 gene locus_tag LOCUS_24990 512 3163 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255972.1 protein_id gnl|my_center|LOCUS_24990 3172 4326 gene locus_tag LOCUS_25000 3172 4326 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 protein_id gnl|my_center|LOCUS_25000 4363 5136 gene locus_tag LOCUS_25010 4363 5136 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404765.1 protein_id gnl|my_center|LOCUS_25010 >Feature sequence267 <1 922 gene locus_tag LOCUS_25020 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932589.1:AAA family ATPase 919 1575 gene locus_tag LOCUS_25030 919 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 1607 2068 gene locus_tag LOCUS_25040 1607 2068 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765008.1 protein_id gnl|my_center|LOCUS_25040 2086 4323 gene locus_tag LOCUS_25050 2086 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 >Feature sequence268 <1 584 gene locus_tag LOCUS_25060 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922162.1:cytochrome c biogenesis protein CcsA 1822 833 gene locus_tag LOCUS_25070 1822 833 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816295.1 protein_id gnl|my_center|LOCUS_25070 2830 4479 gene locus_tag LOCUS_25080 2830 4479 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_25080 >Feature sequence269 1210 137 gene locus_tag LOCUS_25090 1210 137 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042596355.1 protein_id gnl|my_center|LOCUS_25090 1471 2409 gene locus_tag LOCUS_25100 gene nadC 1471 2409 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068020.1 protein_id gnl|my_center|LOCUS_25100 2485 3477 gene locus_tag LOCUS_25110 2485 3477 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942580.1 protein_id gnl|my_center|LOCUS_25110 3487 4389 gene locus_tag LOCUS_25120 3487 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence270 2837 2334 gene locus_tag LOCUS_25130 2837 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 3952 2834 gene locus_tag LOCUS_25140 3952 2834 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_25140 <5094 4119 gene locus_tag LOCUS_25150 <5094 4119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071542453.1:glutamate-5-semialdehyde dehydrogenase >Feature sequence271 1333 689 gene locus_tag LOCUS_25160 1333 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 1985 1416 gene locus_tag LOCUS_25170 1985 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 1984 3159 gene locus_tag LOCUS_25180 1984 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 3338 4444 gene locus_tag LOCUS_25190 gene purM 3338 4444 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327868.1 protein_id gnl|my_center|LOCUS_25190 4477 4926 gene locus_tag LOCUS_25200 4477 4926 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530517.1 protein_id gnl|my_center|LOCUS_25200 >Feature sequence272 163 1104 gene locus_tag LOCUS_25210 163 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 1179 1313 gene locus_tag LOCUS_25220 1179 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 3071 1350 gene locus_tag LOCUS_25230 3071 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 4850 3099 gene locus_tag LOCUS_25240 4850 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 >Feature sequence273 2666 135 gene locus_tag LOCUS_25250 2666 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 4689 2692 gene locus_tag LOCUS_25260 4689 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 >Feature sequence274 130 1098 gene locus_tag LOCUS_25270 130 1098 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257878.1 protein_id gnl|my_center|LOCUS_25270 1448 1161 gene locus_tag LOCUS_25280 1448 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 3115 1445 gene locus_tag LOCUS_25290 3115 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 3989 3171 gene locus_tag LOCUS_25300 3989 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 4117 4869 gene locus_tag LOCUS_25310 4117 4869 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142748.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence275 468 392 gene locus_tag LOCUS_t00340 468 392 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1617 574 gene locus_tag LOCUS_25320 1617 574 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975953.1 protein_id gnl|my_center|LOCUS_25320 2295 1654 gene locus_tag LOCUS_25330 2295 1654 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086177.1 protein_id gnl|my_center|LOCUS_25330 2330 3211 gene locus_tag LOCUS_25340 2330 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 >Feature sequence276 283 729 gene locus_tag LOCUS_25350 283 729 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_25350 732 1445 gene locus_tag LOCUS_25360 732 1445 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832407.1 protein_id gnl|my_center|LOCUS_25360 1563 2183 gene locus_tag LOCUS_25370 gene ureG 1563 2183 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_25370 2289 3131 gene locus_tag LOCUS_25380 2289 3131 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815718.1 protein_id gnl|my_center|LOCUS_25380 <4798 3350 gene locus_tag LOCUS_25390 <4798 3350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258948.1:transcription-repair coupling factor >Feature sequence277 <1 1394 gene locus_tag LOCUS_25400 <1 1394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267555.1:type III glutamate--ammonia ligase 1562 2002 gene locus_tag LOCUS_25410 gene nikR 1562 2002 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940151.1 protein_id gnl|my_center|LOCUS_25410 2103 2378 gene locus_tag LOCUS_25420 2103 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 3675 2434 gene locus_tag LOCUS_25430 3675 2434 CDS