>Feature sequence01 498 232 gene locus_tag LOCUS_00010 498 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 583 840 gene locus_tag LOCUS_00020 583 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 837 1331 gene locus_tag LOCUS_00030 837 1331 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236777.1 protein_id gnl|my_center|LOCUS_00030 1392 1820 gene locus_tag LOCUS_00040 1392 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 1822 2079 gene locus_tag LOCUS_00050 1822 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 2431 2673 gene locus_tag LOCUS_00060 gene mazE 2431 2673 CDS product type II toxin-antitoxin system antitoxin MazE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581940.1 protein_id gnl|my_center|LOCUS_00060 2673 3014 gene locus_tag LOCUS_00070 gene mazF 2673 3014 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_00070 4802 3900 gene locus_tag LOCUS_00080 4802 3900 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_00080 4936 6420 gene locus_tag LOCUS_00090 4936 6420 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039229.1 protein_id gnl|my_center|LOCUS_00090 6407 7126 gene locus_tag LOCUS_00100 6407 7126 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039228.1 protein_id gnl|my_center|LOCUS_00100 7123 10497 gene locus_tag LOCUS_00110 7123 10497 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00110 10463 11647 gene locus_tag LOCUS_00120 10463 11647 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_00120 11837 11691 gene locus_tag LOCUS_00130 11837 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 12104 11847 gene locus_tag LOCUS_00140 12104 11847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12180 14738 gene locus_tag LOCUS_00150 12180 14738 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064809.1 protein_id gnl|my_center|LOCUS_00150 15089 15289 gene locus_tag LOCUS_00160 15089 15289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15286 16269 gene locus_tag LOCUS_00170 15286 16269 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534908.1 protein_id gnl|my_center|LOCUS_00170 16350 17762 gene locus_tag LOCUS_00180 16350 17762 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765715.1 protein_id gnl|my_center|LOCUS_00180 17799 19766 gene locus_tag LOCUS_00190 17799 19766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19874 20587 gene locus_tag LOCUS_00200 19874 20587 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529987.1 protein_id gnl|my_center|LOCUS_00200 20703 21545 gene locus_tag LOCUS_00210 20703 21545 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267624.1 protein_id gnl|my_center|LOCUS_00210 21637 22563 gene locus_tag LOCUS_00220 21637 22563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22691 22951 gene locus_tag LOCUS_00230 22691 22951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24183 22990 gene locus_tag LOCUS_00240 24183 22990 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_00240 26522 24501 gene locus_tag LOCUS_00250 26522 24501 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316996.1 protein_id gnl|my_center|LOCUS_00250 27576 26623 gene locus_tag LOCUS_00260 27576 26623 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_00260 28604 27693 gene locus_tag LOCUS_00270 28604 27693 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_00270 28709 30193 gene locus_tag LOCUS_00280 28709 30193 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_00280 31714 30221 gene locus_tag LOCUS_00290 gene glpK 31714 30221 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_00290 31860 33434 gene locus_tag LOCUS_00300 31860 33434 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931050.1 protein_id gnl|my_center|LOCUS_00300 33890 33447 gene locus_tag LOCUS_00310 33890 33447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 33965 34612 gene locus_tag LOCUS_00320 33965 34612 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768608.1 protein_id gnl|my_center|LOCUS_00320 35467 34643 gene locus_tag LOCUS_00330 35467 34643 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102956.1 protein_id gnl|my_center|LOCUS_00330 36534 35635 gene locus_tag LOCUS_00340 36534 35635 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268113.1 protein_id gnl|my_center|LOCUS_00340 36659 37072 gene locus_tag LOCUS_00350 36659 37072 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183828876.1 protein_id gnl|my_center|LOCUS_00350 37142 37921 gene locus_tag LOCUS_00360 37142 37921 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268115.1 protein_id gnl|my_center|LOCUS_00360 38290 37937 gene locus_tag LOCUS_00370 38290 37937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 38450 39022 gene locus_tag LOCUS_00380 38450 39022 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566468.1 protein_id gnl|my_center|LOCUS_00380 39082 39789 gene locus_tag LOCUS_00390 39082 39789 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626211.1 protein_id gnl|my_center|LOCUS_00390 39930 40259 gene locus_tag LOCUS_00400 39930 40259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 40282 41151 gene locus_tag LOCUS_00410 40282 41151 CDS product DUF3750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391328.1 protein_id gnl|my_center|LOCUS_00410 41094 41657 gene locus_tag LOCUS_00420 41094 41657 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038981.1 protein_id gnl|my_center|LOCUS_00420 42368 41661 gene locus_tag LOCUS_00430 42368 41661 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204015.1 protein_id gnl|my_center|LOCUS_00430 43162 42461 gene locus_tag LOCUS_00440 43162 42461 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527730.1 protein_id gnl|my_center|LOCUS_00440 43270 44346 gene locus_tag LOCUS_00450 43270 44346 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965785.1 protein_id gnl|my_center|LOCUS_00450 45312 44278 gene locus_tag LOCUS_00460 45312 44278 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877593.1 protein_id gnl|my_center|LOCUS_00460 45380 46294 gene locus_tag LOCUS_00470 45380 46294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 46312 47355 gene locus_tag LOCUS_00480 46312 47355 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407527.1 protein_id gnl|my_center|LOCUS_00480 47330 48310 gene locus_tag LOCUS_00490 47330 48310 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226780.1 protein_id gnl|my_center|LOCUS_00490 48303 49322 gene locus_tag LOCUS_00500 48303 49322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 49529 50275 gene locus_tag LOCUS_00510 49529 50275 CDS product DUF6279 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706414.1 protein_id gnl|my_center|LOCUS_00510 50439 51008 gene locus_tag LOCUS_00520 50439 51008 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_00520 51012 52403 gene locus_tag LOCUS_00530 51012 52403 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925918.1 protein_id gnl|my_center|LOCUS_00530 53597 52497 gene locus_tag LOCUS_00540 gene dctP 53597 52497 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_00540 53875 54846 gene locus_tag LOCUS_00550 53875 54846 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021942.1 protein_id gnl|my_center|LOCUS_00550 55217 56167 gene locus_tag LOCUS_00560 55217 56167 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_00560 56231 58135 gene locus_tag LOCUS_00570 56231 58135 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_00570 58155 59312 gene locus_tag LOCUS_00580 58155 59312 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040791.1 protein_id gnl|my_center|LOCUS_00580 59334 60488 gene locus_tag LOCUS_00590 59334 60488 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494103.1 protein_id gnl|my_center|LOCUS_00590 60478 61680 gene locus_tag LOCUS_00600 60478 61680 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963567.1 protein_id gnl|my_center|LOCUS_00600 61673 62416 gene locus_tag LOCUS_00610 gene lolD 61673 62416 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263326.1 protein_id gnl|my_center|LOCUS_00610 63610 62471 gene locus_tag LOCUS_00620 63610 62471 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807735.1 protein_id gnl|my_center|LOCUS_00620 64485 63694 gene locus_tag LOCUS_00630 64485 63694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 65685 64510 gene locus_tag LOCUS_00640 65685 64510 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815378.1 protein_id gnl|my_center|LOCUS_00640 66989 65682 gene locus_tag LOCUS_00650 66989 65682 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_00650 67384 67010 gene locus_tag LOCUS_00660 gene apaG 67384 67010 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815381.1 protein_id gnl|my_center|LOCUS_00660 67481 68203 gene locus_tag LOCUS_00670 gene rpe 67481 68203 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815384.1 protein_id gnl|my_center|LOCUS_00670 68200 68916 gene locus_tag LOCUS_00680 68200 68916 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931377.1 protein_id gnl|my_center|LOCUS_00680 69192 70718 gene locus_tag LOCUS_00690 gene trpE 69192 70718 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064890.1 protein_id gnl|my_center|LOCUS_00690 70920 72182 gene locus_tag LOCUS_00700 70920 72182 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098087.1 protein_id gnl|my_center|LOCUS_00700 72474 73310 gene locus_tag LOCUS_00710 gene trfA 72474 73310 CDS product plasmid replication initiator TrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942817.1 protein_id gnl|my_center|LOCUS_00710 74049 73741 gene locus_tag LOCUS_00720 74049 73741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 74332 74033 gene locus_tag LOCUS_00730 74332 74033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 74497 74934 gene locus_tag LOCUS_00740 74497 74934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 75129 75533 gene locus_tag LOCUS_00750 75129 75533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 75578 76795 gene locus_tag LOCUS_00760 75578 76795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 76792 77736 gene locus_tag LOCUS_00770 76792 77736 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764770.1 protein_id gnl|my_center|LOCUS_00770 77729 78727 gene locus_tag LOCUS_00780 77729 78727 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108412.1 protein_id gnl|my_center|LOCUS_00780 78930 80096 gene locus_tag LOCUS_00790 78930 80096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 80093 80995 gene locus_tag LOCUS_00800 80093 80995 CDS product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974304.1 protein_id gnl|my_center|LOCUS_00800 80992 81885 gene locus_tag LOCUS_00810 80992 81885 CDS product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974303.1 protein_id gnl|my_center|LOCUS_00810 81968 82162 gene locus_tag LOCUS_00820 81968 82162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 82231 87507 gene locus_tag LOCUS_00830 82231 87507 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_00830 87504 90422 gene locus_tag LOCUS_00840 87504 90422 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_00840 90434 94828 gene locus_tag LOCUS_00850 90434 94828 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_00850 94842 96851 gene locus_tag LOCUS_00860 94842 96851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 96848 100813 gene locus_tag LOCUS_00870 96848 100813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204821.1 protein_id gnl|my_center|LOCUS_00870 100866 101582 gene locus_tag LOCUS_00880 100866 101582 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073934.1 protein_id gnl|my_center|LOCUS_00880 101647 102060 gene locus_tag LOCUS_00890 101647 102060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 102168 102947 gene locus_tag LOCUS_00900 102168 102947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 103161 103748 gene locus_tag LOCUS_00910 103161 103748 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815390.1 protein_id gnl|my_center|LOCUS_00910 103761 104792 gene locus_tag LOCUS_00920 gene trpD 103761 104792 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817833.1 protein_id gnl|my_center|LOCUS_00920 104789 105577 gene locus_tag LOCUS_00930 gene trpC 104789 105577 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815394.1 protein_id gnl|my_center|LOCUS_00930 105868 105677 gene locus_tag LOCUS_00940 105868 105677 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_00940 106238 105909 gene locus_tag LOCUS_00950 106238 105909 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807250.1 protein_id gnl|my_center|LOCUS_00950 106336 107193 gene locus_tag LOCUS_00960 106336 107193 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807247.1 protein_id gnl|my_center|LOCUS_00960 107203 108687 gene locus_tag LOCUS_00970 gene pap 107203 108687 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448382.1 protein_id gnl|my_center|LOCUS_00970 108677 109114 gene locus_tag LOCUS_00980 108677 109114 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925740.1 protein_id gnl|my_center|LOCUS_00980 109150 110034 gene locus_tag LOCUS_00990 109150 110034 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533411.1 protein_id gnl|my_center|LOCUS_00990 110058 110783 gene locus_tag LOCUS_01000 110058 110783 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818450.1 protein_id gnl|my_center|LOCUS_01000 111240 110845 gene locus_tag LOCUS_01010 111240 110845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 111562 111227 gene locus_tag LOCUS_01020 111562 111227 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_01020 111935 113299 gene locus_tag LOCUS_01030 111935 113299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 113229 114443 gene locus_tag LOCUS_01040 113229 114443 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038719.1 protein_id gnl|my_center|LOCUS_01040 114497 114940 gene locus_tag LOCUS_01050 114497 114940 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114062.1 protein_id gnl|my_center|LOCUS_01050 115709 114930 gene locus_tag LOCUS_01060 gene xth 115709 114930 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812032.1 protein_id gnl|my_center|LOCUS_01060 116914 115790 gene locus_tag LOCUS_01070 116914 115790 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038718.1 protein_id gnl|my_center|LOCUS_01070 118856 116925 gene locus_tag LOCUS_01080 118856 116925 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038717.1 protein_id gnl|my_center|LOCUS_01080 118955 119596 gene locus_tag LOCUS_01090 118955 119596 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931276.1 protein_id gnl|my_center|LOCUS_01090 120436 119588 gene locus_tag LOCUS_01100 gene metF 120436 119588 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807199.1 protein_id gnl|my_center|LOCUS_01100 120771 120433 gene locus_tag LOCUS_01110 120771 120433 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_01110 122239 120824 gene locus_tag LOCUS_01120 gene ahcY 122239 120824 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807196.1 protein_id gnl|my_center|LOCUS_01120 122616 123023 gene locus_tag LOCUS_01130 122616 123023 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808835.1 protein_id gnl|my_center|LOCUS_01130 123023 123937 gene locus_tag LOCUS_01140 123023 123937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01140 124199 123969 gene locus_tag LOCUS_01150 124199 123969 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818441.1 protein_id gnl|my_center|LOCUS_01150 125565 124351 gene locus_tag LOCUS_01160 gene metK 125565 124351 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925730.1 protein_id gnl|my_center|LOCUS_01160 125758 126615 gene locus_tag LOCUS_01170 125758 126615 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807187.1 protein_id gnl|my_center|LOCUS_01170 126599 127573 gene locus_tag LOCUS_01180 126599 127573 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807185.1 protein_id gnl|my_center|LOCUS_01180 127600 128484 gene locus_tag LOCUS_01190 gene dapF 127600 128484 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064712.1 protein_id gnl|my_center|LOCUS_01190 128489 129172 gene locus_tag LOCUS_01200 128489 129172 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064713.1 protein_id gnl|my_center|LOCUS_01200 129169 130140 gene locus_tag LOCUS_01210 gene xerC 129169 130140 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038710.1 protein_id gnl|my_center|LOCUS_01210 130285 130917 gene locus_tag LOCUS_01220 130285 130917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 130914 131972 gene locus_tag LOCUS_01230 130914 131972 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064715.1 protein_id gnl|my_center|LOCUS_01230 133079 132060 gene locus_tag LOCUS_01240 133079 132060 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931286.1 protein_id gnl|my_center|LOCUS_01240 133955 133089 gene locus_tag LOCUS_01250 133955 133089 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376994.1 protein_id gnl|my_center|LOCUS_01250 134731 133955 gene locus_tag LOCUS_01260 gene aztA 134731 133955 CDS product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104120.1 protein_id gnl|my_center|LOCUS_01260 134983 135357 gene locus_tag LOCUS_01270 134983 135357 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_01270 135489 136601 gene locus_tag LOCUS_01280 135489 136601 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931290.1 protein_id gnl|my_center|LOCUS_01280 136650 137111 gene locus_tag LOCUS_01290 gene dksA 136650 137111 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807164.1 protein_id gnl|my_center|LOCUS_01290 137180 137713 gene locus_tag LOCUS_01300 gene hslV 137180 137713 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818422.1 protein_id gnl|my_center|LOCUS_01300 137722 139053 gene locus_tag LOCUS_01310 gene hslU 137722 139053 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807162.1 protein_id gnl|my_center|LOCUS_01310 139071 139652 gene locus_tag LOCUS_01320 139071 139652 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038702.1 protein_id gnl|my_center|LOCUS_01320 140645 139686 gene locus_tag LOCUS_01330 gene lipA 140645 139686 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807146.1 protein_id gnl|my_center|LOCUS_01330 141370 140708 gene locus_tag LOCUS_01340 gene lipB 141370 140708 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925723.1 protein_id gnl|my_center|LOCUS_01340 141654 141370 gene locus_tag LOCUS_01350 141654 141370 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807142.1 protein_id gnl|my_center|LOCUS_01350 142550 141657 gene locus_tag LOCUS_01360 142550 141657 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 protein_id gnl|my_center|LOCUS_01360 143799 142591 gene locus_tag LOCUS_01370 143799 142591 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064727.1 protein_id gnl|my_center|LOCUS_01370 144488 143841 gene locus_tag LOCUS_01380 144488 143841 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929621.1 protein_id gnl|my_center|LOCUS_01380 145097 144504 gene locus_tag LOCUS_01390 145097 144504 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925722.1 protein_id gnl|my_center|LOCUS_01390 146053 145103 gene locus_tag LOCUS_01400 146053 145103 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807132.1 protein_id gnl|my_center|LOCUS_01400 146839 146063 gene locus_tag LOCUS_01410 146839 146063 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807131.1 protein_id gnl|my_center|LOCUS_01410 148005 146839 gene locus_tag LOCUS_01420 148005 146839 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449702.1 protein_id gnl|my_center|LOCUS_01420 148073 148870 gene locus_tag LOCUS_01430 148073 148870 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447888.1 protein_id gnl|my_center|LOCUS_01430 148867 149631 gene locus_tag LOCUS_01440 148867 149631 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807125.1 protein_id gnl|my_center|LOCUS_01440 149838 149662 gene locus_tag LOCUS_01450 149838 149662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 151153 149798 gene locus_tag LOCUS_01460 151153 149798 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929616.1 protein_id gnl|my_center|LOCUS_01460 152177 151230 gene locus_tag LOCUS_01470 gene waaC 152177 151230 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905414.1 protein_id gnl|my_center|LOCUS_01470 153097 152174 gene locus_tag LOCUS_01480 gene rfbD 153097 152174 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112614.1 protein_id gnl|my_center|LOCUS_01480 153885 153124 gene locus_tag LOCUS_01490 153885 153124 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083530.1 protein_id gnl|my_center|LOCUS_01490 154693 153911 gene locus_tag LOCUS_01500 154693 153911 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_01500 155475 154702 gene locus_tag LOCUS_01510 155475 154702 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243745.1 protein_id gnl|my_center|LOCUS_01510 155690 156745 gene locus_tag LOCUS_01520 gene rfbB 155690 156745 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_01520 156738 157643 gene locus_tag LOCUS_01530 gene rfbA 156738 157643 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202440.1 protein_id gnl|my_center|LOCUS_01530 157649 158203 gene locus_tag LOCUS_01540 gene rfbC 157649 158203 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_01540 158738 158208 gene locus_tag LOCUS_01550 158738 158208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 159097 159744 gene locus_tag LOCUS_01560 159097 159744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 >Feature sequence02 89 165 gene locus_tag LOCUS_t00010 89 165 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 632 2272 gene locus_tag LOCUS_01570 632 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 2717 2196 gene locus_tag LOCUS_01580 2717 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 2865 2734 gene locus_tag LOCUS_01590 2865 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 4013 3516 gene locus_tag LOCUS_01600 4013 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01600 4948 4124 gene locus_tag LOCUS_01610 4948 4124 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01610 5991 5260 gene locus_tag LOCUS_01620 5991 5260 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039285.1 protein_id gnl|my_center|LOCUS_01620 7313 6051 gene locus_tag LOCUS_01630 7313 6051 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494235.1 protein_id gnl|my_center|LOCUS_01630 8161 7418 gene locus_tag LOCUS_01640 8161 7418 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039083.1 protein_id gnl|my_center|LOCUS_01640 8414 8929 gene locus_tag LOCUS_01650 8414 8929 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 protein_id gnl|my_center|LOCUS_01650 9321 8926 gene locus_tag LOCUS_01660 9321 8926 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346527.1 protein_id gnl|my_center|LOCUS_01660 9580 9945 gene locus_tag LOCUS_01670 9580 9945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 10791 10123 gene locus_tag LOCUS_01680 10791 10123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 11709 11155 gene locus_tag LOCUS_01690 11709 11155 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191124.1 protein_id gnl|my_center|LOCUS_01690 12120 12044 gene locus_tag LOCUS_t00020 12120 12044 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13187 12216 gene locus_tag LOCUS_01700 gene ispB 13187 12216 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807467.1 protein_id gnl|my_center|LOCUS_01700 13286 13597 gene locus_tag LOCUS_01710 gene rplU 13286 13597 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_01710 13626 13883 gene locus_tag LOCUS_01720 gene rpmA 13626 13883 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807460.1 protein_id gnl|my_center|LOCUS_01720 13951 15051 gene locus_tag LOCUS_01730 gene obgE 13951 15051 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807459.1 protein_id gnl|my_center|LOCUS_01730 15096 16229 gene locus_tag LOCUS_01740 gene proB 15096 16229 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807457.1 protein_id gnl|my_center|LOCUS_01740 16728 16234 gene locus_tag LOCUS_01750 16728 16234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 16952 18865 gene locus_tag LOCUS_01760 gene thiC 16952 18865 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807441.1 protein_id gnl|my_center|LOCUS_01760 19026 20063 gene locus_tag LOCUS_01770 19026 20063 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 protein_id gnl|my_center|LOCUS_01770 20265 20426 gene locus_tag LOCUS_01780 20265 20426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 20618 22990 gene locus_tag LOCUS_01790 gene tex 20618 22990 CDS product RNA-binding transcriptional accessory protein Tex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813599.1 protein_id gnl|my_center|LOCUS_01790 24297 23077 gene locus_tag LOCUS_01800 24297 23077 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_01800 25419 24475 gene locus_tag LOCUS_01810 gene argF 25419 24475 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812938.1 protein_id gnl|my_center|LOCUS_01810 26623 25445 gene locus_tag LOCUS_01820 26623 25445 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064106.1 protein_id gnl|my_center|LOCUS_01820 26749 27078 gene locus_tag LOCUS_01830 26749 27078 CDS product DUF3579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812933.1 protein_id gnl|my_center|LOCUS_01830 27989 27033 gene locus_tag LOCUS_01840 27989 27033 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931529.1 protein_id gnl|my_center|LOCUS_01840 28283 28113 gene locus_tag LOCUS_01850 28283 28113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 28624 28361 gene locus_tag LOCUS_01860 gene rpsT 28624 28361 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812908.1 protein_id gnl|my_center|LOCUS_01860 30288 28726 gene locus_tag LOCUS_01870 gene murJ 30288 28726 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931127.1 protein_id gnl|my_center|LOCUS_01870 31043 30285 gene locus_tag LOCUS_01880 31043 30285 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812901.1 protein_id gnl|my_center|LOCUS_01880 31770 31117 gene locus_tag LOCUS_01890 gene adk 31770 31117 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064094.1 protein_id gnl|my_center|LOCUS_01890 32602 31862 gene locus_tag LOCUS_01900 gene kdsB 32602 31862 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567493.1 protein_id gnl|my_center|LOCUS_01900 32797 32609 gene locus_tag LOCUS_01910 32797 32609 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064092.1 protein_id gnl|my_center|LOCUS_01910 33773 32787 gene locus_tag LOCUS_01920 gene lpxK 33773 32787 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064091.1 protein_id gnl|my_center|LOCUS_01920 34259 33852 gene locus_tag LOCUS_01930 34259 33852 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064090.1 protein_id gnl|my_center|LOCUS_01930 34870 34274 gene locus_tag LOCUS_01940 34870 34274 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064089.1 protein_id gnl|my_center|LOCUS_01940 35235 36551 gene locus_tag LOCUS_01950 gene xseA 35235 36551 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812887.1 protein_id gnl|my_center|LOCUS_01950 36653 37231 gene locus_tag LOCUS_01960 gene sodB 36653 37231 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931119.1 protein_id gnl|my_center|LOCUS_01960 37971 37492 gene locus_tag LOCUS_01970 37971 37492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 38346 38101 gene locus_tag LOCUS_01980 38346 38101 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812875.1 protein_id gnl|my_center|LOCUS_01980 38626 38874 gene locus_tag LOCUS_01990 gene clpS 38626 38874 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064083.1 protein_id gnl|my_center|LOCUS_01990 38976 41285 gene locus_tag LOCUS_02000 gene clpA 38976 41285 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447476.1 protein_id gnl|my_center|LOCUS_02000 42002 41550 gene locus_tag LOCUS_02010 gene dut 42002 41550 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186718.1 protein_id gnl|my_center|LOCUS_02010 42694 41999 gene locus_tag LOCUS_02020 42694 41999 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816758.1 protein_id gnl|my_center|LOCUS_02020 43966 42767 gene locus_tag LOCUS_02030 gene coaBC 43966 42767 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928305.1 protein_id gnl|my_center|LOCUS_02030 44490 43978 gene locus_tag LOCUS_02040 gene lspA 44490 43978 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039646.1 protein_id gnl|my_center|LOCUS_02040 47335 44483 gene locus_tag LOCUS_02050 gene ileS 47335 44483 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064040.1 protein_id gnl|my_center|LOCUS_02050 48314 47325 gene locus_tag LOCUS_02060 48314 47325 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930543.1 protein_id gnl|my_center|LOCUS_02060 48416 49012 gene locus_tag LOCUS_02070 gene purN 48416 49012 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064038.1 protein_id gnl|my_center|LOCUS_02070 49132 50397 gene locus_tag LOCUS_02080 49132 50397 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450216.1 protein_id gnl|my_center|LOCUS_02080 50621 51820 gene locus_tag LOCUS_02090 50621 51820 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812548.1 protein_id gnl|my_center|LOCUS_02090 51817 54090 gene locus_tag LOCUS_02100 51817 54090 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812546.1 protein_id gnl|my_center|LOCUS_02100 56062 54119 gene locus_tag LOCUS_02110 56062 54119 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812542.1 protein_id gnl|my_center|LOCUS_02110 56955 56059 gene locus_tag LOCUS_02120 gene prmB 56955 56059 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812540.1 protein_id gnl|my_center|LOCUS_02120 58155 57019 gene locus_tag LOCUS_02130 gene dapE 58155 57019 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812538.1 protein_id gnl|my_center|LOCUS_02130 58992 58171 gene locus_tag LOCUS_02140 gene dapD 58992 58171 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812536.1 protein_id gnl|my_center|LOCUS_02140 60411 59215 gene locus_tag LOCUS_02150 gene dapC 60411 59215 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448163.1 protein_id gnl|my_center|LOCUS_02150 60479 60566 gene locus_tag LOCUS_t00030 60479 60566 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 60626 61948 gene locus_tag LOCUS_02160 gene tig 60626 61948 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905723.1 protein_id gnl|my_center|LOCUS_02160 62000 62662 gene locus_tag LOCUS_02170 gene clpP 62000 62662 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812508.1 protein_id gnl|my_center|LOCUS_02170 62702 64003 gene locus_tag LOCUS_02180 gene clpX 62702 64003 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926436.1 protein_id gnl|my_center|LOCUS_02180 64101 66566 gene locus_tag LOCUS_02190 gene lon 64101 66566 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812504.1 protein_id gnl|my_center|LOCUS_02190 66593 66988 gene locus_tag LOCUS_02200 66593 66988 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811999.1 protein_id gnl|my_center|LOCUS_02200 67681 66998 gene locus_tag LOCUS_02210 gene lexA 67681 66998 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930566.1 protein_id gnl|my_center|LOCUS_02210 69011 67785 gene locus_tag LOCUS_02220 69011 67785 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816819.1 protein_id gnl|my_center|LOCUS_02220 69113 71143 gene locus_tag LOCUS_02230 gene uvrB 69113 71143 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812466.1 protein_id gnl|my_center|LOCUS_02230 71390 71854 gene locus_tag LOCUS_02240 71390 71854 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_02240 72168 71989 gene locus_tag LOCUS_02250 72168 71989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 72181 72717 gene locus_tag LOCUS_02260 gene iscR 72181 72717 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039699.1 protein_id gnl|my_center|LOCUS_02260 72782 73993 gene locus_tag LOCUS_02270 72782 73993 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812462.1 protein_id gnl|my_center|LOCUS_02270 74027 74410 gene locus_tag LOCUS_02280 gene iscU 74027 74410 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812460.1 protein_id gnl|my_center|LOCUS_02280 74427 74750 gene locus_tag LOCUS_02290 gene iscA 74427 74750 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039700.1 protein_id gnl|my_center|LOCUS_02290 74845 75282 gene locus_tag LOCUS_02300 gene hscB 74845 75282 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812456.1 protein_id gnl|my_center|LOCUS_02300 75330 77186 gene locus_tag LOCUS_02310 gene hscA 75330 77186 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926439.1 protein_id gnl|my_center|LOCUS_02310 77218 77559 gene locus_tag LOCUS_02320 gene fdx 77218 77559 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812453.1 protein_id gnl|my_center|LOCUS_02320 77591 78394 gene locus_tag LOCUS_02330 77591 78394 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_02330 78404 79192 gene locus_tag LOCUS_02340 78404 79192 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704986.1 protein_id gnl|my_center|LOCUS_02340 80756 79230 gene locus_tag LOCUS_02350 gene lysS 80756 79230 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816835.1 protein_id gnl|my_center|LOCUS_02350 81517 80753 gene locus_tag LOCUS_02360 81517 80753 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926447.1 protein_id gnl|my_center|LOCUS_02360 82389 81514 gene locus_tag LOCUS_02370 gene prfB 82389 81514 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926448.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02370 84424 82703 gene locus_tag LOCUS_02380 gene recJ 84424 82703 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446709.1 protein_id gnl|my_center|LOCUS_02380 85332 84406 gene locus_tag LOCUS_02390 85332 84406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063646.1 protein_id gnl|my_center|LOCUS_02390 85483 86760 gene locus_tag LOCUS_02400 85483 86760 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039709.1 protein_id gnl|my_center|LOCUS_02400 86753 87466 gene locus_tag LOCUS_02410 gene lolD 86753 87466 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812422.1 protein_id gnl|my_center|LOCUS_02410 87450 88298 gene locus_tag LOCUS_02420 87450 88298 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816840.1 protein_id gnl|my_center|LOCUS_02420 88397 90790 gene locus_tag LOCUS_02430 88397 90790 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063648.1 protein_id gnl|my_center|LOCUS_02430 90815 91747 gene locus_tag LOCUS_02440 90815 91747 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039713.1 protein_id gnl|my_center|LOCUS_02440 91749 92606 gene locus_tag LOCUS_02450 91749 92606 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193008.1 protein_id gnl|my_center|LOCUS_02450 92606 93103 gene locus_tag LOCUS_02460 gene greB 92606 93103 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_02460 93984 93100 gene locus_tag LOCUS_02470 93984 93100 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040207.1 protein_id gnl|my_center|LOCUS_02470 94835 93981 gene locus_tag LOCUS_02480 94835 93981 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812386.1 protein_id gnl|my_center|LOCUS_02480 95462 94860 gene locus_tag LOCUS_02490 95462 94860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 95610 96455 gene locus_tag LOCUS_02500 95610 96455 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810982.1 protein_id gnl|my_center|LOCUS_02500 96448 96945 gene locus_tag LOCUS_02510 gene tadA 96448 96945 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810985.1 protein_id gnl|my_center|LOCUS_02510 96979 97896 gene locus_tag LOCUS_02520 96979 97896 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040000.1 protein_id gnl|my_center|LOCUS_02520 99208 97880 gene locus_tag LOCUS_02530 99208 97880 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216257.1 protein_id gnl|my_center|LOCUS_02530 99472 100569 gene locus_tag LOCUS_02540 gene tsaD 99472 100569 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811013.1 protein_id gnl|my_center|LOCUS_02540 101298 100558 gene locus_tag LOCUS_02550 gene plsY 101298 100558 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811015.1 protein_id gnl|my_center|LOCUS_02550 101298 102080 gene locus_tag LOCUS_02560 gene surE 101298 102080 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811017.1 protein_id gnl|my_center|LOCUS_02560 102065 102847 gene locus_tag LOCUS_02570 102065 102847 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928874.1 protein_id gnl|my_center|LOCUS_02570 102865 103692 gene locus_tag LOCUS_02580 102865 103692 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039995.1 protein_id gnl|my_center|LOCUS_02580 103710 104486 gene locus_tag LOCUS_02590 103710 104486 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811024.1 protein_id gnl|my_center|LOCUS_02590 104489 105826 gene locus_tag LOCUS_02600 gene rlmD 104489 105826 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926715.1 protein_id gnl|my_center|LOCUS_02600 107278 105854 gene locus_tag LOCUS_02610 gene argH 107278 105854 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812010.1 protein_id gnl|my_center|LOCUS_02610 107361 109019 gene locus_tag LOCUS_02620 107361 109019 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926542.1 protein_id gnl|my_center|LOCUS_02620 109047 109385 gene locus_tag LOCUS_02630 109047 109385 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 protein_id gnl|my_center|LOCUS_02630 109435 111060 gene locus_tag LOCUS_02640 gene ggt 109435 111060 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811984.1 protein_id gnl|my_center|LOCUS_02640 112317 111100 gene locus_tag LOCUS_02650 112317 111100 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383177.1 protein_id gnl|my_center|LOCUS_02650 113018 113674 gene locus_tag LOCUS_02660 113018 113674 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811964.1 protein_id gnl|my_center|LOCUS_02660 114594 113731 gene locus_tag LOCUS_02670 gene rlmJ 114594 113731 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926714.1 protein_id gnl|my_center|LOCUS_02670 114750 116714 gene locus_tag LOCUS_02680 114750 116714 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039990.1 protein_id gnl|my_center|LOCUS_02680 117496 116795 gene locus_tag LOCUS_02690 117496 116795 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447512.1 protein_id gnl|my_center|LOCUS_02690 117495 118178 gene locus_tag LOCUS_02700 117495 118178 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_02700 119140 118142 gene locus_tag LOCUS_02710 119140 118142 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063876.1 protein_id gnl|my_center|LOCUS_02710 119170 120534 gene locus_tag LOCUS_02720 119170 120534 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063875.1 protein_id gnl|my_center|LOCUS_02720 122849 120531 gene locus_tag LOCUS_02730 122849 120531 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811115.1 protein_id gnl|my_center|LOCUS_02730 123130 122864 gene locus_tag LOCUS_02740 gene rpoZ 123130 122864 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811126.1 protein_id gnl|my_center|LOCUS_02740 123822 123193 gene locus_tag LOCUS_02750 gene gmk 123822 123193 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930442.1 protein_id gnl|my_center|LOCUS_02750 123921 124679 gene locus_tag LOCUS_02760 123921 124679 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 protein_id gnl|my_center|LOCUS_02760 125660 124734 gene locus_tag LOCUS_02770 125660 124734 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811148.1 protein_id gnl|my_center|LOCUS_02770 125925 126662 gene locus_tag LOCUS_02780 gene rph 125925 126662 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811149.1 protein_id gnl|my_center|LOCUS_02780 127145 126678 gene locus_tag LOCUS_02790 127145 126678 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561623.1 protein_id gnl|my_center|LOCUS_02790 128551 127148 gene locus_tag LOCUS_02800 128551 127148 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811151.1 protein_id gnl|my_center|LOCUS_02800 129728 128568 gene locus_tag LOCUS_02810 129728 128568 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 protein_id gnl|my_center|LOCUS_02810 129885 130808 gene locus_tag LOCUS_02820 129885 130808 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063866.1 protein_id gnl|my_center|LOCUS_02820 130798 131436 gene locus_tag LOCUS_02830 gene rdgB 130798 131436 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930449.1 protein_id gnl|my_center|LOCUS_02830 131447 132667 gene locus_tag LOCUS_02840 gene hemW 131447 132667 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811160.1 protein_id gnl|my_center|LOCUS_02840 132871 134283 gene locus_tag LOCUS_02850 gene glnA 132871 134283 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811164.1 protein_id gnl|my_center|LOCUS_02850 134327 135376 gene locus_tag LOCUS_02860 gene glnL 134327 135376 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811167.1 protein_id gnl|my_center|LOCUS_02860 135373 136845 gene locus_tag LOCUS_02870 gene ntrC 135373 136845 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930451.1 protein_id gnl|my_center|LOCUS_02870 137667 136894 gene locus_tag LOCUS_02880 137667 136894 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811180.1 protein_id gnl|my_center|LOCUS_02880 139355 137673 gene locus_tag LOCUS_02890 139355 137673 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039957.1 protein_id gnl|my_center|LOCUS_02890 140423 139377 gene locus_tag LOCUS_02900 140423 139377 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811185.1 protein_id gnl|my_center|LOCUS_02900 140703 141089 gene locus_tag LOCUS_02910 140703 141089 CDS product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811198.1 protein_id gnl|my_center|LOCUS_02910 141061 143106 gene locus_tag LOCUS_02920 gene recG 141061 143106 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446218.1 protein_id gnl|my_center|LOCUS_02920 143175 144131 gene locus_tag LOCUS_02930 143175 144131 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 protein_id gnl|my_center|LOCUS_02930 144184 144684 gene locus_tag LOCUS_02940 144184 144684 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811209.1 protein_id gnl|my_center|LOCUS_02940 144688 145557 gene locus_tag LOCUS_02950 gene ubiA 144688 145557 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_02950 145635 146483 gene locus_tag LOCUS_02960 gene proC 145635 146483 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811267.1 protein_id gnl|my_center|LOCUS_02960 146546 147640 gene locus_tag LOCUS_02970 146546 147640 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194482.1 protein_id gnl|my_center|LOCUS_02970 147655 148428 gene locus_tag LOCUS_02980 gene hpaI 147655 148428 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113007.1 protein_id gnl|my_center|LOCUS_02980 148435 148917 gene locus_tag LOCUS_02990 148435 148917 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039876.1 protein_id gnl|my_center|LOCUS_02990 150559 149057 gene locus_tag LOCUS_03000 150559 149057 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169161074.1 protein_id gnl|my_center|LOCUS_03000 151932 150556 gene locus_tag LOCUS_03010 151932 150556 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926478.1 protein_id gnl|my_center|LOCUS_03010 152098 152391 gene locus_tag LOCUS_03020 152098 152391 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810207.1 protein_id gnl|my_center|LOCUS_03020 152760 152398 gene locus_tag LOCUS_03030 152760 152398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 152792 153385 gene locus_tag LOCUS_03040 152792 153385 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811316.1 protein_id gnl|my_center|LOCUS_03040 153382 154785 gene locus_tag LOCUS_03050 gene phrB 153382 154785 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114697.1 protein_id gnl|my_center|LOCUS_03050 154791 155198 gene locus_tag LOCUS_03060 154791 155198 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811310.1 protein_id gnl|my_center|LOCUS_03060 >Feature sequence03 <1 1209 gene locus_tag LOCUS_03070 <1 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004566381.1:DegQ family serine endoprotease 1347 3140 gene locus_tag LOCUS_03080 gene lepA 1347 3140 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065097.1 protein_id gnl|my_center|LOCUS_03080 3183 3977 gene locus_tag LOCUS_03090 gene lepB 3183 3977 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065098.1 protein_id gnl|my_center|LOCUS_03090 4022 4783 gene locus_tag LOCUS_03100 gene rnc 4022 4783 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853248.1 protein_id gnl|my_center|LOCUS_03100 4780 5676 gene locus_tag LOCUS_03110 gene era 4780 5676 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813784.1 protein_id gnl|my_center|LOCUS_03110 5657 6265 gene locus_tag LOCUS_03120 gene recO 5657 6265 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065100.1 protein_id gnl|my_center|LOCUS_03120 7337 6243 gene locus_tag LOCUS_03130 7337 6243 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 protein_id gnl|my_center|LOCUS_03130 8941 7379 gene locus_tag LOCUS_03140 8941 7379 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172956.1 protein_id gnl|my_center|LOCUS_03140 9186 8992 gene locus_tag LOCUS_03150 9186 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 9334 10059 gene locus_tag LOCUS_03160 9334 10059 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927020.1 protein_id gnl|my_center|LOCUS_03160 10881 10177 gene locus_tag LOCUS_03170 10881 10177 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813772.1 protein_id gnl|my_center|LOCUS_03170 11502 11044 gene locus_tag LOCUS_03180 11502 11044 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065106.1 protein_id gnl|my_center|LOCUS_03180 13060 11543 gene locus_tag LOCUS_03190 13060 11543 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821370.1 protein_id gnl|my_center|LOCUS_03190 13136 14251 gene locus_tag LOCUS_03200 gene lptF 13136 14251 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065108.1 protein_id gnl|my_center|LOCUS_03200 14445 15449 gene locus_tag LOCUS_03210 14445 15449 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813758.1 protein_id gnl|my_center|LOCUS_03210 16588 15968 gene locus_tag LOCUS_03220 16588 15968 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447287.1 protein_id gnl|my_center|LOCUS_03220 16750 18636 gene locus_tag LOCUS_03230 16750 18636 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065113.1 protein_id gnl|my_center|LOCUS_03230 18633 19043 gene locus_tag LOCUS_03240 18633 19043 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926942.1 protein_id gnl|my_center|LOCUS_03240 19091 21070 gene locus_tag LOCUS_03250 gene acs 19091 21070 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926941.1 protein_id gnl|my_center|LOCUS_03250 21155 22399 gene locus_tag LOCUS_03260 21155 22399 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263616.1 protein_id gnl|my_center|LOCUS_03260 22752 22459 gene locus_tag LOCUS_03270 22752 22459 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447274.1 protein_id gnl|my_center|LOCUS_03270 23705 22749 gene locus_tag LOCUS_03280 23705 22749 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_03280 25340 23712 gene locus_tag LOCUS_03290 25340 23712 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449775.1 protein_id gnl|my_center|LOCUS_03290 25493 25936 gene locus_tag LOCUS_03300 25493 25936 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813730.1 protein_id gnl|my_center|LOCUS_03300 26041 26742 gene locus_tag LOCUS_03310 26041 26742 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065123.1 protein_id gnl|my_center|LOCUS_03310 26757 27410 gene locus_tag LOCUS_03320 26757 27410 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813726.1 protein_id gnl|my_center|LOCUS_03320 27417 