>Feature sequence001 1 762 gene locus_tag LOCUS_00010 1 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1772 816 gene locus_tag LOCUS_00020 gene cbiB 1772 816 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_00020 2443 1769 gene locus_tag LOCUS_00030 gene cobC 2443 1769 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_00030 2760 2416 gene locus_tag LOCUS_00040 2760 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3923 3162 gene locus_tag LOCUS_00050 gene cobS 3923 3162 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460078.1 protein_id gnl|my_center|LOCUS_00050 4509 3910 gene locus_tag LOCUS_00060 gene cobU 4509 3910 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338347.1 protein_id gnl|my_center|LOCUS_00060 5585 4506 gene locus_tag LOCUS_00070 gene cobT 5585 4506 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_00070 7222 5603 gene locus_tag LOCUS_00080 7222 5603 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437761.1 protein_id gnl|my_center|LOCUS_00080 7799 7239 gene locus_tag LOCUS_00090 7799 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8005 8685 gene locus_tag LOCUS_00100 8005 8685 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_00100 11381 8748 gene locus_tag LOCUS_00110 11381 8748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11651 11406 gene locus_tag LOCUS_00120 11651 11406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12443 11664 gene locus_tag LOCUS_00130 12443 11664 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_00130 12985 12440 gene locus_tag LOCUS_00140 12985 12440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15010 13022 gene locus_tag LOCUS_00150 gene metG 15010 13022 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_00150 15250 15606 gene locus_tag LOCUS_00160 15250 15606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16656 15670 gene locus_tag LOCUS_00170 16656 15670 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_00170 17262 16687 gene locus_tag LOCUS_00180 17262 16687 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_00180 18754 17528 gene locus_tag LOCUS_00190 gene tyrS 18754 17528 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_00190 21192 19357 gene locus_tag LOCUS_00200 21192 19357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 21558 21196 gene locus_tag LOCUS_00210 21558 21196 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814133.1 protein_id gnl|my_center|LOCUS_00210 21741 22418 gene locus_tag LOCUS_00220 21741 22418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 23181 22540 gene locus_tag LOCUS_00230 23181 22540 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_00230 24499 23237 gene locus_tag LOCUS_00240 24499 23237 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948355.1 protein_id gnl|my_center|LOCUS_00240 26031 24547 gene locus_tag LOCUS_00250 gene preA 26031 24547 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987091.1 protein_id gnl|my_center|LOCUS_00250 27409 26045 gene locus_tag LOCUS_00260 gene hydA 27409 26045 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895004.1 protein_id gnl|my_center|LOCUS_00260 28571 27432 gene locus_tag LOCUS_00270 28571 27432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29469 28630 gene locus_tag LOCUS_00280 29469 28630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 30316 29471 gene locus_tag LOCUS_00290 30316 29471 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080857.1 protein_id gnl|my_center|LOCUS_00290 31107 30316 gene locus_tag LOCUS_00300 31107 30316 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240183.1 protein_id gnl|my_center|LOCUS_00300 32450 31299 gene locus_tag LOCUS_00310 32450 31299 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158673.1 protein_id gnl|my_center|LOCUS_00310 33804 32479 gene locus_tag LOCUS_00320 33804 32479 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112315.1 protein_id gnl|my_center|LOCUS_00320 34068 35231 gene locus_tag LOCUS_00330 34068 35231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 35738 35316 gene locus_tag LOCUS_00340 35738 35316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 35895 35749 gene locus_tag LOCUS_00350 35895 35749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 36078 35947 gene locus_tag LOCUS_00360 36078 35947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 36298 36068 gene locus_tag LOCUS_00370 36298 36068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 36282 >37024 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatacatcccatgttacggtttatc >Feature sequence002 2157 760 gene locus_tag LOCUS_00380 2157 760 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_00380 2524 3483 gene locus_tag LOCUS_00390 2524 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 4462 3518 gene locus_tag LOCUS_00400 4462 3518 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_00400 5593 4550 gene locus_tag LOCUS_00410 5593 4550 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_00410 5740 6318 gene locus_tag LOCUS_00420 5740 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 6573 6379 gene locus_tag LOCUS_00430 6573 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 8180 6627 gene locus_tag LOCUS_00440 8180 6627 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437727.1 protein_id gnl|my_center|LOCUS_00440 9609 8182 gene locus_tag LOCUS_00450 9609 8182 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948610.1 protein_id gnl|my_center|LOCUS_00450 11686 9623 gene locus_tag LOCUS_00460 11686 9623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 12448 11714 gene locus_tag LOCUS_00470 gene cobJ 12448 11714 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931509.1 protein_id gnl|my_center|LOCUS_00470 13558 12470 gene locus_tag LOCUS_00480 gene cbiG 13558 12470 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948632.1 protein_id gnl|my_center|LOCUS_00480 14376 13555 gene locus_tag LOCUS_00490 gene cobM 14376 13555 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681800.1 protein_id gnl|my_center|LOCUS_00490 15479 14373 gene locus_tag LOCUS_00500 gene cbiD 15479 14373 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861964.1 protein_id gnl|my_center|LOCUS_00500 16144 15506 gene locus_tag LOCUS_00510 16144 15506 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_00510 17228 16131 gene locus_tag LOCUS_00520 gene cobD 17228 16131 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926914.1 protein_id gnl|my_center|LOCUS_00520 18425 17337 gene locus_tag LOCUS_00530 18425 17337 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430617.1 protein_id gnl|my_center|LOCUS_00530 19447 18638 gene locus_tag LOCUS_00540 19447 18638 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289130.1 protein_id gnl|my_center|LOCUS_00540 20325 19444 gene locus_tag LOCUS_00550 20325 19444 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289132.1 protein_id gnl|my_center|LOCUS_00550 21725 20397 gene locus_tag LOCUS_00560 21725 20397 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527981.1 protein_id gnl|my_center|LOCUS_00560 23245 21938 gene locus_tag LOCUS_00570 23245 21938 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289133.1 protein_id gnl|my_center|LOCUS_00570 25027 23270 gene locus_tag LOCUS_00580 25027 23270 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015253363.1 protein_id gnl|my_center|LOCUS_00580 26552 25017 gene locus_tag LOCUS_00590 26552 25017 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387242.1 protein_id gnl|my_center|LOCUS_00590 28183 26585 gene locus_tag LOCUS_00600 28183 26585 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_00600 29859 28225 gene locus_tag LOCUS_00610 29859 28225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 30718 29963 gene locus_tag LOCUS_00620 30718 29963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 31661 30786 gene locus_tag LOCUS_00630 gene rsmA 31661 30786 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_00630 31913 31743 gene locus_tag LOCUS_00640 31913 31743 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_00640 33375 32044 gene locus_tag LOCUS_00650 33375 32044 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 protein_id gnl|my_center|LOCUS_00650 33834 33388 gene locus_tag LOCUS_00660 gene rplI 33834 33388 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_00660 35882 33831 gene locus_tag LOCUS_00670 35882 33831 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_00670 >Feature sequence003 2054 231 gene locus_tag LOCUS_00680 gene ftsH 2054 231 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966478.1 protein_id gnl|my_center|LOCUS_00680 2615 2073 gene locus_tag LOCUS_00690 gene hpt 2615 2073 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_00690 4030 2630 gene locus_tag LOCUS_00700 gene tilS 4030 2630 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_00700 5919 4030 gene locus_tag LOCUS_00710 5919 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 6370 6077 gene locus_tag LOCUS_00720 6370 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 6758 6357 gene locus_tag LOCUS_00730 6758 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 7037 6759 gene locus_tag LOCUS_00740 7037 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 7317 7075 gene locus_tag LOCUS_00750 7317 7075 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709726.1 protein_id gnl|my_center|LOCUS_00750 7654 7382 gene locus_tag LOCUS_00760 7654 7382 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814866.1 protein_id gnl|my_center|LOCUS_00760 9068 7821 gene locus_tag LOCUS_00770 9068 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 10046 9072 gene locus_tag LOCUS_00780 10046 9072 CDS product CotS family spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966189.1 protein_id gnl|my_center|LOCUS_00780 11449 10106 gene locus_tag LOCUS_00790 11449 10106 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_00790 12588 11446 gene locus_tag LOCUS_00800 12588 11446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 14757 12598 gene locus_tag LOCUS_00810 14757 12598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 16238 14799 gene locus_tag LOCUS_00820 gene proS 16238 14799 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 protein_id gnl|my_center|LOCUS_00820 17100 16396 gene locus_tag LOCUS_00830 17100 16396 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810083.1 protein_id gnl|my_center|LOCUS_00830 17939 17205 gene locus_tag LOCUS_00840 gene pflA 17939 17205 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476647.1 protein_id gnl|my_center|LOCUS_00840 20520 18268 gene locus_tag LOCUS_00850 gene pflB 20520 18268 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_00850 21329 20889 gene locus_tag LOCUS_00860 21329 20889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 21754 21347 gene locus_tag LOCUS_00870 gene fliS 21754 21347 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 protein_id gnl|my_center|LOCUS_00870 23372 21819 gene locus_tag LOCUS_00880 gene fliD 23372 21819 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860688.1 protein_id gnl|my_center|LOCUS_00880 23804 23391 gene locus_tag LOCUS_00890 23804 23391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 24155 23937 gene locus_tag LOCUS_00900 gene csrA 24155 23937 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327053.1 protein_id gnl|my_center|LOCUS_00900 24623 24159 gene locus_tag LOCUS_00910 gene fliW 24623 24159 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860685.1 protein_id gnl|my_center|LOCUS_00910 26229 24649 gene locus_tag LOCUS_00920 26229 24649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 28156 26285 gene locus_tag LOCUS_00930 28156 26285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 29884 28175 gene locus_tag LOCUS_00940 gene flgK 29884 28175 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460797.1 protein_id gnl|my_center|LOCUS_00940 30411 29899 gene locus_tag LOCUS_00950 30411 29899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 30714 30442 gene locus_tag LOCUS_00960 30714 30442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 31734 31330 gene locus_tag LOCUS_00970 31734 31330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 32710 31751 gene locus_tag LOCUS_00980 32710 31751 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_00980 34948 32783 gene locus_tag LOCUS_00990 34948 32783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 >Feature sequence004 <1 969 gene locus_tag LOCUS_01000 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254445.1:cation-translocating P-type ATPase 1057 1863 gene locus_tag LOCUS_01010 1057 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 1867 2523 gene locus_tag LOCUS_01020 1867 2523 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303625.1 protein_id gnl|my_center|LOCUS_01020 2533 3318 gene locus_tag LOCUS_01030 gene tcyC 2533 3318 CDS product cystine ABC transporter ATP-binding protein TcyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246629.1 protein_id gnl|my_center|LOCUS_01030 3477 4571 gene locus_tag LOCUS_01040 3477 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 4748 5470 gene locus_tag LOCUS_01050 4748 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 7606 5720 gene locus_tag LOCUS_01060 7606 5720 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_01060 9332 7599 gene locus_tag LOCUS_01070 9332 7599 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_01070 9810 9325 gene locus_tag LOCUS_01080 9810 9325 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_01080 10329 10835 gene locus_tag LOCUS_01090 10329 10835 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869802.1 protein_id gnl|my_center|LOCUS_01090 11604 10810 gene locus_tag LOCUS_01100 11604 10810 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679604.1 protein_id gnl|my_center|LOCUS_01100 12042 15386 gene locus_tag LOCUS_01110 12042 15386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 15572 16252 gene locus_tag LOCUS_01120 gene pyrE 15572 16252 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_01120 16283 16609 gene locus_tag LOCUS_01130 16283 16609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 16633 18672 gene locus_tag LOCUS_01140 16633 18672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 18702 19202 gene locus_tag LOCUS_01150 gene purE 18702 19202 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_01150 19303 20328 gene locus_tag LOCUS_01160 gene purM 19303 20328 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_01160 20322 20948 gene locus_tag LOCUS_01170 gene purN 20322 20948 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_01170 20977 22251 gene locus_tag LOCUS_01180 gene purD 20977 22251 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_01180 22251 22886 gene locus_tag LOCUS_01190 22251 22886 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943184.1 protein_id gnl|my_center|LOCUS_01190 22901 25585 gene locus_tag LOCUS_01200 22901 25585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 27376 25595 gene locus_tag LOCUS_01210 27376 25595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 27494 28948 gene locus_tag LOCUS_01220 27494 28948 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_01220 29422 30144 gene locus_tag LOCUS_01230 29422 30144 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460117.1 protein_id gnl|my_center|LOCUS_01230 30148 31806 gene locus_tag LOCUS_01240 30148 31806 CDS product putative ABC exporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048139.1 protein_id gnl|my_center|LOCUS_01240 31995 33539 gene locus_tag LOCUS_01250 31995 33539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 33536 34294 gene locus_tag LOCUS_01260 33536 34294 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804815.1 protein_id gnl|my_center|LOCUS_01260 >Feature sequence005 2053 104 gene locus_tag LOCUS_01270 2053 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 3431 2055 gene locus_tag LOCUS_01280 3431 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 4982 3480 gene locus_tag LOCUS_01290 gene fliC 4982 3480 CDS product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112503.1 protein_id gnl|my_center|LOCUS_01290 5497 5201 gene locus_tag LOCUS_01300 5497 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 5938 5711 gene locus_tag LOCUS_01310 5938 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 6729 6151 gene locus_tag LOCUS_01320 6729 6151 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459363.1 protein_id gnl|my_center|LOCUS_01320 7323 6847 gene locus_tag LOCUS_01330 7323 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 8611 7358 gene locus_tag LOCUS_01340 8611 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 9106 8738 gene locus_tag LOCUS_01350 9106 8738 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_01350 11054 9126 gene locus_tag LOCUS_01360 11054 9126 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01360 11302 11084 gene locus_tag LOCUS_01370 11302 11084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01370 12598 11426 gene locus_tag LOCUS_01380 12598 11426 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963530.1 protein_id gnl|my_center|LOCUS_01380 14394 12601 gene locus_tag LOCUS_01390 14394 12601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 15000 14542 gene locus_tag LOCUS_01400 15000 14542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 15200 16576 gene locus_tag LOCUS_01410 15200 16576 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_01410 16589 17584 gene locus_tag LOCUS_01420 16589 17584 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363756.1 protein_id gnl|my_center|LOCUS_01420 18884 17640 gene locus_tag LOCUS_01430 18884 17640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 21164 19041 gene locus_tag LOCUS_01440 21164 19041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 22081 21302 gene locus_tag LOCUS_01450 22081 21302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 22914 22078 gene locus_tag LOCUS_01460 22914 22078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 24060 23005 gene locus_tag LOCUS_01470 24060 23005 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964934.1 protein_id gnl|my_center|LOCUS_01470 28368 24244 gene locus_tag LOCUS_01480 28368 24244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 29109 28780 gene locus_tag LOCUS_01490 29109 28780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 30920 29262 gene locus_tag LOCUS_01500 30920 29262 CDS product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804059.1 protein_id gnl|my_center|LOCUS_01500 <31590 30959 gene locus_tag LOCUS_01510 <31590 30959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583080.1:sugar ABC transporter permease >Feature sequence006 954 1757 gene locus_tag LOCUS_01520 954 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 3610 1799 gene locus_tag LOCUS_01530 3610 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 4491 3655 gene locus_tag LOCUS_01540 4491 3655 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254021.1 protein_id gnl|my_center|LOCUS_01540 5288 4488 gene locus_tag LOCUS_01550 5288 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 5524 6402 gene locus_tag LOCUS_01560 gene pdxS 5524 6402 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813582.1 protein_id gnl|my_center|LOCUS_01560 6405 6950 gene locus_tag LOCUS_01570 gene pdxT 6405 6950 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461704.1 protein_id gnl|my_center|LOCUS_01570 8802 7006 gene locus_tag LOCUS_01580 8802 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 9625 8789 gene locus_tag LOCUS_01590 9625 8789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 10540 9662 gene locus_tag LOCUS_01600 10540 9662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 11506 10688 gene locus_tag LOCUS_01610 11506 10688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 11740 12624 gene locus_tag LOCUS_01620 11740 12624 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101944.1 protein_id gnl|my_center|LOCUS_01620 13208 12636 gene locus_tag LOCUS_01630 13208 12636 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015812.1 protein_id gnl|my_center|LOCUS_01630 14442 13189 gene locus_tag LOCUS_01640 gene thiH 14442 13189 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_01640 15225 14455 gene locus_tag LOCUS_01650 15225 14455 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 protein_id gnl|my_center|LOCUS_01650 15652 15434 gene locus_tag LOCUS_01660 15652 15434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 16654 15911 gene locus_tag LOCUS_01670 16654 15911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 17767 16793 gene locus_tag LOCUS_01680 gene bsh 17767 16793 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317802.1 protein_id gnl|my_center|LOCUS_01680 18561 17893 gene locus_tag LOCUS_01690 18561 17893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 19855 18572 gene locus_tag LOCUS_01700 19855 18572 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105320.1 protein_id gnl|my_center|LOCUS_01700 22535 20151 gene locus_tag LOCUS_01710 22535 20151 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814229.1 protein_id gnl|my_center|LOCUS_01710 22822 22538 gene locus_tag LOCUS_01720 22822 22538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 23505 22819 gene locus_tag LOCUS_01730 23505 22819 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020493338.1 protein_id gnl|my_center|LOCUS_01730 24549 23605 gene locus_tag LOCUS_01740 24549 23605 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943877.1 protein_id gnl|my_center|LOCUS_01740 25232 24537 gene locus_tag LOCUS_01750 25232 24537 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459494.1 protein_id gnl|my_center|LOCUS_01750 27070 25481 gene locus_tag LOCUS_01760 27070 25481 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760930.1 protein_id gnl|my_center|LOCUS_01760 27398 27171 gene locus_tag LOCUS_01770 27398 27171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 27591 27776 gene locus_tag LOCUS_01780 27591 27776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 30082 27800 gene locus_tag LOCUS_01790 30082 27800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 >Feature sequence007 670 1305 gene locus_tag LOCUS_01800 670 1305 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168857.1 protein_id gnl|my_center|LOCUS_01800 1540 1331 gene locus_tag LOCUS_01810 1540 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 1720 1547 gene locus_tag LOCUS_01820 1720 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 1945 1757 gene locus_tag LOCUS_01830 1945 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 4291 2594 gene locus_tag LOCUS_01840 4291 2594 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_01840 4863 4792 gene locus_tag LOCUS_t00010 4863 4792 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6059 4983 gene locus_tag LOCUS_01850 6059 4983 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528458.1 protein_id gnl|my_center|LOCUS_01850 7270 6128 gene locus_tag LOCUS_01860 7270 6128 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_01860 9560 7299 gene locus_tag LOCUS_01870 9560 7299 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_01870 11851 9578 gene locus_tag LOCUS_01880 11851 9578 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022610.1 protein_id gnl|my_center|LOCUS_01880 12906 11869 gene locus_tag LOCUS_01890 12906 11869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 13679 12909 gene locus_tag LOCUS_01900 13679 12909 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808828.1 protein_id gnl|my_center|LOCUS_01900 14482 13694 gene locus_tag LOCUS_01910 14482 13694 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206766.1 protein_id gnl|my_center|LOCUS_01910 15161 14739 gene locus_tag LOCUS_01920 15161 14739 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861830.1 protein_id gnl|my_center|LOCUS_01920 16234 15161 gene locus_tag LOCUS_01930 16234 15161 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272581.1 protein_id gnl|my_center|LOCUS_01930 17644 16355 gene locus_tag LOCUS_01940 17644 16355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 19546 17705 gene locus_tag LOCUS_01950 19546 17705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 20421 19783 gene locus_tag LOCUS_01960 gene cysC 20421 19783 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963430.1 protein_id gnl|my_center|LOCUS_01960 21605 20436 gene locus_tag LOCUS_01970 21605 20436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 21836 22519 gene locus_tag LOCUS_01980 21836 22519 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_01980 22512 23729 gene locus_tag LOCUS_01990 22512 23729 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490535.1 protein_id gnl|my_center|LOCUS_01990 24876 23731 gene locus_tag LOCUS_02000 24876 23731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02000 25758 24880 gene locus_tag LOCUS_02010 25758 24880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02010 26518 25751 gene locus_tag LOCUS_02020 26518 25751 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 protein_id gnl|my_center|LOCUS_02020 27774 26725 gene locus_tag LOCUS_02030 27774 26725 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_02030 28468 27788 gene locus_tag LOCUS_02040 28468 27788 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_02040 >Feature sequence008 231 1334 gene locus_tag LOCUS_02050 231 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 1686 2621 gene locus_tag LOCUS_02060 1686 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 2714 4441 gene locus_tag