product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922349.1 protein_id gnl|my_center|LOCUS_25430 <4795 3986 gene locus_tag LOCUS_25440 <4795 3986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004529100.1:TonB-dependent receptor >Feature sequence278 472 678 gene locus_tag LOCUS_25450 472 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 689 847 gene locus_tag LOCUS_25460 689 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 2747 885 gene locus_tag LOCUS_25470 2747 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 4104 2800 gene locus_tag LOCUS_25480 4104 2800 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551117.1 protein_id gnl|my_center|LOCUS_25480 >Feature sequence279 2568 2170 gene locus_tag LOCUS_25490 2568 2170 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_25490 2834 2568 gene locus_tag LOCUS_25500 2834 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 3159 4724 gene locus_tag LOCUS_25510 gene cimA 3159 4724 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880180.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence280 2934 2158 gene locus_tag LOCUS_25520 2934 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 <4757 3299 gene locus_tag LOCUS_25530 <4757 3299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence281 2605 3363 gene locus_tag LOCUS_25540 2605 3363 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_25540 3658 3392 gene locus_tag LOCUS_25550 3658 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence282 168 680 gene locus_tag LOCUS_25560 168 680 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_25560 775 1815 gene locus_tag LOCUS_25570 gene folE2 775 1815 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722743.1 protein_id gnl|my_center|LOCUS_25570 2728 1823 gene locus_tag LOCUS_25580 2728 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 2819 4447 gene locus_tag LOCUS_25590 2819 4447 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615419.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence283 1837 845 gene locus_tag LOCUS_25600 1837 845 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931757.1 protein_id gnl|my_center|LOCUS_25600 1855 2337 gene locus_tag LOCUS_25610 1855 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 <4669 2351 gene locus_tag LOCUS_25620 <4669 2351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099915172.1:M4 family metallopeptidase >Feature sequence284 <4657 4037 gene locus_tag LOCUS_25630 <4657 4037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920832.1:2-succinylbenzoate--CoA ligase >Feature sequence285 2655 1759 gene locus_tag LOCUS_25640 gene lipA 2655 1759 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_25640 3465 2710 gene locus_tag LOCUS_25650 gene lipB 3465 2710 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943071.1 protein_id gnl|my_center|LOCUS_25650 3944 3462 gene locus_tag LOCUS_25660 3944 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 >Feature sequence286 <1 666 gene locus_tag LOCUS_25670 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113857.1:ABC transporter ATP-binding protein 753 1475 gene locus_tag LOCUS_25680 753 1475 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_25680 1534 3399 gene locus_tag LOCUS_25690 1534 3399 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_25690 >Feature sequence287 <1 541 gene locus_tag LOCUS_25700 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000524416.1:NADH-quinone oxidoreductase subunit B 586 1230 gene locus_tag LOCUS_25710 586 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 1264 2502 gene locus_tag LOCUS_25720 gene nuoD 1264 2502 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_25720 2636 3124 gene locus_tag LOCUS_25730 2636 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 3144 3383 gene locus_tag LOCUS_25740 3144 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence288 722 1618 gene locus_tag LOCUS_25750 722 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 <4509 1615 gene locus_tag LOCUS_25760 <4509 1615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III domain-containing protein >Feature sequence289 16 465 gene locus_tag LOCUS_25770 gene mraZ 16 465 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_25770 533 1498 gene locus_tag LOCUS_25780 gene rsmH 533 1498 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_25780 1512 1916 gene locus_tag LOCUS_25790 1512 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 1921 3819 gene locus_tag LOCUS_25800 1921 3819 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_25800 >Feature sequence290 255 740 gene locus_tag LOCUS_25810 255 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 1537 752 gene locus_tag LOCUS_25820 1537 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 2471 1545 gene locus_tag LOCUS_25830 2471 1545 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_25830 3001 2468 gene locus_tag LOCUS_25840 gene sixA 3001 2468 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763283.1 protein_id gnl|my_center|LOCUS_25840 3690 3046 gene locus_tag LOCUS_25850 gene pdxH 3690 3046 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403320.1 protein_id gnl|my_center|LOCUS_25850 >Feature sequence291 1074 454 gene locus_tag LOCUS_25860 1074 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 2214 1129 gene locus_tag LOCUS_25870 gene aroB 2214 1129 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_25870 3951 2272 gene locus_tag LOCUS_25880 3951 2272 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767764.