29222 gene locus_tag LOCUS_03330 27417 29222 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065133.1 protein_id gnl|my_center|LOCUS_03330 29265 30917 gene locus_tag LOCUS_03340 29265 30917 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813705.1 protein_id gnl|my_center|LOCUS_03340 30914 31762 gene locus_tag LOCUS_03350 gene kdsA 30914 31762 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065134.1 protein_id gnl|my_center|LOCUS_03350 31810 33096 gene locus_tag LOCUS_03360 gene eno 31810 33096 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813700.1 protein_id gnl|my_center|LOCUS_03360 33108 33491 gene locus_tag LOCUS_03370 gene ftsB 33108 33491 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813698.1 protein_id gnl|my_center|LOCUS_03370 34054 33509 gene locus_tag LOCUS_03380 34054 33509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 34382 35182 gene locus_tag LOCUS_03390 34382 35182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086844.1 protein_id gnl|my_center|LOCUS_03390 36442 35525 gene locus_tag LOCUS_03400 gene hslO 36442 35525 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065143.1 protein_id gnl|my_center|LOCUS_03400 36963 36442 gene locus_tag LOCUS_03410 36963 36442 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040199.1 protein_id gnl|my_center|LOCUS_03410 38696 37005 gene locus_tag LOCUS_03420 38696 37005 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813682.1 protein_id gnl|my_center|LOCUS_03420 39342 38767 gene locus_tag LOCUS_03430 39342 38767 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813677.1 protein_id gnl|my_center|LOCUS_03430 39595 39398 gene locus_tag LOCUS_03440 39595 39398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 41431 39683 gene locus_tag LOCUS_03450 41431 39683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 41869 41441 gene locus_tag LOCUS_03460 41869 41441 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813670.1 protein_id gnl|my_center|LOCUS_03460 43193 41904 gene locus_tag LOCUS_03470 43193 41904 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810251.1 protein_id gnl|my_center|LOCUS_03470 44270 43236 gene locus_tag LOCUS_03480 gene holA 44270 43236 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810253.1 protein_id gnl|my_center|LOCUS_03480 44851 44267 gene locus_tag LOCUS_03490 44851 44267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 47543 44877 gene locus_tag LOCUS_03500 gene leuS 47543 44877 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926800.1 protein_id gnl|my_center|LOCUS_03500 47934 47767 gene locus_tag LOCUS_03510 gene rpmG 47934 47767 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810296.1 protein_id gnl|my_center|LOCUS_03510 48203 47967 gene locus_tag LOCUS_03520 gene rpmB 48203 47967 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810297.1 protein_id gnl|my_center|LOCUS_03520 48410 49675 gene locus_tag LOCUS_03530 48410 49675 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926799.1 protein_id gnl|my_center|LOCUS_03530 50697 49672 gene locus_tag LOCUS_03540 50697 49672 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084062.1 protein_id gnl|my_center|LOCUS_03540 50858 52039 gene locus_tag LOCUS_03550 50858 52039 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905810.1 protein_id gnl|my_center|LOCUS_03550 52761 52042 gene locus_tag LOCUS_03560 gene radC 52761 52042 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810520.1 protein_id gnl|my_center|LOCUS_03560 52825 53286 gene locus_tag LOCUS_03570 52825 53286 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040115.1 protein_id gnl|my_center|LOCUS_03570 53286 54242 gene locus_tag LOCUS_03580 gene ispH 53286 54242 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446429.1 protein_id gnl|my_center|LOCUS_03580 55202 54270 gene locus_tag LOCUS_03590 55202 54270 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195013.1 protein_id gnl|my_center|LOCUS_03590 56178 55219 gene locus_tag LOCUS_03600 56178 55219 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533048.1 protein_id gnl|my_center|LOCUS_03600 56978 56196 gene locus_tag LOCUS_03610 56978 56196 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533049.1 protein_id gnl|my_center|LOCUS_03610 59504 56988 gene locus_tag LOCUS_03620 59504 56988 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086442.1 protein_id gnl|my_center|LOCUS_03620 60389 59508 gene locus_tag LOCUS_03630 60389 59508 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170747.1 protein_id gnl|my_center|LOCUS_03630 61720 60452 gene locus_tag LOCUS_03640 61720 60452 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931548.1 protein_id gnl|my_center|LOCUS_03640 61826 62548 gene locus_tag LOCUS_03650 61826 62548 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725050.1 protein_id gnl|my_center|LOCUS_03650 62624 62549 gene locus_tag LOCUS_t00040 62624 62549 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 62765 62840 gene locus_tag LOCUS_t00050 62765 62840 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 63193 62918 gene locus_tag LOCUS_03660 63193 62918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 63564 63373 gene locus_tag LOCUS_03670 63564 63373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 64041 65081 gene locus_tag LOCUS_03680 64041 65081 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389904.1 protein_id gnl|my_center|LOCUS_03680 65277 67622 gene locus_tag LOCUS_03690 65277 67622 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_03690 69191 67767 gene locus_tag LOCUS_03700 69191 67767 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_03700 69396 69938 gene locus_tag LOCUS_03710 gene speG 69396 69938 CDS product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209779.1 protein_id gnl|my_center|LOCUS_03710 70016 70897 gene locus_tag LOCUS_03720 70016 70897 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807015.1 protein_id gnl|my_center|LOCUS_03720 70915 72261 gene locus_tag LOCUS_03730 70915 72261 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141651.1 protein_id gnl|my_center|LOCUS_03730 72778 72272 gene locus_tag LOCUS_03740 72778 72272 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072803.1 protein_id gnl|my_center|LOCUS_03740 73656 72775 gene locus_tag LOCUS_03750 73656 72775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 74162 73734 gene locus_tag LOCUS_03760 74162 73734 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378342.1 protein_id gnl|my_center|LOCUS_03760 74410 75099 gene locus_tag LOCUS_03770 74410 75099 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_03770 75801 75109 gene locus_tag LOCUS_03780 75801 75109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 76153 77016 gene locus_tag LOCUS_03790 76153 77016 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_03790 77048 77533 gene locus_tag LOCUS_03800 gene cutC 77048 77533 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 protein_id gnl|my_center|LOCUS_03800 77570 79975 gene locus_tag LOCUS_03810 77570 79975 CDS product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 protein_id gnl|my_center|LOCUS_03810 79997 80635 gene locus_tag LOCUS_03820 79997 80635 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730864.1 protein_id gnl|my_center|LOCUS_03820 80656 81570 gene locus_tag LOCUS_03830 80656 81570 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_03830 81574 82794 gene locus_tag LOCUS_03840 81574 82794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 82879 83634 gene locus_tag LOCUS_03850 82879 83634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 83635 84327 gene locus_tag LOCUS_03860 83635 84327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 84464 85627 gene locus_tag LOCUS_03870 84464 85627 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_03870 86947 85697 gene locus_tag LOCUS_03880 86947 85697 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064136.1 protein_id gnl|my_center|LOCUS_03880 87600 89273 gene locus_tag LOCUS_03890 87600 89273 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173726.1 protein_id gnl|my_center|LOCUS_03890 89358 90311 gene locus_tag LOCUS_03900 89358 90311 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090644.1 protein_id gnl|my_center|LOCUS_03900 90346 91239 gene locus_tag LOCUS_03910 90346 91239 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090643.1 protein_id gnl|my_center|LOCUS_03910 91239 92288 gene locus_tag LOCUS_03920 91239 92288 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966121.1 protein_id gnl|my_center|LOCUS_03920 92285 93301 gene locus_tag LOCUS_03930 92285 93301 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090640.1 protein_id gnl|my_center|LOCUS_03930 94019 93312 gene locus_tag LOCUS_03940 94019 93312 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252482.1 protein_id gnl|my_center|LOCUS_03940 94342 95241 gene locus_tag LOCUS_03950 94342 95241 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185533.1 protein_id gnl|my_center|LOCUS_03950 95296 95598 gene locus_tag LOCUS_03960 95296 95598 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862556.1 protein_id gnl|my_center|LOCUS_03960 95598 95936 gene locus_tag LOCUS_03970 95598 95936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 95923 96249 gene locus_tag LOCUS_03980 95923 96249 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814827.1 protein_id gnl|my_center|LOCUS_03980 96246 97958 gene locus_tag LOCUS_03990 gene ureC 96246 97958 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763096.1 protein_id gnl|my_center|LOCUS_03990 97961 98506 gene locus_tag LOCUS_04000 97961 98506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 98493 99203 gene locus_tag LOCUS_04010 98493 99203 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446466.1 protein_id gnl|my_center|LOCUS_04010 99207 99824 gene locus_tag LOCUS_04020 gene ureG 99207 99824 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185810.1 protein_id gnl|my_center|LOCUS_04020 102677 99900 gene locus_tag LOCUS_04030 102677 99900 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 protein_id gnl|my_center|LOCUS_04030 103776 102970 gene locus_tag LOCUS_04040 103776 102970 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926867.1 protein_id gnl|my_center|LOCUS_04040 104229 104005 gene locus_tag LOCUS_04050 104229 104005 CDS product FeoC-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390224.1 protein_id gnl|my_center|LOCUS_04050 106579 104240 gene locus_tag LOCUS_04060 gene feoB 106579 104240 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337005.1 protein_id gnl|my_center|LOCUS_04060 106810 106580 gene locus_tag LOCUS_04070 106810 106580 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390222.1 protein_id gnl|my_center|LOCUS_04070 107099 106842 gene locus_tag LOCUS_04080 107099 106842 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392945.1 protein_id gnl|my_center|LOCUS_04080 107675 107307 gene locus_tag LOCUS_04090 107675 107307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 108151 107783 gene locus_tag LOCUS_04100 108151 107783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 109320 108625 gene locus_tag LOCUS_04110 109320 108625 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207546.1 protein_id gnl|my_center|LOCUS_04110 109419 109904 gene locus_tag LOCUS_04120 109419 109904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 110525 110449 gene locus_tag LOCUS_t00060 110525 110449 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 110617 111621 gene locus_tag LOCUS_04130 110617 111621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 111624 113189 gene locus_tag LOCUS_04140 111624 113189 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041937173.1 protein_id gnl|my_center|LOCUS_04140 113352 113852 gene locus_tag LOCUS_04150 gene rimP 113352 113852 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810544.1 protein_id gnl|my_center|LOCUS_04150 113849 115330 gene locus_tag LOCUS_04160 gene nusA 113849 115330 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810546.1 protein_id gnl|my_center|LOCUS_04160 115410 118271 gene locus_tag LOCUS_04170 gene infB 115410 118271 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040110.1 protein_id gnl|my_center|LOCUS_04170 118282 118671 gene locus_tag LOCUS_04180 gene rbfA 118282 118671 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810550.1 protein_id gnl|my_center|LOCUS_04180 118700 119443 gene locus_tag LOCUS_04190 gene truB 118700 119443 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810552.1 protein_id gnl|my_center|LOCUS_04190 119469 121292 gene locus_tag LOCUS_04200 gene typA 119469 121292 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818637.1 protein_id gnl|my_center|LOCUS_04200 122877 121393 gene locus_tag LOCUS_04210 gene gabD 122877 121393 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368063.1 protein_id gnl|my_center|LOCUS_04210 123659 122982 gene locus_tag LOCUS_04220 123659 122982 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930272.1 protein_id gnl|my_center|LOCUS_04220 123658 126405 gene locus_tag LOCUS_04230 gene polA 123658 126405 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810562.1 protein_id gnl|my_center|LOCUS_04230 126688 126885 gene locus_tag LOCUS_04240 126688 126885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04240 127769 126897 gene locus_tag LOCUS_04250 gene htpX 127769 126897 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813142.1 protein_id gnl|my_center|LOCUS_04250 129027 127879 gene locus_tag LOCUS_04260 129027 127879 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931139.1 protein_id gnl|my_center|LOCUS_04260 129203 129487 gene locus_tag LOCUS_04270 129203 129487 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813109.1 protein_id gnl|my_center|LOCUS_04270 129484 130404 gene locus_tag LOCUS_04280 129484 130404 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813107.1 protein_id gnl|my_center|LOCUS_04280 130415 132292 gene locus_tag LOCUS_04290 gene dxs 130415 132292 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813105.1 protein_id gnl|my_center|LOCUS_04290 132518 132889 gene locus_tag LOCUS_04300 gene rpsF 132518 132889 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926331.1 protein_id gnl|my_center|LOCUS_04300 133238 133507 gene locus_tag LOCUS_04310 gene rpsR 133238 133507 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813094.1 protein_id gnl|my_center|LOCUS_04310 133521 133976 gene locus_tag LOCUS_04320 gene rplI 133521 133976 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813092.1 protein_id gnl|my_center|LOCUS_04320 134075 135451 gene locus_tag LOCUS_04330 134075 135451 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813089.1 protein_id gnl|my_center|LOCUS_04330 136443 135445 gene locus_tag LOCUS_04340 gene pdxA 136443 135445 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813085.1 protein_id gnl|my_center|LOCUS_04340 138137 136443 gene locus_tag LOCUS_04350 138137 136443 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 protein_id gnl|my_center|LOCUS_04350 138698 138231 gene locus_tag LOCUS_04360 138698 138231 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813079.1 protein_id gnl|my_center|LOCUS_04360 139146 138700 gene locus_tag LOCUS_04370 139146 138700 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813077.1 protein_id gnl|my_center|LOCUS_04370 139350 140534 gene locus_tag LOCUS_04380 gene alaC 139350 140534 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931132.1 protein_id gnl|my_center|LOCUS_04380 140534 141835 gene locus_tag LOCUS_04390 140534 141835 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039535.1 protein_id gnl|my_center|LOCUS_04390 141835 143244 gene locus_tag LOCUS_04400 gene thrC 141835 143244 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813072.1 protein_id gnl|my_center|LOCUS_04400 143250 143648 gene locus_tag LOCUS_04410 gene crcB 143250 143648 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651074.1 protein_id gnl|my_center|LOCUS_04410 144922 143645 gene locus_tag LOCUS_04420 gene hpnE 144922 143645 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040124.1 protein_id gnl|my_center|LOCUS_04420 >Feature sequence04 526 65 gene locus_tag LOCUS_04430 526 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 1234 914 gene locus_tag LOCUS_04440 1234 914 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967294.1 protein_id gnl|my_center|LOCUS_04440 1470 1231 gene locus_tag LOCUS_04450 1470 1231 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402169.1 protein_id gnl|my_center|LOCUS_04450 1780 1625 gene locus_tag LOCUS_04460 1780 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 1968 2237 gene locus_tag LOCUS_04470 1968 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 3178 2465 gene locus_tag LOCUS_04480 3178 2465 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440237.1 protein_id gnl|my_center|LOCUS_04480 3518 3138 gene locus_tag LOCUS_04490 3518 3138 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390973.1 protein_id gnl|my_center|LOCUS_04490 3649 4674 gene locus_tag LOCUS_04500 3649 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 5335 6873 gene locus_tag LOCUS_04510 gene ltrA 5335 6873 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189111.1 protein_id gnl|my_center|LOCUS_04510 7019 7360 gene locus_tag LOCUS_04520 7019 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 7766 7512 gene locus_tag LOCUS_04530 7766 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 7952 8173 gene locus_tag LOCUS_04540 7952 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 9527 8220 gene locus_tag LOCUS_04550 9527 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 9790 9524 gene locus_tag LOCUS_04560 9790 9524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 10489 10202 gene locus_tag LOCUS_04570 10489 10202 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 protein_id gnl|my_center|LOCUS_04570 10808 10476 gene locus_tag LOCUS_04580 10808 10476 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599895.1 protein_id gnl|my_center|LOCUS_04580 11502 11023 gene locus_tag LOCUS_04590 11502 11023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 12095 11721 gene locus_tag LOCUS_04600 12095 11721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04600 13233 12379 gene locus_tag LOCUS_04610 13233 12379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098799.1 protein_id gnl|my_center|LOCUS_04610 13916 13245 gene locus_tag LOCUS_04620 13916 13245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 14750 13935 gene locus_tag LOCUS_04630 14750 13935 CDS product TIGR04255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098801.1 protein_id gnl|my_center|LOCUS_04630 15178 14852 gene locus_tag LOCUS_04640 15178 14852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 15908 15222 gene locus_tag LOCUS_04650 15908 15222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 16219 17196 gene locus_tag LOCUS_04660 16219 17196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 17156 18130 gene locus_tag LOCUS_04670 17156 18130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 18241 18077 gene locus_tag LOCUS_04680 18241 18077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 18980 19420 gene locus_tag LOCUS_04690 18980 19420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 20200 20125 gene locus_tag LOCUS_t00070 20200 20125 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 20329 21711 gene locus_tag LOCUS_04700 gene hemA 20329 21711 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064647.1 protein_id gnl|my_center|LOCUS_04700 21830 22900 gene locus_tag LOCUS_04710 gene prfA 21830 22900 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807618.1 protein_id gnl|my_center|LOCUS_04710 22890 23744 gene locus_tag LOCUS_04720 gene prmC 22890 23744 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929958.1 protein_id gnl|my_center|LOCUS_04720 23811 24137 gene locus_tag LOCUS_04730 gene grxD 23811 24137 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807622.1 protein_id gnl|my_center|LOCUS_04730 24155 24721 gene locus_tag LOCUS_04740 24155 24721 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807624.1 protein_id gnl|my_center|LOCUS_04740 25672 24764 gene locus_tag LOCUS_04750 gene ttcA 25672 24764 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815371.1 protein_id gnl|my_center|LOCUS_04750 26065 25700 gene locus_tag LOCUS_04760 gene folB 26065 25700 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817821.1 protein_id gnl|my_center|LOCUS_04760 26176 27072 gene locus_tag LOCUS_04770 26176 27072 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931382.1 protein_id gnl|my_center|LOCUS_04770 28227 27127 gene locus_tag LOCUS_04780 gene mnmH 28227 27127 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266576.1 protein_id gnl|my_center|LOCUS_04780 30005 28230 gene locus_tag LOCUS_04790 30005 28230 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815368.1 protein_id gnl|my_center|LOCUS_04790 30043 30834 gene locus_tag LOCUS_04800 30043 30834 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815367.1 protein_id gnl|my_center|LOCUS_04800 31132 31545 gene locus_tag LOCUS_04810 31132 31545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 31628 32509 gene locus_tag LOCUS_04820 gene atpB 31628 32509 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815364.1 protein_id gnl|my_center|LOCUS_04820 32590 32829 gene locus_tag LOCUS_04830 gene atpE 32590 32829 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815363.1 protein_id gnl|my_center|LOCUS_04830 32970 33440 gene locus_tag LOCUS_04840 32970 33440 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064895.1 protein_id gnl|my_center|LOCUS_04840 33453 33995 gene locus_tag LOCUS_04850 33453 33995 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815348.1 protein_id gnl|my_center|LOCUS_04850 34026 35567 gene locus_tag LOCUS_04860 gene atpA 34026 35567 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040647.1 protein_id gnl|my_center|LOCUS_04860 35607 36524 gene locus_tag LOCUS_04870 gene atpG 35607 36524 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815344.1 protein_id gnl|my_center|LOCUS_04870 36585 37985 gene locus_tag LOCUS_04880 gene atpD 36585 37985 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064897.1 protein_id gnl|my_center|LOCUS_04880 37995 38426 gene locus_tag LOCUS_04890 37995 38426 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815341.1 protein_id gnl|my_center|LOCUS_04890 38545 39321 gene locus_tag LOCUS_04900 38545 39321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931388.1 protein_id gnl|my_center|LOCUS_04900 39368 40441 gene locus_tag LOCUS_04910 gene hemE 39368 40441 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815337.1 protein_id gnl|my_center|LOCUS_04910 40814 42865 gene locus_tag LOCUS_04920 40814 42865 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815335.1 protein_id gnl|my_center|LOCUS_04920 42878 44905 gene locus_tag LOCUS_04930 42878 44905 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815333.1 protein_id gnl|my_center|LOCUS_04930 45818 44958 gene locus_tag LOCUS_04940 45818 44958 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815316.1 protein_id gnl|my_center|LOCUS_04940 45891 47417 gene locus_tag LOCUS_04950 45891 47417 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815305.1 protein_id gnl|my_center|LOCUS_04950 48434 47514 gene locus_tag LOCUS_04960 48434 47514 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172607919.1 protein_id gnl|my_center|LOCUS_04960 48550 48624 gene locus_tag LOCUS_t00080 48550 48624 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 50236 48668 gene locus_tag LOCUS_04970 gene gshA 50236 48668 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815271.1 protein_id gnl|my_center|LOCUS_04970 50344 50871 gene locus_tag LOCUS_04980 50344 50871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929589.1 protein_id gnl|my_center|LOCUS_04980 51076 50846 gene locus_tag LOCUS_04990 51076 50846 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815265.1 protein_id gnl|my_center|LOCUS_04990 51236 52078 gene locus_tag LOCUS_05000 51236 52078 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815255.1 protein_id gnl|my_center|LOCUS_05000 52179 53399 gene locus_tag LOCUS_05010 52179 53399 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815253.1 protein_id gnl|my_center|LOCUS_05010 53389 54009 gene locus_tag LOCUS_05020 gene metW 53389 54009 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817748.1 protein_id gnl|my_center|LOCUS_05020 54006 55268 gene locus_tag LOCUS_05030 54006 55268 CDS product muropeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815250.1 protein_id gnl|my_center|LOCUS_05030 56170 55304 gene locus_tag LOCUS_05040 56170 55304 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815215.1 protein_id gnl|my_center|LOCUS_05040 57035 56223 gene locus_tag LOCUS_05050 57035 56223 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815212.1 protein_id gnl|my_center|LOCUS_05050 57108 57788 gene locus_tag LOCUS_05060 gene pyrE 57108 57788 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929769.1 protein_id gnl|my_center|LOCUS_05060 59239 57785 gene locus_tag LOCUS_05070 gene gatB 59239 57785 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929770.1 protein_id gnl|my_center|LOCUS_05070 60765 59236 gene locus_tag LOCUS_05080 gene gatA 60765 59236 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040608.1 protein_id gnl|my_center|LOCUS_05080 61079 60771 gene locus_tag LOCUS_05090 gene gatC 61079 60771 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929772.1 protein_id gnl|my_center|LOCUS_05090 61293 62336 gene locus_tag LOCUS_05100 61293 62336 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815204.1 protein_id gnl|my_center|LOCUS_05100 62417 63352 gene locus_tag LOCUS_05110 gene mreC 62417 63352 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929773.1 protein_id gnl|my_center|LOCUS_05110 63339 63899 gene locus_tag LOCUS_05120 gene mreD 63339 63899 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040607.1 protein_id gnl|my_center|LOCUS_05120 63914 65800 gene locus_tag LOCUS_05130 gene mrdA 63914 65800 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815201.1 protein_id gnl|my_center|LOCUS_05130 65797 66942 gene locus_tag LOCUS_05140 gene rodA 65797 66942 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815198.1 protein_id gnl|my_center|LOCUS_05140 67964 66912 gene locus_tag LOCUS_05150 gene mutY 67964 66912 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931673.1 protein_id gnl|my_center|LOCUS_05150 68877 67969 gene locus_tag LOCUS_05160 68877 67969 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040576.1 protein_id gnl|my_center|LOCUS_05160 69548 68874 gene locus_tag LOCUS_05170 69548 68874 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815073.1 protein_id gnl|my_center|LOCUS_05170 69738 70754 gene locus_tag LOCUS_05180 69738 70754 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815070.1 protein_id gnl|my_center|LOCUS_05180 70858 72051 gene locus_tag LOCUS_05190 70858 72051 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815068.1 protein_id gnl|my_center|LOCUS_05190 72054 73154 gene locus_tag LOCUS_05200 72054 73154 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815066.1 protein_id gnl|my_center|LOCUS_05200 73187 73927 gene locus_tag LOCUS_05210 73187 73927 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815064.1 protein_id gnl|my_center|LOCUS_05210 74026 74214 gene locus_tag LOCUS_05220 74026 74214 CDS product DUF3460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815055.1 protein_id gnl|my_center|LOCUS_05220 74221 75099 gene locus_tag LOCUS_05230 74221 75099 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815053.1 protein_id gnl|my_center|LOCUS_05230 75128 75970 gene locus_tag LOCUS_05240 gene panC 75128 75970 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815051.1 protein_id gnl|my_center|LOCUS_05240 76082 76423 gene locus_tag LOCUS_05250 76082 76423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 77099 76356 gene locus_tag LOCUS_05260 77099 76356 CDS product copper resistance protein NlpE N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815047.1 protein_id gnl|my_center|LOCUS_05260 77218 77874 gene locus_tag LOCUS_05270 77218 77874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 77867 78469 gene locus_tag LOCUS_05280 gene coaE 77867 78469 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927124.1 protein_id gnl|my_center|LOCUS_05280 78496 79248 gene locus_tag LOCUS_05290 gene zapD 78496 79248 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815038.1 protein_id gnl|my_center|LOCUS_05290 79324 80757 gene locus_tag LOCUS_05300 79324 80757 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927123.1 protein_id gnl|my_center|LOCUS_05300 81663 80710 gene locus_tag LOCUS_05310 81663 80710 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815027.1 protein_id gnl|my_center|LOCUS_05310 82537 81656 gene locus_tag LOCUS_05320 82537 81656 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815026.1 protein_id gnl|my_center|LOCUS_05320 83770 82544 gene locus_tag LOCUS_05330 gene argJ 83770 82544 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815023.1 protein_id gnl|my_center|LOCUS_05330 85066 83786 gene locus_tag LOCUS_05340 gene hemL 85066 83786 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814987.1 protein_id gnl|my_center|LOCUS_05340 85779 85138 gene locus_tag LOCUS_05350 gene thiE 85779 85138 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040557.1 protein_id gnl|my_center|LOCUS_05350 86618 85776 gene locus_tag LOCUS_05360 86618 85776 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929734.1 protein_id gnl|my_center|LOCUS_05360 86680 86844 gene locus_tag LOCUS_05370 86680 86844 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814980.1 protein_id gnl|my_center|LOCUS_05370 86851 87420 gene locus_tag LOCUS_05380 86851 87420 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927118.1 protein_id gnl|my_center|LOCUS_05380 87417 87827 gene locus_tag LOCUS_05390 gene ruvX 87417 87827 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064931.1 protein_id gnl|my_center|LOCUS_05390 87839 88372 gene locus_tag LOCUS_05400 gene pyrR 87839 88372 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185915.1 protein_id gnl|my_center|LOCUS_05400 88372 89325 gene locus_tag LOCUS_05410 88372 89325 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_05410 89328 90617 gene locus_tag LOCUS_05420 89328 90617 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186353.1 protein_id gnl|my_center|LOCUS_05420 90614 91381 gene locus_tag LOCUS_05430 90614 91381 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927117.1 protein_id gnl|my_center|LOCUS_05430 92261 91422 gene locus_tag LOCUS_05440 92261 91422 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929738.1 protein_id gnl|my_center|LOCUS_05440 93439 92258 gene locus_tag LOCUS_05450 gene lptG 93439 92258 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446409.1 protein_id gnl|my_center|LOCUS_05450 94312 93449 gene locus_tag LOCUS_05460 gene aroE 94312 93449 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040552.1 protein_id gnl|my_center|LOCUS_05460 95224 94334 gene locus_tag LOCUS_05470 95224 94334 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931246.1 protein_id gnl|my_center|LOCUS_05470 97122 95239 gene locus_tag LOCUS_05480 97122 95239 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814957.1 protein_id gnl|my_center|LOCUS_05480 97731 97123 gene locus_tag LOCUS_05490 97731 97123 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814956.1 protein_id gnl|my_center|LOCUS_05490 99095 97731 gene locus_tag LOCUS_05500 gene mpl 99095 97731 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814955.1 protein_id gnl|my_center|LOCUS_05500 99184 99732 gene locus_tag LOCUS_05510 99184 99732 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040551.1 protein_id gnl|my_center|LOCUS_05510 99787 100287 gene locus_tag LOCUS_05520 gene aroQ 99787 100287 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814953.1 protein_id gnl|my_center|LOCUS_05520 100357 100821 gene locus_tag LOCUS_05530 gene accB 100357 100821 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814952.1 protein_id gnl|my_center|LOCUS_05530 100824 102170 gene locus_tag LOCUS_05540 gene accC 100824 102170 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814951.1 protein_id gnl|my_center|LOCUS_05540 102193 103098 gene locus_tag LOCUS_05550 gene prmA 102193 103098 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814950.1 protein_id gnl|my_center|LOCUS_05550 103602 104360 gene locus_tag LOCUS_05560 103602 104360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 104394 105332 gene locus_tag LOCUS_05570 104394 105332 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040548.1 protein_id gnl|my_center|LOCUS_05570 105379 105885 gene locus_tag LOCUS_05580 105379 105885 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814946.1 protein_id gnl|my_center|LOCUS_05580 106581 106018 gene locus_tag LOCUS_05590 106581 106018 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814933.1 protein_id gnl|my_center|LOCUS_05590 107217 106708 gene locus_tag LOCUS_05600 107217 106708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 108680 107469 gene locus_tag LOCUS_05610 108680 107469 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814929.1 protein_id gnl|my_center|LOCUS_05610 111636 108712 gene locus_tag LOCUS_05620 111636 108712 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814928.1 protein_id gnl|my_center|LOCUS_05620 113342 111843 gene locus_tag LOCUS_05630 gene gltX 113342 111843 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814917.1 protein_id gnl|my_center|LOCUS_05630 113491 115974 gene locus_tag LOCUS_05640 113491 115974 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040542.1 protein_id gnl|my_center|LOCUS_05640 116656 115985 gene locus_tag LOCUS_05650 116656 115985 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931226.1 protein_id gnl|my_center|LOCUS_05650 117237 116653 gene locus_tag LOCUS_05660 gene yjgA 117237 116653 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814897.1 protein_id gnl|my_center|LOCUS_05660 117304 118659 gene locus_tag LOCUS_05670 gene pmbA 117304 118659 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814895.1 protein_id gnl|my_center|LOCUS_05670 118840 119268 gene locus_tag LOCUS_05680 gene rplM 118840 119268 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927106.1 protein_id gnl|my_center|LOCUS_05680 119278 119670 gene locus_tag LOCUS_05690 gene rpsI 119278 119670 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814889.1 protein_id gnl|my_center|LOCUS_05690 119872 120960 gene locus_tag LOCUS_05700 gene argC 119872 120960 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820599.1 protein_id gnl|my_center|LOCUS_05700 122378 120939 gene locus_tag LOCUS_05710 122378 120939 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411955.1 protein_id gnl|my_center|LOCUS_05710 122750 123118 gene locus_tag LOCUS_05720 gene erpA 122750 123118 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814883.1 protein_id gnl|my_center|LOCUS_05720 124272 123172 gene locus_tag LOCUS_05730 124272 123172 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931222.1 protein_id gnl|my_center|LOCUS_05730 125629 124289 gene locus_tag LOCUS_05740 125629 124289 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931221.1 protein_id gnl|my_center|LOCUS_05740 125885 127123 gene locus_tag LOCUS_05750 gene tyrS 125885 127123 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814877.1 protein_id gnl|my_center|LOCUS_05750 127292 127933 gene locus_tag LOCUS_05760 127292 127933 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_05760 128092 129336 gene locus_tag LOCUS_05770 128092 129336 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814873.1 protein_id gnl|my_center|LOCUS_05770 129348 129818 gene locus_tag LOCUS_05780 gene nrdR 129348 129818 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814871.1 protein_id gnl|my_center|LOCUS_05780 129848 131017 gene locus_tag LOCUS_05790 gene ribD 129848 131017 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931219.1 protein_id gnl|my_center|LOCUS_05790 131113 131727 gene locus_tag LOCUS_05800 131113 131727 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_05800 131921 132268 gene locus_tag LOCUS_05810 131921 132268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 132265 132813 gene locus_tag LOCUS_05820 132265 132813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 132875 132965 gene locus_tag LOCUS_t00090 132875 132965 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 133385 133609 gene locus_tag LOCUS_05830 133385 133609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 133602 134429 gene locus_tag LOCUS_05840 133602 134429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05840 134442 135488 gene locus_tag LOCUS_05850 134442 135488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 135573 135977 gene locus_tag LOCUS_05860 135573 135977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05860 136894 137700 gene locus_tag LOCUS_05870 136894 137700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 >Feature sequence05 1038 214 gene locus_tag LOCUS_05880 1038 214 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813022.1 protein_id gnl|my_center|LOCUS_05880 2579 1110 gene locus_tag LOCUS_05890 2579 1110 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929886.1 protein_id gnl|my_center|LOCUS_05890 3961 2582 gene locus_tag LOCUS_05900 gene trkA 3961 2582 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807336.1 protein_id gnl|my_center|LOCUS_05900 4656 3958 gene locus_tag LOCUS_05910 4656 3958 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929885.1 protein_id gnl|my_center|LOCUS_05910 6975 4669 gene locus_tag LOCUS_05920 6975 4669 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929884.1 protein_id gnl|my_center|LOCUS_05920 7520 6972 gene locus_tag LOCUS_05930 7520 6972 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807331.1 protein_id gnl|my_center|LOCUS_05930 8892 7576 gene locus_tag LOCUS_05940 gene rsmB 8892 7576 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038748.1 protein_id gnl|my_center|LOCUS_05940 9008 10327 gene locus_tag LOCUS_05950 gene rimO 9008 10327 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064698.1 protein_id gnl|my_center|LOCUS_05950 11310 10360 gene locus_tag LOCUS_05960 gene fmt 11310 10360 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929873.1 protein_id gnl|my_center|LOCUS_05960 11828 11316 gene locus_tag LOCUS_05970 gene def 11828 11316 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807300.1 protein_id gnl|my_center|LOCUS_05970 13063 11882 gene locus_tag LOCUS_05980 gene chrA 13063 11882 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337376.1 protein_id gnl|my_center|LOCUS_05980 13087 14001 gene locus_tag LOCUS_05990 13087 14001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 14005 14496 gene locus_tag LOCUS_06000 gene azu 14005 14496 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813974.1 protein_id gnl|my_center|LOCUS_06000 15200 14502 gene locus_tag LOCUS_06010 15200 14502 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807283.1 protein_id gnl|my_center|LOCUS_06010 15281 16558 gene locus_tag LOCUS_06020 15281 16558 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003128157.1 protein_id gnl|my_center|LOCUS_06020 17610 16567 gene locus_tag LOCUS_06030 gene selD 17610 16567 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551284.1 protein_id gnl|my_center|LOCUS_06030 17723 18328 gene locus_tag LOCUS_06040 17723 18328 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173662.1 protein_id gnl|my_center|LOCUS_06040 18969 18349 gene locus_tag LOCUS_06050 18969 18349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170077.1 protein_id gnl|my_center|LOCUS_06050 19937 19011 gene locus_tag LOCUS_06060 19937 19011 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966538.1 protein_id gnl|my_center|LOCUS_06060 20080 21432 gene locus_tag LOCUS_06070 20080 21432 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185845.1 protein_id gnl|my_center|LOCUS_06070 22868 21504 gene locus_tag LOCUS_06080 22868 21504 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815720.1 protein_id gnl|my_center|LOCUS_06080 24282 22900 gene locus_tag LOCUS_06090 gene glmU 24282 22900 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064821.1 protein_id gnl|my_center|LOCUS_06090 24983 24291 gene locus_tag LOCUS_06100 24983 24291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064820.1 protein_id gnl|my_center|LOCUS_06100 25050 25277 gene locus_tag LOCUS_06110 25050 25277 CDS product DUF3717 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064818.1 protein_id gnl|my_center|LOCUS_06110 25890 25303 gene locus_tag LOCUS_06120 25890 25303 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815727.1 protein_id gnl|my_center|LOCUS_06120 26769 25912 gene locus_tag LOCUS_06130 gene cyoE 26769 25912 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064816.1 protein_id gnl|my_center|LOCUS_06130 27885 26827 gene locus_tag LOCUS_06140 27885 26827 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064815.1 protein_id gnl|my_center|LOCUS_06140 28530 27913 gene locus_tag LOCUS_06150 28530 27913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815732.1 protein_id gnl|my_center|LOCUS_06150 29372 28542 gene locus_tag LOCUS_06160 29372 28542 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995706.1 protein_id gnl|my_center|LOCUS_06160 29436 29639 gene locus_tag LOCUS_06170 29436 29639 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815736.1 protein_id gnl|my_center|LOCUS_06170 30624 29749 gene locus_tag LOCUS_06180 30624 29749 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815738.1 protein_id gnl|my_center|LOCUS_06180 30918 30676 gene locus_tag LOCUS_06190 30918 30676 CDS product DUF2970 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815740.1 protein_id gnl|my_center|LOCUS_06190 32701 31082 gene locus_tag LOCUS_06200 gene ctaD 32701 31082 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064812.1 protein_id gnl|my_center|LOCUS_06200 33944 32796 gene locus_tag LOCUS_06210 gene coxB 33944 32796 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064811.1 protein_id gnl|my_center|LOCUS_06210 34408 34998 gene locus_tag LOCUS_06220 34408 34998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 37489 34961 gene locus_tag LOCUS_06230 37489 34961 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927217.1 protein_id gnl|my_center|LOCUS_06230 38411 37572 gene locus_tag LOCUS_06240 gene rpoH 38411 37572 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040728.1 protein_id gnl|my_center|LOCUS_06240 38606 39331 gene locus_tag LOCUS_06250 38606 39331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040731.1 protein_id gnl|my_center|LOCUS_06250 39455 44170 gene locus_tag LOCUS_06260 39455 44170 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064803.1 protein_id gnl|my_center|LOCUS_06260 44184 45650 gene locus_tag LOCUS_06270 44184 45650 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448901.1 protein_id gnl|my_center|LOCUS_06270 45682 46554 gene locus_tag LOCUS_06280 45682 46554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931636.1 protein_id gnl|my_center|LOCUS_06280 46551 47336 gene locus_tag LOCUS_06290 gene mlaE 46551 47336 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815775.1 protein_id gnl|my_center|LOCUS_06290 47362 47832 gene locus_tag LOCUS_06300 gene mlaD 47362 47832 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 protein_id gnl|my_center|LOCUS_06300 47854 48639 gene locus_tag LOCUS_06310 47854 48639 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931638.1 protein_id gnl|my_center|LOCUS_06310 48636 49295 gene locus_tag LOCUS_06320 48636 49295 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040736.1 protein_id gnl|my_center|LOCUS_06320 49298 50098 gene locus_tag LOCUS_06330 49298 50098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446832.1 protein_id gnl|my_center|LOCUS_06330 50095 50889 gene locus_tag LOCUS_06340 50095 50889 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815783.1 protein_id gnl|my_center|LOCUS_06340 50911 51153 gene locus_tag LOCUS_06350 50911 51153 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815785.1 protein_id gnl|my_center|LOCUS_06350 51153 52421 gene locus_tag LOCUS_06360 gene murA 51153 52421 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927222.1 protein_id gnl|my_center|LOCUS_06360 52418 53080 gene locus_tag LOCUS_06370 gene hisG 52418 53080 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931640.1 protein_id gnl|my_center|LOCUS_06370 53173 54471 gene locus_tag LOCUS_06380 gene hisD 53173 54471 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931641.1 protein_id gnl|my_center|LOCUS_06380 54567 55154 gene locus_tag LOCUS_06390 gene hisB 54567 55154 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815795.1 protein_id gnl|my_center|LOCUS_06390 55193 55834 gene locus_tag LOCUS_06400 gene hisH 55193 55834 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815798.1 protein_id gnl|my_center|LOCUS_06400 55863 56603 gene locus_tag LOCUS_06410 gene hisA 55863 56603 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 protein_id gnl|my_center|LOCUS_06410 56600 57421 gene locus_tag LOCUS_06420 gene hisF 56600 57421 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815802.1 protein_id gnl|my_center|LOCUS_06420 57411 57827 gene locus_tag LOCUS_06430 gene hisI 57411 57827 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815804.1 protein_id gnl|my_center|LOCUS_06430 57824 58183 gene locus_tag LOCUS_06440 57824 58183 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815805.1 protein_id gnl|my_center|LOCUS_06440 58187 58555 gene locus_tag LOCUS_06450 58187 58555 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815807.1 protein_id gnl|my_center|LOCUS_06450 58569 58811 gene locus_tag LOCUS_06460 gene tatA 58569 58811 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 protein_id gnl|my_center|LOCUS_06460 58889 59338 gene locus_tag LOCUS_06470 gene tatB 58889 59338 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906112.1 protein_id gnl|my_center|LOCUS_06470 59335 60144 gene locus_tag LOCUS_06480 gene tatC 59335 60144 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815810.1 protein_id gnl|my_center|LOCUS_06480 61094 60141 gene locus_tag LOCUS_06490 61094 60141 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965948.1 protein_id gnl|my_center|LOCUS_06490 61281 61598 gene locus_tag LOCUS_06500 61281 61598 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115217.1 protein_id gnl|my_center|LOCUS_06500 61646 62413 gene locus_tag LOCUS_06510 61646 62413 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927226.1 protein_id gnl|my_center|LOCUS_06510 62877 62419 gene locus_tag LOCUS_06520 gene mscL 62877 62419 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815814.1 protein_id gnl|my_center|LOCUS_06520 62996 63640 gene locus_tag LOCUS_06530 gene petA 62996 63640 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064798.1 protein_id gnl|my_center|LOCUS_06530 63699 65078 gene locus_tag LOCUS_06540 63699 65078 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815816.1 protein_id gnl|my_center|LOCUS_06540 65278 65946 gene locus_tag LOCUS_06550 65278 65946 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247426.1 protein_id gnl|my_center|LOCUS_06550 66031 66642 gene locus_tag LOCUS_06560 66031 66642 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815819.1 protein_id gnl|my_center|LOCUS_06560 66658 67098 gene locus_tag LOCUS_06570 66658 67098 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815821.1 protein_id gnl|my_center|LOCUS_06570 67189 67264 gene locus_tag LOCUS_t00100 67189 67264 