LOCUS_02070 2714 4441 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_02070 4447 5184 gene locus_tag LOCUS_02080 4447 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 5186 7384 gene locus_tag LOCUS_02090 5186 7384 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584017.1 protein_id gnl|my_center|LOCUS_02090 7448 8497 gene locus_tag LOCUS_02100 7448 8497 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_02100 9389 8472 gene locus_tag LOCUS_02110 9389 8472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 9671 11074 gene locus_tag LOCUS_02120 9671 11074 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_02120 11173 12198 gene locus_tag LOCUS_02130 11173 12198 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_02130 12198 13073 gene locus_tag LOCUS_02140 12198 13073 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_02140 13101 14276 gene locus_tag LOCUS_02150 13101 14276 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583022.1 protein_id gnl|my_center|LOCUS_02150 14280 15452 gene locus_tag LOCUS_02160 14280 15452 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108595.1 protein_id gnl|my_center|LOCUS_02160 15467 16492 gene locus_tag LOCUS_02170 15467 16492 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_02170 16495 17544 gene locus_tag LOCUS_02180 16495 17544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 17589 18695 gene locus_tag LOCUS_02190 17589 18695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 18709 21021 gene locus_tag LOCUS_02200 18709 21021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 21178 22161 gene locus_tag LOCUS_02210 gene ganR 21178 22161 CDS product galactan degradation operon transcriptional regulator GanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244199.1 protein_id gnl|my_center|LOCUS_02210 22363 23016 gene locus_tag LOCUS_02220 22363 23016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 23019 24092 gene locus_tag LOCUS_02230 23019 24092 CDS product arabinogalactan endo-beta-1,4-galactanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097214.1 protein_id gnl|my_center|LOCUS_02230 24108 25319 gene locus_tag LOCUS_02240 24108 25319 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887206.1 protein_id gnl|my_center|LOCUS_02240 25327 26238 gene locus_tag LOCUS_02250 25327 26238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 >Feature sequence009 666 43 gene locus_tag LOCUS_02260 666 43 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 protein_id gnl|my_center|LOCUS_02260 2786 663 gene locus_tag LOCUS_02270 2786 663 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721318.1 protein_id gnl|my_center|LOCUS_02270 3364 2783 gene locus_tag LOCUS_02280 3364 2783 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_02280 4082 3372 gene locus_tag LOCUS_02290 4082 3372 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016734.1 protein_id gnl|my_center|LOCUS_02290 5106 4075 gene locus_tag LOCUS_02300 5106 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 6001 5078 gene locus_tag LOCUS_02310 6001 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582849.1 protein_id gnl|my_center|LOCUS_02310 7377 5998 gene locus_tag LOCUS_02320 7377 5998 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966858.1 protein_id gnl|my_center|LOCUS_02320 9398 7398 gene locus_tag LOCUS_02330 9398 7398 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_02330 10700 9507 gene locus_tag LOCUS_02340 10700 9507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 12471 10648 gene locus_tag LOCUS_02350 12471 10648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 13225 12590 gene locus_tag LOCUS_02360 13225 12590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 13614 13225 gene locus_tag LOCUS_02370 13614 13225 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_02370 13892 15973 gene locus_tag LOCUS_02380 gene htpG 13892 15973 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_02380 16573 16049 gene locus_tag LOCUS_02390 16573 16049 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_02390 17586 16570 gene locus_tag LOCUS_02400 17586 16570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 17856 17593 gene locus_tag LOCUS_02410 17856 17593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 18545 17922 gene locus_tag LOCUS_02420 18545 17922 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_02420 22159 18542 gene locus_tag LOCUS_02430 gene addA 22159 18542 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572274.1 protein_id gnl|my_center|LOCUS_02430 25574 22125 gene locus_tag LOCUS_02440 gene addB 25574 22125 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_02440 26286 25594 gene locus_tag LOCUS_02450 26286 25594 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_02450 >Feature sequence010 1450 956 gene locus_tag LOCUS_02460 1450 956 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072119.1 protein_id gnl|my_center|LOCUS_02460 2438 1479 gene locus_tag LOCUS_02470 2438 1479 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_02470 4206 2464 gene locus_tag LOCUS_02480 4206 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 4642 4217 gene locus_tag LOCUS_02490 gene fabZ 4642 4217 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356286.1 protein_id gnl|my_center|LOCUS_02490 5880 4648 gene locus_tag LOCUS_02500 gene fabF 5880 4648 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_02500 6651 5911 gene locus_tag LOCUS_02510 gene fabG 6651 5911 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_02510 7561 6638 gene locus_tag LOCUS_02520 gene fabD 7561 6638 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_02520 8497 7571 gene locus_tag LOCUS_02530 gene fabK 8497 7571 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_02530 8734 8501 gene locus_tag LOCUS_02540 gene acpP 8734 8501 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057709.1 protein_id gnl|my_center|LOCUS_02540 9883 8945 gene locus_tag LOCUS_02550 9883 8945 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_02550 12415 10034 gene locus_tag LOCUS_02560 12415 10034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 13062 12514 gene locus_tag LOCUS_02570 gene spoVT 13062 12514 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359411.1 protein_id gnl|my_center|LOCUS_02570 13228 15324 gene locus_tag LOCUS_02580 13228 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 17420 15381 gene locus_tag LOCUS_02590 17420 15381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 19015 17600 gene locus_tag LOCUS_02600 gene pyk 19015 17600 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_02600 19488 19072 gene locus_tag LOCUS_02610 19488 19072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 20656 19481 gene locus_tag LOCUS_02620 20656 19481 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_02620 21336 20692 gene locus_tag LOCUS_02630 21336 20692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 21857 21339 gene locus_tag LOCUS_02640 21857 21339 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_02640 22722 21850 gene locus_tag LOCUS_02650 gene aroE 22722 21850 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861653.1 protein_id gnl|my_center|LOCUS_02650 24991 22769 gene locus_tag LOCUS_02660 24991 22769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 <26323 25016 gene locus_tag LOCUS_02670 <26323 25016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_128975638.1:LTA synthase family protein >Feature sequence011 1112 60 gene locus_tag LOCUS_02680 1112 60 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682008.1 protein_id gnl|my_center|LOCUS_02680 2670 1171 gene locus_tag LOCUS_02690 2670 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 4409 2799 gene locus_tag LOCUS_02700 4409 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 6417 5029 gene locus_tag LOCUS_02710 6417 5029 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861185.1 protein_id gnl|my_center|LOCUS_02710 7067 6408 gene locus_tag LOCUS_02720 7067 6408 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405372.1 protein_id gnl|my_center|LOCUS_02720 7782 7060 gene locus_tag LOCUS_02730 7782 7060 CDS product lantibiotic immunity ABC transporter MutG family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861184.1 protein_id gnl|my_center|LOCUS_02730 8543 7779 gene locus_tag LOCUS_02740 8543 7779 CDS product lantibiotic immunity ABC transporter MutE/EpiE family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949125.1 protein_id gnl|my_center|LOCUS_02740 9244 8540 gene locus_tag LOCUS_02750 9244 8540 CDS product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896245.1 protein_id gnl|my_center|LOCUS_02750 10254 9313 gene locus_tag LOCUS_02760 10254 9313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 10783 10244 gene locus_tag LOCUS_02770 10783 10244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 11269 11066 gene locus_tag LOCUS_02780 11269 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 12023 11418 gene locus_tag LOCUS_02790 12023 11418 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005627.1 protein_id gnl|my_center|LOCUS_02790 12450 12040 gene locus_tag LOCUS_02800 12450 12040 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705736.1 protein_id gnl|my_center|LOCUS_02800 12652 14325 gene locus_tag LOCUS_02810 12652 14325 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_02810 15858 14512 gene locus_tag LOCUS_02820 15858 14512 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_02820 16782 16159 gene locus_tag LOCUS_02830 16782 16159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 17348 16779 gene locus_tag LOCUS_02840 17348 16779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 18344 17520 gene locus_tag LOCUS_02850 18344 17520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 19305 18526 gene locus_tag LOCUS_02860 19305 18526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 19730 19302 gene locus_tag LOCUS_02870 19730 19302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 20649 20014 gene locus_tag LOCUS_02880 20649 20014 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861240.1 protein_id gnl|my_center|LOCUS_02880 20847 20674 gene locus_tag LOCUS_02890 20847 20674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 21723 20869 gene locus_tag LOCUS_02900 21723 20869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 21904 22446 gene locus_tag LOCUS_02910 21904 22446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence012 623 2545 gene locus_tag LOCUS_02920 623 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 2546 3724 gene locus_tag LOCUS_02930 2546 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 3824 4849 gene locus_tag LOCUS_02940 gene rfbB 3824 4849 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_02940 4866 5768 gene locus_tag LOCUS_02950 gene rfbD 4866 5768 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476435.1 protein_id gnl|my_center|LOCUS_02950 5770 6654 gene locus_tag LOCUS_02960 gene rfbA 5770 6654 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112125.1 protein_id gnl|my_center|LOCUS_02960 6720 7319 gene locus_tag LOCUS_02970 gene rfbC 6720 7319 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_02970 7479 9074 gene locus_tag LOCUS_02980 7479 9074 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_02980 9234 10940 gene locus_tag LOCUS_02990 9234 10940 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_02990 11055 11402 gene locus_tag LOCUS_03000 11055 11402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 11357 11545 gene locus_tag LOCUS_03010 11357 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 11693 11962 gene locus_tag LOCUS_03020 11693 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 11946 12179 gene locus_tag LOCUS_03030 11946 12179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 12482 14428 gene locus_tag LOCUS_03040 12482 14428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 14409 15311 gene locus_tag LOCUS_03050 14409 15311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 15711 16523 gene locus_tag LOCUS_03060 15711 16523 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987021.1 protein_id gnl|my_center|LOCUS_03060 16604 16873 gene locus_tag LOCUS_03070 16604 16873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 16891 18753 gene locus_tag LOCUS_03080 16891 18753 CDS product motility associated factor glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965500.1 protein_id gnl|my_center|LOCUS_03080 19897 18740 gene locus_tag LOCUS_03090 19897 18740 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704233.1 protein_id gnl|my_center|LOCUS_03090 21084 19897 gene locus_tag LOCUS_03100 21084 19897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 21171 22784 gene locus_tag LOCUS_03110 21171 22784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 22781 23794 gene locus_tag LOCUS_03120 22781 23794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 23861 24244 gene locus_tag LOCUS_03130 23861 24244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 >Feature sequence013 1984 1499 gene locus_tag LOCUS_03140 gene greA 1984 1499 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_03140 3177 2209 gene locus_tag LOCUS_03150 gene dusB 3177 2209 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_03150 3959 3180 gene locus_tag LOCUS_03160 3959 3180 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783138.1 protein_id gnl|my_center|LOCUS_03160 4324 3956 gene locus_tag LOCUS_03170 4324 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 5288 4311 gene locus_tag LOCUS_03180 5288 4311 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948775.1 protein_id gnl|my_center|LOCUS_03180 6319 5330 gene locus_tag LOCUS_03190 gene argF 6319 5330 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_03190 7709 6450 gene locus_tag LOCUS_03200 7709 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 8271 8029 gene locus_tag LOCUS_03210 8271 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 8518 9594 gene locus_tag LOCUS_03220 8518 9594 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_03220 10092 9682 gene locus_tag LOCUS_03230 10092 9682 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_03230 11093 10104 gene locus_tag LOCUS_03240 11093 10104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 11741 11118 gene locus_tag LOCUS_03250 11741 11118 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254484.1 protein_id gnl|my_center|LOCUS_03250 13055 11808 gene locus_tag LOCUS_03260 13055 11808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 13249 13052 gene locus_tag LOCUS_03270 13249 13052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 13665 13261 gene locus_tag LOCUS_03280 13665 13261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 14335 13706 gene locus_tag LOCUS_03290 14335 13706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 16173 14620 gene locus_tag LOCUS_03300 16173 14620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 16340 16173 gene locus_tag LOCUS_03310 16340 16173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 17570 16353 gene locus_tag LOCUS_03320 17570 16353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 18318 17581 gene locus_tag LOCUS_03330 18318 17581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 19531 18275 gene locus_tag LOCUS_03340 19531 18275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 20507 19524 gene locus_tag LOCUS_03350 20507 19524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 21072 20539 gene locus_tag LOCUS_03360 21072 20539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 21213 21443 gene locus_tag LOCUS_03370 21213 21443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 21942 21466 gene locus_tag LOCUS_03380 21942 21466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 23400 21952 gene locus_tag LOCUS_03390 23400 21952 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_03390 23592 23804 gene locus_tag LOCUS_03400 23592 23804 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359346.1 protein_id gnl|my_center|LOCUS_03400 24614 23862 gene locus_tag LOCUS_03410 24614 23862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 >Feature sequence014 418 801 gene locus_tag LOCUS_03420 418 801 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_03420 1021 2619 gene locus_tag LOCUS_03430 1021 2619 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108010.1 protein_id gnl|my_center|LOCUS_03430 2684 3943 gene locus_tag LOCUS_03440 gene hisS 2684 3943 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964121.1 protein_id gnl|my_center|LOCUS_03440 3971 5770 gene locus_tag LOCUS_03450 gene aspS 3971 5770 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965567.1 protein_id gnl|my_center|LOCUS_03450 5776 6822 gene locus_tag LOCUS_03460 5776 6822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 8283 6841 gene locus_tag LOCUS_03470 8283 6841 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_03470 8975 8280 gene locus_tag LOCUS_03480 8975 8280 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_03480 11393 9012 gene locus_tag LOCUS_03490 11393 9012 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_03490 11505 12770 gene locus_tag LOCUS_03500 11505 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 12792 13736 gene locus_tag LOCUS_03510 12792 13736 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_03510 13794 15257 gene locus_tag LOCUS_03520 gene rlmD 13794 15257 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_03520 15712 15206 gene locus_tag LOCUS_03530 15712 15206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 15894 16688 gene locus_tag LOCUS_03540 15894 16688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 17382 16735 gene locus_tag LOCUS_03550 17382 16735 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964200.1 protein_id gnl|my_center|LOCUS_03550 17615 18856 gene locus_tag LOCUS_03560 17615 18856 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963947.1 protein_id gnl|my_center|LOCUS_03560 19746 18853 gene locus_tag LOCUS_03570 19746 18853 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002932053.1 protein_id gnl|my_center|LOCUS_03570 19802 19924 gene locus_tag LOCUS_03580 19802 19924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 19902 21569 gene locus_tag LOCUS_03590 19902 21569 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860825.1 protein_id gnl|my_center|LOCUS_03590 21639 23093 gene locus_tag LOCUS_03600 21639 23093 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057658.1 protein_id gnl|my_center|LOCUS_03600 23090 23314 gene locus_tag LOCUS_03610 23090 23314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 23368 24063 gene locus_tag LOCUS_03620 23368 24063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 >Feature sequence015 <1 744 gene locus_tag LOCUS_03630 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043943610.1:class I SAM-dependent methyltransferase 858 1886 gene locus_tag LOCUS_03640 858 1886 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 protein_id gnl|my_center|LOCUS_03640 1943 4102 gene locus_tag LOCUS_03650 gene glgX 1943 4102 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_03650 4403 4140 gene locus_tag LOCUS_03660 4403 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 5235 4513 gene locus_tag LOCUS_03670 5235 4513 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948252.1 protein_id gnl|my_center|LOCUS_03670 5332 5406 gene locus_tag LOCUS_t00020 5332 5406 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7377 5563 gene locus_tag LOCUS_03680 gene glmS 7377 5563 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_03680 7982 8518 gene locus_tag LOCUS_03690 gene lepB 7982 8518 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425129.1 protein_id gnl|my_center|LOCUS_03690 8628 9548 gene locus_tag LOCUS_03700 gene nadA 8628 9548 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546803.1 protein_id gnl|my_center|LOCUS_03700 11407 9641 gene locus_tag LOCUS_03710 11407 9641 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814523.1 protein_id gnl|my_center|LOCUS_03710 12068 11397 gene locus_tag LOCUS_03720 12068 11397 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_03720 12785 12093 gene locus_tag LOCUS_03730 12785 12093 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_03730 12995 13546 gene locus_tag LOCUS_03740 12995 13546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 14900 13632 gene locus_tag LOCUS_03750 14900 13632 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814514.1 protein_id gnl|my_center|LOCUS_03750 15596 14919 gene locus_tag LOCUS_03760 15596 14919 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_03760 15813 16724 gene locus_tag LOCUS_03770 15813 16724 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_03770 16768 17679 gene locus_tag LOCUS_03780 gene pstC 16768 17679 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_03780 17676 18554 gene locus_tag LOCUS_03790 gene pstA 17676 18554 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_03790 19103 19537 gene locus_tag LOCUS_03800 19103 19537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 19608 20297 gene locus_tag LOCUS_03810 19608 20297 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436876.1 protein_id gnl|my_center|LOCUS_03810 21380 22141 gene locus_tag LOCUS_03820 gene pstB 21380 22141 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432349.1 protein_id gnl|my_center|LOCUS_03820 22141 22794 gene locus_tag LOCUS_03830 gene phoU 22141 22794 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545517.1 protein_id gnl|my_center|LOCUS_03830 22966 23634 gene locus_tag LOCUS_03840 22966 23634 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_03840 >Feature sequence016 925 443 gene locus_tag LOCUS_03850 925 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 1300 1088 gene locus_tag LOCUS_03860 1300 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 2945 1728 gene locus_tag LOCUS_03870 2945 1728 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_03870 3438 4778 gene locus_tag LOCUS_03880 3438 4778 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461055.1 protein_id gnl|my_center|LOCUS_03880 4912 7053 gene locus_tag LOCUS_03890 4912 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 7950 7105 gene locus_tag LOCUS_03900 7950 7105 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_03900 8600 7983 gene locus_tag LOCUS_03910 gene lepB 8600 7983 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583882.1 protein_id gnl|my_center|LOCUS_03910 10512 8602 gene locus_tag LOCUS_03920 10512 8602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 11387 10509 gene locus_tag LOCUS_03930 11387 10509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 12484 11510 gene locus_tag LOCUS_03940 12484 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 13691 12561 gene locus_tag LOCUS_03950 13691 12561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 14358 13630 gene locus_tag LOCUS_03960 14358 13630 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704149.1 protein_id gnl|my_center|LOCUS_03960 15116 14355 gene locus_tag LOCUS_03970 15116 14355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 15843 15136 gene locus_tag LOCUS_03980 gene cps4B 15843 15136 CDS product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922734.1 protein_id gnl|my_center|LOCUS_03980 17826 16459 gene locus_tag LOCUS_03990 17826 16459 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262172.1 protein_id gnl|my_center|LOCUS_03990 18554 17865 gene locus_tag LOCUS_04000 18554 17865 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_04000 20037 18532 gene locus_tag LOCUS_04010 20037 18532 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963640.1 protein_id gnl|my_center|LOCUS_04010 21314 20133 gene locus_tag LOCUS_04020 gene metK 21314 20133 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163123.1 protein_id gnl|my_center|LOCUS_04020 21637 22752 gene locus_tag LOCUS_04030 21637 22752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 <23921 22827 gene locus_tag LOCUS_04040 <23921 22827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003359322.