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence292 3583 4449 gene locus_tag LOCUS_25890 3583 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence293 1204 1785 gene locus_tag LOCUS_25900 1204 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 1959 2402 gene locus_tag LOCUS_25910 1959 2402 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084286.1 protein_id gnl|my_center|LOCUS_25910 2715 2416 gene locus_tag LOCUS_25920 2715 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 2906 3424 gene locus_tag LOCUS_25930 2906 3424 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224001.1 protein_id gnl|my_center|LOCUS_25930 >Feature sequence294 <1 1417 gene locus_tag LOCUS_25940 <1 1417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929181.1:NCS2 family permease 2752 1442 gene locus_tag LOCUS_25950 2752 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 3692 2769 gene locus_tag LOCUS_25960 3692 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 <4438 3770 gene locus_tag LOCUS_25970 <4438 3770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005416818.1:voltage-gated chloride channel family protein >Feature sequence295 2019 580 gene locus_tag LOCUS_25980 gene ahcY 2019 580 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035988.1 protein_id gnl|my_center|LOCUS_25980 3336 2116 gene locus_tag LOCUS_25990 gene metK 3336 2116 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053346.1 protein_id gnl|my_center|LOCUS_25990 3659 4024 gene locus_tag LOCUS_26000 3659 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 >Feature sequence296 664 2100 gene locus_tag LOCUS_26010 664 2100 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_26010 2194 3075 gene locus_tag LOCUS_26020 2194 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 3145 3220 gene locus_tag LOCUS_t00350 3145 3220 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3634 4098 gene locus_tag LOCUS_26030 3634 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence297 <1 681 gene locus_tag LOCUS_26040 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939776.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase 732 1778 gene locus_tag LOCUS_26050 732 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 1809 2963 gene locus_tag LOCUS_26060 gene ftsW 1809 2963 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957396.1 protein_id gnl|my_center|LOCUS_26060 2963 4099 gene locus_tag LOCUS_26070 gene murG 2963 4099 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972053.1 protein_id gnl|my_center|LOCUS_26070 >Feature sequence298 500 105 gene locus_tag LOCUS_26080 500 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 2359 551 gene locus_tag LOCUS_26090 2359 551 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871983.1 protein_id gnl|my_center|LOCUS_26090 <4386 2422 gene locus_tag LOCUS_26100 <4386 2422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338201.1:DNA primase >Feature sequence299 387 1112 gene locus_tag LOCUS_26110 387 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 1208 2284 gene locus_tag LOCUS_26120 1208 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence300 785 18 gene locus_tag LOCUS_26130 gene hisN 785 18 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090456.1 protein_id gnl|my_center|LOCUS_26130 944 1621 gene locus_tag LOCUS_26140 944 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 2245 1556 gene locus_tag LOCUS_26150 2245 1556 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869805.1 protein_id gnl|my_center|LOCUS_26150 2312 4297 gene locus_tag LOCUS_26160 gene pepF 2312 4297 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903691.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence301 <1 3014 gene locus_tag LOCUS_26170 <1 3014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616068.1:UTP--glucose-1-phosphate uridylyltransferase 4352 3051 gene locus_tag LOCUS_26180 4352 3051 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941553.1 protein_id gnl|my_center|LOCUS_26180 >Feature sequence302 350 192 gene locus_tag LOCUS_26190 350 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 624 445 gene locus_tag LOCUS_26200 624 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 1266 757 gene locus_tag LOCUS_26210 1266 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 4264 1319 gene locus_tag LOCUS_26220 4264 1319 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546856.1 protein_id gnl|my_center|LOCUS_26220 >Feature sequence303 1712 243 gene locus_tag LOCUS_26230 1712 243 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_26230 1819 2946 gene locus_tag LOCUS_26240 1819 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence304 985 320 gene locus_tag LOCUS_26250 985 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 1655 1047 gene locus_tag LOCUS_26260 1655 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 1694 2590 gene locus_tag LOCUS_26270 1694 2590 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529224.1 protein_id gnl|my_center|LOCUS_26270 3114 2632 gene locus_tag LOCUS_26280 3114 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 3773 3123 gene locus_tag LOCUS_26290 3773 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 >Feature sequence305 2924 534 gene locus_tag LOCUS_26300 2924 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 3358 2930 gene locus_tag LOCUS_26310 3358 2930 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878970.1 protein_id gnl|my_center|LOCUS_26310 <4317 3355 gene locus_tag LOCUS_26320 <4317 3355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256430.1:ATP-binding protein >Feature sequence306 1774 884 gene locus_tag LOCUS_26330 1774 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26330 1897 2466 gene locus_tag LOCUS_26340 1897 2466 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_26340 2471 3673 gene locus_tag LOCUS_26350 gene queG 2471 3673 