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 67563 68624 gene locus_tag LOCUS_06580 67563 68624 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_06580 68719 69579 gene locus_tag LOCUS_06590 68719 69579 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190656.1 protein_id gnl|my_center|LOCUS_06590 69642 70595 gene locus_tag LOCUS_06600 69642 70595 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529505.1 protein_id gnl|my_center|LOCUS_06600 70628 72028 gene locus_tag LOCUS_06610 70628 72028 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090693.1 protein_id gnl|my_center|LOCUS_06610 73084 72032 gene locus_tag LOCUS_06620 73084 72032 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263137.1 protein_id gnl|my_center|LOCUS_06620 73521 73228 gene locus_tag LOCUS_06630 73521 73228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 75216 73525 gene locus_tag LOCUS_06640 gene garD 75216 73525 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268905.1 protein_id gnl|my_center|LOCUS_06640 75199 75837 gene locus_tag LOCUS_06650 75199 75837 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078997.1 protein_id gnl|my_center|LOCUS_06650 75867 76052 gene locus_tag LOCUS_06660 75867 76052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 76960 76049 gene locus_tag LOCUS_06670 76960 76049 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247635.1 protein_id gnl|my_center|LOCUS_06670 77253 77744 gene locus_tag LOCUS_06680 77253 77744 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807412.1 protein_id gnl|my_center|LOCUS_06680 77764 78234 gene locus_tag LOCUS_06690 77764 78234 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929906.1 protein_id gnl|my_center|LOCUS_06690 79271 78240 gene locus_tag LOCUS_06700 79271 78240 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925756.1 protein_id gnl|my_center|LOCUS_06700 79808 79278 gene locus_tag LOCUS_06710 gene secB 79808 79278 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807422.1 protein_id gnl|my_center|LOCUS_06710 80127 79849 gene locus_tag LOCUS_06720 gene grxC 80127 79849 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929908.1 protein_id gnl|my_center|LOCUS_06720 80524 80138 gene locus_tag LOCUS_06730 80524 80138 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958278.1 protein_id gnl|my_center|LOCUS_06730 80622 81398 gene locus_tag LOCUS_06740 gene gpmA 80622 81398 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807430.1 protein_id gnl|my_center|LOCUS_06740 81400 82602 gene locus_tag LOCUS_06750 81400 82602 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038761.1 protein_id gnl|my_center|LOCUS_06750 82661 84076 gene locus_tag LOCUS_06760 gene cptA 82661 84076 CDS product protease CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446625.1 protein_id gnl|my_center|LOCUS_06760 84094 84846 gene locus_tag LOCUS_06770 gene moeB 84094 84846 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038762.1 protein_id gnl|my_center|LOCUS_06770 85611 84865 gene locus_tag LOCUS_06780 85611 84865 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815194.1 protein_id gnl|my_center|LOCUS_06780 86519 85623 gene locus_tag LOCUS_06790 gene argB 86519 85623 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815193.1 protein_id gnl|my_center|LOCUS_06790 87070 86579 gene locus_tag LOCUS_06800 87070 86579 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815191.1 protein_id gnl|my_center|LOCUS_06800 87873 87103 gene locus_tag LOCUS_06810 87873 87103 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815190.1 protein_id gnl|my_center|LOCUS_06810 88463 87870 gene locus_tag LOCUS_06820 88463 87870 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446211.1 protein_id gnl|my_center|LOCUS_06820 90375 88525 gene locus_tag LOCUS_06830 90375 88525 CDS product bifunctional anthranilate synthase component I family protein/class IV aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225844.1 protein_id gnl|my_center|LOCUS_06830 90556 91497 gene locus_tag LOCUS_06840 gene rsmI 90556 91497 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929780.1 protein_id gnl|my_center|LOCUS_06840 92367 91462 gene locus_tag LOCUS_06850 92367 91462 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929963.1 protein_id gnl|my_center|LOCUS_06850 93275 92364 gene locus_tag LOCUS_06860 gene rapZ 93275 92364 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815183.1 protein_id gnl|my_center|LOCUS_06860 94200 93268 gene locus_tag LOCUS_06870 gene hprK 94200 93268 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815180.1 protein_id gnl|my_center|LOCUS_06870 94702 94235 gene locus_tag LOCUS_06880 94702 94235 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929966.1 protein_id gnl|my_center|LOCUS_06880 95130 94804 gene locus_tag LOCUS_06890 gene raiA 95130 94804 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815178.1 protein_id gnl|my_center|LOCUS_06890 96015 95236 gene locus_tag LOCUS_06900 gene lptB 96015 95236 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815177.1 protein_id gnl|my_center|LOCUS_06900 96663 96028 gene locus_tag LOCUS_06910 gene lptA 96663 96028 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815175.1 protein_id gnl|my_center|LOCUS_06910 97274 96660 gene locus_tag LOCUS_06920 gene lptC 97274 96660 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815173.1 protein_id gnl|my_center|LOCUS_06920 97874 97281 gene locus_tag LOCUS_06930 97874 97281 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815172.1 protein_id gnl|my_center|LOCUS_06930 98857 97871 gene locus_tag LOCUS_06940 98857 97871 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815171.1 protein_id gnl|my_center|LOCUS_06940 98999 100156 gene locus_tag LOCUS_06950 gene purT 98999 100156 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929968.1 protein_id gnl|my_center|LOCUS_06950 101667 100153 gene locus_tag LOCUS_06960 gene ilvA 101667 100153 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_06960 101756 102211 gene locus_tag LOCUS_06970 101756 102211 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815154.1 protein_id gnl|my_center|LOCUS_06970 102349 106278 gene locus_tag LOCUS_06980 102349 106278 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815152.1 protein_id gnl|my_center|LOCUS_06980 107049 106282 gene locus_tag LOCUS_06990 107049 106282 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815133.1 protein_id gnl|my_center|LOCUS_06990 108072 107059 gene locus_tag LOCUS_07000 108072 107059 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815130.1 protein_id gnl|my_center|LOCUS_07000 108809 108075 gene locus_tag LOCUS_07010 gene pxpB 108809 108075 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815128.1 protein_id gnl|my_center|LOCUS_07010 110383 109025 gene locus_tag LOCUS_07020 gene phoR 110383 109025 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929655.1 protein_id gnl|my_center|LOCUS_07020 111081 110383 gene locus_tag LOCUS_07030 gene phoB 111081 110383 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_07030 111198 111977 gene locus_tag LOCUS_07040 gene ubiE 111198 111977 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815111.1 protein_id gnl|my_center|LOCUS_07040 112118 113035 gene locus_tag LOCUS_07050 112118 113035 CDS product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929656.1 protein_id gnl|my_center|LOCUS_07050 113181 113795 gene locus_tag LOCUS_07060 113181 113795 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853232.1 protein_id gnl|my_center|LOCUS_07060 113792 115339 gene locus_tag LOCUS_07070 gene ubiB 113792 115339 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929658.1 protein_id gnl|my_center|LOCUS_07070 115440 116300 gene locus_tag LOCUS_07080 115440 116300 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815103.1 protein_id gnl|my_center|LOCUS_07080 116334 116822 gene locus_tag LOCUS_07090 gene rfaE2 116334 116822 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815102.1 protein_id gnl|my_center|LOCUS_07090 118233 116848 gene locus_tag LOCUS_07100 118233 116848 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_07100 118935 118246 gene locus_tag LOCUS_07110 118935 118246 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815097.1 protein_id gnl|my_center|LOCUS_07110 119778 118948 gene locus_tag LOCUS_07120 gene thiD 119778 118948 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815096.1 protein_id gnl|my_center|LOCUS_07120 120607 119819 gene locus_tag LOCUS_07130 120607 119819 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931559.1 protein_id gnl|my_center|LOCUS_07130 121415 120621 gene locus_tag LOCUS_07140 121415 120621 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931558.1 protein_id gnl|my_center|LOCUS_07140 123317 121416 gene locus_tag LOCUS_07150 123317 121416 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815090.1 protein_id gnl|my_center|LOCUS_07150 123697 127470 gene locus_tag LOCUS_07160 gene metH 123697 127470 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064919.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence06 1500 187 gene locus_tag LOCUS_07170 1500 187 CDS product DUF3422 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530349.1 protein_id gnl|my_center|LOCUS_07170 1629 2231 gene locus_tag LOCUS_07180 1629 2231 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382851.1 protein_id gnl|my_center|LOCUS_07180 2325 3311 gene locus_tag LOCUS_07190 2325 3311 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969365.1 protein_id gnl|my_center|LOCUS_07190 3857 3297 gene locus_tag LOCUS_07200 3857 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 4611 3883 gene locus_tag LOCUS_07210 4611 3883 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925340.1 protein_id gnl|my_center|LOCUS_07210 6880 4637 gene locus_tag LOCUS_07220 gene rpoD 6880 4637 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930783.1 protein_id gnl|my_center|LOCUS_07220 6852 7193 gene locus_tag LOCUS_07230 6852 7193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 9701 7770 gene locus_tag LOCUS_07240 gene dnaG 9701 7770 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063924.1 protein_id gnl|my_center|LOCUS_07240 9950 9738 gene locus_tag LOCUS_07250 gene rpsU 9950 9738 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006218592.1 protein_id gnl|my_center|LOCUS_07250 10623 10087 gene locus_tag LOCUS_07260 10623 10087 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527158.1 protein_id gnl|my_center|LOCUS_07260 11935 10640 gene locus_tag LOCUS_07270 11935 10640 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852902.1 protein_id gnl|my_center|LOCUS_07270 13135 11945 gene locus_tag LOCUS_07280 13135 11945 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063927.1 protein_id gnl|my_center|LOCUS_07280 14134 13259 gene locus_tag LOCUS_07290 gene hflC 14134 13259 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063928.1 protein_id gnl|my_center|LOCUS_07290 15490 14144 gene locus_tag LOCUS_07300 gene hflK 15490 14144 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928767.1 protein_id gnl|my_center|LOCUS_07300 16571 15465 gene locus_tag LOCUS_07310 gene hflX 16571 15465 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447752.1 protein_id gnl|my_center|LOCUS_07310 16841 16605 gene locus_tag LOCUS_07320 gene hfq 16841 16605 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810707.1 protein_id gnl|my_center|LOCUS_07320 18064 16991 gene locus_tag LOCUS_07330 gene hisC 18064 16991 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040076.1 protein_id gnl|my_center|LOCUS_07330 19438 18071 gene locus_tag LOCUS_07340 gene der 19438 18071 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063931.1 protein_id gnl|my_center|LOCUS_07340 20603 19443 gene locus_tag LOCUS_07350 gene bamB 20603 19443 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810701.1 protein_id gnl|my_center|LOCUS_07350 21247 20615 gene locus_tag LOCUS_07360 21247 20615 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930791.1 protein_id gnl|my_center|LOCUS_07360 22568 21252 gene locus_tag LOCUS_07370 gene hisS 22568 21252 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926751.1 protein_id gnl|my_center|LOCUS_07370 23888 22584 gene locus_tag LOCUS_07380 gene ispG 23888 22584 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 protein_id gnl|my_center|LOCUS_07380 24375 23878 gene locus_tag LOCUS_07390 24375 23878 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810693.1 protein_id gnl|my_center|LOCUS_07390 25544 24372 gene locus_tag LOCUS_07400 gene rlmN 25544 24372 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568542.1 protein_id gnl|my_center|LOCUS_07400 26039 25614 gene locus_tag LOCUS_07410 gene ndk 26039 25614 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810689.1 protein_id gnl|my_center|LOCUS_07410 26208 29090 gene locus_tag LOCUS_07420 26208 29090 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063937.1 protein_id gnl|my_center|LOCUS_07420 29848 29099 gene locus_tag LOCUS_07430 gene trmD 29848 29099 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063943.1 protein_id gnl|my_center|LOCUS_07430 30295 29972 gene locus_tag LOCUS_07440 30295 29972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 30732 30310 gene locus_tag LOCUS_07450 30732 30310 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819794.1 protein_id gnl|my_center|LOCUS_07450 31049 30732 gene locus_tag LOCUS_07460 31049 30732 CDS product DUF883 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809432.1 protein_id gnl|my_center|LOCUS_07460 31828 31166 gene locus_tag LOCUS_07470 gene rimM 31828 31166 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063944.1 protein_id gnl|my_center|LOCUS_07470 32110 31856 gene locus_tag LOCUS_07480 gene rpsP 32110 31856 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926757.1 protein_id gnl|my_center|LOCUS_07480 32420 32172 gene locus_tag LOCUS_07490 32420 32172 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568544.1 protein_id gnl|my_center|LOCUS_07490 35107 32426 gene locus_tag LOCUS_07500 gene alaS 35107 32426 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810664.1 protein_id gnl|my_center|LOCUS_07500 36029 35082 gene locus_tag LOCUS_07510 36029 35082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 36784 36095 gene locus_tag LOCUS_07520 36784 36095 CDS product type 4 pilus major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063949.1 protein_id gnl|my_center|LOCUS_07520 36947 36753 gene locus_tag LOCUS_07530 36947 36753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 38105 36972 gene locus_tag LOCUS_07540 38105 36972 CDS product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040085.1 protein_id gnl|my_center|LOCUS_07540 39826 38102 gene locus_tag LOCUS_07550 39826 38102 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063951.1 protein_id gnl|my_center|LOCUS_07550 40251 39823 gene locus_tag LOCUS_07560 40251 39823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 41569 40238 gene locus_tag LOCUS_07570 41569 40238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 43163 41559 gene locus_tag LOCUS_07580 43163 41559 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063954.1 protein_id gnl|my_center|LOCUS_07580 43885 43160 gene locus_tag LOCUS_07590 43885 43160 CDS product TcpQ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063955.1 protein_id gnl|my_center|LOCUS_07590 45324 44035 gene locus_tag LOCUS_07600 45324 44035 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063960.1 protein_id gnl|my_center|LOCUS_07600 46631 45375 gene locus_tag LOCUS_07610 46631 45375 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063961.1 protein_id gnl|my_center|LOCUS_07610 47726 46683 gene locus_tag LOCUS_07620 47726 46683 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930577.1 protein_id gnl|my_center|LOCUS_07620 50089 47768 gene locus_tag LOCUS_07630 gene parC 50089 47768 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930281.1 protein_id gnl|my_center|LOCUS_07630 52095 50131 gene locus_tag LOCUS_07640 52095 50131 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033451799.1 protein_id gnl|my_center|LOCUS_07640 52432 52758 gene locus_tag LOCUS_07650 gene trxA 52432 52758 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852918.1 protein_id gnl|my_center|LOCUS_07650 52850 54106 gene locus_tag LOCUS_07660 gene rho 52850 54106 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810577.1 protein_id gnl|my_center|LOCUS_07660 57776 54114 gene locus_tag LOCUS_07670 57776 54114 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926768.1 protein_id gnl|my_center|LOCUS_07670 57887 60712 gene locus_tag LOCUS_07680 gene glnE 57887 60712 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810574.1 protein_id gnl|my_center|LOCUS_07680 61102 60746 gene locus_tag LOCUS_07690 61102 60746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 62403 61117 gene locus_tag LOCUS_07700 62403 61117 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390060.1 protein_id gnl|my_center|LOCUS_07700 62675 63232 gene locus_tag LOCUS_07710 62675 63232 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810571.1 protein_id gnl|my_center|LOCUS_07710 64080 63208 gene locus_tag LOCUS_07720 64080 63208 CDS product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853020.1 protein_id gnl|my_center|LOCUS_07720 64022 64477 gene locus_tag LOCUS_07730 64022 64477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 65392 64385 gene locus_tag LOCUS_07740 65392 64385 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814720.1 protein_id gnl|my_center|LOCUS_07740 68191 65603 gene locus_tag LOCUS_07750 gene clpB 68191 65603 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818587.1 protein_id gnl|my_center|LOCUS_07750 68353 69225 gene locus_tag LOCUS_07760 68353 69225 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266649.1 protein_id gnl|my_center|LOCUS_07760 69372 70049 gene locus_tag LOCUS_07770 gene btr 69372 70049 CDS product oxygen-responsive transcriptional regulator Btr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930241.1 protein_id gnl|my_center|LOCUS_07770 70609 70037 gene locus_tag LOCUS_07780 70609 70037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07780 71044 70619 gene locus_tag LOCUS_07790 71044 70619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07790 71615 71049 gene locus_tag LOCUS_07800 71615 71049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07800 71888 71640 gene locus_tag LOCUS_07810 71888 71640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07810 72200 71919 gene locus_tag LOCUS_07820 72200 71919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07820 72578 72330 gene locus_tag LOCUS_07830 72578 72330 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930778.1 protein_id gnl|my_center|LOCUS_07830 72800 72591 gene locus_tag LOCUS_07840 72800 72591 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810390.1 protein_id gnl|my_center|LOCUS_07840 74314 72812 gene locus_tag LOCUS_07850 gene ccoG 74314 72812 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 protein_id gnl|my_center|LOCUS_07850 75314 74364 gene locus_tag LOCUS_07860 gene ccoP 75314 74364 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930775.1 protein_id gnl|my_center|LOCUS_07860 75493 75311 gene locus_tag LOCUS_07870 75493 75311 CDS product cytochrome oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818560.1 protein_id gnl|my_center|LOCUS_07870 76172 75495 gene locus_tag LOCUS_07880 gene ccoO 76172 75495 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810383.1 protein_id gnl|my_center|LOCUS_07880 77591 76188 gene locus_tag LOCUS_07890 gene ccoN 77591 76188 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063997.1 protein_id gnl|my_center|LOCUS_07890 78925 77963 gene locus_tag LOCUS_07900 78925 77963 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818557.1 protein_id gnl|my_center|LOCUS_07900 80442 79138 gene locus_tag LOCUS_07910 gene aceA 80442 79138 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810362.1 protein_id gnl|my_center|LOCUS_07910 80725 81579 gene locus_tag LOCUS_07920 gene queF 80725 81579 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930727.1 protein_id gnl|my_center|LOCUS_07920 82834 81551 gene locus_tag LOCUS_07930 82834 81551 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810358.1 protein_id gnl|my_center|LOCUS_07930 83423 82854 gene locus_tag LOCUS_07940 gene pgsA 83423 82854 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810356.1 protein_id gnl|my_center|LOCUS_07940 85381 83498 gene locus_tag LOCUS_07950 gene uvrC 85381 83498 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449735.1 protein_id gnl|my_center|LOCUS_07950 86429 85362 gene locus_tag LOCUS_07960 gene nagZ 86429 85362 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810348.1 protein_id gnl|my_center|LOCUS_07960 87196 86426 gene locus_tag LOCUS_07970 gene pdxJ 87196 86426 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810344.1 protein_id gnl|my_center|LOCUS_07970 88704 87193 gene locus_tag LOCUS_07980 88704 87193 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810342.1 protein_id gnl|my_center|LOCUS_07980 91862 88701 gene locus_tag LOCUS_07990 91862 88701 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810340.1 protein_id gnl|my_center|LOCUS_07990 93039 91897 gene locus_tag LOCUS_08000 93039 91897 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810338.1 protein_id gnl|my_center|LOCUS_08000 93641 93060 gene locus_tag LOCUS_08010 93641 93060 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810329.1 protein_id gnl|my_center|LOCUS_08010 95249 93708 gene locus_tag LOCUS_08020 95249 93708 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064005.1 protein_id gnl|my_center|LOCUS_08020 96067 95339 gene locus_tag LOCUS_08030 96067 95339 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930714.1 protein_id gnl|my_center|LOCUS_08030 96344 96619 gene locus_tag LOCUS_08040 96344 96619 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818624.1 protein_id gnl|my_center|LOCUS_08040 96797 98539 gene locus_tag LOCUS_08050 96797 98539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040117.1 protein_id gnl|my_center|LOCUS_08050 98536 99942 gene locus_tag LOCUS_08060 98536 99942 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930260.1 protein_id gnl|my_center|LOCUS_08060 100585 99935 gene locus_tag LOCUS_08070 gene orn 100585 99935 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813303.1 protein_id gnl|my_center|LOCUS_08070 100669 101922 gene locus_tag LOCUS_08080 100669 101922 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813306.1 protein_id gnl|my_center|LOCUS_08080 101919 102821 gene locus_tag LOCUS_08090 gene rsgA 101919 102821 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813309.1 protein_id gnl|my_center|LOCUS_08090 103438 102779 gene locus_tag LOCUS_08100 103438 102779 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813314.1 protein_id gnl|my_center|LOCUS_08100 104125 103751 gene locus_tag LOCUS_08110 gene rplS 104125 103751 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189360.1 protein_id gnl|my_center|LOCUS_08110 104519 104358 gene locus_tag LOCUS_08120 104519 104358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 105424 104678 gene locus_tag LOCUS_08130 gene mtgA 105424 104678 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814960.1 protein_id gnl|my_center|LOCUS_08130 105977 105417 gene locus_tag LOCUS_08140 105977 105417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 105946 106893 gene locus_tag LOCUS_08150 105946 106893 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390999.1 protein_id gnl|my_center|LOCUS_08150 107157 107396 gene locus_tag LOCUS_08160 107157 107396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 >Feature sequence07 361 182 gene locus_tag LOCUS_08170 361 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 831 469 gene locus_tag LOCUS_08180 831 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 1108 815 gene locus_tag LOCUS_08190 1108 815 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045668639.1 protein_id gnl|my_center|LOCUS_08190 1356 1281 gene locus_tag LOCUS_t00110 1356 1281 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3509 1488 gene locus_tag LOCUS_08200 3509 1488 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814547.1 protein_id gnl|my_center|LOCUS_08200 3480 3644 gene locus_tag LOCUS_08210 3480 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 5018 3882 gene locus_tag LOCUS_08220 5018 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 5109 5957 gene locus_tag LOCUS_08230 5109 5957 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814549.1 protein_id gnl|my_center|LOCUS_08230 7661 6000 gene locus_tag LOCUS_08240 7661 6000 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927068.1 protein_id gnl|my_center|LOCUS_08240 7762 8967 gene locus_tag LOCUS_08250 7762 8967 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814551.1 protein_id gnl|my_center|LOCUS_08250 9010 10491 gene locus_tag LOCUS_08260 gene mgtE 9010 10491 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814555.1 protein_id gnl|my_center|LOCUS_08260 11555 10494 gene locus_tag LOCUS_08270 gene ydiK 11555 10494 CDS product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211812.1 protein_id gnl|my_center|LOCUS_08270 11733 12656 gene locus_tag LOCUS_08280 gene ppk2 11733 12656 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965809.1 protein_id gnl|my_center|LOCUS_08280 12848 14530 gene locus_tag LOCUS_08290 12848 14530 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543612.1 protein_id gnl|my_center|LOCUS_08290 14577 15353 gene locus_tag LOCUS_08300 14577 15353 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727762.1 protein_id gnl|my_center|LOCUS_08300 15487 17274 gene locus_tag LOCUS_08310 15487 17274 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_08310 17368 18144 gene locus_tag LOCUS_08320 17368 18144 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195806.1 protein_id gnl|my_center|LOCUS_08320 18223 18936 gene locus_tag LOCUS_08330 18223 18936 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813858.1 protein_id gnl|my_center|LOCUS_08330 18983 20197 gene locus_tag LOCUS_08340 18983 20197 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185183.1 protein_id gnl|my_center|LOCUS_08340 20221 21135 gene locus_tag LOCUS_08350 20221 21135 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813860.1 protein_id gnl|my_center|LOCUS_08350 21227 22126 gene locus_tag LOCUS_08360 21227 22126 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313874.1 protein_id gnl|my_center|LOCUS_08360 22166 23038 gene locus_tag LOCUS_08370 22166 23038 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931500.1 protein_id gnl|my_center|LOCUS_08370 23124 24152 gene locus_tag LOCUS_08380 23124 24152 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929634.1 protein_id gnl|my_center|LOCUS_08380 24169 25449 gene locus_tag LOCUS_08390 24169 25449 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815926.1 protein_id gnl|my_center|LOCUS_08390 25534 26403 gene locus_tag LOCUS_08400 25534 26403 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815927.1 protein_id gnl|my_center|LOCUS_08400 26400 27245 gene locus_tag LOCUS_08410 26400 27245 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815929.1 protein_id gnl|my_center|LOCUS_08410 27256 28131 gene locus_tag LOCUS_08420 27256 28131 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192869.1 protein_id gnl|my_center|LOCUS_08420 28646 28209 gene locus_tag LOCUS_08430 28646 28209 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257301.1 protein_id gnl|my_center|LOCUS_08430 29350 28709 gene locus_tag LOCUS_08440 29350 28709 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809621.1 protein_id gnl|my_center|LOCUS_08440 29963 29754 gene locus_tag LOCUS_08450 29963 29754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 30555 30079 gene locus_tag LOCUS_08460 gene greA 30555 30079 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809615.1 protein_id gnl|my_center|LOCUS_08460 32433 30709 gene locus_tag LOCUS_08470 32433 30709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 33385 32648 gene locus_tag LOCUS_08480 33385 32648 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810083.1 protein_id gnl|my_center|LOCUS_08480 34218 33382 gene locus_tag LOCUS_08490 34218 33382 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810082.1 protein_id gnl|my_center|LOCUS_08490 36095 34215 gene locus_tag LOCUS_08500 36095 34215 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810078.1 protein_id gnl|my_center|LOCUS_08500 37375 36164 gene locus_tag LOCUS_08510 37375 36164 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930653.1 protein_id gnl|my_center|LOCUS_08510 37596 38369 gene locus_tag LOCUS_08520 37596 38369 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811187.1 protein_id gnl|my_center|LOCUS_08520 38366 39007 gene locus_tag LOCUS_08530 38366 39007 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393242.1 protein_id gnl|my_center|LOCUS_08530 39084 39743 gene locus_tag LOCUS_08540 39084 39743 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809593.1 protein_id gnl|my_center|LOCUS_08540 40551 39781 gene locus_tag LOCUS_08550 40551 39781 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809590.1 protein_id gnl|my_center|LOCUS_08550 43811 40569 gene locus_tag LOCUS_08560 gene carB 43811 40569 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809588.1 protein_id gnl|my_center|LOCUS_08560 45024 43819 gene locus_tag LOCUS_08570 gene carA 45024 43819 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076879800.1 protein_id gnl|my_center|LOCUS_08570 45047 46006 gene locus_tag LOCUS_08580 gene tal 45047 46006 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926156.1 protein_id gnl|my_center|LOCUS_08580 46018 46266 gene locus_tag LOCUS_08590 46018 46266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 46350 47243 gene locus_tag LOCUS_08600 gene mmsB 46350 47243 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811743.1 protein_id gnl|my_center|LOCUS_08600 47787 47272 gene locus_tag LOCUS_08610 gene recR 47787 47272 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930424.1 protein_id gnl|my_center|LOCUS_08610 47701 47886 gene locus_tag LOCUS_08620 47701 47886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 48209 47883 gene locus_tag LOCUS_08630 48209 47883 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809572.1 protein_id gnl|my_center|LOCUS_08630 50007 48259 gene locus_tag LOCUS_08640 50007 48259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 53510 50205 gene locus_tag LOCUS_08650 53510 50205 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040290.1 protein_id gnl|my_center|LOCUS_08650 56142 53503 gene locus_tag LOCUS_08660 56142 53503 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930420.1 protein_id gnl|my_center|LOCUS_08660 56313 56146 gene locus_tag LOCUS_08670 56313 56146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 57545 56337 gene locus_tag LOCUS_08680 57545 56337 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809565.1 protein_id gnl|my_center|LOCUS_08680 57782 57707 gene locus_tag LOCUS_t00120 57782 57707 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 58783 57878 gene locus_tag LOCUS_08690 gene xerD 58783 57878 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809554.1 protein_id gnl|my_center|LOCUS_08690 58895 59788 gene locus_tag LOCUS_08700 58895 59788 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065020.1 protein_id gnl|my_center|LOCUS_08700 59822 60334 gene locus_tag LOCUS_08710 59822 60334 CDS product bifunctional alanine racemase/tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929706.1 protein_id gnl|my_center|LOCUS_08710 60334 61668 gene locus_tag LOCUS_08720 60334 61668 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247543.1 protein_id gnl|my_center|LOCUS_08720 61730 63586 gene locus_tag LOCUS_08730 gene mutL 61730 63586 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039151.1 protein_id gnl|my_center|LOCUS_08730 63583 64524 gene locus_tag LOCUS_08740 gene miaA 63583 64524 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065014.1 protein_id gnl|my_center|LOCUS_08740 65581 64532 gene locus_tag LOCUS_08750 gene purM 65581 64532 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065013.1 protein_id gnl|my_center|LOCUS_08750 65701 66396 gene locus_tag LOCUS_08760 gene hda 65701 66396 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065012.1 protein_id gnl|my_center|LOCUS_08760 66393 67091 gene locus_tag LOCUS_08770 66393 67091 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820913.1 protein_id gnl|my_center|LOCUS_08770 67091 68485 gene locus_tag LOCUS_08780 gene pcnB 67091 68485 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929702.1 protein_id gnl|my_center|LOCUS_08780 68482 68961 gene locus_tag LOCUS_08790 68482 68961 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814348.1 protein_id gnl|my_center|LOCUS_08790 70154 68958 gene locus_tag LOCUS_08800 70154 68958 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064994.1 protein_id gnl|my_center|LOCUS_08800 70978 70151 gene locus_tag LOCUS_08810 70978 70151 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064993.1 protein_id gnl|my_center|LOCUS_08810 72116 70998 gene locus_tag LOCUS_08820 72116 70998 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815676.1 protein_id gnl|my_center|LOCUS_08820 73342 72152 gene locus_tag LOCUS_08830 73342 72152 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929936.1 protein_id gnl|my_center|LOCUS_08830 73572 74486 gene locus_tag LOCUS_08840 73572 74486 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 protein_id gnl|my_center|LOCUS_08840 74528 75730 gene locus_tag LOCUS_08850 74528 75730 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817791.1 protein_id gnl|my_center|LOCUS_08850 77368 75848 gene locus_tag LOCUS_08860 77368 75848 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064992.1 protein_id gnl|my_center|LOCUS_08860 78219 77446 gene locus_tag LOCUS_08870 78219 77446 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820893.1 protein_id gnl|my_center|LOCUS_08870 78409 79335 gene locus_tag LOCUS_08880 gene glyQ 78409 79335 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929585.1 protein_id gnl|my_center|LOCUS_08880 79332 81467 gene locus_tag LOCUS_08890 gene glyS 79332 81467 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929586.1 protein_id gnl|my_center|LOCUS_08890 81464 82012 gene locus_tag LOCUS_08900 gene gmhB 81464 82012 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814404.1 protein_id gnl|my_center|LOCUS_08900 82009 82728 gene locus_tag LOCUS_08910 82009 82728 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064981.1 protein_id gnl|my_center|LOCUS_08910 82765 83586 gene locus_tag LOCUS_08920 82765 83586 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929587.1 protein_id gnl|my_center|LOCUS_08920 83619 84008 gene locus_tag LOCUS_08930 gene gloA 83619 84008 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216418.1 protein_id gnl|my_center|LOCUS_08930 84032 85261 gene locus_tag LOCUS_08940 84032 85261 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929184.1 protein_id gnl|my_center|LOCUS_08940 85240 86415 gene locus_tag LOCUS_08950 85240 86415 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064976.1 protein_id gnl|my_center|LOCUS_08950 87175 86378 gene locus_tag LOCUS_08960 gene rsmA 87175 86378 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814423.1 protein_id gnl|my_center|LOCUS_08960 88647 87172 gene locus_tag LOCUS_08970 88647 87172 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814426.1 protein_id gnl|my_center|LOCUS_08970 90947 88647 gene locus_tag LOCUS_08980 90947 88647 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814429.1 protein_id gnl|my_center|LOCUS_08980 91104 92150 gene locus_tag LOCUS_08990 91104 92150 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929187.1 protein_id gnl|my_center|LOCUS_08990 92162 92842 gene locus_tag LOCUS_09000 92162 92842 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039134.1 protein_id gnl|my_center|LOCUS_09000 92975 93706 gene locus_tag LOCUS_09010 92975 93706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064973.1 protein_id gnl|my_center|LOCUS_09010 94492 93728 gene locus_tag LOCUS_09020 94492 93728 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969919.1 protein_id gnl|my_center|LOCUS_09020 95235 94507 gene locus_tag LOCUS_09030 95235 94507 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339314.1 protein_id gnl|my_center|LOCUS_09030 96221 95250 gene locus_tag LOCUS_09040 96221 95250 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815555.1 protein_id gnl|my_center|LOCUS_09040 97285 96266 gene locus_tag LOCUS_09050 97285 96266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 97446 98516 gene locus_tag LOCUS_09060 97446 98516 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267493.1 protein_id gnl|my_center|LOCUS_09060 98513 101578 gene locus_tag LOCUS_09070 98513 101578 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973652.1 protein_id gnl|my_center|LOCUS_09070 101636 102079 gene locus_tag LOCUS_09080 101636 102079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 102076 102528 gene locus_tag LOCUS_09090 102076 102528 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479700.1 protein_id gnl|my_center|LOCUS_09090 102525 103205 gene locus_tag LOCUS_09100 102525 103205 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 protein_id gnl|my_center|LOCUS_09100 103538 103227 gene locus_tag LOCUS_09110 103538 103227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 103753 103535 gene locus_tag LOCUS_09120 103753 103535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence08 1203 667 gene locus_tag LOCUS_09130 gene msrA 1203 667 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814600.1 protein_id gnl|my_center|LOCUS_09130 1572 1222 gene locus_tag LOCUS_09140 1572 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 3241 1556 gene locus_tag LOCUS_09150 gene ilvD 3241 1556 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814604.1 protein_id gnl|my_center|LOCUS_09150 3329 4123 gene locus_tag LOCUS_09160 gene lgt 3329 4123 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814606.1 protein_id gnl|my_center|LOCUS_09160 4615 4319 gene locus_tag LOCUS_09170 4615 4319 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814611.1 protein_id gnl|my_center|LOCUS_09170 5130 4615 gene locus_tag LOCUS_09180 5130 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 5129 6037 gene locus_tag LOCUS_09190 5129 6037 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814620.1 protein_id gnl|my_center|LOCUS_09190 6559 6011 gene locus_tag LOCUS_09200 6559 6011 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814635.1 protein_id gnl|my_center|LOCUS_09200 6645 8399 gene locus_tag LOCUS_09210 6645 8399 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814636.1 protein_id gnl|my_center|LOCUS_09210 8380 8850 gene locus_tag LOCUS_09220 gene ybgC 8380 8850 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527641.1 protein_id gnl|my_center|LOCUS_09220 8829 9500 gene locus_tag LOCUS_09230 gene tolQ 8829 9500 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814641.1 protein_id gnl|my_center|LOCUS_09230 9551 9964 gene locus_tag LOCUS_09240 gene tolR 9551 9964 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 protein_id gnl|my_center|LOCUS_09240 9964 11196 gene locus_tag LOCUS_09250 9964 11196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 11217 12512 gene locus_tag LOCUS_09260 gene tolB 11217 12512 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931417.1 protein_id gnl|my_center|LOCUS_09260 12554 13057 gene locus_tag LOCUS_09270 gene pal 12554 13057 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814650.1 protein_id gnl|my_center|LOCUS_09270 13076 13738 gene locus_tag LOCUS_09280 gene ybgF 13076 13738 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814652.1 protein_id gnl|my_center|LOCUS_09280 14657 13743 gene locus_tag LOCUS_09290 14657 13743 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083045.1 protein_id gnl|my_center|LOCUS_09290 16466 14808 gene locus_tag LOCUS_09300 gene groL 16466 14808 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808619.1 protein_id gnl|my_center|LOCUS_09300 16782 16495 gene locus_tag LOCUS_09310 gene groES 16782 16495 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808621.1 protein_id gnl|my_center|LOCUS_09310 17781 16984 gene locus_tag LOCUS_09320 17781 16984 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925927.1 protein_id gnl|my_center|LOCUS_09320 18174 17800 gene locus_tag LOCUS_09330 18174 17800 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926797.1 protein_id gnl|my_center|LOCUS_09330 18324 18713 gene locus_tag LOCUS_09340 18324 18713 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808610.1 protein_id gnl|my_center|LOCUS_09340 18713 19534 gene locus_tag LOCUS_09350 gene pyrF 18713 19534 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808606.1 protein_id gnl|my_center|LOCUS_09350 20046 19531 gene locus_tag LOCUS_09360 20046 19531 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808604.1 protein_id gnl|my_center|LOCUS_09360 20483 20055 gene locus_tag LOCUS_09370 20483 20055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 21574 20588 gene locus_tag LOCUS_09380 gene thiL 21574 20588 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931503.1 protein_id gnl|my_center|LOCUS_09380 22093 21587 gene locus_tag LOCUS_09390 gene nusB 22093 21587 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808599.1 protein_id gnl|my_center|LOCUS_09390 22587 22090 gene locus_tag LOCUS_09400 gene ribH 22587 22090 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039074.1 protein_id gnl|my_center|LOCUS_09400 23780 22584 gene locus_tag LOCUS_09410 gene ribBA 23780 22584 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808597.1 protein_id gnl|my_center|LOCUS_09410 23948 25507 gene locus_tag LOCUS_09420 23948 25507 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925999.1 protein_id gnl|my_center|LOCUS_09420 26592 25504 gene locus_tag LOCUS_09430 gene ftsY 26592 25504 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853086.1 protein_id gnl|my_center|LOCUS_09430 26594 27154 gene locus_tag LOCUS_09440 gene rsmD 26594 27154 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808577.1 protein_id gnl|my_center|LOCUS_09440 27151 27660 gene locus_tag LOCUS_09450 gene coaD 27151 27660 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808574.1 protein_id gnl|my_center|LOCUS_09450 27691 27954 gene locus_tag LOCUS_09460 27691 27954 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808570.1 protein_id gnl|my_center|LOCUS_09460 28358 27975 gene locus_tag LOCUS_09470 28358 27975 CDS product MOSC N-terminal beta barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808567.1 protein_id gnl|my_center|LOCUS_09470 29375 28398 gene locus_tag LOCUS_09480 29375 28398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 30241 29384 gene locus_tag LOCUS_09490 30241 29384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 32012 30234 gene locus_tag LOCUS_09500 32012 30234 CDS product glucan ABC transporter ATP-binding protein/ permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084139.1 protein_id gnl|my_center|LOCUS_09500 33779 32016 gene locus_tag LOCUS_09510 gene mdoH 33779 32016 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038607.1 protein_id gnl|my_center|LOCUS_09510 33976 34968 gene locus_tag LOCUS_09520 33976 34968 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230079.1 protein_id gnl|my_center|LOCUS_09520 34978 35379 gene locus_tag LOCUS_09530 34978 35379 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230078.1 protein_id gnl|my_center|LOCUS_09530 35373 36452 gene locus_tag LOCUS_09540 35373 36452 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256070.1 protein_id gnl|my_center|LOCUS_09540 37103 36429 gene locus_tag LOCUS_09550 37103 36429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 37265 38413 gene locus_tag LOCUS_09560 gene ribA 37265 38413 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391384.1 protein_id gnl|my_center|LOCUS_09560 38680 39030 gene locus_tag LOCUS_09570 38680 39030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 41157 39571 gene locus_tag LOCUS_09580 gene ahpF 41157 39571 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389171.1 protein_id gnl|my_center|LOCUS_09580 41870 41295 gene locus_tag LOCUS_09590 gene ahpC 41870 41295 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083828.1 protein_id gnl|my_center|LOCUS_09590 43566 42475 gene locus_tag LOCUS_09600 gene ychF 43566 42475 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039054.1 protein_id gnl|my_center|LOCUS_09600 44380 43637 gene locus_tag LOCUS_09610 44380 43637 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064479.1 protein_id gnl|my_center|LOCUS_09610 44921 44397 gene locus_tag LOCUS_09620 gene pth 44921 44397 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931308.1 protein_id gnl|my_center|LOCUS_09620 45744 45130 gene locus_tag LOCUS_09630 45744 45130 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808505.1 protein_id gnl|my_center|LOCUS_09630 46884 45880 gene locus_tag LOCUS_09640 46884 45880 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_09640 46983 46907 gene locus_tag LOCUS_t00130 46983 46907 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 47902 46985 gene locus_tag LOCUS_09650 gene ispE 47902 46985 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039050.1 protein_id gnl|my_center|LOCUS_09650 48487 47918 gene locus_tag LOCUS_09660 gene lolB 48487 47918 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818921.1 protein_id gnl|my_center|LOCUS_09660 50280 48484 gene locus_tag LOCUS_09670 50280 48484 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808496.1 protein_id gnl|my_center|LOCUS_09670 50380 51219 gene locus_tag LOCUS_09680 gene mutM 50380 51219 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925978.1 protein_id gnl|my_center|LOCUS_09680 52618 51209 gene locus_tag LOCUS_09690 52618 51209 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931317.1 protein_id gnl|my_center|LOCUS_09690 52776 54161 gene locus_tag LOCUS_09700 52776 54161 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808464.1 protein_id gnl|my_center|LOCUS_09700 54176 55729 gene locus_tag LOCUS_09710 gene pgi 54176 55729 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039040.1 protein_id gnl|my_center|LOCUS_09710 56398 55736 gene locus_tag LOCUS_09720 56398 55736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 57090 56734 gene locus_tag LOCUS_09730 57090 56734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 57982 57311 gene locus_tag LOCUS_09740 gene coq7 57982 57311 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064484.1 protein_id gnl|my_center|LOCUS_09740 58289 58732 gene locus_tag LOCUS_09750 58289 58732 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808444.1 protein_id gnl|my_center|LOCUS_09750 58738 59532 gene locus_tag LOCUS_09760 58738 59532 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776901.1 protein_id gnl|my_center|LOCUS_09760 59529 60014 gene locus_tag LOCUS_09770 59529 60014 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816386.1 protein_id gnl|my_center|LOCUS_09770 62887 60011 gene locus_tag LOCUS_09780 gene gcvP 62887 60011 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929677.1 protein_id gnl|my_center|LOCUS_09780 63271 62891 gene locus_tag LOCUS_09790 gene gcvH 63271 62891 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929676.1 protein_id gnl|my_center|LOCUS_09790 64401 63310 gene locus_tag LOCUS_09800 gene gcvT 64401 63310 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808404.1 protein_id gnl|my_center|LOCUS_09800 66014 64809 gene locus_tag LOCUS_09810 66014 64809 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929672.1 protein_id gnl|my_center|LOCUS_09810 68282 66021 gene locus_tag LOCUS_09820 68282 66021 CDS product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808393.1 protein_id gnl|my_center|LOCUS_09820 68887 68324 gene locus_tag LOCUS_09830 gene dcd 68887 68324 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808382.1 protein_id gnl|my_center|LOCUS_09830 70044 68956 gene locus_tag LOCUS_09840 gene apbC 70044 68956 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448044.1 protein_id gnl|my_center|LOCUS_09840 70114 70389 gene locus_tag LOCUS_09850 70114 70389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 70456 72522 gene locus_tag LOCUS_09860 gene metG 70456 72522 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064494.1 protein_id gnl|my_center|LOCUS_09860 73306 72560 gene locus_tag LOCUS_09870 73306 72560 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039013.1 protein_id gnl|my_center|LOCUS_09870 74580 73321 gene locus_tag LOCUS_09880 gene kch 74580 73321 CDS product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807739.1 protein_id gnl|my_center|LOCUS_09880 75203 75883 gene locus_tag LOCUS_09890 75203 75883 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038231.1 protein_id gnl|my_center|LOCUS_09890 75876 76802 gene locus_tag LOCUS_09900 75876 76802 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038232.1 protein_id gnl|my_center|LOCUS_09900 76998 76925 gene locus_tag LOCUS_t00140 76998 76925 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 77065 77265 gene locus_tag LOCUS_09910 gene thiS 77065 77265 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432400.1 protein_id gnl|my_center|LOCUS_09910 77265 77945 gene locus_tag LOCUS_09920 gene trmB 77265 77945 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931594.1 protein_id gnl|my_center|LOCUS_09920 79354 77942 gene locus_tag LOCUS_09930 gene ffh 79354 77942 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929607.1 protein_id gnl|my_center|LOCUS_09930 79381 80235 gene locus_tag LOCUS_09940 gene ccsA 79381 80235 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929606.1 protein_id gnl|my_center|LOCUS_09940 80238 80495 gene locus_tag LOCUS_09950 80238 80495 CDS product PP0621 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807805.1 protein_id gnl|my_center|LOCUS_09950 80503 81084 gene locus_tag LOCUS_09960 gene ampD 80503 81084 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112844.1 protein_id gnl|my_center|LOCUS_09960 82998 81091 gene locus_tag LOCUS_09970 gene htpG 82998 81091 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038845.1 protein_id gnl|my_center|LOCUS_09970 83194 83278 gene locus_tag LOCUS_t00150 83194 83278 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 83454 84443 gene locus_tag LOCUS_09980 gene rhuM 83454 84443 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_09980 84891 85043 gene locus_tag LOCUS_09990 84891 85043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 85285 85058 gene locus_tag LOCUS_10000 85285 85058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 85445 85696 gene locus_tag LOCUS_10010 85445 85696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 86433 85714 gene locus_tag LOCUS_10020 86433 85714 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_10020 87739 86423 gene locus_tag LOCUS_10030 87739 86423 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_10030 87967 88644 gene locus_tag LOCUS_10040 gene virB5 87967 88644 CDS product P-type DNA transfer protein VirB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042067.1 protein_id gnl|my_center|LOCUS_10040 88656 89633 gene locus_tag LOCUS_10050 88656 89633 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042069.1 protein_id gnl|my_center|LOCUS_10050 89736 89936 gene locus_tag LOCUS_10060 89736 89936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 90354 91043 gene locus_tag LOCUS_10070 90354 91043 CDS product virB8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974428.