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence017 452 1300 gene locus_tag LOCUS_04050 452 1300 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965690.1 protein_id gnl|my_center|LOCUS_04050 1326 1946 gene locus_tag LOCUS_04060 1326 1946 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129648.1 protein_id gnl|my_center|LOCUS_04060 2072 2593 gene locus_tag LOCUS_04070 2072 2593 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_04070 2606 3604 gene locus_tag LOCUS_04080 2606 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 3657 5108 gene locus_tag LOCUS_04090 3657 5108 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994262.1 protein_id gnl|my_center|LOCUS_04090 6451 5105 gene locus_tag LOCUS_04100 6451 5105 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_04100 6731 7627 gene locus_tag LOCUS_04110 6731 7627 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529211.1 protein_id gnl|my_center|LOCUS_04110 7762 8643 gene locus_tag LOCUS_04120 7762 8643 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_04120 8670 9518 gene locus_tag LOCUS_04130 8670 9518 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_04130 9600 10916 gene locus_tag LOCUS_04140 9600 10916 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568103.1 protein_id gnl|my_center|LOCUS_04140 11009 12427 gene locus_tag LOCUS_04150 11009 12427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 12417 13148 gene locus_tag LOCUS_04160 12417 13148 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720577.1 protein_id gnl|my_center|LOCUS_04160 13151 14242 gene locus_tag LOCUS_04170 gene ugpC 13151 14242 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_04170 14491 14679 gene locus_tag LOCUS_04180 14491 14679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 14768 16453 gene locus_tag LOCUS_04190 14768 16453 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_04190 17297 16455 gene locus_tag LOCUS_04200 17297 16455 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_04200 17467 18768 gene locus_tag LOCUS_04210 17467 18768 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068626.1 protein_id gnl|my_center|LOCUS_04210 18765 19640 gene locus_tag LOCUS_04220 18765 19640 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051829.1 protein_id gnl|my_center|LOCUS_04220 19637 20479 gene locus_tag LOCUS_04230 19637 20479 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence018 244 759 gene locus_tag LOCUS_04240 244 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 1652 795 gene locus_tag LOCUS_04250 gene metF 1652 795 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858469.1 protein_id gnl|my_center|LOCUS_04250 1876 2082 gene locus_tag LOCUS_04260 1876 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 2151 2378 gene locus_tag LOCUS_04270 2151 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 2458 2664 gene locus_tag LOCUS_04280 2458 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 2945 2643 gene locus_tag LOCUS_04290 2945 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04290 3637 5214 gene locus_tag LOCUS_04300 3637 5214 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_04300 5305 6327 gene locus_tag LOCUS_04310 5305 6327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 6492 6800 gene locus_tag LOCUS_04320 6492 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 6793 7197 gene locus_tag LOCUS_04330 6793 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 7194 8411 gene locus_tag LOCUS_04340 7194 8411 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807909.1 protein_id gnl|my_center|LOCUS_04340 8556 10646 gene locus_tag LOCUS_04350 8556 10646 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966624.1 protein_id gnl|my_center|LOCUS_04350 10750 11595 gene locus_tag LOCUS_04360 10750 11595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 11756 12292 gene locus_tag LOCUS_04370 11756 12292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 12559 12759 gene locus_tag LOCUS_04380 12559 12759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 12890 13063 gene locus_tag LOCUS_04390 12890 13063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 13243 15207 gene locus_tag LOCUS_04400 13243 15207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 15263 16135 gene locus_tag LOCUS_04410 15263 16135 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 protein_id gnl|my_center|LOCUS_04410 17172 16408 gene locus_tag LOCUS_04420 17172 16408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 20056 17186 gene locus_tag LOCUS_04430 20056 17186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 20271 21299 gene locus_tag LOCUS_04440 20271 21299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 21406 21828 gene locus_tag LOCUS_04450 21406 21828 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_04450 >Feature sequence019 19 974 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttacagtcacgtaatttgtttaggtactaaaat 2021 1035 gene locus_tag LOCUS_04460 2021 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 2227 2018 gene locus_tag LOCUS_04470 2227 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 3245 2331 gene locus_tag LOCUS_04480 gene cas1 3245 2331 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_04480 6716 3402 gene locus_tag LOCUS_04490 6716 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 7473 7321 gene locus_tag LOCUS_04500 7473 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 7931 7509 gene locus_tag LOCUS_04510 7931 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 9026 7980 gene locus_tag LOCUS_04520 9026 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 11624 9093 gene locus_tag LOCUS_04530 11624 9093 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_04530 11948 11643 gene locus_tag LOCUS_04540 11948 11643 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_04540 12107 13054 gene locus_tag LOCUS_04550 12107 13054 CDS product DUF4846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765761.1 protein_id gnl|my_center|LOCUS_04550 13526 13032 gene locus_tag LOCUS_04560 13526 13032 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022620559.1 protein_id gnl|my_center|LOCUS_04560 13988 13707 gene locus_tag LOCUS_04570 13988 13707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 15501 14023 gene locus_tag LOCUS_04580 15501 14023 CDS product GLUG motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108635.1 protein_id gnl|my_center|LOCUS_04580 16641 15526 gene locus_tag LOCUS_04590 16641 15526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 18267 16759 gene locus_tag LOCUS_04600 18267 16759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 19040 18279 gene locus_tag LOCUS_04610 19040 18279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 19511 19143 gene locus_tag LOCUS_04620 19511 19143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 20505 19765 gene locus_tag LOCUS_04630 20505 19765 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963763.1 protein_id gnl|my_center|LOCUS_04630 20809 20528 gene locus_tag LOCUS_04640 20809 20528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 22008 20818 gene locus_tag LOCUS_04650 22008 20818 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966117.1 protein_id gnl|my_center|LOCUS_04650 >Feature sequence020 419 748 gene locus_tag LOCUS_04660 419 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 849 2606 gene locus_tag LOCUS_04670 gene dnaK 849 2606 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_04670 2814 3467 gene locus_tag LOCUS_04680 gene fsa 2814 3467 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964656.1 protein_id gnl|my_center|LOCUS_04680 3564 4403 gene locus_tag LOCUS_04690 3564 4403 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_04690 4391 5329 gene locus_tag LOCUS_04700 4391 5329 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_04700 5883 5326 gene locus_tag LOCUS_04710 gene yfcE 5883 5326 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966036.1 protein_id gnl|my_center|LOCUS_04710 7693 6047 gene locus_tag LOCUS_04720 7693 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 8174 7683 gene locus_tag LOCUS_04730 8174 7683 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816820.1 protein_id gnl|my_center|LOCUS_04730 8539 8952 gene locus_tag LOCUS_04740 8539 8952 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_04740 9081 9839 gene locus_tag LOCUS_04750 9081 9839 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295276.1 protein_id gnl|my_center|LOCUS_04750 9966 10346 gene locus_tag LOCUS_04760 9966 10346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 10643 11629 gene locus_tag LOCUS_04770 10643 11629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 11647 13614 gene locus_tag LOCUS_04780 11647 13614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 13625 14440 gene locus_tag LOCUS_04790 13625 14440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 14788 14462 gene locus_tag LOCUS_04800 14788 14462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 15031 17022 gene locus_tag LOCUS_04810 15031 17022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 17019 18392 gene locus_tag LOCUS_04820 17019 18392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 18408 19343 gene locus_tag LOCUS_04830 18408 19343 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_04830 19425 19850 gene locus_tag LOCUS_04840 19425 19850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 >Feature sequence021 1582 383 gene locus_tag LOCUS_04850 1582 383 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864195.1 protein_id gnl|my_center|LOCUS_04850 2499 1606 gene locus_tag LOCUS_04860 gene argB 2499 1606 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864194.1 protein_id gnl|my_center|LOCUS_04860 2968 2510 gene locus_tag LOCUS_04870 2968 2510 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851934.1 protein_id gnl|my_center|LOCUS_04870 4116 3058 gene locus_tag LOCUS_04880 gene argC 4116 3058 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_04880 4328 5557 gene locus_tag LOCUS_04890 4328 5557 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_04890 6341 5610 gene locus_tag LOCUS_04900 6341 5610 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_04900 7231 6362 gene locus_tag LOCUS_04910 7231 6362 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967756.1 protein_id gnl|my_center|LOCUS_04910 8018 7233 gene locus_tag LOCUS_04920 8018 7233 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083383.1 protein_id gnl|my_center|LOCUS_04920 12657 8155 gene locus_tag LOCUS_04930 12657 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 13274 12819 gene locus_tag LOCUS_04940 13274 12819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 14152 13277 gene locus_tag LOCUS_04950 gene metF 14152 13277 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_04950 14676 14173 gene locus_tag LOCUS_04960 gene greA 14676 14173 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182999.1 protein_id gnl|my_center|LOCUS_04960 15322 14693 gene locus_tag LOCUS_04970 15322 14693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 16184 15315 gene locus_tag LOCUS_04980 16184 15315 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_04980 17722 16196 gene locus_tag LOCUS_04990 17722 16196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 19095 17803 gene locus_tag LOCUS_05000 19095 17803 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_05000 20137 19271 gene locus_tag LOCUS_05010 20137 19271 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 protein_id gnl|my_center|LOCUS_05010 >Feature sequence022 143 1342 gene locus_tag LOCUS_05020 143 1342 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682004.1 protein_id gnl|my_center|LOCUS_05020 1488 2549 gene locus_tag LOCUS_05030 1488 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 3640 2552 gene locus_tag LOCUS_05040 3640 2552 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937723.1 protein_id gnl|my_center|LOCUS_05040 3820 5400 gene locus_tag LOCUS_05050 3820 5400 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680556.1 protein_id gnl|my_center|LOCUS_05050 5529 6482 gene locus_tag LOCUS_05060 5529 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 6545 6694 gene locus_tag LOCUS_05070 6545 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 6704 7993 gene locus_tag LOCUS_05080 6704 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 8015 8884 gene locus_tag LOCUS_05090 8015 8884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 8881 9354 gene locus_tag LOCUS_05100 8881 9354 CDS product LURP-one-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900805.1 protein_id gnl|my_center|LOCUS_05100 10219 9407 gene locus_tag LOCUS_05110 10219 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 11504 10311 gene locus_tag LOCUS_05120 11504 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 12606 11497 gene locus_tag LOCUS_05130 12606 11497 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303623.1 protein_id gnl|my_center|LOCUS_05130 12794 13003 gene locus_tag LOCUS_05140 12794 13003 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263444.1 protein_id gnl|my_center|LOCUS_05140 13000 13485 gene locus_tag LOCUS_05150 13000 13485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 13498 14856 gene locus_tag LOCUS_05160 13498 14856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 15305 15871 gene locus_tag LOCUS_05170 15305 15871 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816608.1 protein_id gnl|my_center|LOCUS_05170 17141 15996 gene locus_tag LOCUS_05180 gene fucO 17141 15996 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 protein_id gnl|my_center|LOCUS_05180 17513 18739 gene locus_tag LOCUS_05190 17513 18739 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263157.1 protein_id gnl|my_center|LOCUS_05190 18810 20429 gene locus_tag LOCUS_05200 18810 20429 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287495.1 protein_id gnl|my_center|LOCUS_05200 >Feature sequence023 1337 291 gene locus_tag LOCUS_05210 1337 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 2729 1455 gene locus_tag LOCUS_05220 2729 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 3300 3109 gene locus_tag LOCUS_05230 3300 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 4323 3418 gene locus_tag LOCUS_05240 4323 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 5142 4654 gene locus_tag LOCUS_05250 5142 4654 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696696.1 protein_id gnl|my_center|LOCUS_05250 5568 5284 gene locus_tag LOCUS_05260 5568 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 6537 5776 gene locus_tag LOCUS_05270 6537 5776 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 protein_id gnl|my_center|LOCUS_05270 8928 6553 gene locus_tag LOCUS_05280 8928 6553 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983425.1 protein_id gnl|my_center|LOCUS_05280 10088 9000 gene locus_tag LOCUS_05290 10088 9000 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142319324.1 protein_id gnl|my_center|LOCUS_05290 10743 10081 gene locus_tag LOCUS_05300 gene regX 10743 10081 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876914.1 protein_id gnl|my_center|LOCUS_05300 12171 10921 gene locus_tag LOCUS_05310 12171 10921 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_05310 12532 12290 gene locus_tag LOCUS_05320 12532 12290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 14119 12935 gene locus_tag LOCUS_05330 gene cytX 14119 12935 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225706.1 protein_id gnl|my_center|LOCUS_05330 14965 14171 gene locus_tag LOCUS_05340 gene thiD 14965 14171 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_05340 17603 14976 gene locus_tag LOCUS_05350 17603 14976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 19083 17608 gene locus_tag LOCUS_05360 19083 17608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 19864 19151 gene locus_tag LOCUS_05370 19864 19151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 >Feature sequence024 1982 285 gene locus_tag LOCUS_05380 1982 285 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963431.1 protein_id gnl|my_center|LOCUS_05380 3060 2002 gene locus_tag LOCUS_05390 3060 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 3914 3072 gene locus_tag LOCUS_05400 gene cysW 3914 3072 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534651.1 protein_id gnl|my_center|LOCUS_05400 4815 3964 gene locus_tag LOCUS_05410 gene cysT 4815 3964 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_05410 5821 4793 gene locus_tag LOCUS_05420 5821 4793 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 protein_id gnl|my_center|LOCUS_05420 7497 6142 gene locus_tag LOCUS_05430 7497 6142 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_05430 10586 7548 gene locus_tag LOCUS_05440 10586 7548 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288607.1 protein_id gnl|my_center|LOCUS_05440 10755 11618 gene locus_tag LOCUS_05450 10755 11618 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_05450 11804 12733 gene locus_tag LOCUS_05460 11804 12733 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_05460 12919 14220 gene locus_tag LOCUS_05470 12919 14220 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582886.1 protein_id gnl|my_center|LOCUS_05470 14463 15770 gene locus_tag LOCUS_05480 14463 15770 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582886.1 protein_id gnl|my_center|LOCUS_05480 15945 16682 gene locus_tag LOCUS_05490 15945 16682 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969762.1 protein_id gnl|my_center|LOCUS_05490 16675 17484 gene locus_tag LOCUS_05500 16675 17484 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289130.1 protein_id gnl|my_center|LOCUS_05500 17487 18485 gene locus_tag LOCUS_05510 17487 18485 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949137.1 protein_id gnl|my_center|LOCUS_05510 19732 18596 gene locus_tag LOCUS_05520 19732 18596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 >Feature sequence025 3430 503 gene locus_tag LOCUS_05530 3430 503 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_05530 4365 3469 gene locus_tag LOCUS_05540 gene mscS 4365 3469 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_05540 5638 4400 gene locus_tag LOCUS_05550 5638 4400 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_05550 6926 5763 gene locus_tag LOCUS_05560 6926 5763 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_05560 8010 6928 gene locus_tag LOCUS_05570 gene serC 8010 6928 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_05570 9725 8046 gene locus_tag LOCUS_05580 gene ilvB 9725 8046 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_05580 11417 9744 gene locus_tag LOCUS_05590 gene ilvD 11417 9744 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_05590 12530 11430 gene locus_tag LOCUS_05600 gene leuB 12530 11430 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861060.1 protein_id gnl|my_center|LOCUS_05600 13056 12733 gene locus_tag LOCUS_05610 13056 12733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 14283 13135 gene locus_tag LOCUS_05620 gene tgt 14283 13135 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_05620 16073 14310 gene locus_tag LOCUS_05630 16073 14310 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989902.1 protein_id gnl|my_center|LOCUS_05630 16194 17294 gene locus_tag LOCUS_05640 gene aroC 16194 17294 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_05640 >Feature sequence026 <1 1289 gene locus_tag LOCUS_05650 <1 1289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965827.1:HD-GYP domain-containing protein 1571 3283 gene locus_tag LOCUS_05660 1571 3283 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_05660 3570 5288 gene locus_tag LOCUS_05670 3570 5288 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989902.1 protein_id gnl|my_center|LOCUS_05670 5383 8007 gene locus_tag LOCUS_05680 5383 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 8536 9594 gene locus_tag LOCUS_05690 8536 9594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 9888 12569 gene locus_tag LOCUS_05700 gene pulA 9888 12569 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167510.1 protein_id gnl|my_center|LOCUS_05700 13249 12611 gene locus_tag LOCUS_05710 13249 12611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 13526 13239 gene locus_tag LOCUS_05720 13526 13239 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437519.1 protein_id gnl|my_center|LOCUS_05720 13811 15550 gene locus_tag LOCUS_05730 13811 15550 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017171.1 protein_id gnl|my_center|LOCUS_05730 15669 17039 gene locus_tag LOCUS_05740 15669 17039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 17342 17929 gene locus_tag LOCUS_05750 17342 17929 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567081.1 protein_id gnl|my_center|LOCUS_05750 19217 17997 gene locus_tag LOCUS_05760 gene pepT 19217 17997 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460034.1 protein_id gnl|my_center|LOCUS_05760 >Feature sequence027 2038 530 gene locus_tag LOCUS_05770 2038 530 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256992.1 protein_id gnl|my_center|LOCUS_05770 4237 2084 gene locus_tag LOCUS_05780 4237 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 5084 4242 gene locus_tag LOCUS_05790 5084 4242 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080850.1 protein_id gnl|my_center|LOCUS_05790 5982 5077 gene locus_tag LOCUS_05800 5982 5077 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080851.1 protein_id gnl|my_center|LOCUS_05800 7319 6042 gene locus_tag LOCUS_05810 7319 6042 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977908.1 protein_id gnl|my_center|LOCUS_05810 9171 7333 gene locus_tag LOCUS_05820 9171 7333 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251368.1 protein_id gnl|my_center|LOCUS_05820 10254 9289 gene locus_tag LOCUS_05830 10254 9289 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109361.1 protein_id gnl|my_center|LOCUS_05830 11122 10247 gene locus_tag LOCUS_05840 11122 10247 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028344.1 protein_id gnl|my_center|LOCUS_05840 12101 11112 gene locus_tag LOCUS_05850 12101 11112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 12338 13081 gene locus_tag LOCUS_05860 gene nagB 12338 13081 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_05860 13111 14220 gene locus_tag LOCUS_05870 gene nagA 13111 14220 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722368.1 protein_id gnl|my_center|LOCUS_05870 14570 14289 gene locus_tag LOCUS_05880 gene minE 14570 14289 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419058.1 protein_id gnl|my_center|LOCUS_05880 15376 14585 gene locus_tag LOCUS_05890 gene minD 15376 14585 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419057.1 protein_id gnl|my_center|LOCUS_05890 16112 15399 gene locus_tag LOCUS_05900 16112 15399 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902702.1 protein_id gnl|my_center|LOCUS_05900 17606 16209 gene locus_tag LOCUS_05910 17606 16209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 17760 18401 gene locus_tag LOCUS_05920 gene trmB 17760 18401 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286189.1 protein_id gnl|my_center|LOCUS_05920 <19334 18423 gene locus_tag LOCUS_05930 <19334 18423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066523182.1:transglutaminase domain-containing protein >Feature sequence028 267 79 gene locus_tag LOCUS_05940 267 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 469 242 gene locus_tag LOCUS_05950 469 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 1108 617 gene locus_tag LOCUS_05960 1108 617 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_05960 2043 1150 gene locus_tag LOCUS_05970 2043 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 2938 2045 gene locus_tag LOCUS_05980 2938 2045 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_05980 3077 2931 gene locus_tag LOCUS_05990 3077 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 3890 3468 gene locus_tag LOCUS_06000 3890 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 4130 4789 gene locus_tag LOCUS_06010 4130 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 8091 4885 gene locus_tag LOCUS_06020 gene carB 8091 4885 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_06020 9161 8091 gene locus_tag LOCUS_06030 gene carA 9161 8091 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_06030 9913 9329 gene locus_tag LOCUS_06040 9913 9329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 12139 9914 gene locus_tag LOCUS_06050 12139 9914 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_06050 12558 12211 gene locus_tag LOCUS_06060 12558 12211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 13415 12597 gene locus_tag LOCUS_06070 gene flgG 13415 12597 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657111.1 protein_id gnl|my_center|LOCUS_06070 14253 13453 gene locus_tag LOCUS_06080 14253 13453 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965439.1 protein_id gnl|my_center|LOCUS_06080 15352 14357 gene locus_tag LOCUS_06090 15352 14357 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_06090 18417 15571 gene locus_tag LOCUS_06100 gene uvrA 18417 15571 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436266.1 protein_id gnl|my_center|LOCUS_06100 <19082 18437 gene locus_tag LOCUS_06110 <19082 18437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000607031.1:excinuclease ABC subunit UvrB >Feature sequence029 1209 142 gene locus_tag LOCUS_06120 gene cobD 1209 142 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 protein_id gnl|my_center|LOCUS_06120 2216 1230 gene locus_tag LOCUS_06130 gene cbiB 2216 1230 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_06130 2911 2246 gene locus_tag LOCUS_06140 2911 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 3216 2884 gene locus_tag LOCUS_06150 3216 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 4018 3254 gene locus_tag LOCUS_06160 gene cobS 4018 3254 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016745.1 protein_id gnl|my_center|LOCUS_06160 4616 4023 gene locus_tag LOCUS_06170 gene cobU 4616 4023 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964692.1 protein_id gnl|my_center|LOCUS_06170 5703 4663 gene locus_tag LOCUS_06180 gene cobT 5703 4663 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_06180 7360 5741 gene locus_tag LOCUS_06190 7360 5741 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948601.1 protein_id gnl|my_center|LOCUS_06190 8460 7348 gene locus_tag LOCUS_06200 8460 7348 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439823.1 protein_id gnl|my_center|LOCUS_06200 9515 8481 gene locus_tag LOCUS_06210 9515 8481 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682008.1 protein_id gnl|my_center|LOCUS_06210 10635 9484 gene locus_tag LOCUS_06220 10635 9484 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682009.1 protein_id gnl|my_center|LOCUS_06220 11111 10632 gene locus_tag LOCUS_06230 11111 10632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 