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397385.1 protein_id gnl|my_center|LOCUS_26350 4043 3967 gene locus_tag LOCUS_t00360 4043 3967 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence307 765 2510 gene locus_tag LOCUS_26360 765 2510 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 protein_id gnl|my_center|LOCUS_26360 2507 2713 gene locus_tag LOCUS_26370 gene nrdD 2507 2713 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196981.1 protein_id gnl|my_center|LOCUS_26370 2710 3474 gene locus_tag LOCUS_26380 2710 3474 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389029.1 protein_id gnl|my_center|LOCUS_26380 >Feature sequence308 1208 666 gene locus_tag LOCUS_26390 1208 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 2765 1212 gene locus_tag LOCUS_26400 2765 1212 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_26400 <4302 2906 gene locus_tag LOCUS_26410 <4302 2906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106392.1:DUF1800 domain-containing protein >Feature sequence309 2 259 gene locus_tag LOCUS_26420 2 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 249 590 gene locus_tag LOCUS_26430 249 590 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_26430 3113 900 gene locus_tag LOCUS_26440 3113 900 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_26440 4073 3171 gene locus_tag LOCUS_26450 4073 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence310 1319 246 gene locus_tag LOCUS_26460 1319 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 2988 1366 gene locus_tag LOCUS_26470 2988 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 3775 3077 gene locus_tag LOCUS_26480 3775 3077 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_26480 4141 4067 gene locus_tag LOCUS_t00370 4141 4067 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence311 1069 2469 gene locus_tag LOCUS_26490 gene lpdA 1069 2469 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_26490 4059 2599 gene locus_tag LOCUS_26500 4059 2599 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047961.1 protein_id gnl|my_center|LOCUS_26500 >Feature sequence312 1840 824 gene locus_tag LOCUS_26510 1840 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 2738 1995 gene locus_tag LOCUS_26520 2738 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337106.1 protein_id gnl|my_center|LOCUS_26520 2741 3925 gene locus_tag LOCUS_26530 2741 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 >Feature sequence313 552 3842 gene locus_tag LOCUS_26540 552 3842 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268604.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence314 220 750 gene locus_tag LOCUS_26550 220 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 939 1910 gene locus_tag LOCUS_26560 939 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 1932 3158 gene locus_tag LOCUS_26570 1932 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 3179 3685 gene locus_tag LOCUS_26580 3179 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence315 738 181 gene locus_tag LOCUS_26590 738 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056051.1 protein_id gnl|my_center|LOCUS_26590 3659 801 gene locus_tag LOCUS_26600 3659 801 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_26600 >Feature sequence316 906 235 gene locus_tag LOCUS_26610 906 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 <4161 1069 gene locus_tag LOCUS_26620 <4161 1069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962421.1:TaqI-like C-terminal specificity domain-containing protein >Feature sequence317 2363 966 gene locus_tag LOCUS_26630 2363 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 3752 2370 gene locus_tag LOCUS_26640 3752 2370 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 protein_id gnl|my_center|LOCUS_26640 4009 3749 gene locus_tag LOCUS_26650 4009 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence318 <1 1982 gene locus_tag LOCUS_26660 <1 1982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027033.1:glycoside hydrolase family 95 protein >Feature sequence319 25 327 gene locus_tag LOCUS_26670 25 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 324 590 gene locus_tag LOCUS_26680 324 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 1750 638 gene locus_tag LOCUS_26690 gene hpxD 1750 638 CDS product molybdenum cofactor-independent xanthine hydroxylase subunit HpxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705426.1 protein_id gnl|my_center|LOCUS_26690 2785 1766 gene locus_tag LOCUS_26700 2785 1766 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270038.1 protein_id gnl|my_center|LOCUS_26700 <4094 2868 gene locus_tag LOCUS_26710 <4094 2868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705409.1:alanine--glyoxylate aminotransferase family protein >Feature sequence320 639 1931 gene locus_tag LOCUS_26720 gene fabF 639 1931 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689969.1 protein_id gnl|my_center|LOCUS_26720 2013 3053 gene locus_tag LOCUS_26730 2013 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 <4080 3121 gene locus_tag LOCUS_26740 <4080 3121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036002.1:aldo/keto reductase >Feature sequence321 786 592 gene locus_tag LOCUS_26750 786 592 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_26750 1253 783 gene locus_tag LOCUS_26760 1253 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 <4059 3106 gene locus_tag LOCUS_26770 <4059 3106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902891.1:Xaa-Pro peptidase family protein >Feature sequence322 3045 1741 gene locus_tag LOCUS_26780 3045 1741 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106970097.1 protein_id gnl|my_center|LOCUS_26780 <4049 3279 