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence09 3580 335 gene locus_tag LOCUS_10080 3580 335 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948214.1 protein_id gnl|my_center|LOCUS_10080 4860 3706 gene locus_tag LOCUS_10090 4860 3706 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967657.1 protein_id gnl|my_center|LOCUS_10090 6560 4857 gene locus_tag LOCUS_10100 6560 4857 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070071251.1 protein_id gnl|my_center|LOCUS_10100 7262 6651 gene locus_tag LOCUS_10110 7262 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 8562 7501 gene locus_tag LOCUS_10120 8562 7501 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_10120 8940 9230 gene locus_tag LOCUS_10130 8940 9230 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389943.1 protein_id gnl|my_center|LOCUS_10130 10253 9330 gene locus_tag LOCUS_10140 10253 9330 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089553.1 protein_id gnl|my_center|LOCUS_10140 10538 11275 gene locus_tag LOCUS_10150 gene leuE 10538 11275 CDS product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207051.1 protein_id gnl|my_center|LOCUS_10150 11597 12520 gene locus_tag LOCUS_10160 11597 12520 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198019.1 protein_id gnl|my_center|LOCUS_10160 12653 13942 gene locus_tag LOCUS_10170 12653 13942 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267114.1 protein_id gnl|my_center|LOCUS_10170 14103 15377 gene locus_tag LOCUS_10180 14103 15377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 15463 15993 gene locus_tag LOCUS_10190 gene ppa 15463 15993 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812734.1 protein_id gnl|my_center|LOCUS_10190 17708 16110 gene locus_tag LOCUS_10200 17708 16110 CDS product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064060.1 protein_id gnl|my_center|LOCUS_10200 19096 17711 gene locus_tag LOCUS_10210 19096 17711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 20759 19608 gene locus_tag LOCUS_10220 20759 19608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 21713 20769 gene locus_tag LOCUS_10230 gene hemC 21713 20769 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820470.1 protein_id gnl|my_center|LOCUS_10230 22982 22233 gene locus_tag LOCUS_10240 22982 22233 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811686.1 protein_id gnl|my_center|LOCUS_10240 24006 27581 gene locus_tag LOCUS_10250 24006 27581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 27964 28179 gene locus_tag LOCUS_10260 27964 28179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 29318 28437 gene locus_tag LOCUS_10270 gene sucD 29318 28437 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812748.1 protein_id gnl|my_center|LOCUS_10270 30522 29362 gene locus_tag LOCUS_10280 gene sucC 30522 29362 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812749.1 protein_id gnl|my_center|LOCUS_10280 31246 30707 gene locus_tag LOCUS_10290 31246 30707 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930988.1 protein_id gnl|my_center|LOCUS_10290 33096 31525 gene locus_tag LOCUS_10300 33096 31525 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107814.1 protein_id gnl|my_center|LOCUS_10300 33656 33291 gene locus_tag LOCUS_10310 33656 33291 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176929198.1 protein_id gnl|my_center|LOCUS_10310 34389 33898 gene locus_tag LOCUS_10320 34389 33898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 35527 34382 gene locus_tag LOCUS_10330 gene recA 35527 34382 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812760.1 protein_id gnl|my_center|LOCUS_10330 35782 36480 gene locus_tag LOCUS_10340 35782 36480 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812762.1 protein_id gnl|my_center|LOCUS_10340 36508 38064 gene locus_tag LOCUS_10350 36508 38064 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812764.1 protein_id gnl|my_center|LOCUS_10350 38993 38517 gene locus_tag LOCUS_10360 38993 38517 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388486.1 protein_id gnl|my_center|LOCUS_10360 39888 39076 gene locus_tag LOCUS_10370 39888 39076 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328364.1 protein_id gnl|my_center|LOCUS_10370 40466 39888 gene locus_tag LOCUS_10380 40466 39888 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104051.1 protein_id gnl|my_center|LOCUS_10380 41749 40463 gene locus_tag LOCUS_10390 41749 40463 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338708.1 protein_id gnl|my_center|LOCUS_10390 42342 41746 gene locus_tag LOCUS_10400 42342 41746 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267595.1 protein_id gnl|my_center|LOCUS_10400 43580 42360 gene locus_tag LOCUS_10410 43580 42360 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971979.1 protein_id gnl|my_center|LOCUS_10410 44470 43577 gene locus_tag LOCUS_10420 44470 43577 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_10420 45815 44475 gene locus_tag LOCUS_10430 45815 44475 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163651105.1 protein_id gnl|my_center|LOCUS_10430 46369 45815 gene locus_tag LOCUS_10440 46369 45815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 46608 47270 gene locus_tag LOCUS_10450 46608 47270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 47537 48445 gene locus_tag LOCUS_10460 47537 48445 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 protein_id gnl|my_center|LOCUS_10460 48501 48902 gene locus_tag LOCUS_10470 48501 48902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 49959 48874 gene locus_tag LOCUS_10480 49959 48874 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813006.1 protein_id gnl|my_center|LOCUS_10480 50319 49960 gene locus_tag LOCUS_10490 50319 49960 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_10490 50602 50312 gene locus_tag LOCUS_10500 50602 50312 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228510.1 protein_id gnl|my_center|LOCUS_10500 52128 50818 gene locus_tag LOCUS_10510 52128 50818 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_10510 52380 52817 gene locus_tag LOCUS_10520 gene trxC 52380 52817 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070806.1 protein_id gnl|my_center|LOCUS_10520 54283 52850 gene locus_tag LOCUS_10530 gene pyk 54283 52850 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390218.1 protein_id gnl|my_center|LOCUS_10530 56317 54458 gene locus_tag LOCUS_10540 56317 54458 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817018.1 protein_id gnl|my_center|LOCUS_10540 56614 57990 gene locus_tag LOCUS_10550 gene clcA 56614 57990 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393094.1 protein_id gnl|my_center|LOCUS_10550 59124 58003 gene locus_tag LOCUS_10560 59124 58003 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185574.1 protein_id gnl|my_center|LOCUS_10560 59911 59033 gene locus_tag LOCUS_10570 59911 59033 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196438.1 protein_id gnl|my_center|LOCUS_10570 61045 60065 gene locus_tag LOCUS_10580 61045 60065 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194986.1 protein_id gnl|my_center|LOCUS_10580 61676 61176 gene locus_tag LOCUS_10590 61676 61176 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005100764.1 protein_id gnl|my_center|LOCUS_10590 61761 62261 gene locus_tag LOCUS_10600 61761 62261 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813272.1 protein_id gnl|my_center|LOCUS_10600 62277 63872 gene locus_tag LOCUS_10610 62277 63872 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926811.1 protein_id gnl|my_center|LOCUS_10610 63885 64613 gene locus_tag LOCUS_10620 63885 64613 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029628.1 protein_id gnl|my_center|LOCUS_10620 65439 64687 gene locus_tag LOCUS_10630 65439 64687 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861855.1 protein_id gnl|my_center|LOCUS_10630 65839 66795 gene locus_tag LOCUS_10640 65839 66795 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813147.1 protein_id gnl|my_center|LOCUS_10640 66799 67494 gene locus_tag LOCUS_10650 66799 67494 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974210.1 protein_id gnl|my_center|LOCUS_10650 67952 67524 gene locus_tag LOCUS_10660 67952 67524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807254.1 protein_id gnl|my_center|LOCUS_10660 68405 67956 gene locus_tag LOCUS_10670 68405 67956 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_10670 69138 68500 gene locus_tag LOCUS_10680 69138 68500 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815892.1 protein_id gnl|my_center|LOCUS_10680 70422 69184 gene locus_tag LOCUS_10690 gene serA 70422 69184 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269265.1 protein_id gnl|my_center|LOCUS_10690 70828 70607 gene locus_tag LOCUS_10700 70828 70607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 71348 73648 gene locus_tag LOCUS_10710 71348 73648 CDS product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268538.1 protein_id gnl|my_center|LOCUS_10710 73911 75704 gene locus_tag LOCUS_10720 73911 75704 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_10720 75782 76576 gene locus_tag LOCUS_10730 75782 76576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 76905 77276 gene locus_tag LOCUS_10740 76905 77276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 77299 77607 gene locus_tag LOCUS_10750 77299 77607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 77558 78040 gene locus_tag LOCUS_10760 77558 78040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 78178 79383 gene locus_tag LOCUS_10770 78178 79383 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174694.1 protein_id gnl|my_center|LOCUS_10770 80581 79463 gene locus_tag LOCUS_10780 80581 79463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 81596 80613 gene locus_tag LOCUS_10790 81596 80613 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 protein_id gnl|my_center|LOCUS_10790 82328 81738 gene locus_tag LOCUS_10800 82328 81738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 82297 82449 gene locus_tag LOCUS_10810 82297 82449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 82499 84220 gene locus_tag LOCUS_10820 gene poxB 82499 84220 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994147.1 protein_id gnl|my_center|LOCUS_10820 85714 84263 gene locus_tag LOCUS_10830 85714 84263 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185874.1 protein_id gnl|my_center|LOCUS_10830 85993 86220 gene locus_tag LOCUS_10840 85993 86220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 86220 86402 gene locus_tag LOCUS_10850 86220 86402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10850 86482 88104 gene locus_tag LOCUS_10860 86482 88104 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089209.1 protein_id gnl|my_center|LOCUS_10860 89086 88250 gene locus_tag LOCUS_10870 89086 88250 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857192.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence10 302 3007 gene locus_tag LOCUS_10880 gene acnA 302 3007 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810198.1 protein_id gnl|my_center|LOCUS_10880 4145 3111 gene locus_tag LOCUS_10890 4145 3111 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929220.1 protein_id gnl|my_center|LOCUS_10890 4327 5202 gene locus_tag LOCUS_10900 4327 5202 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814552.1 protein_id gnl|my_center|LOCUS_10900 5234 6418 gene locus_tag LOCUS_10910 5234 6418 CDS product DUF2863 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810196.1 protein_id gnl|my_center|LOCUS_10910 6415 7527 gene locus_tag LOCUS_10920 gene earP 6415 7527 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268554.1 protein_id gnl|my_center|LOCUS_10920 7595 8155 gene locus_tag LOCUS_10930 gene efp 7595 8155 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810194.1 protein_id gnl|my_center|LOCUS_10930 8703 8221 gene locus_tag LOCUS_10940 8703 8221 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930687.1 protein_id gnl|my_center|LOCUS_10940 10458 8734 gene locus_tag LOCUS_10950 10458 8734 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568003.1 protein_id gnl|my_center|LOCUS_10950 11948 10458 gene locus_tag LOCUS_10960 11948 10458 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926305.1 protein_id gnl|my_center|LOCUS_10960 12925 11948 gene locus_tag LOCUS_10970 12925 11948 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810153.1 protein_id gnl|my_center|LOCUS_10970 15177 12922 gene locus_tag LOCUS_10980 15177 12922 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039388.1 protein_id gnl|my_center|LOCUS_10980 15788 15165 gene locus_tag LOCUS_10990 15788 15165 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926304.1 protein_id gnl|my_center|LOCUS_10990 16013 16960 gene locus_tag LOCUS_11000 16013 16960 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693583.1 protein_id gnl|my_center|LOCUS_11000 17159 17608 gene locus_tag LOCUS_11010 17159 17608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 18581 17652 gene locus_tag LOCUS_11020 18581 17652 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930664.1 protein_id gnl|my_center|LOCUS_11020 19016 18681 gene locus_tag LOCUS_11030 19016 18681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 20965 19232 gene locus_tag LOCUS_11040 gene soxB 20965 19232 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 protein_id gnl|my_center|LOCUS_11040 21650 21024 gene locus_tag LOCUS_11050 gene soxX 21650 21024 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881175.1 protein_id gnl|my_center|LOCUS_11050 22476 21667 gene locus_tag LOCUS_11060 gene soxA 22476 21667 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228668.1 protein_id gnl|my_center|LOCUS_11060 22825 22508 gene locus_tag LOCUS_11070 gene soxZ 22825 22508 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932697.1 protein_id gnl|my_center|LOCUS_11070 23350 22895 gene locus_tag LOCUS_11080 gene soxY 23350 22895 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083833.1 protein_id gnl|my_center|LOCUS_11080 24485 23409 gene locus_tag LOCUS_11090 24485 23409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 25836 24469 gene locus_tag LOCUS_11100 gene soxC 25836 24469 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_11100 26043 26981 gene locus_tag LOCUS_11110 26043 26981 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703993.1 protein_id gnl|my_center|LOCUS_11110 27154 27486 gene locus_tag LOCUS_11120 27154 27486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 27511 28788 gene locus_tag LOCUS_11130 27511 28788 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_11130 29537 28971 gene locus_tag LOCUS_11140 29537 28971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 29905 29549 gene locus_tag LOCUS_11150 29905 29549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 31456 29954 gene locus_tag LOCUS_11160 31456 29954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184304236.1 protein_id gnl|my_center|LOCUS_11160 31561 33078 gene locus_tag LOCUS_11170 31561 33078 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921781.1 protein_id gnl|my_center|LOCUS_11170 33225 34631 gene locus_tag LOCUS_11180 33225 34631 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037939.1 protein_id gnl|my_center|LOCUS_11180 34643 35641 gene locus_tag LOCUS_11190 gene cydB 34643 35641 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096666.1 protein_id gnl|my_center|LOCUS_11190 35883 37367 gene locus_tag LOCUS_11200 gene cydD 35883 37367 CDS product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044527.1 protein_id gnl|my_center|LOCUS_11200 37364 39019 gene locus_tag LOCUS_11210 gene cydC 37364 39019 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815160.1 protein_id gnl|my_center|LOCUS_11210 38980 39225 gene locus_tag LOCUS_11220 38980 39225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11220 39385 39870 gene locus_tag LOCUS_11230 39385 39870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11230 39818 40126 gene locus_tag LOCUS_11240 39818 40126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11240 42181 40232 gene locus_tag LOCUS_11250 42181 40232 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_11250 43239 42259 gene locus_tag LOCUS_11260 43239 42259 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056629.1 protein_id gnl|my_center|LOCUS_11260 43786 43415 gene locus_tag LOCUS_11270 43786 43415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11270 44589 43972 gene locus_tag LOCUS_11280 44589 43972 CDS product PqiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064077.1 protein_id gnl|my_center|LOCUS_11280 46232 44586 gene locus_tag LOCUS_11290 46232 44586 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064078.1 protein_id gnl|my_center|LOCUS_11290 47443 46268 gene locus_tag LOCUS_11300 47443 46268 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064079.1 protein_id gnl|my_center|LOCUS_11300 48363 47638 gene locus_tag LOCUS_11310 48363 47638 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810365.1 protein_id gnl|my_center|LOCUS_11310 48736 48356 gene locus_tag LOCUS_11320 48736 48356 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930769.1 protein_id gnl|my_center|LOCUS_11320 49314 48829 gene locus_tag LOCUS_11330 49314 48829 CDS product SOS response-associated peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206972.1 protein_id gnl|my_center|LOCUS_11330 50368 49487 gene locus_tag LOCUS_11340 50368 49487 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969407.1 protein_id gnl|my_center|LOCUS_11340 51054 50446 gene locus_tag LOCUS_11350 51054 50446 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809123.1 protein_id gnl|my_center|LOCUS_11350 51245 52081 gene locus_tag LOCUS_11360 51245 52081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 52095 52406 gene locus_tag LOCUS_11370 52095 52406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 52491 53969 gene locus_tag LOCUS_11380 52491 53969 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243012.1 protein_id gnl|my_center|LOCUS_11380 53986 55818 gene locus_tag LOCUS_11390 53986 55818 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_11390 56190 56972 gene locus_tag LOCUS_11400 56190 56972 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204588.1 protein_id gnl|my_center|LOCUS_11400 56994 58073 gene locus_tag LOCUS_11410 56994 58073 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085701.1 protein_id gnl|my_center|LOCUS_11410 59115 58135 gene locus_tag LOCUS_11420 59115 58135 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039499.1 protein_id gnl|my_center|LOCUS_11420 60174 59236 gene locus_tag LOCUS_11430 60174 59236 CDS product glycine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085352.1 protein_id gnl|my_center|LOCUS_11430 60734 60171 gene locus_tag LOCUS_11440 60734 60171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040628.1 protein_id gnl|my_center|LOCUS_11440 61556 60825 gene locus_tag LOCUS_11450 61556 60825 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040629.1 protein_id gnl|my_center|LOCUS_11450 62623 61553 gene locus_tag LOCUS_11460 62623 61553 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815298.1 protein_id gnl|my_center|LOCUS_11460 62793 63623 gene locus_tag LOCUS_11470 62793 63623 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087048.1 protein_id gnl|my_center|LOCUS_11470 64018 63731 gene locus_tag LOCUS_11480 64018 63731 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171395.1 protein_id gnl|my_center|LOCUS_11480 64941 64081 gene locus_tag LOCUS_11490 64941 64081 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387897.1 protein_id gnl|my_center|LOCUS_11490 65186 65497 gene locus_tag LOCUS_11500 65186 65497 CDS product high-potential iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197194.1 protein_id gnl|my_center|LOCUS_11500 65720 66082 gene locus_tag LOCUS_11510 65720 66082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 66116 66373 gene locus_tag LOCUS_11520 66116 66373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 66619 68133 gene locus_tag LOCUS_11530 66619 68133 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808433.1 protein_id gnl|my_center|LOCUS_11530 69439 68228 gene locus_tag LOCUS_11540 69439 68228 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529753.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence11 317 129 gene locus_tag LOCUS_11550 317 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 615 334 gene locus_tag LOCUS_11560 615 334 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_11560 856 768 gene locus_tag LOCUS_t00160 856 768 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 988 2385 gene locus_tag LOCUS_11570 gene hemN 988 2385 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216474.1 protein_id gnl|my_center|LOCUS_11570 2387 3073 gene locus_tag LOCUS_11580 gene dnr 2387 3073 CDS product transcriptional regulator Dnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_11580 3539 3060 gene locus_tag LOCUS_11590 gene moaC 3539 3060 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531740.1 protein_id gnl|my_center|LOCUS_11590 4063 3536 gene locus_tag LOCUS_11600 gene moaE 4063 3536 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266803.1 protein_id gnl|my_center|LOCUS_11600 4277 4023 gene locus_tag LOCUS_11610 gene moaD 4277 4023 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532479.1 protein_id gnl|my_center|LOCUS_11610 5515 4274 gene locus_tag LOCUS_11620 5515 4274 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114306.1 protein_id gnl|my_center|LOCUS_11620 6523 5540 gene locus_tag LOCUS_11630 gene moaA 6523 5540 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059643243.1 protein_id gnl|my_center|LOCUS_11630 6889 6656 gene locus_tag LOCUS_11640 6889 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 6918 8006 gene locus_tag LOCUS_11650 6918 8006 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767507.1 protein_id gnl|my_center|LOCUS_11650 9181 8003 gene locus_tag LOCUS_11660 9181 8003 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_11660 9461 9372 gene locus_tag LOCUS_t00170 9461 9372 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9546 10535 gene locus_tag LOCUS_11670 9546 10535 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040275.1 protein_id gnl|my_center|LOCUS_11670 10886 11656 gene locus_tag LOCUS_11680 gene tpiA 10886 11656 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813996.1 protein_id gnl|my_center|LOCUS_11680 11738 12211 gene locus_tag LOCUS_11690 11738 12211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 12245 12329 gene locus_tag LOCUS_t00180 12245 12329 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12607 13602 gene locus_tag LOCUS_11700 gene ansZ 12607 13602 CDS product asparaginase AnsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246337.1 protein_id gnl|my_center|LOCUS_11700 13926 15104 gene locus_tag LOCUS_11710 13926 15104 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040259.1 protein_id gnl|my_center|LOCUS_11710 15526 15347 gene locus_tag LOCUS_11720 15526 15347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 15540 16682 gene locus_tag LOCUS_11730 15540 16682 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040259.1 protein_id gnl|my_center|LOCUS_11730 16881 18080 gene locus_tag LOCUS_11740 16881 18080 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040259.1 protein_id gnl|my_center|LOCUS_11740 18129 18488 gene locus_tag LOCUS_11750 18129 18488 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813943.1 protein_id gnl|my_center|LOCUS_11750 18545 19021 gene locus_tag LOCUS_11760 18545 19021 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813941.1 protein_id gnl|my_center|LOCUS_11760 19108 19728 gene locus_tag LOCUS_11770 19108 19728 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926963.1 protein_id gnl|my_center|LOCUS_11770 19731 20987 gene locus_tag LOCUS_11780 19731 20987 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930035.1 protein_id gnl|my_center|LOCUS_11780 21019 21510 gene locus_tag LOCUS_11790 gene nuoE 21019 21510 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813932.1 protein_id gnl|my_center|LOCUS_11790 21507 22874 gene locus_tag LOCUS_11800 gene nuoF 21507 22874 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_11800 22887 25223 gene locus_tag LOCUS_11810 gene nuoG 22887 25223 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813928.1 protein_id gnl|my_center|LOCUS_11810 25223 26296 gene locus_tag LOCUS_11820 gene nuoH 25223 26296 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813926.1 protein_id gnl|my_center|LOCUS_11820 26326 26814 gene locus_tag LOCUS_11830 gene nuoI 26326 26814 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_11830 26833 27462 gene locus_tag LOCUS_11840 26833 27462 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813921.1 protein_id gnl|my_center|LOCUS_11840 27453 27761 gene locus_tag LOCUS_11850 gene nuoK 27453 27761 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813920.1 protein_id gnl|my_center|LOCUS_11850 27823 29838 gene locus_tag LOCUS_11860 gene nuoL 27823 29838 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813919.1 protein_id gnl|my_center|LOCUS_11860 29838 31334 gene locus_tag LOCUS_11870 29838 31334 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813918.1 protein_id gnl|my_center|LOCUS_11870 31341 32816 gene locus_tag LOCUS_11880 gene nuoN 31341 32816 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_11880 32839 33144 gene locus_tag LOCUS_11890 32839 33144 CDS product DUF2818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813915.1 protein_id gnl|my_center|LOCUS_11890 34093 33233 gene locus_tag LOCUS_11900 gene serB 34093 33233 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813898.1 protein_id gnl|my_center|LOCUS_11900 37414 34109 gene locus_tag LOCUS_11910 gene mfd 37414 34109 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065075.1 protein_id gnl|my_center|LOCUS_11910 37594 38310 gene locus_tag LOCUS_11920 gene ispD 37594 38310 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040254.1 protein_id gnl|my_center|LOCUS_11920 38307 38798 gene locus_tag LOCUS_11930 gene ispF 38307 38798 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813893.1 protein_id gnl|my_center|LOCUS_11930 40189 38819 gene locus_tag LOCUS_11940 40189 38819 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813884.1 protein_id gnl|my_center|LOCUS_11940 40922 40176 gene locus_tag LOCUS_11950 gene ompR 40922 40176 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813882.1 protein_id gnl|my_center|LOCUS_11950 41634 40987 gene locus_tag LOCUS_11960 41634 40987 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813302.1 protein_id gnl|my_center|LOCUS_11960 41722 44595 gene locus_tag LOCUS_11970 gene ppc 41722 44595 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191560.1 protein_id gnl|my_center|LOCUS_11970 44645 44721 gene locus_tag LOCUS_t00190 44645 44721 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 44960 46039 gene locus_tag LOCUS_11980 44960 46039 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 protein_id gnl|my_center|LOCUS_11980 46043 46972 gene locus_tag LOCUS_11990 46043 46972 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 protein_id gnl|my_center|LOCUS_11990 46969 48060 gene locus_tag LOCUS_12000 46969 48060 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_12000 48215 48586 gene locus_tag LOCUS_12010 48215 48586 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198795.1 protein_id gnl|my_center|LOCUS_12010 48757 48605 gene locus_tag LOCUS_12020 48757 48605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 49741 48779 gene locus_tag LOCUS_12030 49741 48779 CDS product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 protein_id gnl|my_center|LOCUS_12030 50045 50518 gene locus_tag LOCUS_12040 50045 50518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 51574 50618 gene locus_tag LOCUS_12050 51574 50618 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 protein_id gnl|my_center|LOCUS_12050 52432 51896 gene locus_tag LOCUS_12060 52432 51896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 52938 52534 gene locus_tag LOCUS_12070 52938 52534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 54471 53044 gene locus_tag LOCUS_12080 54471 53044 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095324.1 protein_id gnl|my_center|LOCUS_12080 55424 54552 gene locus_tag LOCUS_12090 55424 54552 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770654.1 protein_id gnl|my_center|LOCUS_12090 55617 55489 gene locus_tag LOCUS_12100 55617 55489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 56182 55694 gene locus_tag LOCUS_12110 56182 55694 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821327.1 protein_id gnl|my_center|LOCUS_12110 56559 57371 gene locus_tag LOCUS_12120 56559 57371 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811028.1 protein_id gnl|my_center|LOCUS_12120 57869 57438 gene locus_tag LOCUS_12130 57869 57438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 59037 58117 gene locus_tag LOCUS_12140 59037 58117 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522101.1 protein_id gnl|my_center|LOCUS_12140 59746 59018 gene locus_tag LOCUS_12150 59746 59018 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522426.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence12 1204 293 gene locus_tag LOCUS_12160 1204 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1438 1319 gene locus_tag LOCUS_12170 1438 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 3562 2024 gene locus_tag LOCUS_12180 gene glmS 3562 2024 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815700.1 protein_id gnl|my_center|LOCUS_12180 4002 4508 gene locus_tag LOCUS_12190 4002 4508 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064827.1 protein_id gnl|my_center|LOCUS_12190 5403 4492 gene locus_tag LOCUS_12200 5403 4492 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806881.1 protein_id gnl|my_center|LOCUS_12200 6229 5435 gene locus_tag LOCUS_12210 6229 5435 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806879.1 protein_id gnl|my_center|LOCUS_12210 6887 6222 gene locus_tag LOCUS_12220 gene rsmG 6887 6222 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818284.1 protein_id gnl|my_center|LOCUS_12220 8872 6929 gene locus_tag LOCUS_12230 gene mnmG 8872 6929 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929569.1 protein_id gnl|my_center|LOCUS_12230 9137 10306 gene locus_tag LOCUS_12240 9137 10306 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906142.1 protein_id gnl|my_center|LOCUS_12240 12063 10696 gene locus_tag LOCUS_12250 gene mnmE 12063 10696 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931687.1 protein_id gnl|my_center|LOCUS_12250 13754 12066 gene locus_tag LOCUS_12260 gene yidC 13754 12066 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927254.1 protein_id gnl|my_center|LOCUS_12260 14043 13810 gene locus_tag LOCUS_12270 gene yidD 14043 13810 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816027.1 protein_id gnl|my_center|LOCUS_12270 14857 16227 gene locus_tag LOCUS_12280 gene dnaA 14857 16227 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929554.1 protein_id gnl|my_center|LOCUS_12280 16232 17341 gene locus_tag LOCUS_12290 gene dnaN 16232 17341 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929839.1 protein_id gnl|my_center|LOCUS_12290 17347 19794 gene locus_tag LOCUS_12300 gene gyrB 17347 19794 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816022.1 protein_id gnl|my_center|LOCUS_12300 20192 19845 gene locus_tag LOCUS_12310 20192 19845 CDS product DUF1840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815933.1 protein_id gnl|my_center|LOCUS_12310 20296 21981 gene locus_tag LOCUS_12320 gene argS 20296 21981 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815935.1 protein_id gnl|my_center|LOCUS_12320 21994 22599 gene locus_tag LOCUS_12330 21994 22599 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927242.1 protein_id gnl|my_center|LOCUS_12330 22641 23240 gene locus_tag LOCUS_12340 22641 23240 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929628.1 protein_id gnl|my_center|LOCUS_12340 24459 23272 gene locus_tag LOCUS_12350 gene metC 24459 23272 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815941.1 protein_id gnl|my_center|LOCUS_12350 25514 24456 gene locus_tag LOCUS_12360 25514 24456 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815946.1 protein_id gnl|my_center|LOCUS_12360 25604 27436 gene locus_tag LOCUS_12370 gene aceK 25604 27436 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818202.1 protein_id gnl|my_center|LOCUS_12370 28304 27408 gene locus_tag LOCUS_12380 28304 27408 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200655.1 protein_id gnl|my_center|LOCUS_12380 30685 28301 gene locus_tag LOCUS_12390 30685 28301 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187774.1 protein_id gnl|my_center|LOCUS_12390 31086 32576 gene locus_tag LOCUS_12400 31086 32576 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371557.1 protein_id gnl|my_center|LOCUS_12400 32579 33550 gene locus_tag LOCUS_12410 32579 33550 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391136.1 protein_id gnl|my_center|LOCUS_12410 33627 34997 gene locus_tag LOCUS_12420 33627 34997 CDS product DUF2868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815874.1 protein_id gnl|my_center|LOCUS_12420 34997 36418 gene locus_tag LOCUS_12430 34997 36418 CDS product GTPase/DUF3482 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815876.1 protein_id gnl|my_center|LOCUS_12430 36586 37887 gene locus_tag LOCUS_12440 36586 37887 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448947.1 protein_id gnl|my_center|LOCUS_12440 37964 39574 gene locus_tag LOCUS_12450 37964 39574 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815895.1 protein_id gnl|my_center|LOCUS_12450 39605 40228 gene locus_tag LOCUS_12460 39605 40228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815897.1 protein_id gnl|my_center|LOCUS_12460 41651 40236 gene locus_tag LOCUS_12470 gene rpoN 41651 40236 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927240.1 protein_id gnl|my_center|LOCUS_12470 41776 42240 gene locus_tag LOCUS_12480 41776 42240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 42670 44382 gene locus_tag LOCUS_12490 gene leuA 42670 44382 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815908.1 protein_id gnl|my_center|LOCUS_12490 45193 44384 gene locus_tag LOCUS_12500 45193 44384 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566336.1 protein_id gnl|my_center|LOCUS_12500 45288 45770 gene locus_tag LOCUS_12510 45288 45770 CDS product DUF3429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267848.1 protein_id gnl|my_center|LOCUS_12510 46285 45767 gene locus_tag LOCUS_12520 46285 45767 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818232.1 protein_id gnl|my_center|LOCUS_12520 47148 46300 gene locus_tag LOCUS_12530 gene panB 47148 46300 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087450.1 protein_id gnl|my_center|LOCUS_12530 49752 47161 gene locus_tag LOCUS_12540 49752 47161 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815970.1 protein_id gnl|my_center|LOCUS_12540 50693 49809 gene locus_tag LOCUS_12550 gene gluQRS 50693 49809 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064768.1 protein_id gnl|my_center|LOCUS_12550 51164 50703 gene locus_tag LOCUS_12560 51164 50703 CDS product DUF494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815964.1 protein_id gnl|my_center|LOCUS_12560 51372 52724 gene locus_tag LOCUS_12570 51372 52724 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_12570 53318 53791 gene locus_tag LOCUS_12580 53318 53791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12580 53825 54055 gene locus_tag LOCUS_12590 53825 54055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 54113 54454 gene locus_tag LOCUS_12600 54113 54454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12600 54793 55593 gene locus_tag LOCUS_12610 54793 55593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 55783 56679 gene locus_tag LOCUS_12620 55783 56679 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12620 >Feature sequence13 503 144 gene locus_tag LOCUS_tm00010 503 144 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 860 1228 gene locus_tag LOCUS_12630 gene rplN 860 1228 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806916.1 protein_id gnl|my_center|LOCUS_12630 1241 1564 gene locus_tag LOCUS_12640 gene rplX 1241 1564 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806917.1 protein_id gnl|my_center|LOCUS_12640 1576 2115 gene locus_tag LOCUS_12650 gene rplE 1576 2115 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806918.1 protein_id gnl|my_center|LOCUS_12650 2128 2433 gene locus_tag LOCUS_12660 gene rpsN 2128 2433 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806919.1 protein_id gnl|my_center|LOCUS_12660 2445 2840 gene locus_tag LOCUS_12670 gene rpsH 2445 2840 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806920.1 protein_id gnl|my_center|LOCUS_12670 2851 3384 gene locus_tag LOCUS_12680 gene rplF 2851 3384 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806921.1 protein_id gnl|my_center|LOCUS_12680 3406 3771 gene locus_tag LOCUS_12690 gene rplR 3406 3771 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064756.1 protein_id gnl|my_center|LOCUS_12690 3787 4305 gene locus_tag LOCUS_12700 gene rpsE 3787 4305 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806923.1 protein_id gnl|my_center|LOCUS_12700 4309 4494 gene locus_tag LOCUS_12710 gene rpmD 4309 4494 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806924.1 protein_id gnl|my_center|LOCUS_12710 4506 4943 gene locus_tag LOCUS_12720 gene rplO 4506 4943 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806925.1 protein_id gnl|my_center|LOCUS_12720 4958 6280 gene locus_tag LOCUS_12730 gene secY 4958 6280 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_12730 6288 6506 gene locus_tag LOCUS_12740 gene infA 6288 6506 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806927.1 protein_id gnl|my_center|LOCUS_12740 6688 7053 gene locus_tag LOCUS_12750 gene rpsM 6688 7053 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806929.1 protein_id gnl|my_center|LOCUS_12750 7066 7464 gene locus_tag LOCUS_12760 gene rpsK 7066 7464 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806930.1 protein_id gnl|my_center|LOCUS_12760 7476 8099 gene locus_tag LOCUS_12770 gene rpsD 7476 8099 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806931.1 protein_id gnl|my_center|LOCUS_12770 8204 9190 gene locus_tag LOCUS_12780 gene rpoA 8204 9190 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064754.1 protein_id gnl|my_center|LOCUS_12780 9305 9709 gene locus_tag LOCUS_12790 gene rplQ 9305 9709 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064753.1 protein_id gnl|my_center|LOCUS_12790 9877 10233 gene locus_tag LOCUS_12800 9877 10233 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038658.1 protein_id gnl|my_center|LOCUS_12800 10230 12122 gene locus_tag LOCUS_12810 gene dsbD 10230 12122 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064751.1 protein_id gnl|my_center|LOCUS_12810 12132 13319 gene locus_tag LOCUS_12820 12132 13319 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814920.1 protein_id gnl|my_center|LOCUS_12820 14358 13333 gene locus_tag LOCUS_12830 gene hemB 14358 13333 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038660.1 protein_id gnl|my_center|LOCUS_12830 14891 14355 gene locus_tag LOCUS_12840 gene yihA 14891 14355 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806940.1 protein_id gnl|my_center|LOCUS_12840 15059 15757 gene locus_tag LOCUS_12850 15059 15757 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806941.1 protein_id gnl|my_center|LOCUS_12850 15943 17937 gene locus_tag LOCUS_12860 15943 17937 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806942.1 protein_id gnl|my_center|LOCUS_12860 17942 19273 gene locus_tag LOCUS_12870 gene ccsB 17942 19273 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806943.1 protein_id gnl|my_center|LOCUS_12870 19289 20494 gene locus_tag LOCUS_12880 19289 20494 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382995.1 protein_id gnl|my_center|LOCUS_12880 21822 20527 gene locus_tag LOCUS_12890 gene lysA 21822 20527 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806944.1 protein_id gnl|my_center|LOCUS_12890 22098 22427 gene locus_tag LOCUS_12900 gene cyaY 22098 22427 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806945.1 protein_id gnl|my_center|LOCUS_12900 24894 22468 gene locus_tag LOCUS_12910 24894 22468 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038661.1 protein_id gnl|my_center|LOCUS_12910 24964 25467 gene locus_tag LOCUS_12920 24964 25467 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806947.1 protein_id gnl|my_center|LOCUS_12920 25471 26559 gene locus_tag LOCUS_12930 gene aroB 25471 26559 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806948.1 protein_id gnl|my_center|LOCUS_12930 26573 27709 gene locus_tag LOCUS_12940 26573 27709 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806949.1 protein_id gnl|my_center|LOCUS_12940 27723 28292 gene locus_tag LOCUS_12950 27723 28292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 31174 28313 gene locus_tag LOCUS_12960 gene uvrA 31174 28313 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925694.1 protein_id gnl|my_center|LOCUS_12960 31246 32484 gene locus_tag LOCUS_12970 31246 32484 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806952.1 protein_id gnl|my_center|LOCUS_12970 32615 33094 gene locus_tag LOCUS_12980 gene ssb 32615 33094 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_12980 33636 33247 gene locus_tag LOCUS_12990 33636 33247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 33755 34144 gene locus_tag LOCUS_13000 33755 34144 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 protein_id gnl|my_center|LOCUS_13000 34141 34647 gene locus_tag LOCUS_13010 34141 34647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 34644 35678 gene locus_tag LOCUS_13020 gene arsB 34644 35678 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272375.1 protein_id gnl|my_center|LOCUS_13020 36314 35688 gene locus_tag LOCUS_13030 36314 35688 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338471.1 protein_id gnl|my_center|LOCUS_13030 37408 36311 gene locus_tag LOCUS_13040 37408 36311 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036086.1 protein_id gnl|my_center|LOCUS_13040 37546 39177 gene locus_tag LOCUS_13050 37546 39177 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925709.1 protein_id gnl|my_center|LOCUS_13050 39279 39695 gene locus_tag LOCUS_13060 39279 39695 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962808.1 protein_id gnl|my_center|LOCUS_13060 39719 40027 gene locus_tag LOCUS_13070 39719 40027 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_13070 40583 40074 gene locus_tag LOCUS_13080 gene allA 40583 40074 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776388.1 protein_id gnl|my_center|LOCUS_13080 42295 40583 gene locus_tag LOCUS_13090 42295 40583 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969263.1 protein_id gnl|my_center|LOCUS_13090 42605 42288 gene locus_tag LOCUS_13100 42605 42288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 44116 42602 gene locus_tag LOCUS_13110 44116 42602 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921413.1 protein_id gnl|my_center|LOCUS_13110 45615 44113 gene locus_tag LOCUS_13120 45615 44113 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389325.1 protein_id gnl|my_center|LOCUS_13120 45974 45612 gene locus_tag LOCUS_13130 45974 45612 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_13130 46987 45986 gene locus_tag LOCUS_13140 46987 45986 