12494 11589 gene locus_tag LOCUS_06240 12494 11589 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939388.1 protein_id gnl|my_center|LOCUS_06240 12610 13371 gene locus_tag LOCUS_06250 12610 13371 CDS product DUF4866 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930717.1 protein_id gnl|my_center|LOCUS_06250 13358 14698 gene locus_tag LOCUS_06260 13358 14698 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547031.1 protein_id gnl|my_center|LOCUS_06260 14996 14718 gene locus_tag LOCUS_06270 14996 14718 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890712.1 protein_id gnl|my_center|LOCUS_06270 15459 15028 gene locus_tag LOCUS_06280 15459 15028 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902921.1 protein_id gnl|my_center|LOCUS_06280 16163 15573 gene locus_tag LOCUS_06290 16163 15573 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_06290 17618 16272 gene locus_tag LOCUS_06300 17618 16272 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036258.1 protein_id gnl|my_center|LOCUS_06300 18084 17635 gene locus_tag LOCUS_06310 18084 17635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 >Feature sequence030 319 1182 gene locus_tag LOCUS_06320 gene araQ 319 1182 CDS product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 protein_id gnl|my_center|LOCUS_06320 1207 1557 gene locus_tag LOCUS_06330 1207 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 1554 4718 gene locus_tag LOCUS_06340 1554 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 5035 5304 gene locus_tag LOCUS_06350 5035 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 5301 5639 gene locus_tag LOCUS_06360 5301 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06360 5882 7222 gene locus_tag LOCUS_06370 5882 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 7249 8979 gene locus_tag LOCUS_06380 7249 8979 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963863.1 protein_id gnl|my_center|LOCUS_06380 9314 9535 gene locus_tag LOCUS_06390 9314 9535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 9528 10274 gene locus_tag LOCUS_06400 9528 10274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 10520 10789 gene locus_tag LOCUS_06410 10520 10789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 10819 11772 gene locus_tag LOCUS_06420 10819 11772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 11772 13016 gene locus_tag LOCUS_06430 gene hflX 11772 13016 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_06430 13221 15590 gene locus_tag LOCUS_06440 13221 15590 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964652.1 protein_id gnl|my_center|LOCUS_06440 16649 15600 gene locus_tag LOCUS_06450 16649 15600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 <18123 16722 gene locus_tag LOCUS_06460 <18123 16722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986883.1:translational GTPase TypA >Feature sequence031 <1 2863 gene locus_tag LOCUS_06470 <1 2863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392027.1:SbcC/MukB-like Walker B domain-containing protein 2945 4054 gene locus_tag LOCUS_06480 2945 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 4117 4995 gene locus_tag LOCUS_06490 4117 4995 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640688.1 protein_id gnl|my_center|LOCUS_06490 5966 5001 gene locus_tag LOCUS_06500 gene bioB 5966 5001 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920732.1 protein_id gnl|my_center|LOCUS_06500 6267 6115 gene locus_tag LOCUS_06510 6267 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 6439 7527 gene locus_tag LOCUS_06520 gene trpS 6439 7527 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_06520 7547 8008 gene locus_tag LOCUS_06530 7547 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 8010 9443 gene locus_tag LOCUS_06540 8010 9443 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_06540 9457 10620 gene locus_tag LOCUS_06550 9457 10620 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_06550 10642 11739 gene locus_tag LOCUS_06560 10642 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 11791 12732 gene locus_tag LOCUS_06570 11791 12732 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430615.1 protein_id gnl|my_center|LOCUS_06570 13607 12729 gene locus_tag LOCUS_06580 13607 12729 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194105476.1 protein_id gnl|my_center|LOCUS_06580 13740 15065 gene locus_tag LOCUS_06590 13740 15065 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003738285.1 protein_id gnl|my_center|LOCUS_06590 15942 15052 gene locus_tag LOCUS_06600 15942 15052 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_06600 16139 16519 gene locus_tag LOCUS_06610 16139 16519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 16914 17231 gene locus_tag LOCUS_06620 gene rpsJ 16914 17231 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_06620 >Feature sequence032 302 907 gene locus_tag LOCUS_06630 302 907 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869097.1 protein_id gnl|my_center|LOCUS_06630 907 1626 gene locus_tag LOCUS_06640 907 1626 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_06640 1642 2247 gene locus_tag LOCUS_06650 gene rsxA 1642 2247 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_06650 2262 3050 gene locus_tag LOCUS_06660 2262 3050 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_06660 4179 3121 gene locus_tag LOCUS_06670 4179 3121 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897671.1 protein_id gnl|my_center|LOCUS_06670 4321 5160 gene locus_tag LOCUS_06680 gene proB 4321 5160 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_06680 5160 5384 gene locus_tag LOCUS_06690 5160 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 5359 5946 gene locus_tag LOCUS_06700 5359 5946 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_06700 5949 7211 gene locus_tag LOCUS_06710 5949 7211 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704295.1 protein_id gnl|my_center|LOCUS_06710 7238 8674 gene locus_tag LOCUS_06720 gene miaB 7238 8674 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_06720 8667 9050 gene locus_tag LOCUS_06730 8667 9050 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416526.1 protein_id gnl|my_center|LOCUS_06730 9034 9558 gene locus_tag LOCUS_06740 9034 9558 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432371.1 protein_id gnl|my_center|LOCUS_06740 9634 10245 gene locus_tag LOCUS_06750 gene ruvA 9634 10245 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_06750 10267 11268 gene locus_tag LOCUS_06760 gene ruvB 10267 11268 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_06760 11349 11807 gene locus_tag LOCUS_06770 11349 11807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 11867 14083 gene locus_tag LOCUS_06780 11867 14083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 14083 15432 gene locus_tag LOCUS_06790 14083 15432 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357478.1 protein_id gnl|my_center|LOCUS_06790 15429 16859 gene locus_tag LOCUS_06800 15429 16859 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048310.1 protein_id gnl|my_center|LOCUS_06800 16928 17380 gene locus_tag LOCUS_06810 16928 17380 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416968.1 protein_id gnl|my_center|LOCUS_06810 17395 17727 gene locus_tag LOCUS_06820 17395 17727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 >Feature sequence033 2794 1076 gene locus_tag LOCUS_06830 2794 1076 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_06830 3911 2820 gene locus_tag LOCUS_06840 3911 2820 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459186.1 protein_id gnl|my_center|LOCUS_06840 4364 3924 gene locus_tag LOCUS_06850 4364 3924 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475872.1 protein_id gnl|my_center|LOCUS_06850 5845 4451 gene locus_tag LOCUS_06860 5845 4451 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690317.1 protein_id gnl|my_center|LOCUS_06860 6811 5969 gene locus_tag LOCUS_06870 6811 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 10785 6841 gene locus_tag LOCUS_06880 10785 6841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 11317 10805 gene locus_tag LOCUS_06890 11317 10805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 11476 11958 gene locus_tag LOCUS_06900 11476 11958 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964672.1 protein_id gnl|my_center|LOCUS_06900 13478 12003 gene locus_tag LOCUS_06910 13478 12003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 14189 13830 gene locus_tag LOCUS_06920 14189 13830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 14910 14308 gene locus_tag LOCUS_06930 14910 14308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 15407 15237 gene locus_tag LOCUS_06940 15407 15237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 15845 15606 gene locus_tag LOCUS_06950 15845 15606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06950 16482 15865 gene locus_tag LOCUS_06960 16482 15865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 17718 16600 gene locus_tag LOCUS_06970 17718 16600 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272909.1 protein_id gnl|my_center|LOCUS_06970 >Feature sequence034 423 1265 gene locus_tag LOCUS_06980 423 1265 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262978.1 protein_id gnl|my_center|LOCUS_06980 1262 2998 gene locus_tag LOCUS_06990 1262 2998 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994174.1 protein_id gnl|my_center|LOCUS_06990 3173 4279 gene locus_tag LOCUS_07000 gene araR 3173 4279 CDS product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 protein_id gnl|my_center|LOCUS_07000 4445 5941 gene locus_tag LOCUS_07010 gene araA 4445 5941 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229499.1 protein_id gnl|my_center|LOCUS_07010 6011 7600 gene locus_tag LOCUS_07020 6011 7600 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287286.1 protein_id gnl|my_center|LOCUS_07020 7681 8376 gene locus_tag LOCUS_07030 7681 8376 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 protein_id gnl|my_center|LOCUS_07030 8497 9300 gene locus_tag LOCUS_07040 8497 9300 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679293.1 protein_id gnl|my_center|LOCUS_07040 9439 9729 gene locus_tag LOCUS_07050 9439 9729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_07050 9975 10532 gene locus_tag LOCUS_07060 9975 10532 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_07060 10762 12729 gene locus_tag LOCUS_07070 10762 12729 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_07070 12954 12781 gene locus_tag LOCUS_07080 12954 12781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 14343 13066 gene locus_tag LOCUS_07090 14343 13066 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007785170.1 protein_id gnl|my_center|LOCUS_07090 15059 14346 gene locus_tag LOCUS_07100 15059 14346 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812913.1 protein_id gnl|my_center|LOCUS_07100 15536 15135 gene locus_tag LOCUS_07110 15536 15135 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297874.1 protein_id gnl|my_center|LOCUS_07110 16392 15547 gene locus_tag LOCUS_07120 gene panC 16392 15547 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966198.1 protein_id gnl|my_center|LOCUS_07120 17301 16474 gene locus_tag LOCUS_07130 gene panB 17301 16474 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence035 977 1675 gene locus_tag LOCUS_07140 977 1675 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_07140 1687 2220 gene locus_tag LOCUS_07150 1687 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 2225 2977 gene locus_tag LOCUS_07160 2225 2977 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355903.1 protein_id gnl|my_center|LOCUS_07160 2988 3584 gene locus_tag LOCUS_07170 gene lspA 2988 3584 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387467.1 protein_id gnl|my_center|LOCUS_07170 3589 4512 gene locus_tag LOCUS_07180 3589 4512 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_07180 4580 5209 gene locus_tag LOCUS_07190 4580 5209 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_07190 5308 5757 gene locus_tag LOCUS_07200 gene dtd 5308 5757 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_07200 5928 6656 gene locus_tag LOCUS_07210 5928 6656 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_07210 6643 7698 gene locus_tag LOCUS_07220 6643 7698 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435347.1 protein_id gnl|my_center|LOCUS_07220 7789 8166 gene locus_tag LOCUS_07230 7789 8166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 8942 8217 gene locus_tag LOCUS_07240 8942 8217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 10519 9506 gene locus_tag LOCUS_07250 10519 9506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 11295 10678 gene locus_tag LOCUS_07260 gene lexA 11295 10678 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965137.1 protein_id gnl|my_center|LOCUS_07260 11474 11854 gene locus_tag LOCUS_07270 11474 11854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 12363 12025 gene locus_tag LOCUS_07280 gene rsfS 12363 12025 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475792.1 protein_id gnl|my_center|LOCUS_07280 12938 12351 gene locus_tag LOCUS_07290 gene yqeK 12938 12351 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_07290 13559 12957 gene locus_tag LOCUS_07300 gene nadD 13559 12957 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360011.1 protein_id gnl|my_center|LOCUS_07300 13855 13565 gene locus_tag LOCUS_07310 gene yhbY 13855 13565 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_07310 15156 13870 gene locus_tag LOCUS_07320 gene obgE 15156 13870 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_07320 15500 15213 gene locus_tag LOCUS_07330 gene rpmA 15500 15213 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289452.1 protein_id gnl|my_center|LOCUS_07330 15830 15504 gene locus_tag LOCUS_07340 15830 15504 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816543.1 protein_id gnl|my_center|LOCUS_07340 16156 15848 gene locus_tag LOCUS_07350 gene rplU 16156 15848 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229668.1 protein_id gnl|my_center|LOCUS_07350 17468 16275 gene locus_tag LOCUS_07360 17468 16275 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964568.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence036 1999 3228 gene locus_tag LOCUS_07370 1999 3228 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706002.1 protein_id gnl|my_center|LOCUS_07370 3696 3280 gene locus_tag LOCUS_07380 3696 3280 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940790.1 protein_id gnl|my_center|LOCUS_07380 5114 3717 gene locus_tag LOCUS_07390 gene atpD 5114 3717 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_07390 6023 5127 gene locus_tag LOCUS_07400 gene atpG 6023 5127 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_07400 7541 6036 gene locus_tag LOCUS_07410 gene atpA 7541 6036 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356056.1 protein_id gnl|my_center|LOCUS_07410 8065 7547 gene locus_tag LOCUS_07420 8065 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 8495 8043 gene locus_tag LOCUS_07430 8495 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 8770 8540 gene locus_tag LOCUS_07440 gene atpE 8770 8540 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356112.1 protein_id gnl|my_center|LOCUS_07440 9495 8809 gene locus_tag LOCUS_07450 9495 8809 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966155.1 protein_id gnl|my_center|LOCUS_07450 10678 9722 gene locus_tag LOCUS_07460 10678 9722 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_07460 11448 10675 gene locus_tag LOCUS_07470 11448 10675 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922420.1 protein_id gnl|my_center|LOCUS_07470 12260 11520 gene locus_tag LOCUS_07480 gene sigF 12260 11520 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_07480 12687 12250 gene locus_tag LOCUS_07490 gene spoIIAB 12687 12250 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418415.1 protein_id gnl|my_center|LOCUS_07490 13006 12689 gene locus_tag LOCUS_07500 gene spoIIAA 13006 12689 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_07500 14478 13108 gene locus_tag LOCUS_07510 14478 13108 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861214.1 protein_id gnl|my_center|LOCUS_07510 14653 14495 gene locus_tag LOCUS_07520 14653 14495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 16168 14783 gene locus_tag LOCUS_07530 16168 14783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 <17447 16207 gene locus_tag LOCUS_07540 <17447 16207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861890.1:valine--tRNA ligase >Feature sequence037 <1 903 gene locus_tag LOCUS_07550 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948557.1:LysR family transcriptional regulator 900 1667 gene locus_tag LOCUS_07560 900 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 2417 1656 gene locus_tag LOCUS_07570 2417 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 4967 2550 gene locus_tag LOCUS_07580 gene leuS 4967 2550 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009455.1 protein_id gnl|my_center|LOCUS_07580 6207 5182 gene locus_tag LOCUS_07590 gene ilvC 6207 5182 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_07590 6771 6271 gene locus_tag LOCUS_07600 gene ilvN 6771 6271 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061054.1 protein_id gnl|my_center|LOCUS_07600 7301 6900 gene locus_tag LOCUS_07610 7301 6900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 8495 7317 gene locus_tag LOCUS_07620 8495 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 9078 8599 gene locus_tag LOCUS_07630 9078 8599 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130650.1 protein_id gnl|my_center|LOCUS_07630 9903 9274 gene locus_tag LOCUS_07640 9903 9274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 11124 9946 gene locus_tag LOCUS_07650 gene rpoD 11124 9946 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721960.1 protein_id gnl|my_center|LOCUS_07650 11400 11182 gene locus_tag LOCUS_07660 11400 11182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 11614 11411 gene locus_tag LOCUS_07670 11614 11411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 12150 11584 gene locus_tag LOCUS_07680 12150 11584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 13035 12358 gene locus_tag LOCUS_07690 13035 12358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 14781 13768 gene locus_tag LOCUS_07700 14781 13768 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_07700 <15373 14802 gene locus_tag LOCUS_07710 <15373 14802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965855.1:iron-sulfur cluster assembly scaffold protein >Feature sequence038 367 26 gene locus_tag LOCUS_07720 367 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 1972 389 gene locus_tag LOCUS_07730 1972 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07730 2314 1988 gene locus_tag LOCUS_07740 2314 1988 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869719.1 protein_id gnl|my_center|LOCUS_07740 3089 2484 gene locus_tag LOCUS_07750 gene thrH 3089 2484 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_07750 4157 3243 gene locus_tag LOCUS_07760 4157 3243 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263382.1 protein_id gnl|my_center|LOCUS_07760 5631 4312 gene locus_tag LOCUS_07770 5631 4312 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_07770 6907 5717 gene locus_tag LOCUS_07780 6907 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 8126 6987 gene locus_tag LOCUS_07790 8126 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 8689 8123 gene locus_tag LOCUS_07800 8689 8123 CDS product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262569.1 protein_id gnl|my_center|LOCUS_07800 9003 8686 gene locus_tag LOCUS_07810 9003 8686 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002940906.1 protein_id gnl|my_center|LOCUS_07810 10840 9164 gene locus_tag LOCUS_07820 gene malL 10840 9164 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_07820 13143 10957 gene locus_tag LOCUS_07830 13143 10957 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068490.1 protein_id gnl|my_center|LOCUS_07830 <15346 13140 gene locus_tag LOCUS_07840 <15346 13140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068632.1:YhgE/Pip domain-containing protein >Feature sequence039 1203 178 gene locus_tag LOCUS_07850 1203 178 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582922.1 protein_id gnl|my_center|LOCUS_07850 1423 2361 gene locus_tag LOCUS_07860 1423 2361 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775210.1 protein_id gnl|my_center|LOCUS_07860 2374 3270 gene locus_tag LOCUS_07870 2374 3270 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_07870 3292 4971 gene locus_tag LOCUS_07880 3292 4971 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_07880 4986 6452 gene locus_tag LOCUS_07890 4986 6452 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608887.1 protein_id gnl|my_center|LOCUS_07890 6475 7419 gene locus_tag LOCUS_07900 6475 7419 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_07900 9020 7449 gene locus_tag LOCUS_07910 9020 7449 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_07910 9242 9853 gene locus_tag LOCUS_07920 9242 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 10504 9857 gene locus_tag LOCUS_07930 10504 9857 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_07930 11857 10523 gene locus_tag LOCUS_07940 11857 10523 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_07940 13621 12257 gene locus_tag LOCUS_07950 13621 12257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 13992 13627 gene locus_tag LOCUS_07960 13992 13627 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963919.1 protein_id gnl|my_center|LOCUS_07960 14146 14910 gene locus_tag LOCUS_07970 14146 14910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence040 <1 1074 gene locus_tag LOCUS_07980 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398654.1:alpha-L-arabinofuranosidase AbfB 1095 1394 gene locus_tag LOCUS_07990 1095 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 1366 2307 gene locus_tag LOCUS_08000 1366 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08000 2217 2618 gene locus_tag LOCUS_08010 2217 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 3602 2682 gene locus_tag LOCUS_08020 3602 2682 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287299.1 protein_id gnl|my_center|LOCUS_08020 3952 5394 gene locus_tag LOCUS_08030 3952 5394 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_08030 5449 6372 gene locus_tag LOCUS_08040 5449 6372 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776897.1 protein_id gnl|my_center|LOCUS_08040 6384 7253 gene locus_tag LOCUS_08050 6384 7253 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776898.1 protein_id gnl|my_center|LOCUS_08050 7396 8046 gene locus_tag LOCUS_08060 7396 8046 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057487.1 protein_id gnl|my_center|LOCUS_08060 8247 9464 gene locus_tag LOCUS_08070 8247 9464 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_08070 9663 10178 gene locus_tag LOCUS_08080 9663 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 10150 11361 gene locus_tag LOCUS_08090 10150 11361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 11378 11701 gene locus_tag LOCUS_08100 11378 11701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 12795 11776 gene locus_tag LOCUS_08110 12795 11776 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721654.1 protein_id gnl|my_center|LOCUS_08110 12983 14281 gene locus_tag LOCUS_08120 12983 14281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence041 545 2029 gene locus_tag LOCUS_08130 545 2029 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_08130 2315 2500 gene locus_tag LOCUS_08140 2315 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 2594 3460 gene locus_tag LOCUS_08150 2594 3460 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681080.1 protein_id gnl|my_center|LOCUS_08150 3473 4405 gene locus_tag LOCUS_08160 3473 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 4732 7899 gene locus_tag LOCUS_08170 gene ileS 4732 7899 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986028.1 protein_id gnl|my_center|LOCUS_08170 7934 10402 gene locus_tag LOCUS_08180 7934 10402 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_08180 11406 10555 gene locus_tag LOCUS_08190 11406 10555 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389614.1 protein_id gnl|my_center|LOCUS_08190 12721 11867 gene locus_tag LOCUS_08200 12721 11867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 13082 14443 gene locus_tag LOCUS_08210 13082 14443 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence042 2120 615 gene locus_tag LOCUS_08220 2120 615 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_08220 2800 2126 gene locus_tag LOCUS_08230 2800 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 3452 2820 gene locus_tag LOCUS_08240 3452 2820 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_08240 4688 3477 gene locus_tag LOCUS_08250 4688 3477 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_08250 5367 4708 gene locus_tag LOCUS_08260 5367 4708 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814961.1 protein_id gnl|my_center|LOCUS_08260 6781 5399 gene locus_tag LOCUS_08270 6781 5399 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_08270 6691 6882 gene locus_tag LOCUS_08280 6691 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 6952 7185 gene locus_tag LOCUS_08290 6952 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 7413 7267 gene locus_tag LOCUS_08300 7413 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 7504 7833 gene locus_tag LOCUS_08310 7504 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 7853 8140 gene locus_tag LOCUS_08320 7853 8140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 9440 8097 gene locus_tag LOCUS_08330 9440 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 11508 9421 gene locus_tag LOCUS_08340 gene fusA 11508 9421 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_08340 13479 11587 gene locus_tag LOCUS_08350 13479 11587 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460031.