gene locus_tag LOCUS_26790 <4049 3279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229212.1:Ldh family oxidoreductase >Feature sequence323 1843 845 gene locus_tag LOCUS_26800 gene oppB 1843 845 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262164.1 protein_id gnl|my_center|LOCUS_26800 3635 1953 gene locus_tag LOCUS_26810 3635 1953 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277613.1 protein_id gnl|my_center|LOCUS_26810 >Feature sequence324 324 1304 gene locus_tag LOCUS_26820 324 1304 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228400.1 protein_id gnl|my_center|LOCUS_26820 1337 3721 gene locus_tag LOCUS_26830 1337 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 >Feature sequence325 160 669 gene locus_tag LOCUS_26840 160 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 >Feature sequence326 <1 1899 gene locus_tag LOCUS_26850 <1 1899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933346.1:pyruvate, phosphate dikinase 2616 2110 gene locus_tag LOCUS_26860 2616 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 3428 3652 gene locus_tag LOCUS_26870 3428 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence327 216 956 gene locus_tag LOCUS_26880 216 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 953 3136 gene locus_tag LOCUS_26890 953 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 3263 3892 gene locus_tag LOCUS_26900 3263 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence328 13 2628 gene locus_tag LOCUS_26910 13 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 2763 3011 gene locus_tag LOCUS_26920 2763 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 3008 3247 gene locus_tag LOCUS_26930 3008 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 <3993 3435 gene locus_tag LOCUS_26940 <3993 3435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928589.1:M1 family metallopeptidase >Feature sequence329 1289 309 gene locus_tag LOCUS_26950 1289 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 2072 1560 gene locus_tag LOCUS_26960 2072 1560 CDS product DUF3574 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437623.1 protein_id gnl|my_center|LOCUS_26960 2676 2170 gene locus_tag LOCUS_26970 2676 2170 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933886.1 protein_id gnl|my_center|LOCUS_26970 3664 2780 gene locus_tag LOCUS_26980 3664 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 >Feature sequence330 297 43 gene locus_tag LOCUS_26990 297 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 1384 749 gene locus_tag LOCUS_27000 1384 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275369.1 protein_id gnl|my_center|LOCUS_27000 1763 1404 gene locus_tag LOCUS_27010 1763 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 2792 2103 gene locus_tag LOCUS_27020 2792 2103 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582974.1 protein_id gnl|my_center|LOCUS_27020 3927 2803 gene locus_tag LOCUS_27030 3927 2803 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227667.1 protein_id gnl|my_center|LOCUS_27030 >Feature sequence331 <1 3582 gene locus_tag LOCUS_27040 <1 3582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109376.1:glycoside hydrolase N-terminal domain-containing protein >Feature sequence332 1357 392 gene locus_tag LOCUS_27050 1357 392 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_27050 1500 1584 gene locus_tag LOCUS_t00380 1500 1584 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2103 1657 gene locus_tag LOCUS_27060 2103 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 2411 2100 gene locus_tag LOCUS_27070 2411 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 2844 2377 gene locus_tag LOCUS_27080 2844 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 <3963 2965 gene locus_tag LOCUS_27090 <3963 2965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703474.1:glycoside hydrolase family 88 protein >Feature sequence333 2072 831 gene locus_tag LOCUS_27100 2072 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 2209 3186 gene locus_tag LOCUS_27110 2209 3186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_27110 3209 3622 gene locus_tag LOCUS_27120 3209 3622 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_27120 >Feature sequence334 1676 1206 gene locus_tag LOCUS_27130 1676 1206 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920131.1 protein_id gnl|my_center|LOCUS_27130 2310 1690 gene locus_tag LOCUS_27140 2310 1690 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_27140 3294 2314 gene locus_tag LOCUS_27150 3294 2314 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence335 <1 741 gene locus_tag LOCUS_27160 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037478.1:magnesium and cobalt transport protein CorA 758 1735 gene locus_tag LOCUS_27170 gene corA 758 1735 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 protein_id gnl|my_center|LOCUS_27170 3708 1924 gene locus_tag LOCUS_27180 3708 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 >Feature sequence336 2058 364 gene locus_tag LOCUS_27190 2058 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 3148 2072 gene locus_tag LOCUS_27200 3148 2072 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615432.1 protein_id gnl|my_center|LOCUS_27200 3862 3170 gene locus_tag LOCUS_27210 3862 3170 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_27210 >Feature sequence337 3 1493 gene locus_tag LOCUS_27220 3 1493 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_27220 1490 2875 gene locus_tag LOCUS_27230 1490 2875 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_27230 >Feature sequence338 27 1202 gene locus_tag LOCUS_27240 27 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 1266 1985 gene