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599366.1 protein_id gnl|my_center|LOCUS_13140 47301 46984 gene locus_tag LOCUS_13150 gene mnhG 47301 46984 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389329.1 protein_id gnl|my_center|LOCUS_13150 47588 47298 gene locus_tag LOCUS_13160 47588 47298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 48070 47588 gene locus_tag LOCUS_13170 48070 47588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 48344 49768 gene locus_tag LOCUS_13180 48344 49768 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807657.1 protein_id gnl|my_center|LOCUS_13180 49853 50224 gene locus_tag LOCUS_13190 49853 50224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 50281 50886 gene locus_tag LOCUS_13200 50281 50886 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807035.1 protein_id gnl|my_center|LOCUS_13200 50891 52696 gene locus_tag LOCUS_13210 gene aspS 50891 52696 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807038.1 protein_id gnl|my_center|LOCUS_13210 52701 53567 gene locus_tag LOCUS_13220 52701 53567 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807040.1 protein_id gnl|my_center|LOCUS_13220 53570 54418 gene locus_tag LOCUS_13230 53570 54418 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459679.1 protein_id gnl|my_center|LOCUS_13230 54838 54422 gene locus_tag LOCUS_13240 54838 54422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence14 883 1170 gene locus_tag LOCUS_13250 883 1170 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379963.1 protein_id gnl|my_center|LOCUS_13250 1622 2398 gene locus_tag LOCUS_13260 1622 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063602.1 protein_id gnl|my_center|LOCUS_13260 2395 2889 gene locus_tag LOCUS_13270 2395 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 3608 4411 gene locus_tag LOCUS_13280 3608 4411 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971581.1 protein_id gnl|my_center|LOCUS_13280 4454 5125 gene locus_tag LOCUS_13290 4454 5125 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403260.1 protein_id gnl|my_center|LOCUS_13290 5118 5768 gene locus_tag LOCUS_13300 5118 5768 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705411.1 protein_id gnl|my_center|LOCUS_13300 5755 6507 gene locus_tag LOCUS_13310 5755 6507 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971584.1 protein_id gnl|my_center|LOCUS_13310 7048 7260 gene locus_tag LOCUS_13320 7048 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 8159 7506 gene locus_tag LOCUS_13330 8159 7506 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385122.1 protein_id gnl|my_center|LOCUS_13330 8864 8376 gene locus_tag LOCUS_13340 8864 8376 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930202.1 protein_id gnl|my_center|LOCUS_13340 8989 11589 gene locus_tag LOCUS_13350 gene mdeB 8989 11589 CDS product alpha-ketoglutarate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065164.1 protein_id gnl|my_center|LOCUS_13350 11603 12157 gene locus_tag LOCUS_13360 11603 12157 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813998.1 protein_id gnl|my_center|LOCUS_13360 14366 12201 gene locus_tag LOCUS_13370 gene pnp 14366 12201 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821234.1 protein_id gnl|my_center|LOCUS_13370 14732 14463 gene locus_tag LOCUS_13380 gene rpsO 14732 14463 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814002.1 protein_id gnl|my_center|LOCUS_13380 14995 15513 gene locus_tag LOCUS_13390 14995 15513 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814003.1 protein_id gnl|my_center|LOCUS_13390 15510 16025 gene locus_tag LOCUS_13400 15510 16025 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814003.1 protein_id gnl|my_center|LOCUS_13400 16830 16039 gene locus_tag LOCUS_13410 gene pssA 16830 16039 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814004.1 protein_id gnl|my_center|LOCUS_13410 17495 16830 gene locus_tag LOCUS_13420 17495 16830 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196436.1 protein_id gnl|my_center|LOCUS_13420 18621 17605 gene locus_tag LOCUS_13430 gene ilvC 18621 17605 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814005.1 protein_id gnl|my_center|LOCUS_13430 19209 18718 gene locus_tag LOCUS_13440 gene ilvN 19209 18718 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_13440 20938 19220 gene locus_tag LOCUS_13450 20938 19220 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814007.1 protein_id gnl|my_center|LOCUS_13450 21370 23544 gene locus_tag LOCUS_13460 21370 23544 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814008.1 protein_id gnl|my_center|LOCUS_13460 23635 24381 gene locus_tag LOCUS_13470 23635 24381 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194452.1 protein_id gnl|my_center|LOCUS_13470 25759 24410 gene locus_tag LOCUS_13480 25759 24410 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194462.1 protein_id gnl|my_center|LOCUS_13480 26549 25776 gene locus_tag LOCUS_13490 gene yaaA 26549 25776 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814010.1 protein_id gnl|my_center|LOCUS_13490 26718 26807 gene locus_tag LOCUS_t00200 26718 26807 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27202 27444 gene locus_tag LOCUS_13500 27202 27444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 28446 27853 gene locus_tag LOCUS_13510 28446 27853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 30489 28648 gene locus_tag LOCUS_13520 30489 28648 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204893.1 protein_id gnl|my_center|LOCUS_13520 34024 30500 gene locus_tag LOCUS_13530 gene drmA 34024 30500 CDS product DISARM system helicase DrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204892.1 protein_id gnl|my_center|LOCUS_13530 38048 34038 gene locus_tag LOCUS_13540 38048 34038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204891.1 protein_id gnl|my_center|LOCUS_13540 41209 38045 gene locus_tag LOCUS_13550 gene drmD 41209 38045 CDS product DISARM system SNF2-like helicase DrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204890.1 protein_id gnl|my_center|LOCUS_13550 41439 41221 gene locus_tag LOCUS_13560 41439 41221 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113932710.1 protein_id gnl|my_center|LOCUS_13560 41956 41621 gene locus_tag LOCUS_13570 41956 41621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 42369 41953 gene locus_tag LOCUS_13580 42369 41953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 42478 43290 gene locus_tag LOCUS_13590 42478 43290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 43277 43873 gene locus_tag LOCUS_13600 43277 43873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 44082 44513 gene locus_tag LOCUS_13610 44082 44513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 46666 46031 gene locus_tag LOCUS_13620 46666 46031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 47001 46681 gene locus_tag LOCUS_13630 47001 46681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 48953 47166 gene locus_tag LOCUS_13640 48953 47166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 49459 48941 gene locus_tag LOCUS_13650 49459 48941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 49677 49456 gene locus_tag LOCUS_13660 49677 49456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 50371 49757 gene locus_tag LOCUS_13670 50371 49757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 51606 50368 gene locus_tag LOCUS_13680 51606 50368 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265555.1 protein_id gnl|my_center|LOCUS_13680 51985 52116 gene locus_tag LOCUS_13690 51985 52116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 52113 52430 gene locus_tag LOCUS_13700 52113 52430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 52494 52940 gene locus_tag LOCUS_13710 52494 52940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 52937 53239 gene locus_tag LOCUS_13720 52937 53239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 53659 53342 gene locus_tag LOCUS_13730 53659 53342 CDS product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529164.1 protein_id gnl|my_center|LOCUS_13730 53922 53659 gene locus_tag LOCUS_13740 53922 53659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence15 <1 1005 gene locus_tag LOCUS_13750 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813626.1:dihydrolipoyl dehydrogenase 1081 2172 gene locus_tag LOCUS_13760 gene zapE 1081 2172 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447983.1 protein_id gnl|my_center|LOCUS_13760 2184 3548 gene locus_tag LOCUS_13770 2184 3548 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040180.1 protein_id gnl|my_center|LOCUS_13770 3545 5524 gene locus_tag LOCUS_13780 3545 5524 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821440.1 protein_id gnl|my_center|LOCUS_13780 6366 5521 gene locus_tag LOCUS_13790 6366 5521 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040179.1 protein_id gnl|my_center|LOCUS_13790 6426 7418 gene locus_tag LOCUS_13800 6426 7418 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926867.1 protein_id gnl|my_center|LOCUS_13800 7418 8164 gene locus_tag LOCUS_13810 gene pgeF 7418 8164 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247742.1 protein_id gnl|my_center|LOCUS_13810 8297 9916 gene locus_tag LOCUS_13820 gene phaC 8297 9916 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930216.1 protein_id gnl|my_center|LOCUS_13820 9994 10731 gene locus_tag LOCUS_13830 gene phbB 9994 10731 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813586.1 protein_id gnl|my_center|LOCUS_13830 10824 11369 gene locus_tag LOCUS_13840 gene phaR 10824 11369 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813585.1 protein_id gnl|my_center|LOCUS_13840 12283 11414 gene locus_tag LOCUS_13850 12283 11414 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064297.1 protein_id gnl|my_center|LOCUS_13850 13158 12286 gene locus_tag LOCUS_13860 13158 12286 CDS product MOSC N-terminal beta barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194630.1 protein_id gnl|my_center|LOCUS_13860 13249 13731 gene locus_tag LOCUS_13870 13249 13731 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809252.1 protein_id gnl|my_center|LOCUS_13870 14864 13752 gene locus_tag LOCUS_13880 14864 13752 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083007.1 protein_id gnl|my_center|LOCUS_13880 15161 15607 gene locus_tag LOCUS_13890 15161 15607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 15655 16110 gene locus_tag LOCUS_13900 15655 16110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086262.1 protein_id gnl|my_center|LOCUS_13900 16288 17565 gene locus_tag LOCUS_13910 16288 17565 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194989.1 protein_id gnl|my_center|LOCUS_13910 17562 18257 gene locus_tag LOCUS_13920 17562 18257 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765392.1 protein_id gnl|my_center|LOCUS_13920 19048 18254 gene locus_tag LOCUS_13930 19048 18254 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105427165.1 protein_id gnl|my_center|LOCUS_13930 19179 19682 gene locus_tag LOCUS_13940 19179 19682 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766220.1 protein_id gnl|my_center|LOCUS_13940 19852 20550 gene locus_tag LOCUS_13950 19852 20550 CDS product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050480010.1 protein_id gnl|my_center|LOCUS_13950 20550 20978 gene locus_tag LOCUS_13960 20550 20978 CDS product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055933.1 protein_id gnl|my_center|LOCUS_13960 21070 21399 gene locus_tag LOCUS_13970 21070 21399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 21795 21421 gene locus_tag LOCUS_13980 21795 21421 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259291.1 protein_id gnl|my_center|LOCUS_13980 23359 21833 gene locus_tag LOCUS_13990 23359 21833 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036476.1 protein_id gnl|my_center|LOCUS_13990 24651 23356 gene locus_tag LOCUS_14000 24651 23356 CDS product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140837.1 protein_id gnl|my_center|LOCUS_14000 26395 24830 gene locus_tag LOCUS_14010 26395 24830 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256609.1 protein_id gnl|my_center|LOCUS_14010 26318 26500 gene locus_tag LOCUS_14020 26318 26500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 26493 27449 gene locus_tag LOCUS_14030 26493 27449 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306982.1 protein_id gnl|my_center|LOCUS_14030 27454 27756 gene locus_tag LOCUS_14040 27454 27756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306985.1 protein_id gnl|my_center|LOCUS_14040 28092 27763 gene locus_tag LOCUS_14050 28092 27763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 28235 29497 gene locus_tag LOCUS_14060 28235 29497 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098087.1 protein_id gnl|my_center|LOCUS_14060 29612 29421 gene locus_tag LOCUS_14070 29612 29421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 29789 30625 gene locus_tag LOCUS_14080 gene trfA 29789 30625 CDS product plasmid replication initiator TrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942817.1 protein_id gnl|my_center|LOCUS_14080 31147 33885 gene locus_tag LOCUS_14090 31147 33885 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035772.1 protein_id gnl|my_center|LOCUS_14090 34009 34209 gene locus_tag LOCUS_14100 34009 34209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 34193 36496 gene locus_tag LOCUS_14110 34193 36496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 36500 36637 gene locus_tag LOCUS_14120 36500 36637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 36671 38377 gene locus_tag LOCUS_14130 36671 38377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 38395 39270 gene locus_tag LOCUS_14140 38395 39270 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206252.1 protein_id gnl|my_center|LOCUS_14140 39401 42958 gene locus_tag LOCUS_14150 39401 42958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 42965 44584 gene locus_tag LOCUS_14160 42965 44584 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105162.1 protein_id gnl|my_center|LOCUS_14160 44581 45600 gene locus_tag LOCUS_14170 44581 45600 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064796.1 protein_id gnl|my_center|LOCUS_14170 45597 48284 gene locus_tag LOCUS_14180 45597 48284 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081335.1 protein_id gnl|my_center|LOCUS_14180 48595 48311 gene locus_tag LOCUS_14190 48595 48311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 50325 48748 gene locus_tag LOCUS_14200 50325 48748 CDS product IS66-like element ISEc8 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998048.1 protein_id gnl|my_center|LOCUS_14200 50841 50497 gene locus_tag LOCUS_14210 gene tnpB 50841 50497 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529308.1 protein_id gnl|my_center|LOCUS_14210 51257 50838 gene locus_tag LOCUS_14220 51257 50838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 52188 51340 gene locus_tag LOCUS_14230 52188 51340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence16 969 4 gene locus_tag LOCUS_14240 969 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2684 1068 gene locus_tag LOCUS_14250 2684 1068 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927086.1 protein_id gnl|my_center|LOCUS_14250 3659 2817 gene locus_tag LOCUS_14260 3659 2817 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065028.1 protein_id gnl|my_center|LOCUS_14260 3874 5040 gene locus_tag LOCUS_14270 3874 5040 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814298.1 protein_id gnl|my_center|LOCUS_14270 5127 5693 gene locus_tag LOCUS_14280 5127 5693 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814300.1 protein_id gnl|my_center|LOCUS_14280 5747 6379 gene locus_tag LOCUS_14290 gene pdxH 5747 6379 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814302.1 protein_id gnl|my_center|LOCUS_14290 6352 6876 gene locus_tag LOCUS_14300 6352 6876 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814305.1 protein_id gnl|my_center|LOCUS_14300 6882 8003 gene locus_tag LOCUS_14310 6882 8003 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065027.1 protein_id gnl|my_center|LOCUS_14310 8006 8863 gene locus_tag LOCUS_14320 gene purU 8006 8863 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039158.1 protein_id gnl|my_center|LOCUS_14320 8958 10004 gene locus_tag LOCUS_14330 gene rodZ 8958 10004 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090832.1 protein_id gnl|my_center|LOCUS_14330 10965 10054 gene locus_tag LOCUS_14340 10965 10054 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809552.1 protein_id gnl|my_center|LOCUS_14340 11099 12781 gene locus_tag LOCUS_14350 11099 12781 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819848.1 protein_id gnl|my_center|LOCUS_14350 12834 14024 gene locus_tag LOCUS_14360 12834 14024 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930413.1 protein_id gnl|my_center|LOCUS_14360 15026 14034 gene locus_tag LOCUS_14370 15026 14034 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853543.1 protein_id gnl|my_center|LOCUS_14370 16240 15074 gene locus_tag LOCUS_14380 16240 15074 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809527.1 protein_id gnl|my_center|LOCUS_14380 16698 16237 gene locus_tag LOCUS_14390 gene purE 16698 16237 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247930.1 protein_id gnl|my_center|LOCUS_14390 17630 16818 gene locus_tag LOCUS_14400 17630 16818 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809513.1 protein_id gnl|my_center|LOCUS_14400 18778 17714 gene locus_tag LOCUS_14410 gene fba 18778 17714 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064288.1 protein_id gnl|my_center|LOCUS_14410 18892 20061 gene locus_tag LOCUS_14420 18892 20061 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809304.1 protein_id gnl|my_center|LOCUS_14420 20641 20009 gene locus_tag LOCUS_14430 gene mog 20641 20009 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064299.1 protein_id gnl|my_center|LOCUS_14430 20790 23207 gene locus_tag LOCUS_14440 20790 23207 CDS product DUF3141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064308.1 protein_id gnl|my_center|LOCUS_14440 23204 24160 gene locus_tag LOCUS_14450 23204 24160 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809454.1 protein_id gnl|my_center|LOCUS_14450 25370 24183 gene locus_tag LOCUS_14460 25370 24183 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064312.1 protein_id gnl|my_center|LOCUS_14460 26384 25374 gene locus_tag LOCUS_14470 gene gap 26384 25374 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809444.1 protein_id gnl|my_center|LOCUS_14470 28447 26402 gene locus_tag LOCUS_14480 gene tkt 28447 26402 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064313.1 protein_id gnl|my_center|LOCUS_14480 28588 29334 gene locus_tag LOCUS_14490 28588 29334 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064314.1 protein_id gnl|my_center|LOCUS_14490 29858 29403 gene locus_tag LOCUS_14500 29858 29403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 32296 29999 gene locus_tag LOCUS_14510 32296 29999 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126621993.1 protein_id gnl|my_center|LOCUS_14510 33116 32343 gene locus_tag LOCUS_14520 33116 32343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 33252 34415 gene locus_tag LOCUS_14530 33252 34415 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040313.1 protein_id gnl|my_center|LOCUS_14530 35316 34438 gene locus_tag LOCUS_14540 35316 34438 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809436.1 protein_id gnl|my_center|LOCUS_14540 35349 36893 gene locus_tag LOCUS_14550 35349 36893 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040314.1 protein_id gnl|my_center|LOCUS_14550 37849 36890 gene locus_tag LOCUS_14560 37849 36890 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815443.1 protein_id gnl|my_center|LOCUS_14560 38529 37888 gene locus_tag LOCUS_14570 gene upp 38529 37888 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809425.1 protein_id gnl|my_center|LOCUS_14570 39994 38576 gene locus_tag LOCUS_14580 gene dacB 39994 38576 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064320.1 protein_id gnl|my_center|LOCUS_14580 40124 41215 gene locus_tag LOCUS_14590 gene queA 40124 41215 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665804.1 protein_id gnl|my_center|LOCUS_14590 41205 42335 gene locus_tag LOCUS_14600 gene tgt 41205 42335 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809419.1 protein_id gnl|my_center|LOCUS_14600 42374 42715 gene locus_tag LOCUS_14610 gene yajC 42374 42715 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064323.1 protein_id gnl|my_center|LOCUS_14610 42791 44671 gene locus_tag LOCUS_14620 gene secD 42791 44671 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809414.1 protein_id gnl|my_center|LOCUS_14620 44676 45623 gene locus_tag LOCUS_14630 gene secF 44676 45623 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064325.1 protein_id gnl|my_center|LOCUS_14630 45806 47161 gene locus_tag LOCUS_14640 gene miaB 45806 47161 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809403.1 protein_id gnl|my_center|LOCUS_14640 47158 48126 gene locus_tag LOCUS_14650 47158 48126 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809398.1 protein_id gnl|my_center|LOCUS_14650 48098 48583 gene locus_tag LOCUS_14660 gene ybeY 48098 48583 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809396.1 protein_id gnl|my_center|LOCUS_14660 48706 49590 gene locus_tag LOCUS_14670 48706 49590 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930149.1 protein_id gnl|my_center|LOCUS_14670 49598 51193 gene locus_tag LOCUS_14680 gene lnt 49598 51193 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064331.1 protein_id gnl|my_center|LOCUS_14680 51282 51509 gene locus_tag LOCUS_14690 51282 51509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence17 1036 185 gene locus_tag LOCUS_14700 1036 185 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921637.1 protein_id gnl|my_center|LOCUS_14700 2644 1049 gene locus_tag LOCUS_14710 gene ggt 2644 1049 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809852.1 protein_id gnl|my_center|LOCUS_14710 3986 3192 gene locus_tag LOCUS_14720 3986 3192 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253115.1 protein_id gnl|my_center|LOCUS_14720 6048 4735 gene locus_tag LOCUS_14730 gene serS 6048 4735 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814026.1 protein_id gnl|my_center|LOCUS_14730 6254 6105 gene locus_tag LOCUS_14740 6254 6105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 7242 6238 gene locus_tag LOCUS_14750 gene cydB 7242 6238 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968658.1 protein_id gnl|my_center|LOCUS_14750 8678 7239 gene locus_tag LOCUS_14760 8678 7239 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974382.1 protein_id gnl|my_center|LOCUS_14760 10108 8789 gene locus_tag LOCUS_14770 10108 8789 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185515.1 protein_id gnl|my_center|LOCUS_14770 10745 10116 gene locus_tag LOCUS_14780 gene lolA 10745 10116 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930946.1 protein_id gnl|my_center|LOCUS_14780 13077 10783 gene locus_tag LOCUS_14790 13077 10783 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814032.1 protein_id gnl|my_center|LOCUS_14790 13274 14233 gene locus_tag LOCUS_14800 gene trxB 13274 14233 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065064.1 protein_id gnl|my_center|LOCUS_14800 14220 14813 gene locus_tag LOCUS_14810 14220 14813 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929073.1 protein_id gnl|my_center|LOCUS_14810 16835 14775 gene locus_tag LOCUS_14820 16835 14775 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814040.1 protein_id gnl|my_center|LOCUS_14820 17155 16832 gene locus_tag LOCUS_14830 17155 16832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 18570 17314 gene locus_tag LOCUS_14840 gene icd 18570 17314 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814059.1 protein_id gnl|my_center|LOCUS_14840 18639 19073 gene locus_tag LOCUS_14850 18639 19073 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814061.1 protein_id gnl|my_center|LOCUS_14850 19494 19132 gene locus_tag LOCUS_14860 19494 19132 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012248488.1 protein_id gnl|my_center|LOCUS_14860 19874 19509 gene locus_tag LOCUS_14870 19874 19509 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814065.1 protein_id gnl|my_center|LOCUS_14870 20010 20894 gene locus_tag LOCUS_14880 20010 20894 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814066.1 protein_id gnl|my_center|LOCUS_14880 20891 21499 gene locus_tag LOCUS_14890 20891 21499 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037388.1 protein_id gnl|my_center|LOCUS_14890 21489 22658 gene locus_tag LOCUS_14900 21489 22658 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814068.1 protein_id gnl|my_center|LOCUS_14900 22819 25608 gene locus_tag LOCUS_14910 22819 25608 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930957.1 protein_id gnl|my_center|LOCUS_14910 26988 25858 gene locus_tag LOCUS_14920 gene dnaJ 26988 25858 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821186.1 protein_id gnl|my_center|LOCUS_14920 29025 27103 gene locus_tag LOCUS_14930 gene dnaK 29025 27103 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814079.1 protein_id gnl|my_center|LOCUS_14930 29751 29167 gene locus_tag LOCUS_14940 gene grpE 29751 29167 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814083.1 protein_id gnl|my_center|LOCUS_14940 30948 29863 gene locus_tag LOCUS_14950 gene hemH 30948 29863 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814087.1 protein_id gnl|my_center|LOCUS_14950 32020 31001 gene locus_tag LOCUS_14960 gene hrcA 32020 31001 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814090.1 protein_id gnl|my_center|LOCUS_14960 32090 32989 gene locus_tag LOCUS_14970 32090 32989 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039215.1 protein_id gnl|my_center|LOCUS_14970 32994 34649 gene locus_tag LOCUS_14980 gene recN 32994 34649 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065059.1 protein_id gnl|my_center|LOCUS_14980 35113 34676 gene locus_tag LOCUS_14990 gene fur 35113 34676 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814098.1 protein_id gnl|my_center|LOCUS_14990 35347 35757 gene locus_tag LOCUS_15000 35347 35757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 35773 36567 gene locus_tag LOCUS_15010 gene dapB 35773 36567 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926993.1 protein_id gnl|my_center|LOCUS_15010 37621 36590 gene locus_tag LOCUS_15020 gene murB 37621 36590 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930965.1 protein_id gnl|my_center|LOCUS_15020 37724 37799 gene locus_tag LOCUS_t00210 37724 37799 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 37838 37911 gene locus_tag LOCUS_t00220 37838 37911 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 37973 39262 gene locus_tag LOCUS_15030 37973 39262 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178900.1 protein_id gnl|my_center|LOCUS_15030 39498 41846 gene locus_tag LOCUS_15040 39498 41846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 41859 42470 gene locus_tag LOCUS_15050 41859 42470 CDS product DUF2946 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927005.1 protein_id gnl|my_center|LOCUS_15050 42515 43093 gene locus_tag LOCUS_15060 42515 43093 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814161.1 protein_id gnl|my_center|LOCUS_15060 43118 43927 gene locus_tag LOCUS_15070 gene aat 43118 43927 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814164.1 protein_id gnl|my_center|LOCUS_15070 43924 44658 gene locus_tag LOCUS_15080 43924 44658 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039188.1 protein_id gnl|my_center|LOCUS_15080 44655 45698 gene locus_tag LOCUS_15090 44655 45698 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814170.1 protein_id gnl|my_center|LOCUS_15090 45747 46055 gene locus_tag LOCUS_15100 45747 46055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 46809 46234 gene locus_tag LOCUS_15110 gene phaP 46809 46234 CDS product TIGR01841 family phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814172.1 protein_id gnl|my_center|LOCUS_15110 47766 46960 gene locus_tag LOCUS_15120 47766 46960 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814178.1 protein_id gnl|my_center|LOCUS_15120 48808 47927 gene locus_tag LOCUS_15130 48808 47927 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814179.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence18 803 141 gene locus_tag LOCUS_15140 803 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1907 1041 gene locus_tag LOCUS_15150 1907 1041 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088051.1 protein_id gnl|my_center|LOCUS_15150 2444 3607 gene locus_tag LOCUS_15160 2444 3607 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930034.1 protein_id gnl|my_center|LOCUS_15160 4055 3690 gene locus_tag LOCUS_15170 4055 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 4689 4039 gene locus_tag LOCUS_15180 4689 4039 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037164.1 protein_id gnl|my_center|LOCUS_15180 7111 4808 gene locus_tag LOCUS_15190 7111 4808 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187216.1 protein_id gnl|my_center|LOCUS_15190 7388 7705 gene locus_tag LOCUS_15200 gene sugE 7388 7705 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111167.1 protein_id gnl|my_center|LOCUS_15200 7840 8214 gene locus_tag LOCUS_15210 7840 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 8364 9557 gene locus_tag LOCUS_15220 8364 9557 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083205.1 protein_id gnl|my_center|LOCUS_15220 9718 10596 gene locus_tag LOCUS_15230 9718 10596 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 protein_id gnl|my_center|LOCUS_15230 12305 10824 gene locus_tag LOCUS_15240 12305 10824 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762891.1 protein_id gnl|my_center|LOCUS_15240 12484 14094 gene locus_tag LOCUS_15250 12484 14094 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812216.1 protein_id gnl|my_center|LOCUS_15250 15351 14071 gene locus_tag LOCUS_15260 15351 14071 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390598.1 protein_id gnl|my_center|LOCUS_15260 16316 15387 gene locus_tag LOCUS_15270 16316 15387 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390597.1 protein_id gnl|my_center|LOCUS_15270 17377 16316 gene locus_tag LOCUS_15280 17377 16316 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390596.1 protein_id gnl|my_center|LOCUS_15280 18879 17374 gene locus_tag LOCUS_15290 18879 17374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390595.1 protein_id gnl|my_center|LOCUS_15290 19886 18879 gene locus_tag LOCUS_15300 19886 18879 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390594.1 protein_id gnl|my_center|LOCUS_15300 20321 21574 gene locus_tag LOCUS_15310 gene urtA 20321 21574 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112321.1 protein_id gnl|my_center|LOCUS_15310 21674 23281 gene locus_tag LOCUS_15320 gene urtB 21674 23281 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269026.1 protein_id gnl|my_center|LOCUS_15320 23281 24426 gene locus_tag LOCUS_15330 gene urtC 23281 24426 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105220.1 protein_id gnl|my_center|LOCUS_15330 24423 25268 gene locus_tag LOCUS_15340 gene urtD 24423 25268 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 protein_id gnl|my_center|LOCUS_15340 25271 25969 gene locus_tag LOCUS_15350 gene urtE 25271 25969 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223523.1 protein_id gnl|my_center|LOCUS_15350 26897 26109 gene locus_tag LOCUS_15360 gene fabI 26897 26109 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814739.1 protein_id gnl|my_center|LOCUS_15360 28216 26939 gene locus_tag LOCUS_15370 28216 26939 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931356.1 protein_id gnl|my_center|LOCUS_15370 29041 28235 gene locus_tag LOCUS_15380 gene gloB 29041 28235 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927090.1 protein_id gnl|my_center|LOCUS_15380 29056 29817 gene locus_tag LOCUS_15390 29056 29817 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814735.1 protein_id gnl|my_center|LOCUS_15390 29821 30285 gene locus_tag LOCUS_15400 gene rnhA 29821 30285 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814734.1 protein_id gnl|my_center|LOCUS_15400 30323 31579 gene locus_tag LOCUS_15410 30323 31579 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_15410 31576 34689 gene locus_tag LOCUS_15420 31576 34689 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814731.1 protein_id gnl|my_center|LOCUS_15420 34670 35368 gene locus_tag LOCUS_15430 gene dnaQ 34670 35368 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064948.1 protein_id gnl|my_center|LOCUS_15430 35502 35576 gene locus_tag LOCUS_t00230 35502 35576 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 35625 35870 gene locus_tag LOCUS_15440 35625 35870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 37003 36104 gene locus_tag LOCUS_15450 37003 36104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 37497 37276 gene locus_tag LOCUS_15460 37497 37276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 38022 38636 gene locus_tag LOCUS_15470 38022 38636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 38772 41489 gene locus_tag LOCUS_15480 gene acnA 38772 41489 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_15480 41781 42476 gene locus_tag LOCUS_15490 41781 42476 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815414.1 protein_id gnl|my_center|LOCUS_15490 42544 43650 gene locus_tag LOCUS_15500 42544 43650 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943820.1 protein_id gnl|my_center|LOCUS_15500 43784 45796 gene locus_tag LOCUS_15510 43784 45796 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395919.1 protein_id gnl|my_center|LOCUS_15510 46169 45984 gene locus_tag LOCUS_15520 46169 45984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 46405 47133 gene locus_tag LOCUS_15530 46405 47133 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815414.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence19 1041 2810 gene locus_tag LOCUS_15540 1041 2810 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817147.1 protein_id gnl|my_center|LOCUS_15540 2807 3433 gene locus_tag LOCUS_15550 2807 3433 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930126.1 protein_id gnl|my_center|LOCUS_15550 4119 4484 gene locus_tag LOCUS_15560 4119 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 4481 5935 gene locus_tag LOCUS_15570 4481 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 6078 6656 gene locus_tag LOCUS_15580 6078 6656 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022582.1 protein_id gnl|my_center|LOCUS_15580 7125 7307 gene locus_tag LOCUS_15590 7125 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 7300 7818 gene locus_tag LOCUS_15600 7300 7818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 8060 8263 gene locus_tag LOCUS_15610 8060 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 9807 8656 gene locus_tag LOCUS_15620 9807 8656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 10141 10719 gene locus_tag LOCUS_15630 10141 10719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 10934 13018 gene locus_tag LOCUS_15640 10934 13018 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811950.1 protein_id gnl|my_center|LOCUS_15640 13294 14157 gene locus_tag LOCUS_15650 gene folD 13294 14157 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811948.1 protein_id gnl|my_center|LOCUS_15650 14154 14759 gene locus_tag LOCUS_15660 14154 14759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 15061 14843 gene locus_tag LOCUS_15670 15061 14843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 15685 15413 gene locus_tag LOCUS_15680 15685 15413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 15703 16854 gene locus_tag LOCUS_15690 15703 16854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 17201 18751 gene locus_tag LOCUS_15700 17201 18751 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930448.1 protein_id gnl|my_center|LOCUS_15700 18843 19070 gene locus_tag LOCUS_15710 18843 19070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 19407 19763 gene locus_tag LOCUS_15720 19407 19763 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925868.1 protein_id gnl|my_center|LOCUS_15720 19767 21098 gene locus_tag LOCUS_15730 19767 21098 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187394984.1 protein_id gnl|my_center|LOCUS_15730 21342 21181 gene locus_tag LOCUS_15740 21342 21181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 21341 21895 gene locus_tag LOCUS_15750 21341 21895 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446818.1 protein_id gnl|my_center|LOCUS_15750 23210 21909 gene locus_tag LOCUS_15760 23210 21909 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763811.1 protein_id gnl|my_center|LOCUS_15760 23551 23222 gene locus_tag LOCUS_15770 23551 23222 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176728.1 protein_id gnl|my_center|LOCUS_15770 23898 24638 gene locus_tag LOCUS_15780 23898 24638 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038231.1 protein_id gnl|my_center|LOCUS_15780 24635 25555 gene locus_tag LOCUS_15790 24635 25555 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038232.1 protein_id gnl|my_center|LOCUS_15790 25639 25986 gene locus_tag LOCUS_15800 25639 25986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 26697 26230 gene locus_tag LOCUS_15810 26697 26230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 26911 26669 gene locus_tag LOCUS_15820 26911 26669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 28179 26911 gene locus_tag LOCUS_15830 28179 26911 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_15830 28551 28784 gene locus_tag LOCUS_15840 gene vapB 28551 28784 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170066.1 protein_id gnl|my_center|LOCUS_15840 28784 29188 gene locus_tag LOCUS_15850 gene vapC 28784 29188 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170069.1 protein_id gnl|my_center|LOCUS_15850 30833 29796 gene locus_tag LOCUS_15860 30833 29796 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_15860 31275 30853 gene locus_tag LOCUS_15870 31275 30853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 33140 31740 gene locus_tag LOCUS_15880 33140 31740 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039991.1 protein_id gnl|my_center|LOCUS_15880 34373 33363 gene locus_tag LOCUS_15890 34373 33363 CDS product GSU2403 family nucleotidyltransferase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039643590.1 protein_id gnl|my_center|LOCUS_15890 34745 34536 gene locus_tag LOCUS_15900 34745 34536 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_15900 35033 34752 gene locus_tag LOCUS_15910 35033 34752 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_15910 36286 35270 gene locus_tag LOCUS_15920 gene galE 36286 35270 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_15920 36690 36436 gene locus_tag LOCUS_15930 36690 36436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 36918 38255 gene locus_tag LOCUS_15940 36918 38255 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932902.1 protein_id gnl|my_center|LOCUS_15940 38508 41141 gene locus_tag LOCUS_15950 38508 41141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 41690 41163 gene locus_tag LOCUS_15960 41690 41163 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931084.1 protein_id gnl|my_center|LOCUS_15960 41766 41933 gene locus_tag LOCUS_15970 41766 41933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 42124 41918 gene locus_tag LOCUS_15980 42124 41918 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812516.1 protein_id gnl|my_center|LOCUS_15980 43586 42579 gene locus_tag LOCUS_15990 43586 42579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 44282 45379 gene locus_tag LOCUS_16000 44282 45379 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880302.1 protein_id gnl|my_center|LOCUS_16000 45280 45498 gene locus_tag LOCUS_16010 45280 45498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 46299 46808 gene locus_tag LOCUS_16020 46299 46808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence20 393 317 gene locus_tag LOCUS_t00240 393 317 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 822 430 gene locus_tag LOCUS_16030 822 430 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812822.1 protein_id gnl|my_center|LOCUS_16030 1170 838 gene locus_tag LOCUS_16040 1170 838 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812826.1 protein_id gnl|my_center|LOCUS_16040 3597 1180 gene locus_tag LOCUS_16050 gene pheT 3597 1180 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039594.1 protein_id gnl|my_center|LOCUS_16050 4702 3680 gene locus_tag LOCUS_16060 gene pheS 4702 3680 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926359.1 protein_id gnl|my_center|LOCUS_16060 5201 4842 gene locus_tag LOCUS_16070 gene rplT 5201 4842 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812832.1 protein_id gnl|my_center|LOCUS_16070 5483 5214 gene locus_tag LOCUS_16080 5483 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 5960 5703 gene locus_tag LOCUS_16090 5960 5703 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931105.1 protein_id gnl|my_center|LOCUS_16090 6229 6567 gene locus_tag LOCUS_16100 6229 6567 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812839.1 protein_id gnl|my_center|LOCUS_16100 6585 7829 gene locus_tag LOCUS_16110 6585 7829 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 protein_id gnl|my_center|LOCUS_16110 9738 7954 gene locus_tag LOCUS_16120 gene ptsP 9738 7954 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039635.1 protein_id gnl|my_center|LOCUS_16120 9982 9713 gene locus_tag LOCUS_16130 9982 9713 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812598.1 protein_id gnl|my_center|LOCUS_16130 10441 10031 gene locus_tag LOCUS_16140 10441 10031 CDS product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812601.1 protein_id gnl|my_center|LOCUS_16140 11396 10434 gene locus_tag LOCUS_16150 gene gshB 11396 10434 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812603.1 protein_id gnl|my_center|LOCUS_16150 11830 11393 gene locus_tag LOCUS_16160 gene infC 11830 11393 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446215.1 protein_id gnl|my_center|LOCUS_16160 13903 11963 gene locus_tag LOCUS_16170 gene thrS 13903 11963 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812608.1 protein_id gnl|my_center|LOCUS_16170 13994 15046 gene locus_tag LOCUS_16180 13994 15046 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815466.1 protein_id gnl|my_center|LOCUS_16180 15113 15337 gene locus_tag LOCUS_16190 15113 15337 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810411.1 protein_id gnl|my_center|LOCUS_16190 15539 15463 gene locus_tag LOCUS_t00250 15539 15463 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 16265 15603 gene locus_tag LOCUS_16200 16265 15603 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064048.1 protein_id gnl|my_center|LOCUS_16200 17081 16275 gene locus_tag LOCUS_16210 gene truA 17081 16275 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812640.1 protein_id gnl|my_center|LOCUS_16210 18445 17081 gene locus_tag LOCUS_16220 18445 17081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 19674 18583 gene locus_tag LOCUS_16230 gene asd 19674 18583 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812646.1 protein_id gnl|my_center|LOCUS_16230 20874 19792 gene locus_tag LOCUS_16240 gene leuB 20874 19792 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812648.1 protein_id gnl|my_center|LOCUS_16240 21530 20871 gene locus_tag LOCUS_16250 gene leuD 21530 20871 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926388.1 protein_id gnl|my_center|LOCUS_16250 22942 21539 gene locus_tag LOCUS_16260 gene leuC 22942 21539 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_16260 24164 23106 gene locus_tag LOCUS_16270 gene aroC 24164 23106 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820487.1 protein_id gnl|my_center|LOCUS_16270 24709 24287 gene locus_tag LOCUS_16280 24709 24287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 24745 25620 gene locus_tag LOCUS_16290 24745 25620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 25669 26127 gene locus_tag LOCUS_16300 25669 26127 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812703.1 protein_id gnl|my_center|LOCUS_16300 27139 26129 gene locus_tag LOCUS_16310 gene dusA 27139 26129 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930178.1 protein_id gnl|my_center|LOCUS_16310 27245 28219 gene locus_tag LOCUS_16320 27245 28219 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812707.1 protein_id gnl|my_center|LOCUS_16320 28223 29002 gene locus_tag LOCUS_16330 28223 29002 CDS product BPSS1780 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812709.1 protein_id gnl|my_center|LOCUS_16330 29110 28910 gene locus_tag LOCUS_16340 29110 28910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 30099 29305 gene locus_tag LOCUS_16350 30099 29305 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928273.1 protein_id gnl|my_center|LOCUS_16350 30983 30114 gene locus_tag LOCUS_16360 30983 30114 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136348290.1 protein_id gnl|my_center|LOCUS_16360 32593 30965 gene locus_tag LOCUS_16370 32593 30965 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064053.1 protein_id gnl|my_center|LOCUS_16370 33908 32595 gene locus_tag LOCUS_16380 33908 32595 CDS product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064054.1 protein_id gnl|my_center|LOCUS_16380 34861 34031 gene locus_tag LOCUS_16390 gene cpaB 34861 34031 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128354298.1 protein_id gnl|my_center|LOCUS_16390 35037 34858 gene locus_tag LOCUS_16400 35037 34858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 35813 35253 gene locus_tag LOCUS_16410 35813 35253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 37161 35797 gene locus_tag LOCUS_16420 37161 35797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926376.1 protein_id gnl|my_center|LOCUS_16420 37393 37172 gene locus_tag LOCUS_16430 37393 37172 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812728.1 protein_id gnl|my_center|LOCUS_16430 38067 37627 gene locus_tag LOCUS_16440 gene dtd 38067 37627 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922140.1 protein_id gnl|my_center|LOCUS_16440 38194 39363 gene locus_tag LOCUS_16450 gene ugd 38194 39363 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706040.1 protein_id gnl|my_center|LOCUS_16450 39831 39397 gene locus_tag LOCUS_16460 gene arfB 39831 39397 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193488.1 protein_id gnl|my_center|LOCUS_16460 40415 41239 gene locus_tag LOCUS_16470 gene hpnC 40415 41239 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040123.