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence043 <1 719 gene locus_tag LOCUS_08360 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438328.1:DNA translocase FtsK 744 2414 gene locus_tag LOCUS_08370 744 2414 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048375.1 protein_id gnl|my_center|LOCUS_08370 2427 3272 gene locus_tag LOCUS_08380 gene folD 2427 3272 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230259.1 protein_id gnl|my_center|LOCUS_08380 3292 4497 gene locus_tag LOCUS_08390 3292 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 5172 4597 gene locus_tag LOCUS_08400 5172 4597 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948106.1 protein_id gnl|my_center|LOCUS_08400 5256 5735 gene locus_tag LOCUS_08410 gene rlmH 5256 5735 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811533.1 protein_id gnl|my_center|LOCUS_08410 5756 6586 gene locus_tag LOCUS_08420 5756 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 6615 6908 gene locus_tag LOCUS_08430 gene yqfC 6615 6908 CDS product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392128.1 protein_id gnl|my_center|LOCUS_08430 6905 8137 gene locus_tag LOCUS_08440 gene yqfD 6905 8137 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047998.1 protein_id gnl|my_center|LOCUS_08440 8124 9125 gene locus_tag LOCUS_08450 8124 9125 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_08450 9122 10306 gene locus_tag LOCUS_08460 9122 10306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 10303 10803 gene locus_tag LOCUS_08470 gene ybeY 10303 10803 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430894.1 protein_id gnl|my_center|LOCUS_08470 10838 11914 gene locus_tag LOCUS_08480 10838 11914 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_08480 11942 13609 gene locus_tag LOCUS_08490 11942 13609 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_08490 13661 14017 gene locus_tag LOCUS_08500 13661 14017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 >Feature sequence044 194 562 gene locus_tag LOCUS_08510 194 562 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_08510 549 944 gene locus_tag LOCUS_08520 549 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 941 1429 gene locus_tag LOCUS_08530 941 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 3089 1479 gene locus_tag LOCUS_08540 3089 1479 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108010.1 protein_id gnl|my_center|LOCUS_08540 3932 3105 gene locus_tag LOCUS_08550 3932 3105 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963629.1 protein_id gnl|my_center|LOCUS_08550 5139 3817 gene locus_tag LOCUS_08560 5139 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 6130 5141 gene locus_tag LOCUS_08570 6130 5141 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_08570 6594 6154 gene locus_tag LOCUS_08580 6594 6154 CDS product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966249.1 protein_id gnl|my_center|LOCUS_08580 7214 6585 gene locus_tag LOCUS_08590 7214 6585 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_08590 8648 7248 gene locus_tag LOCUS_08600 8648 7248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 9573 8659 gene locus_tag LOCUS_08610 9573 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 10202 9573 gene locus_tag LOCUS_08620 10202 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 10324 10836 gene locus_tag LOCUS_08630 10324 10836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 12891 10948 gene locus_tag LOCUS_08640 12891 10948 CDS product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944118.1 protein_id gnl|my_center|LOCUS_08640 13814 13134 gene locus_tag LOCUS_08650 13814 13134 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706813.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence045 465 379 gene locus_tag LOCUS_t00030 465 379 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1256 546 gene locus_tag LOCUS_08660 gene ispD 1256 546 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966461.1 protein_id gnl|my_center|LOCUS_08660 2289 1261 gene locus_tag LOCUS_08670 gene tsaD 2289 1261 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_08670 2873 2292 gene locus_tag LOCUS_08680 2873 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 3789 2878 gene locus_tag LOCUS_08690 3789 2878 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_08690 4199 3783 gene locus_tag LOCUS_08700 gene rimI 4199 3783 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938967.1 protein_id gnl|my_center|LOCUS_08700 4924 4211 gene locus_tag LOCUS_08710 gene tsaB 4924 4211 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966124.1 protein_id gnl|my_center|LOCUS_08710 5378 4935 gene locus_tag LOCUS_08720 gene tsaE 5378 4935 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_08720 5886 5386 gene locus_tag LOCUS_08730 5886 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 6662 6030 gene locus_tag LOCUS_08740 6662 6030 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_08740 7024 7470 gene locus_tag LOCUS_08750 7024 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 8882 7476 gene locus_tag LOCUS_08760 8882 7476 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618921.1 protein_id gnl|my_center|LOCUS_08760 9668 8940 gene locus_tag LOCUS_08770 9668 8940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 10055 9741 gene locus_tag LOCUS_08780 10055 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 10226 12367 gene locus_tag LOCUS_08790 10226 12367 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895217.1 protein_id gnl|my_center|LOCUS_08790 12678 13679 gene locus_tag LOCUS_08800 12678 13679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence046 1616 3676 gene locus_tag LOCUS_08810 gene ftsH 1616 3676 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048280.1 protein_id gnl|my_center|LOCUS_08810 3737 5548 gene locus_tag LOCUS_08820 gene uvrC 3737 5548 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_08820 5645 6586 gene locus_tag LOCUS_08830 gene hprK 5645 6586 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_08830 6617 8020 gene locus_tag LOCUS_08840 6617 8020 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_08840 8020 8925 gene locus_tag LOCUS_08850 gene murB 8020 8925 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_08850 8926 9807 gene locus_tag LOCUS_08860 gene rapZ 8926 9807 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_08860 9809 10669 gene locus_tag LOCUS_08870 gene whiA 9809 10669 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462177.1 protein_id gnl|my_center|LOCUS_08870 10684 11568 gene locus_tag LOCUS_08880 10684 11568 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_08880 11638 12504 gene locus_tag LOCUS_08890 gene fba 11638 12504 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence047 3 914 gene locus_tag LOCUS_08900 3 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 1375 1001 gene locus_tag LOCUS_08910 1375 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 2066 1485 gene locus_tag LOCUS_08920 2066 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 3306 2089 gene locus_tag LOCUS_08930 gene hydF 3306 2089 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108016.1 protein_id gnl|my_center|LOCUS_08930 4375 3338 gene locus_tag LOCUS_08940 gene hydE 4375 3338 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048412.1 protein_id gnl|my_center|LOCUS_08940 5422 4421 gene locus_tag LOCUS_08950 5422 4421 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518875.1 protein_id gnl|my_center|LOCUS_08950 7137 5518 gene locus_tag LOCUS_08960 7137 5518 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_08960 7316 8026 gene locus_tag LOCUS_08970 7316 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 9020 8070 gene locus_tag LOCUS_08980 9020 8070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 10824 9076 gene locus_tag LOCUS_08990 gene recJ 10824 9076 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_08990 11569 10811 gene locus_tag LOCUS_09000 gene truA 11569 10811 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430279.1 protein_id gnl|my_center|LOCUS_09000 12844 11588 gene locus_tag LOCUS_09010 gene sleC 12844 11588 CDS product spore cortex-lytic germination protein SleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425119.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence048 2228 1233 gene locus_tag LOCUS_09020 2228 1233 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_09020 3199 2270 gene locus_tag LOCUS_09030 3199 2270 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132280311.1 protein_id gnl|my_center|LOCUS_09030 5018 3639 gene locus_tag LOCUS_09040 gene murC 5018 3639 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_09040 5231 6505 gene locus_tag LOCUS_09050 5231 6505 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_09050 6502 7620 gene locus_tag LOCUS_09060 gene glgD 6502 7620 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_09060 7645 7911 gene locus_tag LOCUS_09070 gene spoVG 7645 7911 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966499.1 protein_id gnl|my_center|LOCUS_09070 8549 9133 gene locus_tag LOCUS_09080 gene pth 8549 9133 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_09080 9134 12664 gene locus_tag LOCUS_09090 gene mfd 9134 12664 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048383.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence049 2290 374 gene locus_tag LOCUS_09100 2290 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2453 3034 gene locus_tag LOCUS_09110 2453 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 3035 3394 gene locus_tag LOCUS_09120 gene cheY 3035 3394 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244957.1 protein_id gnl|my_center|LOCUS_09120 4149 3496 gene locus_tag LOCUS_09130 4149 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 4741 4154 gene locus_tag LOCUS_09140 4741 4154 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387193.1 protein_id gnl|my_center|LOCUS_09140 5519 4749 gene locus_tag LOCUS_09150 gene rlmB 5519 4749 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_09150 5965 5531 gene locus_tag LOCUS_09160 5965 5531 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293091.1 protein_id gnl|my_center|LOCUS_09160 7392 5962 gene locus_tag LOCUS_09170 gene cysS 7392 5962 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_09170 8007 7468 gene locus_tag LOCUS_09180 gene ispF 8007 7468 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_09180 9184 8201 gene locus_tag LOCUS_09190 gene pta 9184 8201 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130342.1 protein_id gnl|my_center|LOCUS_09190 10686 9379 gene locus_tag LOCUS_09200 10686 9379 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_09200 11927 10872 gene locus_tag LOCUS_09210 11927 10872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 12160 12086 gene locus_tag LOCUS_t00040 12160 12086 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12264 12190 gene locus_tag LOCUS_t00050 12264 12190 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 <13339 12409 gene locus_tag LOCUS_09220 <13339 12409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938876.1:homocysteine S-methyltransferase family protein >Feature sequence050 1136 354 gene locus_tag LOCUS_09230 1136 354 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_09230 2574 1216 gene locus_tag LOCUS_09240 2574 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 3475 2675 gene locus_tag LOCUS_09250 3475 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 4217 3543 gene locus_tag LOCUS_09260 4217 3543 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963740.1 protein_id gnl|my_center|LOCUS_09260 6448 4217 gene locus_tag LOCUS_09270 gene gyrA 6448 4217 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_09270 8399 6486 gene locus_tag LOCUS_09280 gene gyrB 8399 6486 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_09280 9524 8430 gene locus_tag LOCUS_09290 9524 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 10725 9613 gene locus_tag LOCUS_09300 gene ugpC 10725 9613 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_09300 10947 10873 gene locus_tag LOCUS_t00060 10947 10873 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 11553 10909 gene locus_tag LOCUS_09310 11553 10909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 12021 11587 gene locus_tag LOCUS_09320 gene dutA 12021 11587 CDS product dUTP diphosphatase DutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245820.1 protein_id gnl|my_center|LOCUS_09320 <13024 12023 gene locus_tag LOCUS_09330 <13024 12023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016741.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase >Feature sequence051 799 614 gene locus_tag LOCUS_09340 799 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 2307 1021 gene locus_tag LOCUS_09350 2307 1021 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_09350 3654 2326 gene locus_tag LOCUS_09360 3654 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 6520 3929 gene locus_tag LOCUS_09370 gene clpB 6520 3929 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009165978.1 protein_id gnl|my_center|LOCUS_09370 6843 7478 gene locus_tag LOCUS_09380 6843 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 8932 7529 gene locus_tag LOCUS_09390 8932 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 9639 8929 gene locus_tag LOCUS_09400 9639 8929 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261248.1 protein_id gnl|my_center|LOCUS_09400 10668 9706 gene locus_tag LOCUS_09410 10668 9706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 11431 10673 gene locus_tag LOCUS_09420 11431 10673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 12118 11432 gene locus_tag LOCUS_09430 12118 11432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860718.1 protein_id gnl|my_center|LOCUS_09430 12727 12260 gene locus_tag LOCUS_09440 12727 12260 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence052 1381 197 gene locus_tag LOCUS_09450 1381 197 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_09450 1592 2758 gene locus_tag LOCUS_09460 1592 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 2918 3271 gene locus_tag LOCUS_09470 2918 3271 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356722.1 protein_id gnl|my_center|LOCUS_09470 3258 4265 gene locus_tag LOCUS_09480 3258 4265 CDS product permease prefix domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674257.1 protein_id gnl|my_center|LOCUS_09480 4282 5109 gene locus_tag LOCUS_09490 4282 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 5746 5165 gene locus_tag LOCUS_09500 5746 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 6637 5864 gene locus_tag LOCUS_09510 6637 5864 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948811.1 protein_id gnl|my_center|LOCUS_09510 7519 6638 gene locus_tag LOCUS_09520 7519 6638 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016023.1 protein_id gnl|my_center|LOCUS_09520 8586 7549 gene locus_tag LOCUS_09530 8586 7549 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439336.1 protein_id gnl|my_center|LOCUS_09530 10350 8947 gene locus_tag LOCUS_09540 10350 8947 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228708.1 protein_id gnl|my_center|LOCUS_09540 10713 10369 gene locus_tag LOCUS_09550 10713 10369 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392814.1 protein_id gnl|my_center|LOCUS_09550 11553 10741 gene locus_tag LOCUS_09560 11553 10741 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029818289.1 protein_id gnl|my_center|LOCUS_09560 <12375 11625 gene locus_tag LOCUS_09570 <12375 11625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011014462.1:tyramine oxidase subunit B >Feature sequence053 <1 1289 gene locus_tag LOCUS_09580 <1 1289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707355.1:glycogen debranching protein GlgX 1282 1896 gene locus_tag LOCUS_09590 1282 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1963 2586 gene locus_tag LOCUS_09600 gene sigK 1963 2586 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428359.1 protein_id gnl|my_center|LOCUS_09600 2707 4215 gene locus_tag LOCUS_09610 2707 4215 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_09610 4212 5291 gene locus_tag LOCUS_09620 gene dprA 4212 5291 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_09620 5311 7389 gene locus_tag LOCUS_09630 gene topA 5311 7389 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_09630 7473 8252 gene locus_tag LOCUS_09640 gene codY 7473 8252 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362579.1 protein_id gnl|my_center|LOCUS_09640 8404 8793 gene locus_tag LOCUS_09650 gene flgB 8404 8793 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245656.1 protein_id gnl|my_center|LOCUS_09650 8806 9252 gene locus_tag LOCUS_09660 gene flgC 8806 9252 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_09660 9286 9597 gene locus_tag LOCUS_09670 9286 9597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 9616 11241 gene locus_tag LOCUS_09680 gene fliF 9616 11241 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921537.1 protein_id gnl|my_center|LOCUS_09680 11245 12249 gene locus_tag LOCUS_09690 gene fliG 11245 12249 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 protein_id gnl|my_center|LOCUS_09690 >Feature sequence054 2 2359 gene locus_tag LOCUS_09700 2 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 2365 3102 gene locus_tag LOCUS_09710 2365 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 3977 3111 gene locus_tag LOCUS_09720 3977 3111 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458966.1 protein_id gnl|my_center|LOCUS_09720 4078 4368 gene locus_tag LOCUS_09730 4078 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 4370 4726 gene locus_tag LOCUS_09740 4370 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 4877 4787 gene locus_tag LOCUS_t00070 4877 4787 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5157 6230 gene locus_tag LOCUS_09750 5157 6230 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_09750 6264 7850 gene locus_tag LOCUS_09760 6264 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 7908 8252 gene locus_tag LOCUS_09770 7908 8252 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_09770 8233 8850 gene locus_tag LOCUS_09780 gene recR 8233 8850 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_09780 8893 9729 gene locus_tag LOCUS_09790 8893 9729 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_09790 9717 10658 gene locus_tag LOCUS_09800 9717 10658 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_09800 10836 11981 gene locus_tag LOCUS_09810 10836 11981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence055 230 1279 gene locus_tag LOCUS_09820 230 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1326 2231 gene locus_tag LOCUS_09830 gene cdaA 1326 2231 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420697.1 protein_id gnl|my_center|LOCUS_09830 2197 3504 gene locus_tag LOCUS_09840 2197 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 3533 4882 gene locus_tag LOCUS_09850 gene glmM 3533 4882 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_09850 4895 5158 gene locus_tag LOCUS_09860 4895 5158 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956441.1 protein_id gnl|my_center|LOCUS_09860 5208 6560 gene locus_tag LOCUS_09870 5208 6560 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_09870 6580 7635 gene locus_tag LOCUS_09880 6580 7635 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228264.1 protein_id gnl|my_center|LOCUS_09880 7645 8538 gene locus_tag LOCUS_09890 7645 8538 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199637.1 protein_id gnl|my_center|LOCUS_09890 8572 9348 gene locus_tag LOCUS_09900 8572 9348 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_09900 9384 10127 gene locus_tag LOCUS_09910 9384 10127 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_09910 10141 10851 gene locus_tag LOCUS_09920 10141 10851 CDS product D-ribitol-5-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872486.1 protein_id gnl|my_center|LOCUS_09920 10869 11927 gene locus_tag LOCUS_09930 10869 11927 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004058044.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence056 1216 551 gene locus_tag LOCUS_09940 gene cmk 1216 551 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074539.1 protein_id gnl|my_center|LOCUS_09940 2497 1256 gene locus_tag LOCUS_09950 2497 1256 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_09950 3419 2490 gene locus_tag LOCUS_09960 3419 2490 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_09960 4997 3579 gene locus_tag LOCUS_09970 4997 3579 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_09970 6161 5013 gene locus_tag LOCUS_09980 6161 5013 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_09980 6551 6180 gene locus_tag LOCUS_09990 6551 6180 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_09990 7356 6583 gene locus_tag LOCUS_10000 7356 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 8807 7371 gene locus_tag LOCUS_10010 8807 7371 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_10010 10091 8925 gene locus_tag LOCUS_10020 10091 8925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 10774 10205 gene locus_tag LOCUS_10030 gene scpB 10774 10205 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402814.1 protein_id gnl|my_center|LOCUS_10030 11555 10806 gene locus_tag LOCUS_10040 11555 10806 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965361.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence057 274 1149 gene locus_tag LOCUS_10050 274 1149 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667339.1 protein_id gnl|my_center|LOCUS_10050 1340 2428 gene locus_tag LOCUS_10060 1340 2428 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966511.1 protein_id gnl|my_center|LOCUS_10060 2446 3132 gene locus_tag LOCUS_10070 gene ftsE 2446 3132 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_10070 3122 4027 gene locus_tag LOCUS_10080 gene ftsX 3122 4027 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236202.1 protein_id gnl|my_center|LOCUS_10080 4113 5402 gene locus_tag LOCUS_10090 4113 5402 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_10090 5412 5903 gene locus_tag LOCUS_10100 5412 5903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 6017 7045 gene locus_tag LOCUS_10110 gene prfB 6017 7045 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 protein_id gnl|my_center|LOCUS_10110 7073 8296 gene locus_tag LOCUS_10120 7073 8296 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356656.1 protein_id gnl|my_center|LOCUS_10120 8412 8855 gene locus_tag LOCUS_10130 8412 8855 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_10130 8861 10054 gene locus_tag LOCUS_10140 8861 10054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 10371 10763 gene locus_tag LOCUS_10150 10371 10763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 10774 11184 gene locus_tag LOCUS_10160 10774 11184 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227995.