locus_tag LOCUS_27250 1266 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence339 1184 72 gene locus_tag LOCUS_27260 1184 72 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057016.1 protein_id gnl|my_center|LOCUS_27260 3030 1207 gene locus_tag LOCUS_27270 3030 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 >Feature sequence340 353 745 gene locus_tag LOCUS_27280 353 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 1724 732 gene locus_tag LOCUS_27290 1724 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 2198 1749 gene locus_tag LOCUS_27300 gene tolR 2198 1749 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554654.1 protein_id gnl|my_center|LOCUS_27300 2933 2238 gene locus_tag LOCUS_27310 gene tolQ 2933 2238 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940358.1 protein_id gnl|my_center|LOCUS_27310 3197 3124 gene locus_tag LOCUS_t00390 3197 3124 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence341 1101 490 gene locus_tag LOCUS_27320 1101 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 1505 1128 gene locus_tag LOCUS_27330 gene rpsM 1505 1128 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_27330 2333 1563 gene locus_tag LOCUS_27340 gene map 2333 1563 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_27340 2752 2330 gene locus_tag LOCUS_27350 2752 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 <3747 2849 gene locus_tag LOCUS_27360 <3747 2849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009871874.1:preprotein translocase subunit SecY >Feature sequence342 544 2232 gene locus_tag LOCUS_27370 544 2232 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_27370 2343 3533 gene locus_tag LOCUS_27380 gene nuoH 2343 3533 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_27380 >Feature sequence343 >Feature sequence344 2408 1815 gene locus_tag LOCUS_27390 2408 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 <3715 2405 gene locus_tag LOCUS_27400 <3715 2405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001562609.1:glucans biosynthesis protein MdoG >Feature sequence345 1136 879 gene locus_tag LOCUS_27410 gene rpmA 1136 879 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258180.1 protein_id gnl|my_center|LOCUS_27410 1497 1183 gene locus_tag LOCUS_27420 gene rplU 1497 1183 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_27420 3077 1590 gene locus_tag LOCUS_27430 gene trpE 3077 1590 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_27430 <3709 3185 gene locus_tag LOCUS_27440 <3709 3185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328387.1:glutamine--fructose-6-phosphate transaminase (isomerizing) >Feature sequence346 1072 623 gene locus_tag LOCUS_27450 1072 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 2042 3268 gene locus_tag LOCUS_27460 2042 3268 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920567.1 protein_id gnl|my_center|LOCUS_27460 3567 3274 gene locus_tag LOCUS_27470 3567 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence347 1482 310 gene locus_tag LOCUS_27480 1482 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 <3646 1552 gene locus_tag LOCUS_27490 <3646 1552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257267.1:response regulator >Feature sequence348 >Feature sequence349 908 1225 gene locus_tag LOCUS_27500 908 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 1342 1426 gene locus_tag LOCUS_t00400 1342 1426 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3629 1518 gene locus_tag LOCUS_27510 3629 1518 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209897.1 protein_id gnl|my_center|LOCUS_27510 >Feature sequence350 1186 1261 gene locus_tag LOCUS_t00410 1186 1261 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1314 2504 gene locus_tag LOCUS_27520 gene tuf 1314 2504 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121621.1 protein_id gnl|my_center|LOCUS_27520 2586 2661 gene locus_tag LOCUS_t00420 2586 2661 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2672 2875 gene locus_tag LOCUS_27530 2672 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 2890 3468 gene locus_tag LOCUS_27540 gene nusG 2890 3468 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390510.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence351 1033 260 gene locus_tag LOCUS_27550 1033 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 1140 1064 gene locus_tag LOCUS_t00430 1140 1064 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1265 2065 gene locus_tag LOCUS_27560 gene elyC 1265 2065 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816039.1 protein_id gnl|my_center|LOCUS_27560 3527 2235 gene locus_tag LOCUS_27570 3527 2235 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028898.1 protein_id gnl|my_center|LOCUS_27570 >Feature sequence352 3308 2763 gene locus_tag LOCUS_27580 3308 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 >Feature sequence353 <1 3456 gene locus_tag LOCUS_27590 <1 3456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813236.1:ATP-dependent RNA helicase HrpA >Feature sequence354 875 537 gene locus_tag LOCUS_27600 875 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 1299 3167 gene locus_tag LOCUS_27610 gene htpG 1299 3167 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460040.1 protein_id gnl|my_center|LOCUS_27610 >Feature sequence355 <1 3516 gene locus_tag LOCUS_27620 <1 3516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000784837.1:cytochrome c peroxidase >Feature sequence356 <1 1441 gene locus_tag LOCUS_27630 <1 1441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205127109.1:right-handed parallel beta-helix repeat-containing protein 2139 1585 gene locus_tag LOCUS_27640 2139 1585 CDS product DUF2165 