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence21 2095 818 gene locus_tag LOCUS_16480 gene lplT 2095 818 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813878.1 protein_id gnl|my_center|LOCUS_16480 2218 5793 gene locus_tag LOCUS_16490 gene smc 2218 5793 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931537.1 protein_id gnl|my_center|LOCUS_16490 5871 6920 gene locus_tag LOCUS_16500 5871 6920 CDS product cell division protein ZipA C-terminal FtsZ-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813876.1 protein_id gnl|my_center|LOCUS_16500 6968 9004 gene locus_tag LOCUS_16510 gene ligA 6968 9004 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813875.1 protein_id gnl|my_center|LOCUS_16510 9915 9139 gene locus_tag LOCUS_16520 9915 9139 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813874.1 protein_id gnl|my_center|LOCUS_16520 10187 9912 gene locus_tag LOCUS_16530 10187 9912 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813873.1 protein_id gnl|my_center|LOCUS_16530 10761 10171 gene locus_tag LOCUS_16540 10761 10171 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813872.1 protein_id gnl|my_center|LOCUS_16540 11159 10758 gene locus_tag LOCUS_16550 gene msrB 11159 10758 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813871.1 protein_id gnl|my_center|LOCUS_16550 11212 11892 gene locus_tag LOCUS_16560 11212 11892 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813870.1 protein_id gnl|my_center|LOCUS_16560 11889 12554 gene locus_tag LOCUS_16570 11889 12554 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389087.1 protein_id gnl|my_center|LOCUS_16570 12587 13171 gene locus_tag LOCUS_16580 12587 13171 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931542.1 protein_id gnl|my_center|LOCUS_16580 13858 13193 gene locus_tag LOCUS_16590 13858 13193 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813381.1 protein_id gnl|my_center|LOCUS_16590 14425 13955 gene locus_tag LOCUS_16600 14425 13955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 15071 14643 gene locus_tag LOCUS_16610 15071 14643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 15911 15162 gene locus_tag LOCUS_16620 gene ubiG 15911 15162 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448326.1 protein_id gnl|my_center|LOCUS_16620 16637 16071 gene locus_tag LOCUS_16630 16637 16071 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930094.1 protein_id gnl|my_center|LOCUS_16630 17133 19844 gene locus_tag LOCUS_16640 gene gyrA 17133 19844 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926826.1 protein_id gnl|my_center|LOCUS_16640 19850 20995 gene locus_tag LOCUS_16650 gene serC 19850 20995 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813372.1 protein_id gnl|my_center|LOCUS_16650 20988 22076 gene locus_tag LOCUS_16660 gene pheA 20988 22076 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813370.1 protein_id gnl|my_center|LOCUS_16660 22073 23221 gene locus_tag LOCUS_16670 gene hisC 22073 23221 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_16670 23218 24156 gene locus_tag LOCUS_16680 23218 24156 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930098.1 protein_id gnl|my_center|LOCUS_16680 24153 25487 gene locus_tag LOCUS_16690 gene aroA 24153 25487 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930099.1 protein_id gnl|my_center|LOCUS_16690 25484 26179 gene locus_tag LOCUS_16700 gene cmk 25484 26179 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813361.1 protein_id gnl|my_center|LOCUS_16700 26964 26173 gene locus_tag LOCUS_16710 26964 26173 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144051.1 protein_id gnl|my_center|LOCUS_16710 27248 28966 gene locus_tag LOCUS_16720 gene rpsA 27248 28966 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930101.1 protein_id gnl|my_center|LOCUS_16720 28990 29310 gene locus_tag LOCUS_16730 28990 29310 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928906.1 protein_id gnl|my_center|LOCUS_16730 29441 30373 gene locus_tag LOCUS_16740 29441 30373 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268560.1 protein_id gnl|my_center|LOCUS_16740 30418 30732 gene locus_tag LOCUS_16750 30418 30732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 30752 31978 gene locus_tag LOCUS_16760 gene lapB 30752 31978 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813352.1 protein_id gnl|my_center|LOCUS_16760 31978 32961 gene locus_tag LOCUS_16770 gene rfaE1 31978 32961 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813350.1 protein_id gnl|my_center|LOCUS_16770 32958 33968 gene locus_tag LOCUS_16780 gene rfaD 32958 33968 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813348.1 protein_id gnl|my_center|LOCUS_16780 34036 34542 gene locus_tag LOCUS_16790 34036 34542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 34652 35566 gene locus_tag LOCUS_16800 gene cysM 34652 35566 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930107.1 protein_id gnl|my_center|LOCUS_16800 36830 35649 gene locus_tag LOCUS_16810 gene mltB 36830 35649 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926823.1 protein_id gnl|my_center|LOCUS_16810 36840 37766 gene locus_tag LOCUS_16820 36840 37766 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821521.1 protein_id gnl|my_center|LOCUS_16820 37920 38669 gene locus_tag LOCUS_16830 37920 38669 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930110.1 protein_id gnl|my_center|LOCUS_16830 38673 39602 gene locus_tag LOCUS_16840 38673 39602 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813337.1 protein_id gnl|my_center|LOCUS_16840 39684 40559 gene locus_tag LOCUS_16850 gene cysQ 39684 40559 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818748.1 protein_id gnl|my_center|LOCUS_16850 <41590 40773 gene locus_tag LOCUS_16860 <41590 40773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022377.1:ISL3-like element ISMac21 family transposase >Feature sequence22 237 392 gene locus_tag LOCUS_16870 237 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 524 808 gene locus_tag LOCUS_16880 524 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 810 1118 gene locus_tag LOCUS_16890 810 1118 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038207.1 protein_id gnl|my_center|LOCUS_16890 1471 1746 gene locus_tag LOCUS_16900 1471 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 1811 2134 gene locus_tag LOCUS_16910 1811 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 2131 2556 gene locus_tag LOCUS_16920 2131 2556 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769733.1 protein_id gnl|my_center|LOCUS_16920 3975 2716 gene locus_tag LOCUS_16930 3975 2716 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063790.1 protein_id gnl|my_center|LOCUS_16930 4302 3985 gene locus_tag LOCUS_16940 4302 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 4519 5190 gene locus_tag LOCUS_16950 4519 5190 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811971.1 protein_id gnl|my_center|LOCUS_16950 5259 5495 gene locus_tag LOCUS_16960 5259 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 5658 7166 gene locus_tag LOCUS_16970 5658 7166 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974780.1 protein_id gnl|my_center|LOCUS_16970 7316 8461 gene locus_tag LOCUS_16980 gene alr 7316 8461 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810492.1 protein_id gnl|my_center|LOCUS_16980 8827 10095 gene locus_tag LOCUS_16990 gene radA 8827 10095 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928233.1 protein_id gnl|my_center|LOCUS_16990 10120 12609 gene locus_tag LOCUS_17000 10120 12609 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_17000 12602 13348 gene locus_tag LOCUS_17010 12602 13348 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813264.1 protein_id gnl|my_center|LOCUS_17010 13535 14629 gene locus_tag LOCUS_17020 13535 14629 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813262.1 protein_id gnl|my_center|LOCUS_17020 14635 15765 gene locus_tag LOCUS_17030 gene potA 14635 15765 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813260.1 protein_id gnl|my_center|LOCUS_17030 15762 16700 gene locus_tag LOCUS_17040 15762 16700 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813258.1 protein_id gnl|my_center|LOCUS_17040 16697 17527 gene locus_tag LOCUS_17050 16697 17527 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813256.1 protein_id gnl|my_center|LOCUS_17050 17527 17880 gene locus_tag LOCUS_17060 17527 17880 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813253.1 protein_id gnl|my_center|LOCUS_17060 17877 19262 gene locus_tag LOCUS_17070 gene rmuC 17877 19262 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039504.1 protein_id gnl|my_center|LOCUS_17070 19259 19936 gene locus_tag LOCUS_17080 gene rpiA 19259 19936 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813244.1 protein_id gnl|my_center|LOCUS_17080 20011 20724 gene locus_tag LOCUS_17090 gene phoU 20011 20724 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853444.1 protein_id gnl|my_center|LOCUS_17090 21124 20852 gene locus_tag LOCUS_17100 21124 20852 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813239.1 protein_id gnl|my_center|LOCUS_17100 22659 21247 gene locus_tag LOCUS_17110 gene argA 22659 21247 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813237.1 protein_id gnl|my_center|LOCUS_17110 22800 26579 gene locus_tag LOCUS_17120 gene hrpA 22800 26579 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813236.1 protein_id gnl|my_center|LOCUS_17120 27302 26616 gene locus_tag LOCUS_17130 27302 26616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 28376 27477 gene locus_tag LOCUS_17140 gene lpxO 28376 27477 CDS product lipid A hydroxylase LpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995005.1 protein_id gnl|my_center|LOCUS_17140 28470 31901 gene locus_tag LOCUS_17150 gene dnaE 28470 31901 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813231.1 protein_id gnl|my_center|LOCUS_17150 32005 32946 gene locus_tag LOCUS_17160 32005 32946 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236433.1 protein_id gnl|my_center|LOCUS_17160 33654 32953 gene locus_tag LOCUS_17170 33654 32953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 33784 34461 gene locus_tag LOCUS_17180 33784 34461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 35386 34613 gene locus_tag LOCUS_17190 35386 34613 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813215.1 protein_id gnl|my_center|LOCUS_17190 36341 35406 gene locus_tag LOCUS_17200 36341 35406 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039510.1 protein_id gnl|my_center|LOCUS_17200 36564 38342 gene locus_tag LOCUS_17210 gene msbA 36564 38342 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928167.1 protein_id gnl|my_center|LOCUS_17210 39833 38361 gene locus_tag LOCUS_17220 gene rng 39833 38361 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813204.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence23 261 1277 gene locus_tag LOCUS_17230 gene pdhA 261 1277 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_17230 1268 2251 gene locus_tag LOCUS_17240 1268 2251 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929922.1 protein_id gnl|my_center|LOCUS_17240 2248 2760 gene locus_tag LOCUS_17250 2248 2760 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816847.1 protein_id gnl|my_center|LOCUS_17250 2757 4055 gene locus_tag LOCUS_17260 2757 4055 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812401.1 protein_id gnl|my_center|LOCUS_17260 4093 5097 gene locus_tag LOCUS_17270 4093 5097 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812403.1 protein_id gnl|my_center|LOCUS_17270 5328 5933 gene locus_tag LOCUS_17280 gene pncA 5328 5933 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385573.1 protein_id gnl|my_center|LOCUS_17280 8919 6280 gene locus_tag LOCUS_17290 8919 6280 CDS product autotransporter serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268617.1 protein_id gnl|my_center|LOCUS_17290 9458 9382 gene locus_tag LOCUS_t00260 9458 9382 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9547 10242 gene locus_tag LOCUS_17300 9547 10242 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_17300 10799 10347 gene locus_tag LOCUS_17310 10799 10347 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813017.1 protein_id gnl|my_center|LOCUS_17310 12272 10845 gene locus_tag LOCUS_17320 gene purB 12272 10845 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446450.1 protein_id gnl|my_center|LOCUS_17320 12430 13041 gene locus_tag LOCUS_17330 12430 13041 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931185.1 protein_id gnl|my_center|LOCUS_17330 14142 13042 gene locus_tag LOCUS_17340 gene mnmA 14142 13042 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039549.1 protein_id gnl|my_center|LOCUS_17340 14231 15349 gene locus_tag LOCUS_17350 14231 15349 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813035.1 protein_id gnl|my_center|LOCUS_17350 15351 15668 gene locus_tag LOCUS_17360 15351 15668 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813037.1 protein_id gnl|my_center|LOCUS_17360 15665 17101 gene locus_tag LOCUS_17370 15665 17101 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813039.1 protein_id gnl|my_center|LOCUS_17370 18375 17146 gene locus_tag LOCUS_17380 gene glcF 18375 17146 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813047.1 protein_id gnl|my_center|LOCUS_17380 19516 18389 gene locus_tag LOCUS_17390 gene glcE 19516 18389 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813049.1 protein_id gnl|my_center|LOCUS_17390 21031 19535 gene locus_tag LOCUS_17400 21031 19535 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813050.1 protein_id gnl|my_center|LOCUS_17400 22529 21117 gene locus_tag LOCUS_17410 22529 21117 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039542.1 protein_id gnl|my_center|LOCUS_17410 23639 22566 gene locus_tag LOCUS_17420 gene aroG 23639 22566 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813056.1 protein_id gnl|my_center|LOCUS_17420 25365 23908 gene locus_tag LOCUS_17430 gene tldD 25365 23908 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813059.1 protein_id gnl|my_center|LOCUS_17430 26289 25483 gene locus_tag LOCUS_17440 26289 25483 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813061.1 protein_id gnl|my_center|LOCUS_17440 26767 27150 gene locus_tag LOCUS_17450 26767 27150 CDS product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813062.1 protein_id gnl|my_center|LOCUS_17450 27357 30071 gene locus_tag LOCUS_17460 gene pepN 27357 30071 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930049.1 protein_id gnl|my_center|LOCUS_17460 30108 31133 gene locus_tag LOCUS_17470 30108 31133 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 protein_id gnl|my_center|LOCUS_17470 32277 31291 gene locus_tag LOCUS_17480 32277 31291 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813144.1 protein_id gnl|my_center|LOCUS_17480 32440 33171 gene locus_tag LOCUS_17490 32440 33171 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813187.1 protein_id gnl|my_center|LOCUS_17490 33216 34505 gene locus_tag LOCUS_17500 gene purD 33216 34505 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930862.1 protein_id gnl|my_center|LOCUS_17500 34502 35458 gene locus_tag LOCUS_17510 gene hemF 34502 35458 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930863.1 protein_id gnl|my_center|LOCUS_17510 35458 36057 gene locus_tag LOCUS_17520 gene nadD 35458 36057 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930864.1 protein_id gnl|my_center|LOCUS_17520 36088 36726 gene locus_tag LOCUS_17530 36088 36726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 36729 37202 gene locus_tag LOCUS_17540 gene rlmH 36729 37202 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813199.1 protein_id gnl|my_center|LOCUS_17540 37205 37816 gene locus_tag LOCUS_17550 37205 37816 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930865.1 protein_id gnl|my_center|LOCUS_17550 37813 38376 gene locus_tag LOCUS_17560 gene phnN 37813 38376 CDS product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975692.1 protein_id gnl|my_center|LOCUS_17560 39429 38521 gene locus_tag LOCUS_17570 39429 38521 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807047.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence24 2027 1662 gene locus_tag LOCUS_17580 2027 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 3188 2328 gene locus_tag LOCUS_17590 3188 2328 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814205.1 protein_id gnl|my_center|LOCUS_17590 3282 4646 gene locus_tag LOCUS_17600 3282 4646 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931462.1 protein_id gnl|my_center|LOCUS_17600 5110 4790 gene locus_tag LOCUS_17610 5110 4790 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085147429.1 protein_id gnl|my_center|LOCUS_17610 5427 5113 gene locus_tag LOCUS_17620 5427 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 6113 5646 gene locus_tag LOCUS_17630 6113 5646 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814215.1 protein_id gnl|my_center|LOCUS_17630 6285 7529 gene locus_tag LOCUS_17640 6285 7529 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814217.1 protein_id gnl|my_center|LOCUS_17640 7798 8472 gene locus_tag LOCUS_17650 7798 8472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 8465 9190 gene locus_tag LOCUS_17660 8465 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 9246 10253 gene locus_tag LOCUS_17670 gene dusB 9246 10253 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995141.1 protein_id gnl|my_center|LOCUS_17670 10266 10505 gene locus_tag LOCUS_17680 10266 10505 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039173.1 protein_id gnl|my_center|LOCUS_17680 10557 12149 gene locus_tag LOCUS_17690 gene purH 10557 12149 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814223.1 protein_id gnl|my_center|LOCUS_17690 12164 12724 gene locus_tag LOCUS_17700 gene ruvC 12164 12724 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814225.1 protein_id gnl|my_center|LOCUS_17700 12786 13355 gene locus_tag LOCUS_17710 gene ruvA 12786 13355 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814226.1 protein_id gnl|my_center|LOCUS_17710 13982 13452 gene locus_tag LOCUS_17720 13982 13452 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808796.1 protein_id gnl|my_center|LOCUS_17720 14915 13998 gene locus_tag LOCUS_17730 14915 13998 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065041.1 protein_id gnl|my_center|LOCUS_17730 15959 14928 gene locus_tag LOCUS_17740 15959 14928 CDS product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814230.1 protein_id gnl|my_center|LOCUS_17740 16039 17109 gene locus_tag LOCUS_17750 gene ruvB 16039 17109 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814231.1 protein_id gnl|my_center|LOCUS_17750 18741 17173 gene locus_tag LOCUS_17760 gene recQ 18741 17173 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927009.1 protein_id gnl|my_center|LOCUS_17760 19754 18738 gene locus_tag LOCUS_17770 19754 18738 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814243.1 protein_id gnl|my_center|LOCUS_17770 20908 19751 gene locus_tag LOCUS_17780 20908 19751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 21014 22786 gene locus_tag LOCUS_17790 21014 22786 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814246.1 protein_id gnl|my_center|LOCUS_17790 22796 23578 gene locus_tag LOCUS_17800 gene minC 22796 23578 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931362.1 protein_id gnl|my_center|LOCUS_17800 23723 24538 gene locus_tag LOCUS_17810 gene minD 23723 24538 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814250.1 protein_id gnl|my_center|LOCUS_17810 24538 24801 gene locus_tag LOCUS_17820 gene minE 24538 24801 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814252.1 protein_id gnl|my_center|LOCUS_17820 26189 24954 gene locus_tag LOCUS_17830 26189 24954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 26966 26415 gene locus_tag LOCUS_17840 26966 26415 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814256.1 protein_id gnl|my_center|LOCUS_17840 28664 26991 gene locus_tag LOCUS_17850 gene ettA 28664 26991 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814257.1 protein_id gnl|my_center|LOCUS_17850 28858 29352 gene locus_tag LOCUS_17860 28858 29352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039167.1 protein_id gnl|my_center|LOCUS_17860 30182 29400 gene locus_tag LOCUS_17870 30182 29400 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181512989.1 protein_id gnl|my_center|LOCUS_17870 30341 31294 gene locus_tag LOCUS_17880 30341 31294 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203335.1 protein_id gnl|my_center|LOCUS_17880 31864 31319 gene locus_tag LOCUS_17890 31864 31319 CDS product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082483.1 protein_id gnl|my_center|LOCUS_17890 32140 33303 gene locus_tag LOCUS_17900 32140 33303 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339252.1 protein_id gnl|my_center|LOCUS_17900 33406 33987 gene locus_tag LOCUS_17910 33406 33987 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339251.1 protein_id gnl|my_center|LOCUS_17910 33984 35396 gene locus_tag LOCUS_17920 33984 35396 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339250.1 protein_id gnl|my_center|LOCUS_17920 35400 36758 gene locus_tag LOCUS_17930 35400 36758 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339249.1 protein_id gnl|my_center|LOCUS_17930 36755 36958 gene locus_tag LOCUS_17940 36755 36958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 37858 37052 gene locus_tag LOCUS_17950 37858 37052 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024997765.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence25 196 864 gene locus_tag LOCUS_17960 196 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 837 977 gene locus_tag LOCUS_17970 837 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1080 2381 gene locus_tag LOCUS_17980 1080 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2460 3158 gene locus_tag LOCUS_17990 2460 3158 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814239.1 protein_id gnl|my_center|LOCUS_17990 3212 4540 gene locus_tag LOCUS_18000 3212 4540 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927010.1 protein_id gnl|my_center|LOCUS_18000 5171 4653 gene locus_tag LOCUS_18010 5171 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 5340 6434 gene locus_tag LOCUS_18020 5340 6434 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_18020 7076 6465 gene locus_tag LOCUS_18030 7076 6465 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135175700.1 protein_id gnl|my_center|LOCUS_18030 7615 7079 gene locus_tag LOCUS_18040 7615 7079 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965676.1 protein_id gnl|my_center|LOCUS_18040 8965 7649 gene locus_tag LOCUS_18050 8965 7649 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_18050 10034 8973 gene locus_tag LOCUS_18060 10034 8973 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011771878.1 protein_id gnl|my_center|LOCUS_18060 10157 11227 gene locus_tag LOCUS_18070 10157 11227 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339267.1 protein_id gnl|my_center|LOCUS_18070 12507 11224 gene locus_tag LOCUS_18080 12507 11224 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808794.1 protein_id gnl|my_center|LOCUS_18080 13974 12637 gene locus_tag LOCUS_18090 13974 12637 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450547.1 protein_id gnl|my_center|LOCUS_18090 14001 14828 gene locus_tag LOCUS_18100 14001 14828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 15196 15825 gene locus_tag LOCUS_18110 15196 15825 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_18110 15925 17346 gene locus_tag LOCUS_18120 gene proP 15925 17346 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198608.1 protein_id gnl|my_center|LOCUS_18120 18369 17341 gene locus_tag LOCUS_18130 18369 17341 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525879.1 protein_id gnl|my_center|LOCUS_18130 19075 18458 gene locus_tag LOCUS_18140 19075 18458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 20278 19097 gene locus_tag LOCUS_18150 20278 19097 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388724.1 protein_id gnl|my_center|LOCUS_18150 21187 20288 gene locus_tag LOCUS_18160 21187 20288 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088409.1 protein_id gnl|my_center|LOCUS_18160 21988 21188 gene locus_tag LOCUS_18170 21988 21188 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337815.1 protein_id gnl|my_center|LOCUS_18170 24384 22003 gene locus_tag LOCUS_18180 24384 22003 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_18180 24873 24406 gene locus_tag LOCUS_18190 24873 24406 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_18190 26090 25194 gene locus_tag LOCUS_18200 gene floA 26090 25194 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_18200 26791 26111 gene locus_tag LOCUS_18210 26791 26111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 27786 26803 gene locus_tag LOCUS_18220 gene floA 27786 26803 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_18220 29186 27786 gene locus_tag LOCUS_18230 29186 27786 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583133.1 protein_id gnl|my_center|LOCUS_18230 30844 29201 gene locus_tag LOCUS_18240 30844 29201 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724194.1 protein_id gnl|my_center|LOCUS_18240 31337 30864 gene locus_tag LOCUS_18250 31337 30864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 32473 31505 gene locus_tag LOCUS_18260 32473 31505 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582705.1 protein_id gnl|my_center|LOCUS_18260 32850 33683 gene locus_tag LOCUS_18270 32850 33683 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040702.1 protein_id gnl|my_center|LOCUS_18270 33809 34978 gene locus_tag LOCUS_18280 33809 34978 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083642.1 protein_id gnl|my_center|LOCUS_18280 34975 35754 gene locus_tag LOCUS_18290 34975 35754 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_18290 35751 36797 gene locus_tag LOCUS_18300 35751 36797 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence26 641 321 gene locus_tag LOCUS_18310 641 321 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103139.1 protein_id gnl|my_center|LOCUS_18310 927 649 gene locus_tag LOCUS_18320 927 649 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_18320 1012 1194 gene locus_tag LOCUS_18330 1012 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 1583 1281 gene locus_tag LOCUS_18340 1583 1281 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_18340 3668 2070 gene locus_tag LOCUS_18350 3668 2070 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 protein_id gnl|my_center|LOCUS_18350 3849 4826 gene locus_tag LOCUS_18360 3849 4826 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_18360 4843 5172 gene locus_tag LOCUS_18370 4843 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 5768 6265 gene locus_tag LOCUS_18380 5768 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 6306 7193 gene locus_tag LOCUS_18390 6306 7193 CDS product metallo-mystery pair system four-Cys motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383153.1 protein_id gnl|my_center|LOCUS_18390 7224 8354 gene locus_tag LOCUS_18400 7224 8354 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538117.1 protein_id gnl|my_center|LOCUS_18400 8693 9592 gene locus_tag LOCUS_18410 8693 9592 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948436.1 protein_id gnl|my_center|LOCUS_18410 11495 9624 gene locus_tag LOCUS_18420 11495 9624 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191791.1 protein_id gnl|my_center|LOCUS_18420 11851 13035 gene locus_tag LOCUS_18430 11851 13035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 13092 13442 gene locus_tag LOCUS_18440 13092 13442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 13573 14406 gene locus_tag LOCUS_18450 13573 14406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 14403 14984 gene locus_tag LOCUS_18460 14403 14984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 14987 15523 gene locus_tag LOCUS_18470 14987 15523 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501457.1 protein_id gnl|my_center|LOCUS_18470 16997 15606 gene locus_tag LOCUS_18480 16997 15606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 17633 17004 gene locus_tag LOCUS_18490 17633 17004 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811946.1 protein_id gnl|my_center|LOCUS_18490 17768 17974 gene locus_tag LOCUS_18500 17768 17974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 17999 18214 gene locus_tag LOCUS_18510 17999 18214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 18395 19288 gene locus_tag LOCUS_18520 18395 19288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926621.1 protein_id gnl|my_center|LOCUS_18520 19424 20395 gene locus_tag LOCUS_18530 19424 20395 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121074.1 protein_id gnl|my_center|LOCUS_18530 20649 22190 gene locus_tag LOCUS_18540 20649 22190 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976039.1 protein_id gnl|my_center|LOCUS_18540 22209 23513 gene locus_tag LOCUS_18550 22209 23513 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263718.1 protein_id gnl|my_center|LOCUS_18550 24973 23570 gene locus_tag LOCUS_18560 24973 23570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 26721 25120 gene locus_tag LOCUS_18570 gene hpxW 26721 25120 CDS product oxamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705415.1 protein_id gnl|my_center|LOCUS_18570 28103 26778 gene locus_tag LOCUS_18580 28103 26778 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_18580 28659 28096 gene locus_tag LOCUS_18590 28659 28096 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 protein_id gnl|my_center|LOCUS_18590 29759 28656 gene locus_tag LOCUS_18600 29759 28656 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_18600 30039 32288 gene locus_tag LOCUS_18610 30039 32288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 33456 32323 gene locus_tag LOCUS_18620 33456 32323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 35254 33854 gene locus_tag LOCUS_18630 35254 33854 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115437.1 protein_id gnl|my_center|LOCUS_18630 36108 35269 gene locus_tag LOCUS_18640 36108 35269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence27 33 230 gene locus_tag LOCUS_18650 33 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1625 123 gene locus_tag LOCUS_18660 gene ppx 1625 123 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930172.1 protein_id gnl|my_center|LOCUS_18660 1763 3913 gene locus_tag LOCUS_18670 gene ppk1 1763 3913 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809633.1 protein_id gnl|my_center|LOCUS_18670 3944 4020 gene locus_tag LOCUS_t00270 3944 4020 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4282 4440 gene locus_tag LOCUS_18680 4282 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 4440 4778 gene locus_tag LOCUS_18690 4440 4778 CDS product type II toxin-antitoxin system ChpB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266694.1 protein_id gnl|my_center|LOCUS_18690 6258 4876 gene locus_tag LOCUS_18700 6258 4876 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389222.1 protein_id gnl|my_center|LOCUS_18700 8698 6263 gene locus_tag LOCUS_18710 8698 6263 CDS product DUF3141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947872.1 protein_id gnl|my_center|LOCUS_18710 9616 8843 gene locus_tag LOCUS_18720 gene fabI 9616 8843 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390974.1 protein_id gnl|my_center|LOCUS_18720 9784 10455 gene locus_tag LOCUS_18730 9784 10455 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389137.1 protein_id gnl|my_center|LOCUS_18730 10465 11136 gene locus_tag LOCUS_18740 10465 11136 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389225.1 protein_id gnl|my_center|LOCUS_18740 11178 12203 gene locus_tag LOCUS_18750 11178 12203 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810145.1 protein_id gnl|my_center|LOCUS_18750 13088 12309 gene locus_tag LOCUS_18760 gene pstB 13088 12309 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448479.1 protein_id gnl|my_center|LOCUS_18760 13964 13107 gene locus_tag LOCUS_18770 gene pstA 13964 13107 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521821.1 protein_id gnl|my_center|LOCUS_18770 14965 13973 gene locus_tag LOCUS_18780 gene pstC 14965 13973 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703914.1 protein_id gnl|my_center|LOCUS_18780 16064 15039 gene locus_tag LOCUS_18790 gene pstS 16064 15039 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930170.1 protein_id gnl|my_center|LOCUS_18790 16330 17538 gene locus_tag LOCUS_18800 16330 17538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 17558 18598 gene locus_tag LOCUS_18810 17558 18598 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704186.1 protein_id gnl|my_center|LOCUS_18810 19424 18660 gene locus_tag LOCUS_18820 19424 18660 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704187.1 protein_id gnl|my_center|LOCUS_18820 19524 20609 gene locus_tag LOCUS_18830 19524 20609 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125727.1 protein_id gnl|my_center|LOCUS_18830 20610 21839 gene locus_tag LOCUS_18840 gene arsJ 20610 21839 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798948.1 protein_id gnl|my_center|LOCUS_18840 23035 21836 gene locus_tag LOCUS_18850 23035 21836 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112709.1 protein_id gnl|my_center|LOCUS_18850 28606 23042 gene locus_tag LOCUS_18860 gene uvrA 28606 23042 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814283.1 protein_id gnl|my_center|LOCUS_18860 28645 28773 gene locus_tag LOCUS_18870 28645 28773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018026767.1 protein_id gnl|my_center|LOCUS_18870 29035 30609 gene locus_tag LOCUS_18880 29035 30609 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931365.1 protein_id gnl|my_center|LOCUS_18880 30664 31650 gene locus_tag LOCUS_18890 30664 31650 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814271.1 protein_id gnl|my_center|LOCUS_18890 31650 32561 gene locus_tag LOCUS_18900 31650 32561 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065035.1 protein_id gnl|my_center|LOCUS_18900 32569 33540 gene locus_tag LOCUS_18910 32569 33540 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814268.1 protein_id gnl|my_center|LOCUS_18910 33537 34556 gene locus_tag LOCUS_18920 33537 34556 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039166.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence28 1119 1454 gene locus_tag LOCUS_18930 1119 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 3503 2940 gene locus_tag LOCUS_18940 3503 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 4234 7920 gene locus_tag LOCUS_18950 4234 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 8880 8623 gene locus_tag LOCUS_18960 8880 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 9019 10647 gene locus_tag LOCUS_18970 9019 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 11429 10671 gene locus_tag LOCUS_18980 11429 10671 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256806.1 protein_id gnl|my_center|LOCUS_18980 11766 11422 gene locus_tag LOCUS_18990 11766 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 12904 11816 gene locus_tag LOCUS_19000 12904 11816 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_19000 13921 12929 gene locus_tag LOCUS_19010 13921 12929 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_19010 14836 13922 gene locus_tag LOCUS_19020 14836 13922 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_19020 17288 16011 gene locus_tag LOCUS_19030 17288 16011 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038930.1 protein_id gnl|my_center|LOCUS_19030 17578 17288 gene locus_tag LOCUS_19040 17578 17288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 18175 17822 gene locus_tag LOCUS_19050 18175 17822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 18743 18138 gene locus_tag LOCUS_19060 18743 18138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19060 19589 19227 gene locus_tag LOCUS_19070 19589 19227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 19589 19855 gene locus_tag LOCUS_19080 19589 19855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 20738 19902 gene locus_tag LOCUS_19090 20738 19902 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161532938.1 protein_id gnl|my_center|LOCUS_19090 24165 20791 gene locus_tag LOCUS_19100 24165 20791 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044393613.1 protein_id gnl|my_center|LOCUS_19100 24354 25625 gene locus_tag LOCUS_19110 gene urtA 24354 25625 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767480.1 protein_id gnl|my_center|LOCUS_19110 25760 26674 gene locus_tag LOCUS_19120 gene urtB 25760 26674 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083789.1 protein_id gnl|my_center|LOCUS_19120 26712 27899 gene locus_tag LOCUS_19130 gene urtC 26712 27899 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104863.1 protein_id gnl|my_center|LOCUS_19130 27918 28661 gene locus_tag LOCUS_19140 gene urtD 27918 28661 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104862.1 protein_id gnl|my_center|LOCUS_19140 28672 29361 gene locus_tag LOCUS_19150 gene urtE 28672 29361 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083792.1 protein_id gnl|my_center|LOCUS_19150 29403 30629 gene locus_tag LOCUS_19160 29403 30629 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008540630.1 protein_id gnl|my_center|LOCUS_19160 30659 31015 gene locus_tag LOCUS_19170 30659 31015 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104861.1 protein_id gnl|my_center|LOCUS_19170 31099 32097 gene locus_tag LOCUS_19180 31099 32097 CDS product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083793.1 protein_id gnl|my_center|LOCUS_19180 32168 32917 gene locus_tag LOCUS_19190 gene nirQ 32168 32917 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_19190 32985 34607 gene locus_tag LOCUS_19200 32985 34607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence29 175 522 gene locus_tag LOCUS_19210 175 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814593.1 protein_id gnl|my_center|LOCUS_19210 868 596 gene locus_tag LOCUS_19220 868 596 CDS product SWIB/MDM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814592.1 protein_id gnl|my_center|LOCUS_19220 1014 2207 gene locus_tag LOCUS_19230 1014 2207 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820761.1 protein_id gnl|my_center|LOCUS_19230 2275 3342 gene locus_tag LOCUS_19240 gene pyrC 2275 3342 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814588.1 protein_id gnl|my_center|LOCUS_19240 5132 3327 gene locus_tag LOCUS_19250 5132 3327 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814586.1 protein_id gnl|my_center|LOCUS_19250 5474 5262 gene locus_tag LOCUS_19260 5474 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 5794 6222 gene locus_tag LOCUS_19270 gene mraZ 5794 6222 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931263.1 protein_id gnl|my_center|LOCUS_19270 6226 7191 gene locus_tag LOCUS_19280 gene rsmH 6226 7191 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814582.1 protein_id gnl|my_center|LOCUS_19280 7191 7481 gene locus_tag LOCUS_19290 gene ftsL 7191 7481 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814581.1 protein_id gnl|my_center|LOCUS_19290 7481 9223 gene locus_tag LOCUS_19300 7481 9223 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446492.1 protein_id gnl|my_center|LOCUS_19300 9220 12039 gene locus_tag LOCUS_19310 gene murF 9220 12039 CDS product bifunctional UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase MurE/UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase MurF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064959.1 protein_id gnl|my_center|LOCUS_19310 12029 13201 gene locus_tag LOCUS_19320 gene mraY 12029 13201 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247664.1 protein_id gnl|my_center|LOCUS_19320 13198 14727 gene locus_tag LOCUS_19330 gene murD 13198 14727 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039093.1 protein_id gnl|my_center|LOCUS_19330 14724 15917 gene locus_tag LOCUS_19340 gene ftsW 14724 15917 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931258.1 protein_id gnl|my_center|LOCUS_19340 15914 16990 gene locus_tag LOCUS_19350 gene murG 15914 16990 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039095.1 protein_id gnl|my_center|LOCUS_19350 16987 18384 gene locus_tag LOCUS_19360 gene murC 16987 18384 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814572.1 protein_id gnl|my_center|LOCUS_19360 18381 19352 gene locus_tag LOCUS_19370 18381 19352 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 protein_id gnl|my_center|LOCUS_19370 19356 20162 gene locus_tag LOCUS_19380 19356 20162 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814570.1 protein_id gnl|my_center|LOCUS_19380 20167 21393 gene locus_tag LOCUS_19390 gene ftsA 20167 21393 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814569.1 protein_id gnl|my_center|LOCUS_19390 21561 22724 gene locus_tag LOCUS_19400 gene ftsZ 21561 22724 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814568.1 protein_id gnl|my_center|LOCUS_19400 22901 23824 gene locus_tag LOCUS_19410 gene lpxC 22901 23824 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814567.1 protein_id gnl|my_center|LOCUS_19410 24342 23884 gene locus_tag LOCUS_19420 24342 23884 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931255.1 protein_id gnl|my_center|LOCUS_19420 24521 24997 gene locus_tag LOCUS_19430 24521 24997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 25066 27831 gene locus_tag LOCUS_19440 gene secA 25066 27831 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064961.1 protein_id gnl|my_center|LOCUS_19440 28158 30050 gene locus_tag LOCUS_19450 gene ftsH 28158 30050 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809623.1 protein_id gnl|my_center|LOCUS_19450 30062 30910 gene locus_tag LOCUS_19460 gene folP 30062 30910 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 protein_id gnl|my_center|LOCUS_19460 30907 32241 gene locus_tag LOCUS_19470 gene glmM 30907 32241 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809628.1 protein_id gnl|my_center|LOCUS_19470 32323 33099 gene locus_tag LOCUS_19480 32323 33099 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809629.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence30 266 928 gene locus_tag LOCUS_19490 266 928 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930296.1 protein_id gnl|my_center|LOCUS_19490 1678 971 gene locus_tag LOCUS_19500 1678 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 2494 1718 gene locus_tag LOCUS_19510 2494 1718 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448020.1 protein_id gnl|my_center|LOCUS_19510 3534 2491 gene locus_tag LOCUS_19520 gene holB 3534 2491 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039871.1 protein_id gnl|my_center|LOCUS_19520 4177 3536 gene locus_tag LOCUS_19530 gene tmk 4177 3536 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811733.1 protein_id gnl|my_center|LOCUS_19530 5224 4181 gene locus_tag LOCUS_19540 gene mltG 5224 4181 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930596.1 protein_id gnl|my_center|LOCUS_19540 5677 6477 gene locus_tag LOCUS_19550 5677 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 7625 6501 gene locus_tag LOCUS_19560 7625 6501 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811746.1 protein_id gnl|my_center|LOCUS_19560 7929 7615 gene locus_tag LOCUS_19570 7929 7615 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063760.1 protein_id gnl|my_center|LOCUS_19570 8356 7943 gene locus_tag LOCUS_19580 8356 7943 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811752.1 protein_id gnl|my_center|LOCUS_19580 8444 8902 gene locus_tag LOCUS_19590 gene smpB 8444 8902 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811754.1 protein_id gnl|my_center|LOCUS_19590 11334 8974 gene locus_tag LOCUS_19600 gene ppsA 11334 8974 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811764.1 protein_id gnl|my_center|LOCUS_19600 11554 12390 gene locus_tag LOCUS_19610 11554 12390 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063753.1 protein_id gnl|my_center|LOCUS_19610 13193 12384 gene locus_tag LOCUS_19620 13193 12384 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811768.1 protein_id gnl|my_center|LOCUS_19620 13777 13190 gene locus_tag LOCUS_19630 gene rnhB 13777 13190 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811770.1 protein_id gnl|my_center|LOCUS_19630 14955 13774 gene locus_tag LOCUS_19640 gene lpxB 14955 13774 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930356.1 protein_id gnl|my_center|LOCUS_19640 15746 14952 gene locus_tag LOCUS_19650 gene lpxA 15746 14952 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063749.1 protein_id gnl|my_center|LOCUS_19650 16199 15747 gene locus_tag LOCUS_19660 gene fabZ 16199 15747 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811776.1 protein_id gnl|my_center|LOCUS_19660 17360 16248 gene locus_tag LOCUS_19670 gene lpxD 17360 16248 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039864.1 protein_id gnl|my_center|LOCUS_19670 17996 17385 gene locus_tag LOCUS_19680 17996 17385 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811782.1 protein_id gnl|my_center|LOCUS_19680 20411 18069 gene locus_tag LOCUS_19690 gene bamA 20411 18069 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063747.1 protein_id gnl|my_center|LOCUS_19690 21814 20486 gene locus_tag LOCUS_19700 gene rseP 21814 20486 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930352.1 protein_id gnl|my_center|LOCUS_19700 23037 21808 gene locus_tag LOCUS_19710 23037 21808 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811788.1 protein_id gnl|my_center|LOCUS_19710 23879 23034 gene locus_tag LOCUS_19720 23879 23034 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063744.1 protein_id gnl|my_center|LOCUS_19720 24655 23882 gene locus_tag LOCUS_19730 gene uppS 24655 23882 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930350.1 protein_id gnl|my_center|LOCUS_19730 25279 24716 gene locus_tag LOCUS_19740 gene frr 25279 24716 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811796.1 protein_id gnl|my_center|LOCUS_19740 26012 25296 gene locus_tag LOCUS_19750 gene pyrH 26012 25296 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930349.1 protein_id gnl|my_center|LOCUS_19750 27078 26200 gene locus_tag LOCUS_19760 gene tsf 27078 26200 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926570.1 protein_id gnl|my_center|LOCUS_19760 28007 27252 gene locus_tag LOCUS_19770 gene rpsB 28007 27252 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811803.1 protein_id gnl|my_center|LOCUS_19770 28295 29095 gene locus_tag LOCUS_19780 gene map 28295 29095 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811806.1 protein_id gnl|my_center|LOCUS_19780 29103 31694 gene locus_tag LOCUS_19790 29103 31694 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811808.1 protein_id gnl|my_center|LOCUS_19790 31684 32175 gene locus_tag LOCUS_19800 31684 32175 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811812.1 protein_id gnl|my_center|LOCUS_19800 <32933 32404 gene locus_tag LOCUS_19810 <32933 32404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_140590772.1:IS630 family transposase note possible pseudo, internal stop codon >Feature sequence31 329 2332 gene locus_tag LOCUS_19820 gene ladS 329 2332 CDS product hybrid sensor histidine kinase/response regulator LadS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_19820 3037 2357 gene locus_tag LOCUS_19830 3037 2357 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529766.1 protein_id gnl|my_center|LOCUS_19830 4718 3054 gene locus_tag LOCUS_19840 4718 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 5525 4734 gene locus_tag LOCUS_19850 5525 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 8159 5538 gene locus_tag LOCUS_19860 gene tssH 8159 5538 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941102.1 protein_id gnl|my_center|LOCUS_19860 8651 8208 gene locus_tag LOCUS_19870 8651 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 9172 8684 gene locus_tag LOCUS_19880 9172 8684 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943794.1 protein_id gnl|my_center|LOCUS_19880 10687 9209 gene locus_tag LOCUS_19890 gene tssC 10687 9209 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200974.1 protein_id gnl|my_center|LOCUS_19890 11191 10703 gene locus_tag LOCUS_19900 gene tssB 11191 10703 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530571.1 protein_id gnl|my_center|LOCUS_19900 11440 13170 gene locus_tag LOCUS_19910 gene tssF 11440 13170 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200971.1 protein_id gnl|my_center|LOCUS_19910 13134 14144 gene locus_tag LOCUS_19920 gene tssG 13134 14144 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533373.1 protein_id gnl|my_center|LOCUS_19920 14589 14825 gene locus_tag LOCUS_19930 14589 14825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 15394 14801 gene locus_tag LOCUS_19940 15394 14801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 15618 16322 gene locus_tag LOCUS_19950 15618 16322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 16362 16745 gene locus_tag LOCUS_19960 16362 16745 CDS product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084357.1 protein_id gnl|my_center|LOCUS_19960 16856 18202 gene locus_tag LOCUS_19970 gene tssK 16856 18202 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536933.1 protein_id gnl|my_center|LOCUS_19970 18204 18878 gene locus_tag LOCUS_19980 18204 18878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 18878 22738 gene locus_tag LOCUS_19990 18878 22738 CDS product type VI secretion protein IcmF/TssM N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943786.1 protein_id gnl|my_center|LOCUS_19990 22851 24839 gene locus_tag LOCUS_20000 22851 24839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 24882 25577 gene locus_tag LOCUS_20010 24882 25577 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529057.1 protein_id gnl|my_center|LOCUS_20010 25985 25641 gene locus_tag LOCUS_20020 25985 25641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 26203 26754 gene locus_tag LOCUS_20030 26203 26754 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819665.1 protein_id gnl|my_center|LOCUS_20030 26782 27048 gene locus_tag LOCUS_20040 26782 27048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 27116 27397 gene locus_tag LOCUS_20050 27116 27397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 28261 27839 gene locus_tag LOCUS_20060 28261 27839 CDS product type II toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 protein_id gnl|my_center|LOCUS_20060 28665 28246 gene locus_tag LOCUS_20070 28665 28246 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038625.1 protein_id gnl|my_center|LOCUS_20070 29960 28782 gene locus_tag LOCUS_20080 29960 28782 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_20080 30586 30059 gene locus_tag LOCUS_20090 30586 30059 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931985.