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence058 546 1295 gene locus_tag LOCUS_10170 546 1295 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709193.1 protein_id gnl|my_center|LOCUS_10170 1292 2206 gene locus_tag LOCUS_10180 gene pfkB 1292 2206 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_10180 2219 4252 gene locus_tag LOCUS_10190 2219 4252 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 protein_id gnl|my_center|LOCUS_10190 4318 4575 gene locus_tag LOCUS_10200 4318 4575 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_10200 4634 6253 gene locus_tag LOCUS_10210 gene ptsP 4634 6253 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_10210 7005 7262 gene locus_tag LOCUS_10220 7005 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 7246 7608 gene locus_tag LOCUS_10230 7246 7608 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682305.1 protein_id gnl|my_center|LOCUS_10230 9105 7753 gene locus_tag LOCUS_10240 gene yeeO 9105 7753 CDS product toxic metabolite efflux MATE transporter YeeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943916.1 protein_id gnl|my_center|LOCUS_10240 9353 10207 gene locus_tag LOCUS_10250 gene rsmI 9353 10207 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_10250 <11476 10224 gene locus_tag LOCUS_10260 <11476 10224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193735789.1:DUF885 domain-containing protein >Feature sequence059 132 1124 gene locus_tag LOCUS_10270 132 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1505 5245 gene locus_tag LOCUS_10280 1505 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 5375 5518 gene locus_tag LOCUS_10290 5375 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 5735 9493 gene locus_tag LOCUS_10300 5735 9493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence060 2052 1372 gene locus_tag LOCUS_10310 2052 1372 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044683.1 protein_id gnl|my_center|LOCUS_10310 2654 2055 gene locus_tag LOCUS_10320 2654 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 4644 2665 gene locus_tag LOCUS_10330 4644 2665 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_10330 5029 5778 gene locus_tag LOCUS_10340 5029 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 7002 6298 gene locus_tag LOCUS_10350 7002 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 8405 7041 gene locus_tag LOCUS_10360 8405 7041 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_10360 8709 8425 gene locus_tag LOCUS_10370 8709 8425 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_10370 9530 8727 gene locus_tag LOCUS_10380 9530 8727 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_10380 <11217 9532 gene locus_tag LOCUS_10390 <11217 9532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964331.1:cell division protein FtsA >Feature sequence061 1306 377 gene locus_tag LOCUS_10400 1306 377 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546354.1 protein_id gnl|my_center|LOCUS_10400 1598 1771 gene locus_tag LOCUS_10410 1598 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 2024 1785 gene locus_tag LOCUS_10420 2024 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 2463 3767 gene locus_tag LOCUS_10430 2463 3767 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_10430 3925 4395 gene locus_tag LOCUS_10440 3925 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 4482 5537 gene locus_tag LOCUS_10450 gene rsmH 4482 5537 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_10450 5916 5563 gene locus_tag LOCUS_10460 5916 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 6014 7402 gene locus_tag LOCUS_10470 6014 7402 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 protein_id gnl|my_center|LOCUS_10470 7460 8011 gene locus_tag LOCUS_10480 7460 8011 CDS product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921974.1 protein_id gnl|my_center|LOCUS_10480 8018 9718 gene locus_tag LOCUS_10490 8018 9718 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380507.1 protein_id gnl|my_center|LOCUS_10490 9718 10545 gene locus_tag LOCUS_10500 9718 10545 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641746.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence062 1471 2121 gene locus_tag LOCUS_10510 1471 2121 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964199.1 protein_id gnl|my_center|LOCUS_10510 2485 2180 gene locus_tag LOCUS_10520 2485 2180 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720075.1 protein_id gnl|my_center|LOCUS_10520 2633 3526 gene locus_tag LOCUS_10530 2633 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 3923 3480 gene locus_tag LOCUS_10540 3923 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 4044 5054 gene locus_tag LOCUS_10550 gene asnA 4044 5054 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_10550 5871 5152 gene locus_tag LOCUS_10560 5871 5152 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462080.1 protein_id gnl|my_center|LOCUS_10560 6929 5868 gene locus_tag LOCUS_10570 6929 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 8927 7017 gene locus_tag LOCUS_10580 8927 7017 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_10580 9793 8924 gene locus_tag LOCUS_10590 gene hslO 9793 8924 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048141.1 protein_id gnl|my_center|LOCUS_10590 10548 9808 gene locus_tag LOCUS_10600 10548 9808 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence063 6577 4616 gene locus_tag LOCUS_10610 6577 4616 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272794.1 protein_id gnl|my_center|LOCUS_10610 7179 6685 gene locus_tag LOCUS_10620 7179 6685 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767551.1 protein_id gnl|my_center|LOCUS_10620 7414 7172 gene locus_tag LOCUS_10630 7414 7172 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681231.1 protein_id gnl|my_center|LOCUS_10630 8789 7713 gene locus_tag LOCUS_10640 gene prfA 8789 7713 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_10640 9644 8793 gene locus_tag LOCUS_10650 gene prmC 9644 8793 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_10650 10585 9641 gene locus_tag LOCUS_10660 10585 9641 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421392.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence064 277 1134 gene locus_tag LOCUS_10670 gene ylqF 277 1134 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_10670 1127 1888 gene locus_tag LOCUS_10680 1127 1888 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_10680 1973 3709 gene locus_tag LOCUS_10690 1973 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 3711 4046 gene locus_tag LOCUS_10700 3711 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 4050 4406 gene locus_tag LOCUS_10710 4050 4406 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017105.1 protein_id gnl|my_center|LOCUS_10710 4412 5278 gene locus_tag LOCUS_10720 gene pgeF 4412 5278 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_10720 5383 5754 gene locus_tag LOCUS_10730 5383 5754 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_10730 5747 6652 gene locus_tag LOCUS_10740 5747 6652 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_10740 6627 8522 gene locus_tag LOCUS_10750 6627 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 8612 9934 gene locus_tag LOCUS_10760 gene der 8612 9934 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_10760 9937 10590 gene locus_tag LOCUS_10770 gene plsY 9937 10590 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence065 981 106 gene locus_tag LOCUS_10780 981 106 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086430.1 protein_id gnl|my_center|LOCUS_10780 1007 1150 gene locus_tag LOCUS_10790 1007 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1255 3507 gene locus_tag LOCUS_10800 gene glgP 1255 3507 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950158.1 protein_id gnl|my_center|LOCUS_10800 3719 4900 gene locus_tag LOCUS_10810 3719 4900 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064307.1 protein_id gnl|my_center|LOCUS_10810 4910 6610 gene locus_tag LOCUS_10820 gene tlpC 4910 6610 CDS product methyl-accepting chemotaxis protein TlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246498.1 protein_id gnl|my_center|LOCUS_10820 6754 9168 gene locus_tag LOCUS_10830 6754 9168 CDS product N,N'-diacetylchitobiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195978718.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence066 3741 1231 gene locus_tag LOCUS_10840 3741 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 5225 3870 gene locus_tag LOCUS_10850 5225 3870 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_10850 7521 5236 gene locus_tag LOCUS_10860 7521 5236 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_10860 8962 7580 gene locus_tag LOCUS_10870 8962 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 9658 8969 gene locus_tag LOCUS_10880 9658 8969 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence067 1262 675 gene locus_tag LOCUS_10890 1262 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 3476 1395 gene locus_tag LOCUS_10900 3476 1395 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814145.1 protein_id gnl|my_center|LOCUS_10900 3815 3633 gene locus_tag LOCUS_10910 3815 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 5119 3827 gene locus_tag LOCUS_10920 gene serS 5119 3827 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_10920 6380 5133 gene locus_tag LOCUS_10930 gene glyA 6380 5133 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 protein_id gnl|my_center|LOCUS_10930 8801 6501 gene locus_tag LOCUS_10940 gene secDF 8801 6501 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245970.1 protein_id gnl|my_center|LOCUS_10940 10178 8823 gene locus_tag LOCUS_10950 gene scfB 10178 8823 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence068 309 683 gene locus_tag LOCUS_10960 309 683 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002933016.1 protein_id gnl|my_center|LOCUS_10960 667 2142 gene locus_tag LOCUS_10970 667 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2238 2711 gene locus_tag LOCUS_10980 2238 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 2689 3132 gene locus_tag LOCUS_10990 2689 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 3236 3433 gene locus_tag LOCUS_11000 3236 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 3411 4610 gene locus_tag LOCUS_11010 3411 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 4982 4659 gene locus_tag LOCUS_11020 4982 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 4948 5127 gene locus_tag LOCUS_11030 4948 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 5204 6316 gene locus_tag LOCUS_11040 5204 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 7262 6339 gene locus_tag LOCUS_11050 7262 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 7605 7282 gene locus_tag LOCUS_11060 7605 7282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 8032 9759 gene locus_tag LOCUS_11070 8032 9759 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_11070 9752 10363 gene locus_tag LOCUS_11080 9752 10363 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence069 2484 991 gene locus_tag LOCUS_11090 gene gtfA 2484 991 CDS product accessory Sec system glycosyltransferase GtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836746.1 protein_id gnl|my_center|LOCUS_11090 4845 2512 gene locus_tag LOCUS_11100 gene secA2 4845 2512 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489793.1 protein_id gnl|my_center|LOCUS_11100 5296 4760 gene locus_tag LOCUS_11110 5296 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 6815 5313 gene locus_tag LOCUS_11120 gene asp2 6815 5313 CDS product accessory Sec system protein Asp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836744.1 protein_id gnl|my_center|LOCUS_11120 8400 6808 gene locus_tag LOCUS_11130 gene asp1 8400 6808 CDS product accessory Sec system protein Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468347.1 protein_id gnl|my_center|LOCUS_11130 9630 8428 gene locus_tag LOCUS_11140 9630 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 10379 9714 gene locus_tag LOCUS_11150 10379 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence070 805 152 gene locus_tag LOCUS_11160 805 152 CDS product DUF4367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367181.1 protein_id gnl|my_center|LOCUS_11160 1406 792 gene locus_tag LOCUS_11170 1406 792 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_11170 1947 1417 gene locus_tag LOCUS_11180 1947 1417 CDS product DUF4367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367181.1 protein_id gnl|my_center|LOCUS_11180 2633 2040 gene locus_tag LOCUS_11190 2633 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 3687 2635 gene locus_tag LOCUS_11200 3687 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 5392 3689 gene locus_tag LOCUS_11210 5392 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 6580 5396 gene locus_tag LOCUS_11220 6580 5396 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423769.1 protein_id gnl|my_center|LOCUS_11220 6960 6631 gene locus_tag LOCUS_11230 6960 6631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 7261 7067 gene locus_tag LOCUS_11240 7261 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 8197 7523 gene locus_tag LOCUS_11250 8197 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 8819 8178 gene locus_tag LOCUS_11260 8819 8178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 9724 8816 gene locus_tag LOCUS_11270 gene pmtA 9724 8816 CDS product phenol-soluble modulin export ABC transporter ATP-binding protein PmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991306.1 protein_id gnl|my_center|LOCUS_11270 10078 9740 gene locus_tag LOCUS_11280 10078 9740 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566897.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence071 1414 668 gene locus_tag LOCUS_11290 1414 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 3763 1448 gene locus_tag LOCUS_11300 gene lon 3763 1448 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435613.1 protein_id gnl|my_center|LOCUS_11300 5089 3803 gene locus_tag LOCUS_11310 gene clpX 5089 3803 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_11310 5731 5150 gene locus_tag LOCUS_11320 gene clpP 5731 5150 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965928.1 protein_id gnl|my_center|LOCUS_11320 7180 5843 gene locus_tag LOCUS_11330 gene tig 7180 5843 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_11330 7615 7400 gene locus_tag LOCUS_11340 7615 7400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 8332 7784 gene locus_tag LOCUS_11350 8332 7784 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_11350 8478 9353 gene locus_tag LOCUS_11360 8478 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 9365 9817 gene locus_tag LOCUS_11370 9365 9817 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218702.1 protein_id gnl|my_center|LOCUS_11370 <10347 9818 gene locus_tag LOCUS_11380 <10347 9818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964521.1:DUF1653 domain-containing protein >Feature sequence072 976 608 gene locus_tag LOCUS_11390 976 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1914 1261 gene locus_tag LOCUS_11400 1914 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 2248 1934 gene locus_tag LOCUS_11410 2248 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 2754 2380 gene locus_tag LOCUS_11420 2754 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 3848 2751 gene locus_tag LOCUS_11430 3848 2751 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_11430 4057 3866 gene locus_tag LOCUS_11440 4057 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 4490 4293 gene locus_tag LOCUS_11450 4490 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 6272 4683 gene locus_tag LOCUS_11460 gene guaA 6272 4683 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_11460 7295 6390 gene locus_tag LOCUS_11470 7295 6390 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679981.1 protein_id gnl|my_center|LOCUS_11470 8149 7322 gene locus_tag LOCUS_11480 gene thiM 8149 7322 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_11480 8667 8149 gene locus_tag LOCUS_11490 gene thiW 8667 8149 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829480.1 protein_id gnl|my_center|LOCUS_11490 9335 8697 gene locus_tag LOCUS_11500 gene thiE 9335 8697 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_11500 9646 9389 gene locus_tag LOCUS_11510 gene spoIIID 9646 9389 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_11510 10041 10272 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttacagtcacgtaatttgtttaggtactaaaat >Feature sequence073 1536 517 gene locus_tag LOCUS_11520 1536 517 CDS product DUF5050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966320.1 protein_id gnl|my_center|LOCUS_11520 1624 2754 gene locus_tag LOCUS_11530 gene pheA 1624 2754 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_11530 2782 4320 gene locus_tag LOCUS_11540 2782 4320 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641096.1 protein_id gnl|my_center|LOCUS_11540 4335 6461 gene locus_tag LOCUS_11550 4335 6461 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_11550 6669 7163 gene locus_tag LOCUS_11560 gene infC 6669 7163 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048135.1 protein_id gnl|my_center|LOCUS_11560 7185 7382 gene locus_tag LOCUS_11570 gene rpmI 7185 7382 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_11570 7407 7763 gene locus_tag LOCUS_11580 gene rplT 7407 7763 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808209.1 protein_id gnl|my_center|LOCUS_11580 7820 9187 gene locus_tag LOCUS_11590 7820 9187 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_11590 10043 9207 gene locus_tag LOCUS_11600 10043 9207 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262870.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence074 3922 2273 gene locus_tag LOCUS_11610 3922 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 5566 3935 gene locus_tag LOCUS_11620 5566 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 6779 5571 gene locus_tag LOCUS_11630 6779 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 8913 6817 gene locus_tag LOCUS_11640 8913 6817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 9956 9105 gene locus_tag LOCUS_11650 9956 9105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence075 <1 1666 gene locus_tag LOCUS_11660 <1 1666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003721494.1:CDP-glycerol glycerophosphotransferase family protein 1685 2356 gene locus_tag LOCUS_11670 gene rpe 1685 2356 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965037.1 protein_id gnl|my_center|LOCUS_11670 2360 3493 gene locus_tag LOCUS_11680 2360 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 3495 5255 gene locus_tag LOCUS_11690 3495 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 5386 7185 gene locus_tag LOCUS_11700 5386 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 7199 8734 gene locus_tag LOCUS_11710 7199 8734 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837625.1 protein_id gnl|my_center|LOCUS_11710 8760 10085 gene locus_tag LOCUS_11720 8760 10085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence076 561 1166 gene locus_tag LOCUS_11730 561 1166 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_11730 1982 1209 gene locus_tag LOCUS_11740 1982 1209 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_11740 3636 2704 gene locus_tag LOCUS_11750 gene cysK 3636 2704 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_11750 4391 3933 gene locus_tag LOCUS_11760 4391 3933 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_11760 5616 4381 gene locus_tag LOCUS_11770 5616 4381 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_11770 6526 5618 gene locus_tag LOCUS_11780 6526 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 7943 6537 gene locus_tag LOCUS_11790 gene sufB 7943 6537 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_11790 8706 7960 gene locus_tag LOCUS_11800 gene sufC 8706 7960 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_11800 9161 8736 gene locus_tag LOCUS_11810 9161 8736 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence077 2436 19 gene locus_tag LOCUS_11820 gene leuS 2436 19 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009461.1 protein_id gnl|my_center|LOCUS_11820 4197 2965 gene locus_tag LOCUS_11830 4197 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 6110 4194 gene locus_tag LOCUS_11840 6110 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 9541 6350 gene locus_tag LOCUS_11850 9541 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 9982 9770 gene locus_tag LOCUS_11860 9982 9770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence078 1787 1230 gene locus_tag LOCUS_11870 gene dhaS 1787 1230 CDS product dihydroxyacetone kinase transcriptional activator DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204220.1 protein_id gnl|my_center|LOCUS_11870 3194 1857 gene locus_tag LOCUS_11880 3194 1857 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015792.1 protein_id gnl|my_center|LOCUS_11880 4733 3408 gene locus_tag LOCUS_11890 4733 3408 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475463.1 protein_id gnl|my_center|LOCUS_11890 5504 4752 gene locus_tag LOCUS_11900 5504 4752 CDS product DUF4866 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930717.1 protein_id gnl|my_center|LOCUS_11900 6452 5649 gene locus_tag LOCUS_11910 6452 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 8298 6547 gene locus_tag LOCUS_11920 8298 6547 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836488.1 protein_id gnl|my_center|LOCUS_11920 9277 8282 gene locus_tag LOCUS_11930 9277 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 9779 9267 gene locus_tag LOCUS_11940 9779 9267 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_11940 >Feature sequence079 1574 465 gene locus_tag LOCUS_11950 1574 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 2746 1625 gene locus_tag LOCUS_11960 2746 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 3606 2743 gene locus_tag LOCUS_11970 3606 2743 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861296.1 protein_id gnl|my_center|LOCUS_11970 4375 3584 gene locus_tag LOCUS_11980 4375 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 4920 4372 gene locus_tag LOCUS_11990 4920 4372 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461816.1 protein_id gnl|my_center|LOCUS_11990 7355 5088 gene locus_tag LOCUS_12000 gene metE 7355 5088 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027682.1 protein_id gnl|my_center|LOCUS_12000 9142 7463 gene locus_tag LOCUS_12010 9142 7463 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037529.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence080 <1 1594 gene locus_tag LOCUS_12020 <1 1594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930970.1:MMPL family transporter 1607 3766 gene locus_tag LOCUS_12030 1607 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 3790 4365 gene locus_tag LOCUS_12040 3790 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 4466 5158 gene locus_tag LOCUS_12050 4466 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 5726 5139 gene locus_tag LOCUS_12060 5726 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 5976 7652 gene locus_tag LOCUS_12070 5976 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 7664 8641 gene locus_tag LOCUS_12080 7664 8641 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_12080 8656 9135 gene locus_tag LOCUS_12090 8656 9135 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence081 1577 918 gene locus_tag LOCUS_12100 1577 918 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_12100 2101 1574 gene locus_tag LOCUS_12110 2101 1574 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_12110 2411 2091 gene locus_tag LOCUS_12120 2411 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 2621 2549 gene locus_tag LOCUS_t00080 2621 2549 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2804 3343 gene locus_tag LOCUS_12130 2804 3343 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_12130 3356 4429 gene locus_tag LOCUS_12140 3356 4429 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437017.1 protein_id gnl|my_center|LOCUS_12140 4422 5246 gene locus_tag LOCUS_12150 4422 5246 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_12150 5240 6019 gene locus_tag LOCUS_12160 5240 6019 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_12160 6062 7135 gene locus_tag LOCUS_12170 6062 7135 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_12170 7275 8186 gene locus_tag LOCUS_12180 7275 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 <9196 8241 gene locus_tag LOCUS_12190 <9196 8241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042515450.1:glycogen synthase GlgA >Feature sequence082 2123 819 gene locus_tag LOCUS_12200 2123 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 2289 3755 gene locus_tag LOCUS_12210 2289 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 4676 3771 gene locus_tag LOCUS_12220 4676 3771 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_12220 5476 4676 gene locus_tag LOCUS_12230 gene pyrK 5476 4676 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232111.1 protein_id gnl|my_center|LOCUS_12230 6442 5510 gene locus_tag LOCUS_12240 gene pyrF 6442 5510 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_12240 7754 6468 gene locus_tag LOCUS_12250 7754 6468 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_12250 8909 7770 gene locus_tag LOCUS_12260 8909 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence083 1725 1027 gene locus_tag LOCUS_12270 1725 1027 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_12270 3025 1838 gene locus_tag LOCUS_12280 3025 1838 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158181789.1 protein_id gnl|my_center|LOCUS_12280 3863 3195 gene locus_tag LOCUS_12290 3863 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858686.1 protein_id gnl|my_center|LOCUS_12290 5535 3973 gene locus_tag LOCUS_12300 5535 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 6760 5546 gene locus_tag LOCUS_12310 6760 5546 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_12310 7405 6854 gene locus_tag LOCUS_12320 7405 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 8751 7420 gene locus_tag LOCUS_12330 gene glnA 8751 7420 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence084 46 552 gene locus_tag LOCUS_12340 46 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 696 1088 gene locus_tag LOCUS_12350 696 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1116 2048 gene locus_tag LOCUS_12360 gene arcC 1116 2048 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706022.1 protein_id gnl|my_center|LOCUS_12360 2072 2533 gene locus_tag LOCUS_12370 2072 2533 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_12370 2559 3257 gene locus_tag LOCUS_12380 2559 3257 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965416.1 protein_id gnl|my_center|LOCUS_12380 3319 4149 gene locus_tag LOCUS_12390 gene pdaB 3319 4149 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965679.1 protein_id gnl|my_center|LOCUS_12390 4224 5294 gene locus_tag LOCUS_12400 4224 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 5530 5360 gene locus_tag LOCUS_12410 5530 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 5691 6539 gene locus_tag LOCUS_12420 5691 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 6586 8667 gene locus_tag LOCUS_12430 6586 8667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 >Feature sequence085 2545 824 gene locus_tag LOCUS_12440 2545 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 3351 3007 gene locus_tag LOCUS_12450 3351 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3485 3862 gene locus_tag LOCUS_12460 gene cheY 3485 3862 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081049.1 protein_id gnl|my_center|LOCUS_12460 3868 4764 gene locus_tag LOCUS_12470 3868 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 5584 4841 gene locus_tag LOCUS_12480 5584 4841 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255171.1 protein_id gnl|my_center|LOCUS_12480 6260 5574 gene locus_tag LOCUS_12490 6260 5574 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_12490 7075 6281 gene locus_tag LOCUS_12500 7075 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 8593 7103 gene locus_tag LOCUS_12510 gene thrC 8593 7103 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence086 <1 818 gene locus_tag LOCUS_12520 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068658.1:glycoside hydrolase family 127 protein 1561 815 gene locus_tag LOCUS_12530 1561 815 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016216.1 protein_id gnl|my_center|LOCUS_12530 3351 1567 gene locus_tag LOCUS_12540 3351 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 3601 4479 gene locus_tag LOCUS_12550 3601 4479 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_12550 4479 5318 gene locus_tag LOCUS_12560 4479 5318 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_12560 5332 6642 gene locus_tag LOCUS_12570 5332 6642 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015138.