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974551.1 protein_id gnl|my_center|LOCUS_27640 2613 2691 gene locus_tag LOCUS_t00440 2613 2691 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence357 978 2384 gene locus_tag LOCUS_27650 978 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 2495 3220 gene locus_tag LOCUS_27660 2495 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 >Feature sequence358 2896 1736 gene locus_tag LOCUS_27670 gene rlmN 2896 1736 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392423.1 protein_id gnl|my_center|LOCUS_27670 >Feature sequence359 <1 1005 gene locus_tag LOCUS_27680 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057122.1:PAS domain S-box protein 2437 1058 gene locus_tag LOCUS_27690 2437 1058 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035678.1 protein_id gnl|my_center|LOCUS_27690 3012 2449 gene locus_tag LOCUS_27700 3012 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 >Feature sequence360 860 3421 gene locus_tag LOCUS_27710 860 3421 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_27710 >Feature sequence361 <1 1782 gene locus_tag LOCUS_27720 <1 1782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529839.1:YadA-like family protein >Feature sequence362 2327 1908 gene locus_tag LOCUS_27730 2327 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 <3415 2324 gene locus_tag LOCUS_27740 <3415 2324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930451.1:nitrogen regulation protein NR(I) >Feature sequence363 1071 430 gene locus_tag LOCUS_27750 1071 430 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392057.1 protein_id gnl|my_center|LOCUS_27750 2192 1068 gene locus_tag LOCUS_27760 gene ribD 2192 1068 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_27760 2846 2205 gene locus_tag LOCUS_27770 2846 2205 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218182.1 protein_id gnl|my_center|LOCUS_27770 >Feature sequence364 391 891 gene locus_tag LOCUS_27780 391 891 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088894.1 protein_id gnl|my_center|LOCUS_27780 2225 921 gene locus_tag LOCUS_27790 2225 921 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_27790 3072 2263 gene locus_tag LOCUS_27800 3072 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090587.1 protein_id gnl|my_center|LOCUS_27800 >Feature sequence365 3125 360 gene locus_tag LOCUS_27810 3125 360 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444634.1 protein_id gnl|my_center|LOCUS_27810 >Feature sequence366 1136 546 gene locus_tag LOCUS_27820 1136 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 1638 1141 gene locus_tag LOCUS_27830 1638 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 1848 2903 gene locus_tag LOCUS_27840 1848 2903 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920485.1 protein_id gnl|my_center|LOCUS_27840 >Feature sequence367 <1 685 gene locus_tag LOCUS_27850 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017302344.1:MarC family protein 2144 732 gene locus_tag LOCUS_27860 2144 732 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545685.1 protein_id gnl|my_center|LOCUS_27860 3225 2278 gene locus_tag LOCUS_27870 3225 2278 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_27870 >Feature sequence368 215 125 gene locus_tag LOCUS_t00450 215 125 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 778 1047 gene locus_tag LOCUS_27880 778 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 3061 1058 gene locus_tag LOCUS_27890 3061 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 3244 3171 gene locus_tag LOCUS_t00460 3244 3171 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence369 596 1705 gene locus_tag LOCUS_27900 gene dusB 596 1705 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942604.1 protein_id gnl|my_center|LOCUS_27900 2452 1748 gene locus_tag LOCUS_27910 2452 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 2370 2783 gene locus_tag LOCUS_27920 2370 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 >Feature sequence370 622 95 gene locus_tag LOCUS_27930 622 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 1428 859 gene locus_tag LOCUS_27940 1428 859 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090086.1 protein_id gnl|my_center|LOCUS_27940 2638 1439 gene locus_tag LOCUS_27950 gene apbC 2638 1439 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_27950 >Feature sequence371 3 680 gene locus_tag LOCUS_27960 3 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 1107 748 gene locus_tag LOCUS_27970 1107 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 1459 1253 gene locus_tag LOCUS_27980 1459 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 2720 2487 gene locus_tag LOCUS_27990 2720 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence372 <1 981 gene locus_tag LOCUS_28000 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_086852489.1:LacI family DNA-binding transcriptional regulator 1678 998 gene locus_tag LOCUS_28010 1678 998 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 protein_id gnl|my_center|LOCUS_28010 1807 1977 gene locus_tag LOCUS_28020 1807 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 2192 2118 gene locus_tag LOCUS_t00470 2192 2118 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2393 2890 gene locus_tag LOCUS_28030 2393 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 >Feature sequence373 1951 1043 gene locus_tag LOCUS_28040 1951 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 2072 2380 gene locus_tag LOCUS_28050 2072 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 >Feature sequence374 1710 562 gene locus_tag LOCUS_28060 1710 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 2897 1707 gene locus_tag LOCUS_28070 