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence32 1210 1440 gene locus_tag LOCUS_20100 1210 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 1545 1811 gene locus_tag LOCUS_20110 1545 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2139 1849 gene locus_tag LOCUS_20120 2139 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20120 2519 2929 gene locus_tag LOCUS_20130 2519 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 2951 4012 gene locus_tag LOCUS_20140 2951 4012 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_20140 5309 4842 gene locus_tag LOCUS_20150 5309 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20150 5480 5644 gene locus_tag LOCUS_20160 5480 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 7016 5790 gene locus_tag LOCUS_20170 7016 5790 CDS product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB/ribosomal protein alanine acetyltransferase RimI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931534.1 protein_id gnl|my_center|LOCUS_20170 7280 8095 gene locus_tag LOCUS_20180 7280 8095 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530962.1 protein_id gnl|my_center|LOCUS_20180 8235 8065 gene locus_tag LOCUS_20190 8235 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 8253 8411 gene locus_tag LOCUS_20200 8253 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 8436 8789 gene locus_tag LOCUS_20210 8436 8789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 9838 9014 gene locus_tag LOCUS_20220 gene phnE 9838 9014 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104070585.1 protein_id gnl|my_center|LOCUS_20220 10647 9835 gene locus_tag LOCUS_20230 gene phnE 10647 9835 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 protein_id gnl|my_center|LOCUS_20230 11474 10647 gene locus_tag LOCUS_20240 gene phnC 11474 10647 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_20240 12584 11634 gene locus_tag LOCUS_20250 gene phnD 12584 11634 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538257.1 protein_id gnl|my_center|LOCUS_20250 12941 12750 gene locus_tag LOCUS_20260 12941 12750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 13063 13407 gene locus_tag LOCUS_20270 13063 13407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 13400 14503 gene locus_tag LOCUS_20280 13400 14503 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_20280 15564 14536 gene locus_tag LOCUS_20290 gene glpQ 15564 14536 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098017.1 protein_id gnl|my_center|LOCUS_20290 16822 16115 gene locus_tag LOCUS_20300 16822 16115 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763967.1 protein_id gnl|my_center|LOCUS_20300 18651 16822 gene locus_tag LOCUS_20310 gene atzF 18651 16822 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103526.1 protein_id gnl|my_center|LOCUS_20310 20386 18644 gene locus_tag LOCUS_20320 20386 18644 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086124.1 protein_id gnl|my_center|LOCUS_20320 21249 20401 gene locus_tag LOCUS_20330 21249 20401 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083858.1 protein_id gnl|my_center|LOCUS_20330 22261 21242 gene locus_tag LOCUS_20340 22261 21242 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083857.1 protein_id gnl|my_center|LOCUS_20340 23888 22275 gene locus_tag LOCUS_20350 23888 22275 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083856.1 protein_id gnl|my_center|LOCUS_20350 24397 25950 gene locus_tag LOCUS_20360 24397 25950 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957525.1 protein_id gnl|my_center|LOCUS_20360 27754 26030 gene locus_tag LOCUS_20370 27754 26030 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063696.1 protein_id gnl|my_center|LOCUS_20370 28070 28540 gene locus_tag LOCUS_20380 28070 28540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence33 714 559 gene locus_tag LOCUS_20390 714 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 1048 1383 gene locus_tag LOCUS_20400 1048 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 1407 2816 gene locus_tag LOCUS_20410 1407 2816 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817431.1 protein_id gnl|my_center|LOCUS_20410 3364 2930 gene locus_tag LOCUS_20420 3364 2930 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140283.1 protein_id gnl|my_center|LOCUS_20420 3721 3368 gene locus_tag LOCUS_20430 3721 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 7412 3822 gene locus_tag LOCUS_20440 7412 3822 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523124.1 protein_id gnl|my_center|LOCUS_20440 7946 7482 gene locus_tag LOCUS_20450 7946 7482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 8619 9425 gene locus_tag LOCUS_20460 8619 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 9775 10110 gene locus_tag LOCUS_20470 9775 10110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 10151 10375 gene locus_tag LOCUS_20480 10151 10375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20480 10801 11466 gene locus_tag LOCUS_20490 10801 11466 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401648.1 protein_id gnl|my_center|LOCUS_20490 11504 11713 gene locus_tag LOCUS_20500 11504 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 11859 12341 gene locus_tag LOCUS_20510 11859 12341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 12358 12978 gene locus_tag LOCUS_20520 12358 12978 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095305.1 protein_id gnl|my_center|LOCUS_20520 13319 13098 gene locus_tag LOCUS_20530 13319 13098 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041364541.1 protein_id gnl|my_center|LOCUS_20530 13572 13360 gene locus_tag LOCUS_20540 13572 13360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 13836 13639 gene locus_tag LOCUS_20550 13836 13639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 14135 13971 gene locus_tag LOCUS_20560 14135 13971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 14406 14780 gene locus_tag LOCUS_20570 14406 14780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 14790 15509 gene locus_tag LOCUS_20580 14790 15509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 15506 15949 gene locus_tag LOCUS_20590 15506 15949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 16929 15946 gene locus_tag LOCUS_20600 16929 15946 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150678942.1 protein_id gnl|my_center|LOCUS_20600 17437 17039 gene locus_tag LOCUS_20610 17437 17039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 17657 17935 gene locus_tag LOCUS_20620 17657 17935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 18048 18659 gene locus_tag LOCUS_20630 18048 18659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 20544 19507 gene locus_tag LOCUS_20640 20544 19507 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538073.1 protein_id gnl|my_center|LOCUS_20640 21128 20625 gene locus_tag LOCUS_20650 21128 20625 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928801.1 protein_id gnl|my_center|LOCUS_20650 22084 21125 gene locus_tag LOCUS_20660 22084 21125 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188904.1 protein_id gnl|my_center|LOCUS_20660 23345 22104 gene locus_tag LOCUS_20670 23345 22104 CDS product PrpF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160554901.1 protein_id gnl|my_center|LOCUS_20670 24612 23443 gene locus_tag LOCUS_20680 gene tcuB 24612 23443 CDS product tricarballylate utilization 4Fe-4S protein TcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813507.1 protein_id gnl|my_center|LOCUS_20680 26008 24599 gene locus_tag LOCUS_20690 gene tcuA 26008 24599 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228705.1 protein_id gnl|my_center|LOCUS_20690 27364 26012 gene locus_tag LOCUS_20700 gene pcaB 27364 26012 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090665.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence34 145 741 gene locus_tag LOCUS_20710 145 741 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807607.1 protein_id gnl|my_center|LOCUS_20710 784 2376 gene locus_tag LOCUS_20720 784 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2396 2623 gene locus_tag LOCUS_20730 2396 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 2838 3047 gene locus_tag LOCUS_20740 2838 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 3455 3829 gene locus_tag LOCUS_20750 3455 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 4308 3856 gene locus_tag LOCUS_20760 4308 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 5654 4305 gene locus_tag LOCUS_20770 5654 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 6112 5651 gene locus_tag LOCUS_20780 6112 5651 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_20780 7065 6688 gene locus_tag LOCUS_20790 7065 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 7534 6956 gene locus_tag LOCUS_20800 7534 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 7863 8087 gene locus_tag LOCUS_20810 7863 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 8084 8329 gene locus_tag LOCUS_20820 8084 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 8326 10467 gene locus_tag LOCUS_20830 8326 10467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 11599 11114 gene locus_tag LOCUS_20840 11599 11114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 11814 11611 gene locus_tag LOCUS_20850 11814 11611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 11949 12272 gene locus_tag LOCUS_20860 11949 12272 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895635.1 protein_id gnl|my_center|LOCUS_20860 12420 14516 gene locus_tag LOCUS_20870 12420 14516 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038162489.1 protein_id gnl|my_center|LOCUS_20870 14761 15678 gene locus_tag LOCUS_20880 14761 15678 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947828.1 protein_id gnl|my_center|LOCUS_20880 15675 16733 gene locus_tag LOCUS_20890 15675 16733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269295.1 protein_id gnl|my_center|LOCUS_20890 16879 17928 gene locus_tag LOCUS_20900 16879 17928 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 protein_id gnl|my_center|LOCUS_20900 18259 18089 gene locus_tag LOCUS_20910 18259 18089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 18734 19117 gene locus_tag LOCUS_20920 18734 19117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 19313 19924 gene locus_tag LOCUS_20930 19313 19924 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947367.1 protein_id gnl|my_center|LOCUS_20930 20012 21439 gene locus_tag LOCUS_20940 20012 21439 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806915.1 protein_id gnl|my_center|LOCUS_20940 21818 21540 gene locus_tag LOCUS_20950 gene rpsQ 21818 21540 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806913.1 protein_id gnl|my_center|LOCUS_20950 22012 21821 gene locus_tag LOCUS_20960 gene rpmC 22012 21821 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806912.1 protein_id gnl|my_center|LOCUS_20960 22452 22036 gene locus_tag LOCUS_20970 gene rplP 22452 22036 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806911.1 protein_id gnl|my_center|LOCUS_20970 23264 22455 gene locus_tag LOCUS_20980 gene rpsC 23264 22455 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806910.1 protein_id gnl|my_center|LOCUS_20980 23603 23274 gene locus_tag LOCUS_20990 gene rplV 23603 23274 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925688.1 protein_id gnl|my_center|LOCUS_20990 23882 23607 gene locus_tag LOCUS_21000 gene rpsS 23882 23607 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806908.1 protein_id gnl|my_center|LOCUS_21000 24721 23894 gene locus_tag LOCUS_21010 gene rplB 24721 23894 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806907.1 protein_id gnl|my_center|LOCUS_21010 25018 24722 gene locus_tag LOCUS_21020 gene rplW 25018 24722 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806906.1 protein_id gnl|my_center|LOCUS_21020 25635 25015 gene locus_tag LOCUS_21030 gene rplD 25635 25015 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806905.1 protein_id gnl|my_center|LOCUS_21030 26266 25640 gene locus_tag LOCUS_21040 gene rplC 26266 25640 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925687.1 protein_id gnl|my_center|LOCUS_21040 26813 26502 gene locus_tag LOCUS_21050 gene rpsJ 26813 26502 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806903.1 protein_id gnl|my_center|LOCUS_21050 >Feature sequence35 728 336 gene locus_tag LOCUS_21060 728 336 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640610.1 protein_id gnl|my_center|LOCUS_21060 848 1684 gene locus_tag LOCUS_21070 848 1684 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705810.1 protein_id gnl|my_center|LOCUS_21070 1684 2805 gene locus_tag LOCUS_21080 1684 2805 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813122.1 protein_id gnl|my_center|LOCUS_21080 2982 4019 gene locus_tag LOCUS_21090 2982 4019 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930836.1 protein_id gnl|my_center|LOCUS_21090 4101 5180 gene locus_tag LOCUS_21100 4101 5180 CDS product putative 2-aminoethylphosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061794.1 protein_id gnl|my_center|LOCUS_21100 5180 6892 gene locus_tag LOCUS_21110 5180 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 7718 6912 gene locus_tag LOCUS_21120 7718 6912 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869263.1 protein_id gnl|my_center|LOCUS_21120 8312 7746 gene locus_tag LOCUS_21130 8312 7746 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932744.1 protein_id gnl|my_center|LOCUS_21130 9182 8541 gene locus_tag LOCUS_21140 9182 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 10834 9179 gene locus_tag LOCUS_21150 10834 9179 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064078.1 protein_id gnl|my_center|LOCUS_21150 12037 10859 gene locus_tag LOCUS_21160 12037 10859 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064079.1 protein_id gnl|my_center|LOCUS_21160 12346 12059 gene locus_tag LOCUS_21170 12346 12059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 13026 12823 gene locus_tag LOCUS_21180 13026 12823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 12971 13123 gene locus_tag LOCUS_21190 12971 13123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 13914 13249 gene locus_tag LOCUS_21200 13914 13249 CDS product type VI secretion system-associated protein TagC-5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551877.1 protein_id gnl|my_center|LOCUS_21200 15014 13965 gene locus_tag LOCUS_21210 15014 13965 CDS product type VI secretion system-associated protein TagB-5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556233.1 protein_id gnl|my_center|LOCUS_21210 17698 15011 gene locus_tag LOCUS_21220 17698 15011 CDS product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064515.1 protein_id gnl|my_center|LOCUS_21220 19523 17700 gene locus_tag LOCUS_21230 19523 17700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 21199 19583 gene locus_tag LOCUS_21240 21199 19583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 21710 21417 gene locus_tag LOCUS_21250 21710 21417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 22720 21707 gene locus_tag LOCUS_21260 22720 21707 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878259.1 protein_id gnl|my_center|LOCUS_21260 23173 23661 gene locus_tag LOCUS_21270 23173 23661 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943794.1 protein_id gnl|my_center|LOCUS_21270 23812 25785 gene locus_tag LOCUS_21280 23812 25785 CDS product 7TM diverse intracellular signaling domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763284.1 protein_id gnl|my_center|LOCUS_21280 26192 25770 gene locus_tag LOCUS_21290 26192 25770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 26319 26462 gene locus_tag LOCUS_21300 26319 26462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence36 1881 589 gene locus_tag LOCUS_21310 1881 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 2469 1939 gene locus_tag LOCUS_21320 2469 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 3692 2736 gene locus_tag LOCUS_21330 3692 2736 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727553.1 protein_id gnl|my_center|LOCUS_21330 4446 4913 gene locus_tag LOCUS_21340 4446 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 4865 5842 gene locus_tag LOCUS_21350 4865 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 6042 7148 gene locus_tag LOCUS_21360 6042 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 7189 9246 gene locus_tag LOCUS_21370 7189 9246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 9311 9550 gene locus_tag LOCUS_21380 9311 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 10121 9567 gene locus_tag LOCUS_21390 10121 9567 CDS product cyclin-dependent kinase inhibitor 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928648.1 protein_id gnl|my_center|LOCUS_21390 10732 11676 gene locus_tag LOCUS_21400 10732 11676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 11979 11770 gene locus_tag LOCUS_21410 11979 11770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 12134 11949 gene locus_tag LOCUS_21420 12134 11949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21420 13289 12471 gene locus_tag LOCUS_21430 13289 12471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 14253 15629 gene locus_tag LOCUS_21440 14253 15629 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088478.1 protein_id gnl|my_center|LOCUS_21440 17008 15740 gene locus_tag LOCUS_21450 gene norW 17008 15740 CDS product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064743.1 protein_id gnl|my_center|LOCUS_21450 18147 17005 gene locus_tag LOCUS_21460 18147 17005 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921632.1 protein_id gnl|my_center|LOCUS_21460 18732 18169 gene locus_tag LOCUS_21470 18732 18169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 20543 18945 gene locus_tag LOCUS_21480 20543 18945 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176720.1 protein_id gnl|my_center|LOCUS_21480 20833 22200 gene locus_tag LOCUS_21490 20833 22200 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088478.1 protein_id gnl|my_center|LOCUS_21490 22206 23042 gene locus_tag LOCUS_21500 gene ntrB 22206 23042 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967199.1 protein_id gnl|my_center|LOCUS_21500 23055 23912 gene locus_tag LOCUS_21510 23055 23912 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088476.1 protein_id gnl|my_center|LOCUS_21510 23951 24415 gene locus_tag LOCUS_21520 gene cynS 23951 24415 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896757.1 protein_id gnl|my_center|LOCUS_21520 24447 24734 gene locus_tag LOCUS_21530 24447 24734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 25129 24815 gene locus_tag LOCUS_21540 25129 24815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 25261 26418 gene locus_tag LOCUS_21550 25261 26418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389361.1 protein_id gnl|my_center|LOCUS_21550 26646 26404 gene locus_tag LOCUS_21560 26646 26404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 >Feature sequence37 1483 491 gene locus_tag LOCUS_21570 1483 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 1561 1890 gene locus_tag LOCUS_21580 1561 1890 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986456.1 protein_id gnl|my_center|LOCUS_21580 1895 2449 gene locus_tag LOCUS_21590 1895 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 2454 3473 gene locus_tag LOCUS_21600 2454 3473 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526398.1 protein_id gnl|my_center|LOCUS_21600 4045 3524 gene locus_tag LOCUS_21610 4045 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 4366 5277 gene locus_tag LOCUS_21620 4366 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 5758 7989 gene locus_tag LOCUS_21630 gene nrfB 5758 7989 CDS product cyclic di-3',5'-guanylate-activated glycosyltransferase NrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383919.1 protein_id gnl|my_center|LOCUS_21630 7980 10886 gene locus_tag LOCUS_21640 gene nfrA 7980 10886 CDS product bacteriophage adsorption protein NfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602218.1 protein_id gnl|my_center|LOCUS_21640 10880 11776 gene locus_tag LOCUS_21650 10880 11776 CDS product DUF4434 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224604.1 protein_id gnl|my_center|LOCUS_21650 12973 11765 gene locus_tag LOCUS_21660 gene wecB 12973 11765 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208051.1 protein_id gnl|my_center|LOCUS_21660 13394 14650 gene locus_tag LOCUS_21670 13394 14650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 15497 14610 gene locus_tag LOCUS_21680 15497 14610 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089063.1 protein_id gnl|my_center|LOCUS_21680 15773 16024 gene locus_tag LOCUS_21690 15773 16024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 16070 16450 gene locus_tag LOCUS_21700 gene tnpA 16070 16450 CDS product IS200/IS605-like element ISEc46 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064873.1 protein_id gnl|my_center|LOCUS_21700 18016 16700 gene locus_tag LOCUS_21710 18016 16700 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089531.1 protein_id gnl|my_center|LOCUS_21710 18519 18013 gene locus_tag LOCUS_21720 18519 18013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 19599 18595 gene locus_tag LOCUS_21730 19599 18595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 20590 19769 gene locus_tag LOCUS_21740 20590 19769 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814390.1 protein_id gnl|my_center|LOCUS_21740 20750 21316 gene locus_tag LOCUS_21750 20750 21316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 21328 22194 gene locus_tag LOCUS_21760 21328 22194 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039143.1 protein_id gnl|my_center|LOCUS_21760 22216 22884 gene locus_tag LOCUS_21770 22216 22884 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537831.1 protein_id gnl|my_center|LOCUS_21770 22889 23845 gene locus_tag LOCUS_21780 22889 23845 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384692.1 protein_id gnl|my_center|LOCUS_21780 23842 24225 gene locus_tag LOCUS_21790 23842 24225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence38 1646 432 gene locus_tag LOCUS_21800 gene odhB 1646 432 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065167.1 protein_id gnl|my_center|LOCUS_21800 4593 1726 gene locus_tag LOCUS_21810 4593 1726 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065166.1 protein_id gnl|my_center|LOCUS_21810 4940 7240 gene locus_tag LOCUS_21820 4940 7240 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446507.1 protein_id gnl|my_center|LOCUS_21820 8671 7376 gene locus_tag LOCUS_21830 8671 7376 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813645.1 protein_id gnl|my_center|LOCUS_21830 8958 8698 gene locus_tag LOCUS_21840 8958 8698 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813647.1 protein_id gnl|my_center|LOCUS_21840 9691 8975 gene locus_tag LOCUS_21850 9691 8975 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065157.1 protein_id gnl|my_center|LOCUS_21850 11489 9711 gene locus_tag LOCUS_21860 gene sdhA 11489 9711 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065156.1 protein_id gnl|my_center|LOCUS_21860 11876 11493 gene locus_tag LOCUS_21870 gene sdhD 11876 11493 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813653.1 protein_id gnl|my_center|LOCUS_21870 12289 11879 gene locus_tag LOCUS_21880 gene sdhC 12289 11879 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813654.1 protein_id gnl|my_center|LOCUS_21880 13238 12405 gene locus_tag LOCUS_21890 13238 12405 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813656.1 protein_id gnl|my_center|LOCUS_21890 13406 14395 gene locus_tag LOCUS_21900 13406 14395 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065155.1 protein_id gnl|my_center|LOCUS_21900 14458 15348 gene locus_tag LOCUS_21910 gene prpB 14458 15348 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040192.1 protein_id gnl|my_center|LOCUS_21910 15376 16563 gene locus_tag LOCUS_21920 gene prpC 15376 16563 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065153.1 protein_id gnl|my_center|LOCUS_21920 16660 19251 gene locus_tag LOCUS_21930 gene acnD 16660 19251 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188189.1 protein_id gnl|my_center|LOCUS_21930 19290 20480 gene locus_tag LOCUS_21940 gene prpF 19290 20480 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187247.1 protein_id gnl|my_center|LOCUS_21940 20533 20835 gene locus_tag LOCUS_21950 20533 20835 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810239.1 protein_id gnl|my_center|LOCUS_21950 20924 23509 gene locus_tag LOCUS_21960 gene acnB 20924 23509 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064143.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence39 883 167 gene locus_tag LOCUS_21970 883 167 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087136.1 protein_id gnl|my_center|LOCUS_21970 1006 2118 gene locus_tag LOCUS_21980 1006 2118 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448968.1 protein_id gnl|my_center|LOCUS_21980 2587 2183 gene locus_tag LOCUS_21990 2587 2183 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088090.1 protein_id gnl|my_center|LOCUS_21990 3759 2590 gene locus_tag LOCUS_22000 3759 2590 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967073.1 protein_id gnl|my_center|LOCUS_22000 3974 4132 gene locus_tag LOCUS_22010 3974 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 4609 4214 gene locus_tag LOCUS_22020 4609 4214 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705071.1 protein_id gnl|my_center|LOCUS_22020 4745 5197 gene locus_tag LOCUS_22030 4745 5197 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810861.1 protein_id gnl|my_center|LOCUS_22030 5274 5690 gene locus_tag LOCUS_22040 5274 5690 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810864.1 protein_id gnl|my_center|LOCUS_22040 5692 6147 gene locus_tag LOCUS_22050 5692 6147 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810867.1 protein_id gnl|my_center|LOCUS_22050 9308 6195 gene locus_tag LOCUS_22060 9308 6195 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063897.1 protein_id gnl|my_center|LOCUS_22060 10606 9320 gene locus_tag LOCUS_22070 10606 9320 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928130.1 protein_id gnl|my_center|LOCUS_22070 11117 10569 gene locus_tag LOCUS_22080 11117 10569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 11056 11322 gene locus_tag LOCUS_22090 11056 11322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 11451 12452 gene locus_tag LOCUS_22100 11451 12452 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268709.1 protein_id gnl|my_center|LOCUS_22100 12540 14108 gene locus_tag LOCUS_22110 12540 14108 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268710.1 protein_id gnl|my_center|LOCUS_22110 14105 16567 gene locus_tag LOCUS_22120 14105 16567 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_22120 16557 17237 gene locus_tag LOCUS_22130 gene pdeM 16557 17237 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_22130 18070 17204 gene locus_tag LOCUS_22140 18070 17204 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931055.1 protein_id gnl|my_center|LOCUS_22140 18979 18080 gene locus_tag LOCUS_22150 18979 18080 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082945.1 protein_id gnl|my_center|LOCUS_22150 19093 20430 gene locus_tag LOCUS_22160 gene folC 19093 20430 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811819.1 protein_id gnl|my_center|LOCUS_22160 20541 21395 gene locus_tag LOCUS_22170 20541 21395 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852965.1 protein_id gnl|my_center|LOCUS_22170 21392 21883 gene locus_tag LOCUS_22180 21392 21883 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811815.1 protein_id gnl|my_center|LOCUS_22180 21929 23440 gene locus_tag LOCUS_22190 gene purF 21929 23440 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811814.1 protein_id gnl|my_center|LOCUS_22190 >Feature sequence40 77 448 gene locus_tag LOCUS_22200 77 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 1016 1441 gene locus_tag LOCUS_22210 1016 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 1603 1995 gene locus_tag LOCUS_22220 1603 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 1988 3262 gene locus_tag LOCUS_22230 gene tviB 1988 3262 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039948.1 protein_id gnl|my_center|LOCUS_22230 3265 4338 gene locus_tag LOCUS_22240 3265 4338 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073076.1 protein_id gnl|my_center|LOCUS_22240 4412 5116 gene locus_tag LOCUS_22250 gene rfbF 4412 5116 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551345.1 protein_id gnl|my_center|LOCUS_22250 5113 6177 gene locus_tag LOCUS_22260 gene rfbG 5113 6177 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535171.1 protein_id gnl|my_center|LOCUS_22260 6174 7106 gene locus_tag LOCUS_22270 6174 7106 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545190.1 protein_id gnl|my_center|LOCUS_22270 7118 8269 gene locus_tag LOCUS_22280 7118 8269 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967053.1 protein_id gnl|my_center|LOCUS_22280 8291 9133 gene locus_tag LOCUS_22290 8291 9133 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_22290 9126 10013 gene locus_tag LOCUS_22300 9126 10013 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002733687.1 protein_id gnl|my_center|LOCUS_22300 10010 11092 gene locus_tag LOCUS_22310 10010 11092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 11337 12572 gene locus_tag LOCUS_22320 11337 12572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545573.1 protein_id gnl|my_center|LOCUS_22320 13194 12706 gene locus_tag LOCUS_22330 13194 12706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22330 13292 13507 gene locus_tag LOCUS_22340 13292 13507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 13425 13742 gene locus_tag LOCUS_22350 13425 13742 CDS product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816713.1 protein_id gnl|my_center|LOCUS_22350 13739 14560 gene locus_tag LOCUS_22360 13739 14560 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011326545.1 protein_id gnl|my_center|LOCUS_22360 15089 16009 gene locus_tag LOCUS_22370 15089 16009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 16019 17170 gene locus_tag LOCUS_22380 16019 17170 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 protein_id gnl|my_center|LOCUS_22380 17220 18353 gene locus_tag LOCUS_22390 17220 18353 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808458.1 protein_id gnl|my_center|LOCUS_22390 18379 20328 gene locus_tag LOCUS_22400 gene asnB 18379 20328 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_22400 20474 21484 gene locus_tag LOCUS_22410 20474 21484 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957841.1 protein_id gnl|my_center|LOCUS_22410 21477 22835 gene locus_tag LOCUS_22420 21477 22835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 22906 23199 gene locus_tag LOCUS_22430 22906 23199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence41 739 981 gene locus_tag LOCUS_22440 739 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1981 1307 gene locus_tag LOCUS_22450 1981 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 3893 1971 gene locus_tag LOCUS_22460 3893 1971 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269181.1 protein_id gnl|my_center|LOCUS_22460 4144 4404 gene locus_tag LOCUS_22470 4144 4404 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262767.1 protein_id gnl|my_center|LOCUS_22470 4416 6230 gene locus_tag LOCUS_22480 4416 6230 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_22480 6350 6745 gene locus_tag LOCUS_22490 6350 6745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 6759 7097 gene locus_tag LOCUS_22500 6759 7097 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 protein_id gnl|my_center|LOCUS_22500 7131 7904 gene locus_tag LOCUS_22510 gene nudC 7131 7904 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113595.1 protein_id gnl|my_center|LOCUS_22510 9113 7923 gene locus_tag LOCUS_22520 9113 7923 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389221.1 protein_id gnl|my_center|LOCUS_22520 10779 9232 gene locus_tag LOCUS_22530 10779 9232 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164930.1 protein_id gnl|my_center|LOCUS_22530 12017 10902 gene locus_tag LOCUS_22540 gene ald 12017 10902 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971809.1 protein_id gnl|my_center|LOCUS_22540 12110 13111 gene locus_tag LOCUS_22550 12110 13111 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195540.1 protein_id gnl|my_center|LOCUS_22550 13170 14273 gene locus_tag LOCUS_22560 13170 14273 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455027.1 protein_id gnl|my_center|LOCUS_22560 14350 15408 gene locus_tag LOCUS_22570 14350 15408 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480736.1 protein_id gnl|my_center|LOCUS_22570 15495 16757 gene locus_tag LOCUS_22580 15495 16757 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480621.1 protein_id gnl|my_center|LOCUS_22580 16761 17612 gene locus_tag LOCUS_22590 16761 17612 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455010.1 protein_id gnl|my_center|LOCUS_22590 18616 17669 gene locus_tag LOCUS_22600 18616 17669 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705198.1 protein_id gnl|my_center|LOCUS_22600 18786 20387 gene locus_tag LOCUS_22610 18786 20387 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966515.1 protein_id gnl|my_center|LOCUS_22610 21611 20472 gene locus_tag LOCUS_22620 21611 20472 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807926.1 protein_id gnl|my_center|LOCUS_22620 22534 21695 gene locus_tag LOCUS_22630 22534 21695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 23123 22665 gene locus_tag LOCUS_22640 23123 22665 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819714.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence42 232 1455 gene locus_tag LOCUS_22650 232 1455 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_22650 1910 1569 gene locus_tag LOCUS_22660 1910 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 2185 1907 gene locus_tag LOCUS_22670 2185 1907 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888120.1 protein_id gnl|my_center|LOCUS_22670 2471 2605 gene locus_tag LOCUS_22680 2471 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 2838 3155 gene locus_tag LOCUS_22690 2838 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 3152 4375 gene locus_tag LOCUS_22700 3152 4375 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268088.1 protein_id gnl|my_center|LOCUS_22700 4830 4570 gene locus_tag LOCUS_22710 4830 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 5203 4913 gene locus_tag LOCUS_22720 5203 4913 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162670.1 protein_id gnl|my_center|LOCUS_22720 7710 5548 gene locus_tag LOCUS_22730 gene katG 7710 5548 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400805.1 protein_id gnl|my_center|LOCUS_22730 8475 7873 gene locus_tag LOCUS_22740 8475 7873 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037827.1 protein_id gnl|my_center|LOCUS_22740 9884 8631 gene locus_tag LOCUS_22750 9884 8631 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_22750 10896 9934 gene locus_tag LOCUS_22760 gene puuE 10896 9934 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521217.1 protein_id gnl|my_center|LOCUS_22760 11634 10915 gene locus_tag LOCUS_22770 11634 10915 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974084.1 protein_id gnl|my_center|LOCUS_22770 12572 11736 gene locus_tag LOCUS_22780 12572 11736 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269173.1 protein_id gnl|my_center|LOCUS_22780 12645 13397 gene locus_tag LOCUS_22790 gene modA 12645 13397 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_22790 13433 14122 gene locus_tag LOCUS_22800 gene modB 13433 14122 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_22800 14143 15258 gene locus_tag LOCUS_22810 gene modC 14143 15258 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267945.1 protein_id gnl|my_center|LOCUS_22810 15609 16985 gene locus_tag LOCUS_22820 15609 16985 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530861.1 protein_id gnl|my_center|LOCUS_22820 17444 18625 gene locus_tag LOCUS_22830 17444 18625 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976770.1 protein_id gnl|my_center|LOCUS_22830 19156 18758 gene locus_tag LOCUS_22840 19156 18758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 20157 19831 gene locus_tag LOCUS_22850 20157 19831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 >Feature sequence43 202 750 gene locus_tag LOCUS_22860 202 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 831 1100 gene locus_tag LOCUS_22870 831 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 1090 2343 gene locus_tag LOCUS_22880 1090 2343 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167435501.1 protein_id gnl|my_center|LOCUS_22880 2535 2338 gene locus_tag LOCUS_22890 2535 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 3307 4149 gene locus_tag LOCUS_22900 3307 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 4149 4916 gene locus_tag LOCUS_22910 4149 4916 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861381.1 protein_id gnl|my_center|LOCUS_22910 4922 5920 gene locus_tag LOCUS_22920 4922 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 6895 6305 gene locus_tag LOCUS_22930 6895 6305 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920198.1 protein_id gnl|my_center|LOCUS_22930 7166 8011 gene locus_tag LOCUS_22940 7166 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222822.1 protein_id gnl|my_center|LOCUS_22940 8956 8057 gene locus_tag LOCUS_22950 8956 8057 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263863.1 protein_id gnl|my_center|LOCUS_22950 9115 9924 gene locus_tag LOCUS_22960 9115 9924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 9954 10361 gene locus_tag LOCUS_22970 9954 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 10715 10392 gene locus_tag LOCUS_22980 10715 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 11011 12276 gene locus_tag LOCUS_22990 11011 12276 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 protein_id gnl|my_center|LOCUS_22990 13057 12257 gene locus_tag LOCUS_23000 13057 12257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 13944 13045 gene locus_tag LOCUS_23010 13944 13045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 14899 13925 gene locus_tag LOCUS_23020 14899 13925 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945777.1 protein_id gnl|my_center|LOCUS_23020 16331 14916 gene locus_tag LOCUS_23030 16331 14916 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946178.1 protein_id gnl|my_center|LOCUS_23030 16737 18419 gene locus_tag LOCUS_23040 16737 18419 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242294.1 protein_id gnl|my_center|LOCUS_23040 19165 18680 gene locus_tag LOCUS_23050 19165 18680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 >Feature sequence44 282 1832 gene locus_tag LOCUS_23060 282 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 1829 2203 gene locus_tag LOCUS_23070 1829 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 4296 2200 gene locus_tag LOCUS_23080 4296 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921545.1 protein_id gnl|my_center|LOCUS_23080 4728 4327 gene locus_tag LOCUS_23090 4728 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 4867 5526 gene locus_tag LOCUS_23100 4867 5526 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705261.1 protein_id gnl|my_center|LOCUS_23100 5543 6181 gene locus_tag LOCUS_23110 5543 6181 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807676.1 protein_id gnl|my_center|LOCUS_23110 7083 6178 gene locus_tag LOCUS_23120 7083 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 7952 7176 gene locus_tag LOCUS_23130 7952 7176 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926281.1 protein_id gnl|my_center|LOCUS_23130 8003 8782 gene locus_tag LOCUS_23140 8003 8782 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809990.1 protein_id gnl|my_center|LOCUS_23140 8880 10460 gene locus_tag LOCUS_23150 8880 10460 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809992.1 protein_id gnl|my_center|LOCUS_23150 10457 11272 gene locus_tag LOCUS_23160 10457 11272 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809994.1 protein_id gnl|my_center|LOCUS_23160 12063 11269 gene locus_tag LOCUS_23170 12063 11269 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064171.1 protein_id gnl|my_center|LOCUS_23170 12688 12056 gene locus_tag LOCUS_23180 12688 12056 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_23180 13422 12685 gene locus_tag LOCUS_23190 13422 12685 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039348.1 protein_id gnl|my_center|LOCUS_23190 13509 15002 gene locus_tag LOCUS_23200 gene cysS 13509 15002 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039349.1 protein_id gnl|my_center|LOCUS_23200 15009 15656 gene locus_tag LOCUS_23210 15009 15656 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810006.1 protein_id gnl|my_center|LOCUS_23210 15712 16677 gene locus_tag LOCUS_23220 15712 16677 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810007.1 protein_id gnl|my_center|LOCUS_23220 16693 17745 gene locus_tag LOCUS_23230 gene tilS 16693 17745 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172452888.1 protein_id gnl|my_center|LOCUS_23230 17795 19051 gene locus_tag LOCUS_23240 17795 19051 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930633.1 protein_id gnl|my_center|LOCUS_23240 19088 19181 gene locus_tag LOCUS_t00280 19088 19181 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence45 521 1684 gene locus_tag LOCUS_23250 521 1684 CDS product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090843.1 protein_id gnl|my_center|LOCUS_23250 1749 2888 gene locus_tag LOCUS_23260 1749 2888 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228417.1 protein_id gnl|my_center|LOCUS_23260 2920 4362 gene locus_tag LOCUS_23270 2920 4362 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986686.1 protein_id gnl|my_center|LOCUS_23270 4423 5562 gene locus_tag LOCUS_23280 4423 5562 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969637.1 protein_id gnl|my_center|LOCUS_23280 6417 5467 gene locus_tag LOCUS_23290 6417 5467 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818883.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23290 7001 6531 gene locus_tag LOCUS_23300 7001 6531 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390210.1 protein_id gnl|my_center|LOCUS_23300 7776 7030 gene locus_tag LOCUS_23310 7776 7030 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384591.1 protein_id gnl|my_center|LOCUS_23310 7954 8949 gene locus_tag LOCUS_23320 7954 8949 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973995.1 protein_id gnl|my_center|LOCUS_23320 9008 9790 gene locus_tag LOCUS_23330 9008 9790 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529864.1 protein_id gnl|my_center|LOCUS_23330 9860 10666 gene locus_tag LOCUS_23340 9860 10666 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816301.1 protein_id gnl|my_center|LOCUS_23340 10668 11753 gene locus_tag LOCUS_23350 10668 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 11750 12637 gene locus_tag LOCUS_23360 11750 12637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 12637 13992 gene locus_tag LOCUS_23370 12637 13992 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 protein_id gnl|my_center|LOCUS_23370 14003 14647 gene locus_tag LOCUS_23380 14003 14647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 14661 14858 gene locus_tag LOCUS_23390 14661 14858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 14855 15853 gene locus_tag LOCUS_23400 14855 15853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 16096 15920 gene locus_tag LOCUS_23410 16096 15920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 16058 16243 gene locus_tag LOCUS_23420 16058 16243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 16513 17733 gene locus_tag LOCUS_23430 16513 17733 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039905.1 protein_id gnl|my_center|LOCUS_23430 18144 17902 gene locus_tag LOCUS_23440 18144 17902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 18473 18398 gene locus_tag LOCUS_t00290 18473 18398 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 <19337 18534 gene locus_tag LOCUS_23450 <19337 18534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930264.1:4-hydroxy-3-methylbut-2-enyl diphosphate reductase >Feature sequence46 662 877 gene locus_tag LOCUS_23460 662 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 886 1155 gene locus_tag LOCUS_23470 886 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 1920 1036 gene locus_tag LOCUS_23480 gene accD 1920 1036 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813843.1 protein_id gnl|my_center|LOCUS_23480 2782 1937 gene locus_tag LOCUS_23490 gene trpA 2782 1937 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813844.1 protein_id gnl|my_center|LOCUS_23490 3996 2797 gene locus_tag LOCUS_23500 gene trpB 3996 2797 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813845.1 protein_id gnl|my_center|LOCUS_23500 6293 4152 gene locus_tag LOCUS_23510 6293 4152 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065079.1 protein_id gnl|my_center|LOCUS_23510 6724 6374 gene locus_tag LOCUS_23520 6724 6374 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813850.1 protein_id gnl|my_center|LOCUS_23520 8025 6763 gene locus_tag LOCUS_23530 gene pncB 8025 6763 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995174.1 protein_id gnl|my_center|LOCUS_23530 8129 8452 gene locus_tag LOCUS_23540 8129 8452 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931551.1 protein_id gnl|my_center|LOCUS_23540 8479 9261 gene locus_tag LOCUS_23550 8479 9261 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065078.1 protein_id gnl|my_center|LOCUS_23550 9265 9849 gene locus_tag LOCUS_23560 9265 9849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 9852 10640 gene locus_tag LOCUS_23570 gene nth 9852 10640 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813856.1 protein_id gnl|my_center|LOCUS_23570 10671 11039 gene locus_tag LOCUS_23580 10671 11039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23580 11210 13423 gene locus_tag LOCUS_23590 11210 13423 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038670.1 protein_id gnl|my_center|LOCUS_23590 13568 14569 gene locus_tag LOCUS_23600 13568 14569 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337702.1 protein_id gnl|my_center|LOCUS_23600 14576 15649 gene locus_tag LOCUS_23610 14576 15649 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337703.1 protein_id gnl|my_center|LOCUS_23610 15662 15829 gene locus_tag LOCUS_23620 15662 15829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 16153 17040 gene locus_tag LOCUS_23630 16153 17040 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391014.