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence087 838 1602 gene locus_tag LOCUS_12580 gene aroD 838 1602 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897376.1 protein_id gnl|my_center|LOCUS_12580 1657 1730 gene locus_tag LOCUS_t00090 1657 1730 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1869 3149 gene locus_tag LOCUS_12590 1869 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 3215 4063 gene locus_tag LOCUS_12600 gene rluF 3215 4063 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936374.1 protein_id gnl|my_center|LOCUS_12600 4038 6008 gene locus_tag LOCUS_12610 gene ligA 4038 6008 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_12610 6017 6949 gene locus_tag LOCUS_12620 gene metA 6017 6949 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121523.1 protein_id gnl|my_center|LOCUS_12620 7554 7754 gene locus_tag LOCUS_12630 7554 7754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 7876 8226 gene locus_tag LOCUS_12640 7876 8226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 8228 8518 gene locus_tag LOCUS_12650 8228 8518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence088 334 44 gene locus_tag LOCUS_12660 334 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1644 1895 gene locus_tag LOCUS_12670 1644 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 2231 3949 gene locus_tag LOCUS_12680 2231 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 3997 4707 gene locus_tag LOCUS_12690 gene cwlD 3997 4707 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860636.1 protein_id gnl|my_center|LOCUS_12690 5865 4732 gene locus_tag LOCUS_12700 5865 4732 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_12700 6443 5874 gene locus_tag LOCUS_12710 6443 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence089 1065 1724 gene locus_tag LOCUS_12720 1065 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1724 2383 gene locus_tag LOCUS_12730 gene spoIIR 1724 2383 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966181.1 protein_id gnl|my_center|LOCUS_12730 2448 2897 gene locus_tag LOCUS_12740 2448 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 3036 4751 gene locus_tag LOCUS_12750 3036 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 5350 4847 gene locus_tag LOCUS_12760 5350 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 5491 6723 gene locus_tag LOCUS_12770 5491 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 6766 8157 gene locus_tag LOCUS_12780 gene asnS 6766 8157 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence090 2257 632 gene locus_tag LOCUS_12790 2257 632 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360293.1 protein_id gnl|my_center|LOCUS_12790 2978 2421 gene locus_tag LOCUS_12800 2978 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12800 4210 3011 gene locus_tag LOCUS_12810 4210 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12810 4349 5233 gene locus_tag LOCUS_12820 4349 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 5332 6291 gene locus_tag LOCUS_12830 5332 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 8100 6313 gene locus_tag LOCUS_12840 8100 6313 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272416.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence091 1746 376 gene locus_tag LOCUS_12850 gene radA 1746 376 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_12850 2163 1750 gene locus_tag LOCUS_12860 2163 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 4652 2208 gene locus_tag LOCUS_12870 4652 2208 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966466.1 protein_id gnl|my_center|LOCUS_12870 6313 4676 gene locus_tag LOCUS_12880 6313 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 8081 6330 gene locus_tag LOCUS_12890 8081 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence092 384 106 gene locus_tag LOCUS_12900 384 106 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613391.1 protein_id gnl|my_center|LOCUS_12900 640 368 gene locus_tag LOCUS_12910 640 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 2044 776 gene locus_tag LOCUS_12920 2044 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 3648 2050 gene locus_tag LOCUS_12930 3648 2050 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922657.1 protein_id gnl|my_center|LOCUS_12930 4407 3883 gene locus_tag LOCUS_12940 4407 3883 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965573.1 protein_id gnl|my_center|LOCUS_12940 5190 4495 gene locus_tag LOCUS_12950 gene tsaA 5190 4495 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_12950 7439 5199 gene locus_tag LOCUS_12960 7439 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence093 799 116 gene locus_tag LOCUS_12970 799 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1121 810 gene locus_tag LOCUS_12980 1121 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1896 1132 gene locus_tag LOCUS_12990 gene whiG 1896 1132 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_12990 2255 1920 gene locus_tag LOCUS_13000 2255 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 2752 2267 gene locus_tag LOCUS_13010 2752 2267 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541375.1 protein_id gnl|my_center|LOCUS_13010 3388 2768 gene locus_tag LOCUS_13020 3388 2768 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006874833.1 protein_id gnl|my_center|LOCUS_13020 3933 3445 gene locus_tag LOCUS_13030 3933 3445 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037040.1 protein_id gnl|my_center|LOCUS_13030 6045 3949 gene locus_tag LOCUS_13040 6045 3949 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965518.1 protein_id gnl|my_center|LOCUS_13040 7060 6047 gene locus_tag LOCUS_13050 gene cheB 7060 6047 CDS product protein-glutamate O-methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245823.1 protein_id gnl|my_center|LOCUS_13050 7860 7117 gene locus_tag LOCUS_13060 7860 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence094 1434 148 gene locus_tag LOCUS_13070 gene aroA 1434 148 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229519.1 protein_id gnl|my_center|LOCUS_13070 1791 1453 gene locus_tag LOCUS_13080 1791 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 2484 1921 gene locus_tag LOCUS_13090 2484 1921 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924525.1 protein_id gnl|my_center|LOCUS_13090 2685 3731 gene locus_tag LOCUS_13100 2685 3731 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235612.1 protein_id gnl|my_center|LOCUS_13100 4837 3800 gene locus_tag LOCUS_13110 gene queA 4837 3800 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_13110 7257 4840 gene locus_tag LOCUS_13120 gene pheT 7257 4840 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_13120 <7850 7271 gene locus_tag LOCUS_13130 <7850 7271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965654.1:phenylalanine--tRNA ligase subunit alpha >Feature sequence095 674 186 gene locus_tag LOCUS_13140 674 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 950 696 gene locus_tag LOCUS_13150 950 696 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154654.1 protein_id gnl|my_center|LOCUS_13150 3628 1097 gene locus_tag LOCUS_13160 3628 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 4140 3667 gene locus_tag LOCUS_13170 4140 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 6455 4197 gene locus_tag LOCUS_13180 6455 4197 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254583.1 protein_id gnl|my_center|LOCUS_13180 6905 6471 gene locus_tag LOCUS_13190 6905 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 7792 6902 gene locus_tag LOCUS_13200 7792 6902 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101955.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence096 82 276 gene locus_tag LOCUS_13210 82 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 323 778 gene locus_tag LOCUS_13220 323 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 839 1480 gene locus_tag LOCUS_13230 839 1480 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_13230 1889 3637 gene locus_tag LOCUS_13240 gene aspS 1889 3637 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_13240 3655 3948 gene locus_tag LOCUS_13250 gene gatC 3655 3948 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_13250 3961 5424 gene locus_tag LOCUS_13260 gene gatA 3961 5424 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_13260 5439 6872 gene locus_tag LOCUS_13270 gene gatB 5439 6872 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048223.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence097 <1 748 gene locus_tag LOCUS_13280 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681886.1:protein-ADP-ribose hydrolase 797 1471 gene locus_tag LOCUS_13290 797 1471 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_13290 1611 1468 gene locus_tag LOCUS_13300 1611 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1710 2369 gene locus_tag LOCUS_13310 1710 2369 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052445.1 protein_id gnl|my_center|LOCUS_13310 2422 2733 gene locus_tag LOCUS_13320 2422 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 2801 3697 gene locus_tag LOCUS_13330 2801 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 3897 4673 gene locus_tag LOCUS_13340 3897 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 5020 4715 gene locus_tag LOCUS_13350 5020 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 5769 5017 gene locus_tag LOCUS_13360 5769 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 6742 5795 gene locus_tag LOCUS_13370 6742 5795 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_13370 <7637 6751 gene locus_tag LOCUS_13380 <7637 6751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963403.1:DMT family transporter >Feature sequence098 1084 113 gene locus_tag LOCUS_13390 gene hemB 1084 113 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087065.1 protein_id gnl|my_center|LOCUS_13390 1734 1105 gene locus_tag LOCUS_13400 1734 1105 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125118834.1 protein_id gnl|my_center|LOCUS_13400 1834 2238 gene locus_tag LOCUS_13410 1834 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2705 2253 gene locus_tag LOCUS_13420 2705 2253 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_13420 3628 2708 gene locus_tag LOCUS_13430 gene pyrB 3628 2708 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_13430 4407 3715 gene locus_tag LOCUS_13440 4407 3715 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_13440 5243 4404 gene locus_tag LOCUS_13450 5243 4404 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_13450 5651 5256 gene locus_tag LOCUS_13460 5651 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386950.1 protein_id gnl|my_center|LOCUS_13460 <7620 6286 gene locus_tag LOCUS_13470 <7620 6286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080960.1:nucleoside kinase >Feature sequence099 <1 850 gene locus_tag LOCUS_13480 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905787.1:ATP-dependent Clp protease ATP-binding subunit ClpX 970 2058 gene locus_tag LOCUS_13490 970 2058 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815696.1 protein_id gnl|my_center|LOCUS_13490 2060 4462 gene locus_tag LOCUS_13500 2060 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 4476 6506 gene locus_tag LOCUS_13510 gene ganA 4476 6506 CDS product beta-galactosidase GanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243532.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence100 870 2330 gene locus_tag LOCUS_13520 gene guaB 870 2330 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965988.1 protein_id gnl|my_center|LOCUS_13520 2363 3655 gene locus_tag LOCUS_13530 2363 3655 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_13530 5098 3695 gene locus_tag LOCUS_13540 5098 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 5649 5098 gene locus_tag LOCUS_13550 5649 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 6062 5646 gene locus_tag LOCUS_13560 6062 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 6232 6059 gene locus_tag LOCUS_13570 6232 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 6378 6232 gene locus_tag LOCUS_13580 6378 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 6881 6504 gene locus_tag LOCUS_13590 6881 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence101 1229 663 gene locus_tag LOCUS_13600 1229 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1489 1244 gene locus_tag LOCUS_13610 1489 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 2063 1455 gene locus_tag LOCUS_13620 2063 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 2171 2653 gene locus_tag LOCUS_13630 gene ybaK 2171 2653 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710889.1 protein_id gnl|my_center|LOCUS_13630 4356 2692 gene locus_tag LOCUS_13640 4356 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 5423 4458 gene locus_tag LOCUS_13650 5423 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 6146 5529 gene locus_tag LOCUS_13660 6146 5529 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131377.1 protein_id gnl|my_center|LOCUS_13660 6765 6256 gene locus_tag LOCUS_13670 6765 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence102 323 1465 gene locus_tag LOCUS_13680 gene glgD 323 1465 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_13680 1538 1915 gene locus_tag LOCUS_13690 1538 1915 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_13690 1998 2396 gene locus_tag LOCUS_13700 gene nusB 1998 2396 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_13700 2393 3616 gene locus_tag LOCUS_13710 gene xseA 2393 3616 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_13710 3609 3830 gene locus_tag LOCUS_13720 3609 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 3830 4723 gene locus_tag LOCUS_13730 3830 4723 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_13730 4739 6607 gene locus_tag LOCUS_13740 gene dxs 4739 6607 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_13740 6604 7407 gene locus_tag LOCUS_13750 6604 7407 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence103 1470 2006 gene locus_tag LOCUS_13760 1470 2006 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433028.1 protein_id gnl|my_center|LOCUS_13760 2472 1993 gene locus_tag LOCUS_13770 gene tadA 2472 1993 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_13770 2573 3121 gene locus_tag LOCUS_13780 gene rimJ 2573 3121 CDS product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704794.1 protein_id gnl|my_center|LOCUS_13780 4040 3108 gene locus_tag LOCUS_13790 4040 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 4215 4604 gene locus_tag LOCUS_13800 4215 4604 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392341.1 protein_id gnl|my_center|LOCUS_13800 4634 5176 gene locus_tag LOCUS_13810 4634 5176 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_13810 5307 5522 gene locus_tag LOCUS_13820 5307 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 5458 6108 gene locus_tag LOCUS_13830 5458 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 6917 6087 gene locus_tag LOCUS_13840 6917 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence104 148 1572 gene locus_tag LOCUS_13850 148 1572 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_13850 1608 2126 gene locus_tag LOCUS_13860 1608 2126 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_13860 2176 3036 gene locus_tag LOCUS_13870 2176 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 3116 5455 gene locus_tag LOCUS_13880 3116 5455 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_13880 5480 6109 gene locus_tag LOCUS_13890 5480 6109 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965570.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence105 330 1343 gene locus_tag LOCUS_13900 330 1343 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_13900 1431 2789 gene locus_tag LOCUS_13910 1431 2789 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016070.1 protein_id gnl|my_center|LOCUS_13910 2818 3678 gene locus_tag LOCUS_13920 gene nadC 2818 3678 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360683.1 protein_id gnl|my_center|LOCUS_13920 3698 4255 gene locus_tag LOCUS_13930 3698 4255 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016072.1 protein_id gnl|my_center|LOCUS_13930 4317 4913 gene locus_tag LOCUS_13940 4317 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 5955 4942 gene locus_tag LOCUS_13950 5955 4942 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974677.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence106 2715 613 gene locus_tag LOCUS_13960 gene amyE 2715 613 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234692.1 protein_id gnl|my_center|LOCUS_13960 3078 2911 gene locus_tag LOCUS_13970 3078 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 3897 3082 gene locus_tag LOCUS_13980 3897 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 4962 3961 gene locus_tag LOCUS_13990 4962 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 5409 4972 gene locus_tag LOCUS_14000 5409 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 5646 6779 gene locus_tag LOCUS_14010 5646 6779 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659266.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence107 1876 2139 gene locus_tag LOCUS_14020 1876 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 2995 2147 gene locus_tag LOCUS_14030 2995 2147 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_14030 3181 4218 gene locus_tag LOCUS_14040 3181 4218 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262240.1 protein_id gnl|my_center|LOCUS_14040 5263 4262 gene locus_tag LOCUS_14050 5263 4262 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244946.1 protein_id gnl|my_center|LOCUS_14050 6209 5301 gene locus_tag LOCUS_14060 6209 5301 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_14060 7066 6209 gene locus_tag LOCUS_14070 7066 6209 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence108 <1 670 gene locus_tag LOCUS_14080 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011475726.1:UDP-glucose--hexose-1-phosphate uridylyltransferase 2470 1106 gene locus_tag LOCUS_14090 2470 1106 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_14090 2672 3733 gene locus_tag LOCUS_14100 gene hisC 2672 3733 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905826.1 protein_id gnl|my_center|LOCUS_14100 3748 4218 gene locus_tag LOCUS_14110 3748 4218 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_14110 4238 5536 gene locus_tag LOCUS_14120 4238 5536 CDS product alcohol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930145.1 protein_id gnl|my_center|LOCUS_14120 5529 6194 gene locus_tag LOCUS_14130 5529 6194 CDS product DUF6320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804300.1 protein_id gnl|my_center|LOCUS_14130 6191 7120 gene locus_tag LOCUS_14140 6191 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence109 674 489 gene locus_tag LOCUS_14150 674 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 950 789 gene locus_tag LOCUS_14160 950 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1170 940 gene locus_tag LOCUS_14170 1170 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1724 1326 gene locus_tag LOCUS_14180 gene rpsI 1724 1326 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723652.1 protein_id gnl|my_center|LOCUS_14180 2167 1739 gene locus_tag LOCUS_14190 gene rplM 2167 1739 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918559.1 protein_id gnl|my_center|LOCUS_14190 3207 2473 gene locus_tag LOCUS_14200 gene truA 3207 2473 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_14200 4097 3282 gene locus_tag LOCUS_14210 4097 3282 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_14210 4986 4123 gene locus_tag LOCUS_14220 4986 4123 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_14220 5877 5020 gene locus_tag LOCUS_14230 5877 5020 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 protein_id gnl|my_center|LOCUS_14230 6382 5879 gene locus_tag LOCUS_14240 gene trmL 6382 5879 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_14240 7005 6385 gene locus_tag LOCUS_14250 7005 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence110 2027 753 gene locus_tag LOCUS_14260 gene flhF 2027 753 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943680.1 protein_id gnl|my_center|LOCUS_14260 4064 2028 gene locus_tag LOCUS_14270 gene flhA 4064 2028 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_14270 5213 4107 gene locus_tag LOCUS_14280 5213 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14280 6015 5236 gene locus_tag LOCUS_14290 gene fliR 6015 5236 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947513.1 protein_id gnl|my_center|LOCUS_14290 6305 6030 gene locus_tag LOCUS_14300 gene fliQ 6305 6030 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626457.1 protein_id gnl|my_center|LOCUS_14300 <7108 6317 gene locus_tag LOCUS_14310 <7108 6317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245692.1:flagellar type III secretion system pore protein FliP >Feature sequence111 1256 876 gene locus_tag LOCUS_14320 1256 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 2086 1274 gene locus_tag LOCUS_14330 2086 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 3613 2099 gene locus_tag LOCUS_14340 3613 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 4522 3647 gene locus_tag LOCUS_14350 4522 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 4976 4524 gene locus_tag LOCUS_14360 4976 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 6307 4997 gene locus_tag LOCUS_14370 gene fliI 6307 4997 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460756.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence112 <1 1316 gene locus_tag LOCUS_14380 <1 1316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964594.1:molecular chaperone DnaK 1393 2562 gene locus_tag LOCUS_14390 gene dnaJ 1393 2562 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048002.1 protein_id gnl|my_center|LOCUS_14390 2660 3079 gene locus_tag LOCUS_14400 2660 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 3355 3137 gene locus_tag LOCUS_14410 3355 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 3508 4467 gene locus_tag LOCUS_14420 gene prmA 3508 4467 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398884.1 protein_id gnl|my_center|LOCUS_14420 4477 5211 gene locus_tag LOCUS_14430 4477 5211 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430913.1 protein_id gnl|my_center|LOCUS_14430 5223 6377 gene locus_tag LOCUS_14440 5223 6377 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence113 1828 569 gene locus_tag LOCUS_14450 gene rpoD 1828 569 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964612.1 protein_id gnl|my_center|LOCUS_14450 3590 1866 gene locus_tag LOCUS_14460 gene dnaG 3590 1866 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_14460 4683 3670 gene locus_tag LOCUS_14470 4683 3670 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_14470 6287 4782 gene locus_tag LOCUS_14480 6287 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 <7003 6284 gene locus_tag LOCUS_14490 <7003 6284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986630.1:MATE family efflux transporter >Feature sequence114 <1 1019 gene locus_tag LOCUS_14500 <1 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003699652.1:aspartate-semialdehyde dehydrogenase 1157 2518 gene locus_tag LOCUS_14510 1157 2518 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868284.1 protein_id gnl|my_center|LOCUS_14510 2546 6055 gene locus_tag LOCUS_14520 2546 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 6076 6756 gene locus_tag LOCUS_14530 6076 6756 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence115 125 1084 gene locus_tag LOCUS_14540 125 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1158 1697 gene locus_tag LOCUS_14550 1158 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2003 3133 gene locus_tag LOCUS_14560 2003 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 3189 4547 gene locus_tag LOCUS_14570 3189 4547 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_14570 4688 5257 gene locus_tag LOCUS_14580 4688 5257 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986315.