2897 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 >Feature sequence375 1616 438 gene locus_tag LOCUS_28080 1616 438 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_28080 2464 1628 gene locus_tag LOCUS_28090 2464 1628 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480221.1 protein_id gnl|my_center|LOCUS_28090 <3253 2525 gene locus_tag LOCUS_28100 <3253 2525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971573.1:isoprenyl transferase >Feature sequence376 676 410 gene locus_tag LOCUS_28110 676 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 846 1700 gene locus_tag LOCUS_28120 846 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 1741 2763 gene locus_tag LOCUS_28130 gene hemF 1741 2763 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401477.1 protein_id gnl|my_center|LOCUS_28130 >Feature sequence377 37 921 gene locus_tag LOCUS_28140 37 921 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262779.1 protein_id gnl|my_center|LOCUS_28140 2240 918 gene locus_tag LOCUS_28150 2240 918 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064374.1 protein_id gnl|my_center|LOCUS_28150 2761 2237 gene locus_tag LOCUS_28160 2761 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 3051 2896 gene locus_tag LOCUS_28170 3051 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 >Feature sequence378 752 144 gene locus_tag LOCUS_28180 752 144 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390290.1 protein_id gnl|my_center|LOCUS_28180 1057 2724 gene locus_tag LOCUS_28190 gene leuA 1057 2724 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933761.1 protein_id gnl|my_center|LOCUS_28190 3129 2761 gene locus_tag LOCUS_28200 3129 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 >Feature sequence379 1590 1195 gene locus_tag LOCUS_28210 1590 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 2084 3052 gene locus_tag LOCUS_28220 2084 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 >Feature sequence380 1530 1997 gene locus_tag LOCUS_28230 gene rpiB 1530 1997 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_28230 2105 2181 gene locus_tag LOCUS_t00480 2105 2181 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2294 2899 gene locus_tag LOCUS_28240 gene metW 2294 2899 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545692.1 protein_id gnl|my_center|LOCUS_28240 >Feature sequence381 >Feature sequence382 491 1108 gene locus_tag LOCUS_28250 491 1108 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097831.1 protein_id gnl|my_center|LOCUS_28250 1592 1146 gene locus_tag LOCUS_28260 1592 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 1808 3121 gene locus_tag LOCUS_28270 1808 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 >Feature sequence383 >Feature sequence384 272 652 gene locus_tag LOCUS_28280 gene rplL 272 652 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_28280 >Feature sequence385 1039 884 gene locus_tag LOCUS_28290 1039 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 1393 1073 gene locus_tag LOCUS_28300 1393 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 >Feature sequence386 475 1227 gene locus_tag LOCUS_28310 475 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 1370 1984 gene locus_tag LOCUS_28320 gene upp 1370 1984 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032884835.1 protein_id gnl|my_center|LOCUS_28320 >Feature sequence387 <1 2227 gene locus_tag LOCUS_28330 <1 2227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920130.1:xanthine dehydrogenase family protein molybdopterin-binding subunit >Feature sequence388 1375 758 gene locus_tag LOCUS_28340 1375 758 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815769.1 protein_id gnl|my_center|LOCUS_28340 2626 1517 gene locus_tag LOCUS_28350 2626 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 >Feature sequence389 997 1608 gene locus_tag LOCUS_28360 997 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 3076 1775 gene locus_tag LOCUS_28370 3076 1775 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040212.1 protein_id gnl|my_center|LOCUS_28370 >Feature sequence390 >Feature sequence391 370 660 gene locus_tag LOCUS_28380 370 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 1323 676 gene locus_tag LOCUS_28390 1323 676 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185693707.1 protein_id gnl|my_center|LOCUS_28390 2388 1435 gene locus_tag LOCUS_28400 2388 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 2779 2540 gene locus_tag LOCUS_28410 2779 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 >Feature sequence392 1666 974 gene locus_tag LOCUS_28420 1666 974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_28420 2959 1772 gene locus_tag LOCUS_28430 2959 1772 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531072.1 protein_id gnl|my_center|LOCUS_28430 >Feature sequence393 203 1732 gene locus_tag LOCUS_28440 203 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 2796 1729 gene locus_tag LOCUS_28450 gene tsaD 2796 1729 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205675.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence394 2356 2099 gene locus_tag LOCUS_28460 gene rpmA 2356 2099 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258180.1 protein_id gnl|my_center|LOCUS_28460 2718 2404 gene locus_tag LOCUS_28470 gene rplU 2718 2404 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_28470 >Feature sequence395 346 1824 gene locus_tag LOCUS_28480 346 1824 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941686.1 protein_id gnl|my_center|LOCUS_28480 >Feature sequence396 >Feature sequence397 1136 423 gene locus_tag LOCUS_28490 1136 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 >Feature sequence398