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23630 17070 17513 gene locus_tag LOCUS_23640 17070 17513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 >Feature sequence47 1334 330 gene locus_tag LOCUS_23650 1334 330 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144922.1 protein_id gnl|my_center|LOCUS_23650 1897 1334 gene locus_tag LOCUS_23660 1897 1334 CDS product sigma-E factor negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813794.1 protein_id gnl|my_center|LOCUS_23660 2508 1909 gene locus_tag LOCUS_23670 gene rpoE 2508 1909 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813797.1 protein_id gnl|my_center|LOCUS_23670 3010 2501 gene locus_tag LOCUS_23680 3010 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 4224 3010 gene locus_tag LOCUS_23690 gene fabF 4224 3010 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040224.1 protein_id gnl|my_center|LOCUS_23690 4633 4397 gene locus_tag LOCUS_23700 gene acpP 4633 4397 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813816.1 protein_id gnl|my_center|LOCUS_23700 5443 4694 gene locus_tag LOCUS_23710 gene fabG 5443 4694 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065092.1 protein_id gnl|my_center|LOCUS_23710 6400 5462 gene locus_tag LOCUS_23720 gene fabD 6400 5462 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813821.1 protein_id gnl|my_center|LOCUS_23720 7410 6424 gene locus_tag LOCUS_23730 7410 6424 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447294.1 protein_id gnl|my_center|LOCUS_23730 8449 7436 gene locus_tag LOCUS_23740 gene plsX 8449 7436 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065089.1 protein_id gnl|my_center|LOCUS_23740 8713 8531 gene locus_tag LOCUS_23750 gene rpmF 8713 8531 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813827.1 protein_id gnl|my_center|LOCUS_23750 9450 8785 gene locus_tag LOCUS_23760 9450 8785 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813829.1 protein_id gnl|my_center|LOCUS_23760 9480 10097 gene locus_tag LOCUS_23770 9480 10097 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821345.1 protein_id gnl|my_center|LOCUS_23770 10084 10818 gene locus_tag LOCUS_23780 10084 10818 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821344.1 protein_id gnl|my_center|LOCUS_23780 11348 10809 gene locus_tag LOCUS_23790 11348 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 12378 11419 gene locus_tag LOCUS_23800 gene msrP 12378 11419 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813837.1 protein_id gnl|my_center|LOCUS_23800 13055 12390 gene locus_tag LOCUS_23810 13055 12390 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929830.1 protein_id gnl|my_center|LOCUS_23810 14035 13052 gene locus_tag LOCUS_23820 14035 13052 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813839.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence48 142 543 gene locus_tag LOCUS_23830 142 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 842 2254 gene locus_tag LOCUS_23840 842 2254 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269396.1 protein_id gnl|my_center|LOCUS_23840 3351 2284 gene locus_tag LOCUS_23850 3351 2284 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946868.1 protein_id gnl|my_center|LOCUS_23850 4307 3456 gene locus_tag LOCUS_23860 4307 3456 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063703.1 protein_id gnl|my_center|LOCUS_23860 4427 4963 gene locus_tag LOCUS_23870 4427 4963 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 protein_id gnl|my_center|LOCUS_23870 5824 4979 gene locus_tag LOCUS_23880 gene mtnP 5824 4979 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_23880 6938 5841 gene locus_tag LOCUS_23890 6938 5841 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339450.1 protein_id gnl|my_center|LOCUS_23890 7552 6935 gene locus_tag LOCUS_23900 7552 6935 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029005.1 protein_id gnl|my_center|LOCUS_23900 8226 7549 gene locus_tag LOCUS_23910 8226 7549 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118717.1 protein_id gnl|my_center|LOCUS_23910 10472 8223 gene locus_tag LOCUS_23920 10472 8223 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_23920 11494 10481 gene locus_tag LOCUS_23930 gene arsS 11494 10481 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_23930 12335 11586 gene locus_tag LOCUS_23940 12335 11586 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838970.1 protein_id gnl|my_center|LOCUS_23940 12467 13027 gene locus_tag LOCUS_23950 12467 13027 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921086.1 protein_id gnl|my_center|LOCUS_23950 13035 13670 gene locus_tag LOCUS_23960 13035 13670 CDS product DUF1109 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087694.1 protein_id gnl|my_center|LOCUS_23960 15049 13730 gene locus_tag LOCUS_23970 15049 13730 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194166.1 protein_id gnl|my_center|LOCUS_23970 15520 16536 gene locus_tag LOCUS_23980 15520 16536 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205740.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence49 2356 254 gene locus_tag LOCUS_23990 gene fusA 2356 254 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806902.1 protein_id gnl|my_center|LOCUS_23990 2845 2375 gene locus_tag LOCUS_24000 gene rpsG 2845 2375 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806901.1 protein_id gnl|my_center|LOCUS_24000 3424 3047 gene locus_tag LOCUS_24010 gene rpsL 3424 3047 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005017264.1 protein_id gnl|my_center|LOCUS_24010 8051 3801 gene locus_tag LOCUS_24020 gene rpoC 8051 3801 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818292.1 protein_id gnl|my_center|LOCUS_24020 12163 8051 gene locus_tag LOCUS_24030 gene rpoB 12163 8051 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929573.1 protein_id gnl|my_center|LOCUS_24030 12701 12321 gene locus_tag LOCUS_24040 gene rplL 12701 12321 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806889.1 protein_id gnl|my_center|LOCUS_24040 13308 12784 gene locus_tag LOCUS_24050 gene rplJ 13308 12784 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 protein_id gnl|my_center|LOCUS_24050 14240 13536 gene locus_tag LOCUS_24060 gene rplA 14240 13536 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806887.1 protein_id gnl|my_center|LOCUS_24060 14673 14242 gene locus_tag LOCUS_24070 gene rplK 14673 14242 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806886.1 protein_id gnl|my_center|LOCUS_24070 15266 14733 gene locus_tag LOCUS_24080 gene nusG 15266 14733 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806885.1 protein_id gnl|my_center|LOCUS_24080 15628 15278 gene locus_tag LOCUS_24090 gene secE 15628 15278 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806884.1 protein_id gnl|my_center|LOCUS_24090 15798 15723 gene locus_tag LOCUS_t00300 15798 15723 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence50 532 113 gene locus_tag LOCUS_24100 532 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 1948 575 gene locus_tag LOCUS_24110 1948 575 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243160.1 protein_id gnl|my_center|LOCUS_24110 2793 1945 gene locus_tag LOCUS_24120 2793 1945 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813319.1 protein_id gnl|my_center|LOCUS_24120 2988 3911 gene locus_tag LOCUS_24130 2988 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 4558 3908 gene locus_tag LOCUS_24140 4558 3908 CDS product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140133.1 protein_id gnl|my_center|LOCUS_24140 4745 7036 gene locus_tag LOCUS_24150 4745 7036 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208315.1 protein_id gnl|my_center|LOCUS_24150 7542 7087 gene locus_tag LOCUS_24160 7542 7087 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225720.1 protein_id gnl|my_center|LOCUS_24160 8297 7611 gene locus_tag LOCUS_24170 8297 7611 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808801.1 protein_id gnl|my_center|LOCUS_24170 8437 8718 gene locus_tag LOCUS_24180 8437 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 8715 10049 gene locus_tag LOCUS_24190 8715 10049 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064402.1 protein_id gnl|my_center|LOCUS_24190 10046 11242 gene locus_tag LOCUS_24200 10046 11242 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064401.1 protein_id gnl|my_center|LOCUS_24200 11244 12023 gene locus_tag LOCUS_24210 11244 12023 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064400.1 protein_id gnl|my_center|LOCUS_24210 12049 12933 gene locus_tag LOCUS_24220 12049 12933 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818697.1 protein_id gnl|my_center|LOCUS_24220 14180 12930 gene locus_tag LOCUS_24230 14180 12930 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_24230 14806 14195 gene locus_tag LOCUS_24240 14806 14195 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113789.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence51 1411 221 gene locus_tag LOCUS_24250 1411 221 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_24250 1691 1455 gene locus_tag LOCUS_24260 1691 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 2800 2360 gene locus_tag LOCUS_24270 2800 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 4677 2830 gene locus_tag LOCUS_24280 4677 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 4957 5175 gene locus_tag LOCUS_24290 4957 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 5202 5654 gene locus_tag LOCUS_24300 5202 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 6216 5788 gene locus_tag LOCUS_24310 6216 5788 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461281.1 protein_id gnl|my_center|LOCUS_24310 7523 6303 gene locus_tag LOCUS_24320 7523 6303 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095714.1 protein_id gnl|my_center|LOCUS_24320 9844 7550 gene locus_tag LOCUS_24330 9844 7550 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095715.1 protein_id gnl|my_center|LOCUS_24330 11265 9856 gene locus_tag LOCUS_24340 11265 9856 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972764.1 protein_id gnl|my_center|LOCUS_24340 11909 11262 gene locus_tag LOCUS_24350 11909 11262 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485986.1 protein_id gnl|my_center|LOCUS_24350 <14811 12137 gene locus_tag LOCUS_24360 <14811 12137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529877.1:DUF5801 repeats-in-toxin domain-containing protein >Feature sequence52 396 196 gene locus_tag LOCUS_24370 396 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 1842 631 gene locus_tag LOCUS_24380 1842 631 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039748.1 protein_id gnl|my_center|LOCUS_24380 4553 1845 gene locus_tag LOCUS_24390 4553 1845 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280508.1 protein_id gnl|my_center|LOCUS_24390 4880 4575 gene locus_tag LOCUS_24400 4880 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 5088 4888 gene locus_tag LOCUS_24410 5088 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 5318 5680 gene locus_tag LOCUS_24420 5318 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24420 7028 6006 gene locus_tag LOCUS_24430 7028 6006 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528694.1 protein_id gnl|my_center|LOCUS_24430 7921 7025 gene locus_tag LOCUS_24440 7921 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 8233 7931 gene locus_tag LOCUS_24450 8233 7931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 9801 8725 gene locus_tag LOCUS_24460 9801 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999841.1 protein_id gnl|my_center|LOCUS_24460 10270 9845 gene locus_tag LOCUS_24470 10270 9845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 11112 12311 gene locus_tag LOCUS_24480 11112 12311 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391834.1 protein_id gnl|my_center|LOCUS_24480 12386 12844 gene locus_tag LOCUS_24490 12386 12844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 12813 13301 gene locus_tag LOCUS_24500 12813 13301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 13586 14599 gene locus_tag LOCUS_24510 13586 14599 CDS product IS110-like element ISYen1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816205.1 protein_id gnl|my_center|LOCUS_24510 >Feature sequence53 844 317 gene locus_tag LOCUS_24520 844 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 1620 841 gene locus_tag LOCUS_24530 1620 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 1832 2995 gene locus_tag LOCUS_24540 1832 2995 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975595.1 protein_id gnl|my_center|LOCUS_24540 2997 4589 gene locus_tag LOCUS_24550 2997 4589 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975594.1 protein_id gnl|my_center|LOCUS_24550 4700 4939 gene locus_tag LOCUS_24560 4700 4939 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144325.1 protein_id gnl|my_center|LOCUS_24560 4936 5322 gene locus_tag LOCUS_24570 4936 5322 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967510.1 protein_id gnl|my_center|LOCUS_24570 5710 5375 gene locus_tag LOCUS_24580 5710 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 5870 9946 gene locus_tag LOCUS_24590 gene purL 5870 9946 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063649.1 protein_id gnl|my_center|LOCUS_24590 10083 11543 gene locus_tag LOCUS_24600 gene guaB 10083 11543 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812368.1 protein_id gnl|my_center|LOCUS_24600 11552 13144 gene locus_tag LOCUS_24610 gene guaA 11552 13144 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812366.1 protein_id gnl|my_center|LOCUS_24610 >Feature sequence54 84 251 gene locus_tag LOCUS_24620 84 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 2021 303 gene locus_tag LOCUS_24630 2021 303 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399950.1 protein_id gnl|my_center|LOCUS_24630 3806 2115 gene locus_tag LOCUS_24640 3806 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064234.1 protein_id gnl|my_center|LOCUS_24640 4021 5232 gene locus_tag LOCUS_24650 4021 5232 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966696.1 protein_id gnl|my_center|LOCUS_24650 5273 6196 gene locus_tag LOCUS_24660 5273 6196 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_24660 6196 7179 gene locus_tag LOCUS_24670 6196 7179 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084217244.1 protein_id gnl|my_center|LOCUS_24670 7179 7928 gene locus_tag LOCUS_24680 7179 7928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_24680 7931 8641 gene locus_tag LOCUS_24690 7931 8641 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_24690 8802 10196 gene locus_tag LOCUS_24700 gene leuC 8802 10196 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388944.1 protein_id gnl|my_center|LOCUS_24700 10225 10848 gene locus_tag LOCUS_24710 gene leuD 10225 10848 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242478.1 protein_id gnl|my_center|LOCUS_24710 12245 10821 gene locus_tag LOCUS_24720 12245 10821 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927872.1 protein_id gnl|my_center|LOCUS_24720 12853 12242 gene locus_tag LOCUS_24730 12853 12242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 >Feature sequence55 963 199 gene locus_tag LOCUS_24740 963 199 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226684.1 protein_id gnl|my_center|LOCUS_24740 1459 1046 gene locus_tag LOCUS_24750 1459 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 2349 1567 gene locus_tag LOCUS_24760 2349 1567 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086299.1 protein_id gnl|my_center|LOCUS_24760 2450 3238 gene locus_tag LOCUS_24770 2450 3238 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929751.1 protein_id gnl|my_center|LOCUS_24770 4205 3222 gene locus_tag LOCUS_24780 gene mak 4205 3222 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816918.1 protein_id gnl|my_center|LOCUS_24780 4344 5468 gene locus_tag LOCUS_24790 4344 5468 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919381.1 protein_id gnl|my_center|LOCUS_24790 6014 5487 gene locus_tag LOCUS_24800 gene pagP 6014 5487 CDS product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931248.1 protein_id gnl|my_center|LOCUS_24800 6974 6408 gene locus_tag LOCUS_24810 6974 6408 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848063.1 protein_id gnl|my_center|LOCUS_24810 7141 6983 gene locus_tag LOCUS_24820 7141 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 7394 8488 gene locus_tag LOCUS_24830 7394 8488 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227407.1 protein_id gnl|my_center|LOCUS_24830 9497 8856 gene locus_tag LOCUS_24840 9497 8856 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368594.1 protein_id gnl|my_center|LOCUS_24840 9935 10351 gene locus_tag LOCUS_24850 9935 10351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24850 10469 10708 gene locus_tag LOCUS_24860 10469 10708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence56 5737 4013 gene locus_tag LOCUS_24870 5737 4013 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895677.1 protein_id gnl|my_center|LOCUS_24870 6208 5903 gene locus_tag LOCUS_24880 6208 5903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 6513 7193 gene locus_tag LOCUS_24890 6513 7193 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965346.1 protein_id gnl|my_center|LOCUS_24890 7559 7741 gene locus_tag LOCUS_24900 7559 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 8369 9046 gene locus_tag LOCUS_24910 8369 9046 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965346.1 protein_id gnl|my_center|LOCUS_24910 9063 11480 gene locus_tag LOCUS_24920 9063 11480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 >Feature sequence57 489 154 gene locus_tag LOCUS_24930 489 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 711 902 gene locus_tag LOCUS_24940 711 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 989 1669 gene locus_tag LOCUS_24950 989 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 3509 1842 gene locus_tag LOCUS_24960 3509 1842 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551607.1 protein_id gnl|my_center|LOCUS_24960 3719 3522 gene locus_tag LOCUS_24970 3719 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 5080 3956 gene locus_tag LOCUS_24980 5080 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 5743 6048 gene locus_tag LOCUS_24990 5743 6048 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095028.1 protein_id gnl|my_center|LOCUS_24990 6177 6548 gene locus_tag LOCUS_25000 6177 6548 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_25000 7098 6670 gene locus_tag LOCUS_25010 7098 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 7645 7364 gene locus_tag LOCUS_25020 7645 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25020 8143 7976 gene locus_tag LOCUS_25030 8143 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 8722 8330 gene locus_tag LOCUS_25040 8722 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 8961 8764 gene locus_tag LOCUS_25050 8961 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 9274 9044 gene locus_tag LOCUS_25060 9274 9044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 9596 10903 gene locus_tag LOCUS_25070 9596 10903 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769085.1 protein_id gnl|my_center|LOCUS_25070 >Feature sequence58 863 102 gene locus_tag LOCUS_25080 863 102 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085024.1 protein_id gnl|my_center|LOCUS_25080 946 1290 gene locus_tag LOCUS_25090 946 1290 CDS product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820700.1 protein_id gnl|my_center|LOCUS_25090 1480 1938 gene locus_tag LOCUS_25100 1480 1938 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814701.1 protein_id gnl|my_center|LOCUS_25100 2125 2628 gene locus_tag LOCUS_25110 2125 2628 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064337.1 protein_id gnl|my_center|LOCUS_25110 2767 3936 gene locus_tag LOCUS_25120 2767 3936 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446871.1 protein_id gnl|my_center|LOCUS_25120 3911 4252 gene locus_tag LOCUS_25130 3911 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 6013 4244 gene locus_tag LOCUS_25140 6013 4244 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869125.1 protein_id gnl|my_center|LOCUS_25140 7006 6044 gene locus_tag LOCUS_25150 7006 6044 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965333.1 protein_id gnl|my_center|LOCUS_25150 7428 7667 gene locus_tag LOCUS_25160 7428 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 8202 7915 gene locus_tag LOCUS_25170 8202 7915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 8201 9871 gene locus_tag LOCUS_25180 8201 9871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 9855 9989 gene locus_tag LOCUS_25190 9855 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 10160 11008 gene locus_tag LOCUS_25200 10160 11008 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 protein_id gnl|my_center|LOCUS_25200 >Feature sequence59 182 1294 gene locus_tag LOCUS_25210 182 1294 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_25210 3096 1444 gene locus_tag LOCUS_25220 3096 1444 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_25220 3293 5017 gene locus_tag LOCUS_25230 3293 5017 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945882.1 protein_id gnl|my_center|LOCUS_25230 5030 6325 gene locus_tag LOCUS_25240 5030 6325 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945883.1 protein_id gnl|my_center|LOCUS_25240 7206 6313 gene locus_tag LOCUS_25250 gene asd 7206 6313 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089371.1 protein_id gnl|my_center|LOCUS_25250 7380 8951 gene locus_tag LOCUS_25260 7380 8951 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089372.1 protein_id gnl|my_center|LOCUS_25260 9505 8894 gene locus_tag LOCUS_25270 9505 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089373.1 protein_id gnl|my_center|LOCUS_25270 9703 10938 gene locus_tag LOCUS_25280 9703 10938 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence60 456 127 gene locus_tag LOCUS_25290 456 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 1319 1750 gene locus_tag LOCUS_25300 1319 1750 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257767.1 protein_id gnl|my_center|LOCUS_25300 1737 2072 gene locus_tag LOCUS_25310 1737 2072 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257768.1 protein_id gnl|my_center|LOCUS_25310 2368 3006 gene locus_tag LOCUS_25320 gene queC 2368 3006 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190026.1 protein_id gnl|my_center|LOCUS_25320 3003 4205 gene locus_tag LOCUS_25330 3003 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 4210 4851 gene locus_tag LOCUS_25340 gene queE 4210 4851 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920995.1 protein_id gnl|my_center|LOCUS_25340 6216 4876 gene locus_tag LOCUS_25350 6216 4876 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816876.1 protein_id gnl|my_center|LOCUS_25350 6490 6233 gene locus_tag LOCUS_25360 6490 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 6802 8121 gene locus_tag LOCUS_25370 6802 8121 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_25370 9582 8224 gene locus_tag LOCUS_25380 9582 8224 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063780.1 protein_id gnl|my_center|LOCUS_25380 9768 10166 gene locus_tag LOCUS_25390 9768 10166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 10427 10197 gene locus_tag LOCUS_25400 10427 10197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 10831 10430 gene locus_tag LOCUS_25410 10831 10430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence61 463 227 gene locus_tag LOCUS_25420 463 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 981 667 gene locus_tag LOCUS_25430 981 667 CDS product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035952.1 protein_id gnl|my_center|LOCUS_25430 1258 989 gene locus_tag LOCUS_25440 1258 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 1942 1613 gene locus_tag LOCUS_25450 1942 1613 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100674343.1 protein_id gnl|my_center|LOCUS_25450 2192 1914 gene locus_tag LOCUS_25460 2192 1914 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816235.1 protein_id gnl|my_center|LOCUS_25460 3086 2478 gene locus_tag LOCUS_25470 3086 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 4741 3827 gene locus_tag LOCUS_25480 4741 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926903.1 protein_id gnl|my_center|LOCUS_25480 5307 4738 gene locus_tag LOCUS_25490 5307 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932363.1 protein_id gnl|my_center|LOCUS_25490 5972 6769 gene locus_tag LOCUS_25500 5972 6769 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115101.1 protein_id gnl|my_center|LOCUS_25500 6759 7946 gene locus_tag LOCUS_25510 6759 7946 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107732.1 protein_id gnl|my_center|LOCUS_25510 8062 8748 gene locus_tag LOCUS_25520 8062 8748 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107734.1 protein_id gnl|my_center|LOCUS_25520 8745 9281 gene locus_tag LOCUS_25530 8745 9281 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088482.1 protein_id gnl|my_center|LOCUS_25530 9906 9490 gene locus_tag LOCUS_25540 gene tnpA 9906 9490 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703865.1 protein_id gnl|my_center|LOCUS_25540 >Feature sequence62 506 685 gene locus_tag LOCUS_25550 506 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 1937 714 gene locus_tag LOCUS_25560 1937 714 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533330.1 protein_id gnl|my_center|LOCUS_25560 2305 1934 gene locus_tag LOCUS_25570 2305 1934 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533331.1 protein_id gnl|my_center|LOCUS_25570 4394 2586 gene locus_tag LOCUS_25580 gene lpdA 4394 2586 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459591.1 protein_id gnl|my_center|LOCUS_25580 5753 4404 gene locus_tag LOCUS_25590 gene aceF 5753 4404 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063727.1 protein_id gnl|my_center|LOCUS_25590 8488 5780 gene locus_tag LOCUS_25600 gene aceE 8488 5780 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811941.1 protein_id gnl|my_center|LOCUS_25600 9169 8651 gene locus_tag LOCUS_25610 9169 8651 CDS product type II toxin-antitoxin system YhaV family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037275395.1 protein_id gnl|my_center|LOCUS_25610 9495 9166 gene locus_tag LOCUS_25620 9495 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 9729 9574 gene locus_tag LOCUS_25630 9729 9574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 >Feature sequence63 1445 810 gene locus_tag LOCUS_25640 1445 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942017.1 protein_id gnl|my_center|LOCUS_25640 1946 1578 gene locus_tag LOCUS_25650 1946 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 1828 2514 gene locus_tag LOCUS_25660 1828 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 2712 2548 gene locus_tag LOCUS_25670 2712 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 2728 3375 gene locus_tag LOCUS_25680 2728 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 3548 3799 gene locus_tag LOCUS_25690 3548 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25690 3815 4303 gene locus_tag LOCUS_25700 3815 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25700 5110 4649 gene locus_tag LOCUS_25710 5110 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 <9028 5443 gene locus_tag LOCUS_25720 <9028 5443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921648.1:YDG domain-containing protein >Feature sequence64 562 2136 gene locus_tag LOCUS_25730 562 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25730 2161 3438 gene locus_tag LOCUS_25740 2161 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 3448 6012 gene locus_tag LOCUS_25750 3448 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 6032 7084 gene locus_tag LOCUS_25760 6032 7084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 7116 7508 gene locus_tag LOCUS_25770 gene tssI 7116 7508 CDS product type VI secretion system protein TssI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200966.1 protein_id gnl|my_center|LOCUS_25770 7518 8174 gene locus_tag LOCUS_25780 7518 8174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 8639 8268 gene locus_tag LOCUS_25790 8639 8268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 >Feature sequence65 246 2450 gene locus_tag LOCUS_25800 246 2450 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262294.1 protein_id gnl|my_center|LOCUS_25800 2800 2612 gene locus_tag LOCUS_25810 2800 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 3111 3683 gene locus_tag LOCUS_25820 3111 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 3948 4466 gene locus_tag LOCUS_25830 3948 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 4504 4980 gene locus_tag LOCUS_25840 4504 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25840 5119 5499 gene locus_tag LOCUS_25850 5119 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25850 6108 5506 gene locus_tag LOCUS_25860 6108 5506 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338930.1 protein_id gnl|my_center|LOCUS_25860 7286 6261 gene locus_tag LOCUS_25870 7286 6261 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039293.1 protein_id gnl|my_center|LOCUS_25870 7730 8668 gene locus_tag LOCUS_25880 7730 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 >Feature sequence66 149 367 gene locus_tag LOCUS_25890 149 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 392 1111 gene locus_tag LOCUS_25900 392 1111 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083209.1 protein_id gnl|my_center|LOCUS_25900 1442 1367 gene locus_tag LOCUS_t00310 1442 1367 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1463 2923 gene locus_tag LOCUS_25910 1463 2923 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930806.1 protein_id gnl|my_center|LOCUS_25910 3742 2939 gene locus_tag LOCUS_25920 3742 2939 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929763.1 protein_id gnl|my_center|LOCUS_25920 4675 3764 gene locus_tag LOCUS_25930 gene rhtA 4675 3764 CDS product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086919.1 protein_id gnl|my_center|LOCUS_25930 4722 4646 gene locus_tag LOCUS_t00320 4722 4646 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4805 5428 gene locus_tag LOCUS_25940 4805 5428 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809950.1 protein_id gnl|my_center|LOCUS_25940 5438 6097 gene locus_tag LOCUS_25950 5438 6097 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447056.1 protein_id gnl|my_center|LOCUS_25950 6265 7125 gene locus_tag LOCUS_25960 gene dapA 6265 7125 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809954.1 protein_id gnl|my_center|LOCUS_25960 7125 8279 gene locus_tag LOCUS_25970 gene bamC 7125 8279 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809956.1 protein_id gnl|my_center|LOCUS_25970 >Feature sequence67 269 655 gene locus_tag LOCUS_25980 269 655 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039185.1 protein_id gnl|my_center|LOCUS_25980 2200 692 gene locus_tag LOCUS_25990 2200 692 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929121.1 protein_id gnl|my_center|LOCUS_25990 2648 2280 gene locus_tag LOCUS_26000 2648 2280 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814188.1 protein_id gnl|my_center|LOCUS_26000 3397 2669 gene locus_tag LOCUS_26010 3397 2669 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931455.1 protein_id gnl|my_center|LOCUS_26010 3518 3742 gene locus_tag LOCUS_26020 3518 3742 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814195.1 protein_id gnl|my_center|LOCUS_26020 3758 4180 gene locus_tag LOCUS_26030 3758 4180 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814197.1 protein_id gnl|my_center|LOCUS_26030 4187 5272 gene locus_tag LOCUS_26040 4187 5272 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814199.1 protein_id gnl|my_center|LOCUS_26040 6806 5301 gene locus_tag LOCUS_26050 6806 5301 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931459.1 protein_id gnl|my_center|LOCUS_26050 6854 7690 gene locus_tag LOCUS_26060 gene galU 6854 7690 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814203.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence68 435 145 gene locus_tag LOCUS_26070 435 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 1087 872 gene locus_tag LOCUS_26080 1087 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 1582 1307 gene locus_tag LOCUS_26090 1582 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 1526 2188 gene locus_tag LOCUS_26100 1526 2188 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268013.1 protein_id gnl|my_center|LOCUS_26100 2233 3726 gene locus_tag LOCUS_26110 2233 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 3782 4009 gene locus_tag LOCUS_26120 3782 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 4000 4224 gene locus_tag LOCUS_26130 4000 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 4276 4821 gene locus_tag LOCUS_26140 4276 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 5753 5319 gene locus_tag LOCUS_26150 5753 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159978205.1 protein_id gnl|my_center|LOCUS_26150 6885 5926 gene locus_tag LOCUS_26160 6885 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26160 7187 6900 gene locus_tag LOCUS_26170 7187 6900 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210984.1 protein_id gnl|my_center|LOCUS_26170 7508 7290 gene locus_tag LOCUS_26180 7508 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 >Feature sequence69 1497 196 gene locus_tag LOCUS_26190 1497 196 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039976.1 protein_id gnl|my_center|LOCUS_26190 2013 1501 gene locus_tag LOCUS_26200 2013 1501 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811094.1 protein_id gnl|my_center|LOCUS_26200 3044 2079 gene locus_tag LOCUS_26210 3044 2079 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811098.1 protein_id gnl|my_center|LOCUS_26210 3500 4114 gene locus_tag LOCUS_26220 3500 4114 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531972.1 protein_id gnl|my_center|LOCUS_26220 4845 4237 gene locus_tag LOCUS_26230 4845 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195773.1 protein_id gnl|my_center|LOCUS_26230 6202 4868 gene locus_tag LOCUS_26240 6202 4868 CDS product flagellar protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259035.1 protein_id gnl|my_center|LOCUS_26240 6550 6747 gene locus_tag LOCUS_26250 6550 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 6846 7280 gene locus_tag LOCUS_26260 6846 7280 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390235.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence70 200 381 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtacgaattgacgccccgttattcaggggattaagac 1164 367 gene locus_tag LOCUS_26270 1164 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 1348 1273 gene locus_tag LOCUS_t00330 1348 1273 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1802 1530 gene locus_tag LOCUS_26280 1802 1530 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 protein_id gnl|my_center|LOCUS_26280 3316 2066 gene locus_tag LOCUS_26290 3316 2066 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064115.1 protein_id gnl|my_center|LOCUS_26290 4099 3353 gene locus_tag LOCUS_26300 gene rlmB 4099 3353 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812973.1 protein_id gnl|my_center|LOCUS_26300 6554 4122 gene locus_tag LOCUS_26310 gene rnr 6554 4122 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080561923.1 protein_id gnl|my_center|LOCUS_26310 6654 6738 gene locus_tag LOCUS_t00340 6654 6738 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence71 157 1113 gene locus_tag LOCUS_26320 157 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926621.1 protein_id gnl|my_center|LOCUS_26320 1446 1670 gene locus_tag LOCUS_26330 1446 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 2137 1667 gene locus_tag LOCUS_26340 2137 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 4020 2134 gene locus_tag LOCUS_26350 4020 2134 CDS product DUF3857 and transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037137.1 protein_id gnl|my_center|LOCUS_26350 5295 4492 gene locus_tag LOCUS_26360 5295 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 5473 5871 gene locus_tag LOCUS_26370 5473 5871 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674794.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence72 1692 1357 gene locus_tag LOCUS_26380 1692 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 1907 1689 gene locus_tag LOCUS_26390 1907 1689 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_26390 2039 2536 gene locus_tag LOCUS_26400 2039 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2737 2979 gene locus_tag LOCUS_26410 2737 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 2981 3442 gene locus_tag LOCUS_26420 2981 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 3724 4920 gene locus_tag LOCUS_26430 3724 4920 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104822.1 protein_id gnl|my_center|LOCUS_26430 >Feature sequence73 310 1311 gene locus_tag LOCUS_26440 310 1311 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815513.1 protein_id gnl|my_center|LOCUS_26440 1855 1457 gene locus_tag LOCUS_26450 1855 1457 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040157.1 protein_id gnl|my_center|LOCUS_26450 2228 1890 gene locus_tag LOCUS_26460 2228 1890 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099359.1 protein_id gnl|my_center|LOCUS_26460 2526 2206 gene locus_tag LOCUS_26470 2526 2206 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679319.1 protein_id gnl|my_center|LOCUS_26470 2744 4621 gene locus_tag LOCUS_26480 2744 4621 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173455.1 protein_id gnl|my_center|LOCUS_26480 5662 4718 gene locus_tag LOCUS_26490 5662 4718 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186242.1 protein_id gnl|my_center|LOCUS_26490 >Feature sequence74 319 585 gene locus_tag LOCUS_26500 319 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 602 1849 gene locus_tag LOCUS_26510 602 1849 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097284.1 protein_id gnl|my_center|LOCUS_26510 1882 4485 gene locus_tag LOCUS_26520 gene mutS 1882 4485 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446228.1 protein_id gnl|my_center|LOCUS_26520 4482 5675 gene locus_tag LOCUS_26530 4482 5675 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039336.1 protein_id gnl|my_center|LOCUS_26530 >Feature sequence75 239 427 gene locus_tag LOCUS_26540 239 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 698 390 gene locus_tag LOCUS_26550 698 390 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390816.1 protein_id gnl|my_center|LOCUS_26550 991 722 gene locus_tag LOCUS_26560 991 722 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103035.1 protein_id gnl|my_center|LOCUS_26560 1281 1087 gene locus_tag LOCUS_26570 1281 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 1355 2455 gene locus_tag LOCUS_26580 1355 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 2738 3772 gene locus_tag LOCUS_26590 2738 3772 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809579.1 protein_id gnl|my_center|LOCUS_26590 3772 4602 gene locus_tag LOCUS_26600 3772 4602 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568207.1 protein_id gnl|my_center|LOCUS_26600 4606 5313 gene locus_tag LOCUS_26610 4606 5313 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809582.1 protein_id gnl|my_center|LOCUS_26610 >Feature sequence76 1144 110 gene locus_tag LOCUS_26620 1144 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 2402 1137 gene locus_tag LOCUS_26630 2402 1137 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464097.1 protein_id gnl|my_center|LOCUS_26630 2703 4028 gene locus_tag LOCUS_26640 2703 4028 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065115.1 protein_id gnl|my_center|LOCUS_26640 4144 4395 gene locus_tag LOCUS_26650 4144 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26650 5006 4398 gene locus_tag LOCUS_26660 5006 4398 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522439.1 protein_id gnl|my_center|LOCUS_26660 >Feature sequence77 329 886 gene locus_tag LOCUS_26670 329 886 CDS product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703843.1 protein_id gnl|my_center|LOCUS_26670 1602 946 gene locus_tag LOCUS_26680 1602 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 1802 2035 gene locus_tag LOCUS_26690 1802 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 2505 3842 gene locus_tag LOCUS_26700 2505 3842 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968626.1 protein_id gnl|my_center|LOCUS_26700 3847 4515 gene locus_tag LOCUS_26710 3847 4515 CDS product TIGR02646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968625.1 protein_id gnl|my_center|LOCUS_26710 4779 4976 gene locus_tag LOCUS_26720 4779 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 >Feature sequence78 1749 1174 gene locus_tag LOCUS_26730 1749 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 3115 2399 gene locus_tag LOCUS_26740 3115 2399 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338238.1 protein_id gnl|my_center|LOCUS_26740 3523 3128 gene locus_tag LOCUS_26750 3523 3128 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969221.1 protein_id gnl|my_center|LOCUS_26750 3865 3683 gene locus_tag LOCUS_26760 3865 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 4318 3986 gene locus_tag LOCUS_26770 4318 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 >Feature sequence79 507 1361 gene locus_tag LOCUS_26780 507 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 1358 2305 gene locus_tag LOCUS_26790 1358 2305 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970904.1 protein_id gnl|my_center|LOCUS_26790 2305 3300 gene locus_tag LOCUS_26800 2305 3300 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970282.1 protein_id gnl|my_center|LOCUS_26800 <4328 3486 gene locus_tag LOCUS_26810 <4328 3486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007247571.1:IS5-like element ISPssy family transposase >Feature sequence80 120 476 gene locus_tag LOCUS_26820 120 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 1135 536 gene locus_tag LOCUS_26830 1135 536 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812191.1 protein_id gnl|my_center|LOCUS_26830 1374 1631 gene locus_tag LOCUS_26840 1374 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 1634 3007 gene locus_tag LOCUS_26850 1634 3007 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039889.1 protein_id gnl|my_center|LOCUS_26850 4084 3107 gene locus_tag LOCUS_26860 4084 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence81 180 1 gene locus_tag LOCUS_26870 180 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 448 3975 gene locus_tag LOCUS_26880 448 3975 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387961.1 protein_id gnl|my_center|LOCUS_26880 >Feature sequence82 140 2878 gene locus_tag LOCUS_26890 140 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 3639 4010 gene locus_tag LOCUS_26900 3639 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26900 >Feature sequence83 1842 166 gene locus_tag LOCUS_26910 1842 166 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931517.1 protein_id gnl|my_center|LOCUS_26910 2855 1908 gene locus_tag LOCUS_26920 2855 1908 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064119.1 protein_id gnl|my_center|LOCUS_26920 2966 3409 gene locus_tag LOCUS_26930 2966 3409 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903016.1 protein_id gnl|my_center|LOCUS_26930 3691 3464 gene locus_tag LOCUS_26940 3691 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26940 >Feature sequence84 652 23 gene locus_tag LOCUS_26950 652 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 1972 1340 gene locus_tag LOCUS_26960 1972 1340 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268606.1 protein_id gnl|my_center|LOCUS_26960 3317 2190 gene locus_tag LOCUS_26970 3317 2190 CDS product IS630-like element ISMsm2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003887303.1 protein_id gnl|my_center|LOCUS_26970 >Feature sequence85 1329 2435 gene locus_tag LOCUS_26980 1329 2435 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086305.1 protein_id gnl|my_center|LOCUS_26980 >Feature sequence86 739 269 gene locus_tag LOCUS_26990 739 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 2296 803 gene locus_tag LOCUS_27000 2296 803 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529087.1 protein_id gnl|my_center|LOCUS_27000 2393 3412 gene locus_tag LOCUS_27010 2393 3412 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987090.1 protein_id gnl|my_center|LOCUS_27010 >Feature sequence87 409 335 gene locus_tag LOCUS_t00350 409 335 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 600 527 gene locus_tag LOCUS_t00360 600 527 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 720 634 gene locus_tag LOCUS_t00370 720 634 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 879 1754 gene locus_tag LOCUS_27020 879 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 1761 2129 gene locus_tag LOCUS_27030 1761 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 2417 2554 gene locus_tag LOCUS_27040 2417 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 >Feature sequence88 797 342 gene locus_tag LOCUS_27050 797 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 1356 775 gene locus_tag LOCUS_27060 1356 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 2485 1484 gene locus_tag LOCUS_27070 2485 1484 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27070 >Feature sequence89 582 43 gene locus_tag LOCUS_27080 582 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 691 1269 gene locus_tag LOCUS_27090 691 1269 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339294.1 protein_id gnl|my_center|LOCUS_27090 2179 1346 gene locus_tag LOCUS_27100 2179 1346 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821314.1 protein_id gnl|my_center|LOCUS_27100 2371 2868 gene locus_tag LOCUS_27110 gene rfaH 2371 2868 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957829.1 protein_id gnl|my_center|LOCUS_27110