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence116 <1 868 gene locus_tag LOCUS_14590 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357588.1:6-phosphofructokinase 962 1735 gene locus_tag LOCUS_14600 962 1735 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_14600 1732 2166 gene locus_tag LOCUS_14610 1732 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 2170 2988 gene locus_tag LOCUS_14620 2170 2988 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_14620 2972 3235 gene locus_tag LOCUS_14630 2972 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 3389 4048 gene locus_tag LOCUS_14640 3389 4048 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_14640 4097 4441 gene locus_tag LOCUS_14650 4097 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 4524 4985 gene locus_tag LOCUS_14660 gene spoVAC 4524 4985 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418420.1 protein_id gnl|my_center|LOCUS_14660 5100 5762 gene locus_tag LOCUS_14670 5100 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 5752 6201 gene locus_tag LOCUS_14680 gene spoVAB 5752 6201 CDS product stage V sporulation protein SpoVAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572931.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence117 324 148 gene locus_tag LOCUS_14690 324 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 365 1285 gene locus_tag LOCUS_14700 365 1285 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775527.1 protein_id gnl|my_center|LOCUS_14700 3181 1352 gene locus_tag LOCUS_14710 3181 1352 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897930.1 protein_id gnl|my_center|LOCUS_14710 5233 3245 gene locus_tag LOCUS_14720 5233 3245 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015263574.1 protein_id gnl|my_center|LOCUS_14720 5422 6477 gene locus_tag LOCUS_14730 5422 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence118 1430 567 gene locus_tag LOCUS_14740 1430 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 3473 1860 gene locus_tag LOCUS_14750 3473 1860 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_14750 4291 3557 gene locus_tag LOCUS_14760 gene sigE 4291 3557 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399432.1 protein_id gnl|my_center|LOCUS_14760 5087 4275 gene locus_tag LOCUS_14770 5087 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 6518 5238 gene locus_tag LOCUS_14780 6518 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence119 1836 1078 gene locus_tag LOCUS_14790 1836 1078 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_14790 2222 1977 gene locus_tag LOCUS_14800 2222 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 4436 2241 gene locus_tag LOCUS_14810 gene feoB 4436 2241 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_14810 4781 4560 gene locus_tag LOCUS_14820 4781 4560 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_14820 5007 4795 gene locus_tag LOCUS_14830 5007 4795 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_14830 5622 5191 gene locus_tag LOCUS_14840 5622 5191 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902921.1 protein_id gnl|my_center|LOCUS_14840 6289 5651 gene locus_tag LOCUS_14850 6289 5651 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence120 2925 1915 gene locus_tag LOCUS_14860 gene trpD 2925 1915 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869732.1 protein_id gnl|my_center|LOCUS_14860 3754 2960 gene locus_tag LOCUS_14870 gene trpA 3754 2960 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966434.1 protein_id gnl|my_center|LOCUS_14870 4958 3771 gene locus_tag LOCUS_14880 gene trpB 4958 3771 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723934.1 protein_id gnl|my_center|LOCUS_14880 5620 4955 gene locus_tag LOCUS_14890 5620 4955 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262055.1 protein_id gnl|my_center|LOCUS_14890 6402 5617 gene locus_tag LOCUS_14900 gene trpC 6402 5617 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence121 1791 925 gene locus_tag LOCUS_14910 1791 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 2008 3543 gene locus_tag LOCUS_14920 2008 3543 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_14920 5377 3635 gene locus_tag LOCUS_14930 5377 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 5823 6341 gene locus_tag LOCUS_14940 5823 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence122 1494 1180 gene locus_tag LOCUS_14950 1494 1180 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357860.1 protein_id gnl|my_center|LOCUS_14950 1756 1487 gene locus_tag LOCUS_14960 1756 1487 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_14960 2979 1759 gene locus_tag LOCUS_14970 gene nusA 2979 1759 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_14970 3572 3105 gene locus_tag LOCUS_14980 3572 3105 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_14980 3833 3761 gene locus_tag LOCUS_t00100 3833 3761 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3982 4737 gene locus_tag LOCUS_14990 3982 4737 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_14990 5015 4943 gene locus_tag LOCUS_t00110 5015 4943 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5259 5187 gene locus_tag LOCUS_t00120 5259 5187 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6381 5365 gene locus_tag LOCUS_15000 gene galE 6381 5365 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence123 916 707 gene locus_tag LOCUS_15010 gene thiS 916 707 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945026.1 protein_id gnl|my_center|LOCUS_15010 1246 929 gene locus_tag LOCUS_15020 gene trxA 1246 929 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_15020 1510 1265 gene locus_tag LOCUS_15030 1510 1265 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816171.1 protein_id gnl|my_center|LOCUS_15030 2363 1503 gene locus_tag LOCUS_15040 2363 1503 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460728.1 protein_id gnl|my_center|LOCUS_15040 3632 2400 gene locus_tag LOCUS_15050 3632 2400 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963429.1 protein_id gnl|my_center|LOCUS_15050 5494 3794 gene locus_tag LOCUS_15060 5494 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 <6386 5496 gene locus_tag LOCUS_15070 <6386 5496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000372751.1:sulfate adenylyltransferase subunit CysD >Feature sequence124 208 1422 gene locus_tag LOCUS_15080 208 1422 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_15080 1502 1954 gene locus_tag LOCUS_15090 1502 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 2305 3057 gene locus_tag LOCUS_15100 2305 3057 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_15100 3131 4789 gene locus_tag LOCUS_15110 3131 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 4799 5605 gene locus_tag LOCUS_15120 4799 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence125 31 1479 gene locus_tag LOCUS_15130 31 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1592 3934 gene locus_tag LOCUS_15140 gene feoB 1592 3934 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_15140 4010 4882 gene locus_tag LOCUS_15150 4010 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence126 1283 411 gene locus_tag LOCUS_15160 1283 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 2526 1303 gene locus_tag LOCUS_15170 2526 1303 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_15170 3506 2661 gene locus_tag LOCUS_15180 3506 2661 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890830.1 protein_id gnl|my_center|LOCUS_15180 4898 3687 gene locus_tag LOCUS_15190 4898 3687 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_15190 5161 5664 gene locus_tag LOCUS_15200 5161 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 5765 5968 gene locus_tag LOCUS_15210 5765 5968 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900759.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence127 59 640 gene locus_tag LOCUS_15220 59 640 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429956.1 protein_id gnl|my_center|LOCUS_15220 956 696 gene locus_tag LOCUS_15230 956 696 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_15230 1164 3737 gene locus_tag LOCUS_15240 gene secA 1164 3737 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947996.1 protein_id gnl|my_center|LOCUS_15240 4824 3814 gene locus_tag LOCUS_15250 4824 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence128 <1 1199 gene locus_tag LOCUS_15260 <1 1199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965946.1:glutamine synthetase III 1325 3076 gene locus_tag LOCUS_15270 1325 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 3261 5906 gene locus_tag LOCUS_15280 3261 5906 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808183.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence129 2296 1430 gene locus_tag LOCUS_15290 2296 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 4508 2412 gene locus_tag LOCUS_15300 gene pnp 4508 2412 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_15300 4931 4665 gene locus_tag LOCUS_15310 gene rpsO 4931 4665 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392569.1 protein_id gnl|my_center|LOCUS_15310 6184 5060 gene locus_tag LOCUS_15320 6184 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence130 83 526 gene locus_tag LOCUS_15330 83 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 568 825 gene locus_tag LOCUS_15340 gene rpsR 568 825 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_15340 1386 1054 gene locus_tag LOCUS_15350 1386 1054 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943036.1 protein_id gnl|my_center|LOCUS_15350 2874 1456 gene locus_tag LOCUS_15360 2874 1456 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963597.1 protein_id gnl|my_center|LOCUS_15360 3207 3695 gene locus_tag LOCUS_15370 3207 3695 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642743.1 protein_id gnl|my_center|LOCUS_15370 3764 4078 gene locus_tag LOCUS_15380 3764 4078 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052490.1 protein_id gnl|my_center|LOCUS_15380 4065 4472 gene locus_tag LOCUS_15390 4065 4472 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052491.1 protein_id gnl|my_center|LOCUS_15390 4469 4771 gene locus_tag LOCUS_15400 4469 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 5159 5863 gene locus_tag LOCUS_15410 gene cas6 5159 5863 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986678.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence131 661 2364 gene locus_tag LOCUS_15420 661 2364 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_15420 2495 2977 gene locus_tag LOCUS_15430 2495 2977 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_15430 2967 3566 gene locus_tag LOCUS_15440 2967 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 4242 3589 gene locus_tag LOCUS_15450 4242 3589 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_15450 4286 4498 gene locus_tag LOCUS_15460 4286 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 4571 4744 gene locus_tag LOCUS_15470 4571 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 4734 5480 gene locus_tag LOCUS_15480 4734 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence132 2038 1121 gene locus_tag LOCUS_15490 2038 1121 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803903.1 protein_id gnl|my_center|LOCUS_15490 3158 2145 gene locus_tag LOCUS_15500 3158 2145 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_15500 5101 3413 gene locus_tag LOCUS_15510 5101 3413 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_15510 5405 5226 gene locus_tag LOCUS_15520 5405 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence133 3165 49 gene locus_tag LOCUS_15530 3165 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 3329 4969 gene locus_tag LOCUS_15540 3329 4969 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_15540 5757 5071 gene locus_tag LOCUS_15550 5757 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence134 <1 1283 gene locus_tag LOCUS_15560 <1 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003425850.1:F0F1 ATP synthase subunit beta 1311 1715 gene locus_tag LOCUS_15570 1311 1715 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966148.1 protein_id gnl|my_center|LOCUS_15570 1835 3292 gene locus_tag LOCUS_15580 1835 3292 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936357.1 protein_id gnl|my_center|LOCUS_15580 3653 3285 gene locus_tag LOCUS_15590 3653 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 3912 4613 gene locus_tag LOCUS_15600 3912 4613 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986982.1 protein_id gnl|my_center|LOCUS_15600 4610 5656 gene locus_tag LOCUS_15610 4610 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence135 235 1221 gene locus_tag LOCUS_15620 235 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 2769 1279 gene locus_tag LOCUS_15630 gene fliC 2769 1279 CDS product H48 family flagellin FliC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079739.1 protein_id gnl|my_center|LOCUS_15630 3258 2962 gene locus_tag LOCUS_15640 3258 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 3576 4004 gene locus_tag LOCUS_15650 3576 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 4287 4096 gene locus_tag LOCUS_15660 4287 4096 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562948.1 protein_id gnl|my_center|LOCUS_15660 5107 4385 gene locus_tag LOCUS_15670 5107 4385 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_15670 5779 5255 gene locus_tag LOCUS_15680 5779 5255 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947935.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence136 <1 1257 gene locus_tag LOCUS_15690 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254470.1:beta-galactosidase 3877 1388 gene locus_tag LOCUS_15700 3877 1388 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107276.1 protein_id gnl|my_center|LOCUS_15700 4112 4297 gene locus_tag LOCUS_15710 4112 4297 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673411.1 protein_id gnl|my_center|LOCUS_15710 4338 5645 gene locus_tag LOCUS_15720 4338 5645 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence137 2036 1014 gene locus_tag LOCUS_15730 2036 1014 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964012.1 protein_id gnl|my_center|LOCUS_15730 2301 2134 gene locus_tag LOCUS_15740 2301 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 2516 4960 gene locus_tag LOCUS_15750 2516 4960 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_15750 5560 5087 gene locus_tag LOCUS_15760 5560 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence138 <1 1225 gene locus_tag LOCUS_15770 <1 1225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880400.1:carbamoyltransferase HypF 1238 1447 gene locus_tag LOCUS_15780 1238 1447 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393665.1 protein_id gnl|my_center|LOCUS_15780 1447 2475 gene locus_tag LOCUS_15790 gene hypD 1447 2475 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964129.1 protein_id gnl|my_center|LOCUS_15790 2495 3502 gene locus_tag LOCUS_15800 gene hypE 2495 3502 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964127.1 protein_id gnl|my_center|LOCUS_15800 3519 3794 gene locus_tag LOCUS_15810 3519 3794 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 protein_id gnl|my_center|LOCUS_15810 3791 4600 gene locus_tag LOCUS_15820 3791 4600 CDS product nitrogenase iron protein NifH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461419.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence139 1623 607 gene locus_tag LOCUS_15830 1623 607 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812003.1 protein_id gnl|my_center|LOCUS_15830 2724 1636 gene locus_tag LOCUS_15840 2724 1636 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_15840 3660 2749 gene locus_tag LOCUS_15850 3660 2749 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_15850 4083 4010 gene locus_tag LOCUS_t00130 4083 4010 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 4250 4330 gene locus_tag LOCUS_t00140 4250 4330 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4409 5776 gene locus_tag LOCUS_15860 4409 5776 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643131.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence140 <1 981 gene locus_tag LOCUS_15870 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942721.1:penicillin-binding protein 2 1022 1831 gene locus_tag LOCUS_15880 gene minD 1022 1831 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392079.1 protein_id gnl|my_center|LOCUS_15880 1821 2039 gene locus_tag LOCUS_15890 1821 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 2041 3150 gene locus_tag LOCUS_15900 gene rodA 2041 3150 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_15900 3164 3559 gene locus_tag LOCUS_15910 gene mgsA 3164 3559 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_15910 3615 4520 gene locus_tag LOCUS_15920 3615 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 4608 5030 gene locus_tag LOCUS_15930 4608 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_15930 5300 5094 gene locus_tag LOCUS_15940 5300 5094 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948188.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence141 4531 983 gene locus_tag LOCUS_15950 4531 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 <5809 4609 gene locus_tag LOCUS_15960 <5809 4609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002297196.1:cation-translocating P-type ATPase >Feature sequence142 <1 828 gene locus_tag LOCUS_15970 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963782.1:hemolysin family protein 921 1649 gene locus_tag LOCUS_15980 921 1649 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_15980 1709 3160 gene locus_tag LOCUS_15990 gene glgA 1709 3160 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_15990 3241 3909 gene locus_tag LOCUS_16000 gene tepA 3241 3909 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence143 314 1276 gene locus_tag LOCUS_16010 314 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1297 2130 gene locus_tag LOCUS_16020 1297 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2155 2853 gene locus_tag LOCUS_16030 gene pyrH 2155 2853 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_16030 2867 3421 gene locus_tag LOCUS_16040 gene frr 2867 3421 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_16040 3488 4201 gene locus_tag LOCUS_16050 3488 4201 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_16050 4203 5003 gene locus_tag LOCUS_16060 4203 5003 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence144 1087 326 gene locus_tag LOCUS_16070 1087 326 CDS product nitrogenase iron protein NifH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461208.1 protein_id gnl|my_center|LOCUS_16070 1841 1362 gene locus_tag LOCUS_16080 1841 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 2411 1875 gene locus_tag LOCUS_16090 2411 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 3451 2672 gene locus_tag LOCUS_16100 gene rsiV 3451 2672 CDS product anti-sigma-V factor RsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398482.1 protein_id gnl|my_center|LOCUS_16100 3644 5035 gene locus_tag LOCUS_16110 3644 5035 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891654.1 protein_id gnl|my_center|LOCUS_16110 <5776 5137 gene locus_tag LOCUS_16120 <5776 5137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000435143.1:threonine--tRNA ligase >Feature sequence145 1174 716 gene locus_tag LOCUS_16130 1174 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 2478 1219 gene locus_tag LOCUS_16140 2478 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 3260 2556 gene locus_tag LOCUS_16150 3260 2556 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948330.1 protein_id gnl|my_center|LOCUS_16150 3718 3257 gene locus_tag LOCUS_16160 3718 3257 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948329.1 protein_id gnl|my_center|LOCUS_16160 5376 3883 gene locus_tag LOCUS_16170 5376 3883 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence146 <1 644 gene locus_tag LOCUS_16180 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000229574.1:30S ribosomal protein S1 1447 722 gene locus_tag LOCUS_16190 1447 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1609 2877 gene locus_tag LOCUS_16200 1609 2877 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856534.1 protein_id gnl|my_center|LOCUS_16200 3100 3017 gene locus_tag LOCUS_t00150 3100 3017 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3252 3467 gene locus_tag LOCUS_16210 3252 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 3487 3765 gene locus_tag LOCUS_16220 3487 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence147 505 2235 gene locus_tag LOCUS_16230 505 2235 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_16230 2281 3642 gene locus_tag LOCUS_16240 gene murD 2281 3642 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_16240 3649 4776 gene locus_tag LOCUS_16250 gene spoVE 3649 4776 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence148 1139 360 gene locus_tag LOCUS_16260 1139 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2553 1132 gene locus_tag LOCUS_16270 2553 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 2624 2839 gene locus_tag LOCUS_16280 2624 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 2840 4534 gene locus_tag LOCUS_16290 2840 4534 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458957.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence149 99 977 gene locus_tag LOCUS_16300 99 977 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_16300 990 1652 gene locus_tag LOCUS_16310 gene gmk 990 1652 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003861.1 protein_id gnl|my_center|LOCUS_16310 1655 1897 gene locus_tag LOCUS_16320 gene rpoZ 1655 1897 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388622.1 protein_id gnl|my_center|LOCUS_16320 1952 3280 gene locus_tag LOCUS_16330 gene rimO 1952 3280 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986784.1 protein_id gnl|my_center|LOCUS_16330 3292 3834 gene locus_tag LOCUS_16340 gene pgsA 3292 3834 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_16340 3834 4319 gene locus_tag LOCUS_16350 3834 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 4307 4864 gene locus_tag LOCUS_16360 gene rsmD 4307 4864 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017073.1 protein_id gnl|my_center|LOCUS_16360 4870 5352 gene locus_tag LOCUS_16370 gene coaD 4870 5352 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence150 281 1120 gene locus_tag LOCUS_16380 281 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1124 2332 gene locus_tag LOCUS_16390 1124 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 3018 2404 gene locus_tag LOCUS_16400 3018 2404 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_16400 3294 3022 gene locus_tag LOCUS_16410 3294 3022 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392904.1 protein_id gnl|my_center|LOCUS_16410 3494 3291 gene locus_tag LOCUS_16420 3494 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 3605 5062 gene locus_tag LOCUS_16430 gene gltX 3605 5062 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence151 1909 497 gene locus_tag LOCUS_16440 gene trpE 1909 497 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966440.1 protein_id gnl|my_center|LOCUS_16440 2463 3416 gene locus_tag LOCUS_16450 2463 3416 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053693.1 protein_id gnl|my_center|LOCUS_16450 3437 4624 gene locus_tag LOCUS_16460 gene gltS 3437 4624 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_16460 4642 4830 gene locus_tag LOCUS_16470 4642 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 >Feature sequence152 1211 513 gene locus_tag LOCUS_16480 1211 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1613 1852 gene locus_tag LOCUS_16490 1613 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1919 4051 gene locus_tag LOCUS_16500 gene rnr 1919 4051 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_16500 4151 4618 gene locus_tag LOCUS_16510 gene smpB 4151 4618 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_16510 4750 5087 gene locus_tag LOCUS_tm00010 4750 5087 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence153 <1 523 gene locus_tag LOCUS_16520 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966254.1:tRNA 4-thiouridine(8) synthase ThiI 836 600 gene locus_tag LOCUS_16530 836 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 955 2262 gene locus_tag LOCUS_16540 gene mtaB 955 2262 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_16540 2342 2605 gene locus_tag LOCUS_16550 2342 2605 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348590.1 protein_id gnl|my_center|LOCUS_16550 2623 3060 gene locus_tag LOCUS_16560 gene ruvX 2623 3060 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810863.1 protein_id gnl|my_center|LOCUS_16560 3080 3343 gene locus_tag LOCUS_16570 3080 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 3370 5043 gene locus_tag LOCUS_16580 3370 5043 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_16580 5051 5227 gene locus_tag LOCUS_16590 5051 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence154 564 1934 gene locus_tag LOCUS_16600 gene eno 564 1934 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080719.1 protein_id gnl|my_center|LOCUS_16600 2990 1929 gene locus_tag LOCUS_16610 2990 1929 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_16610 3526 3017 gene locus_tag LOCUS_16620 3526 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 3987 3508 gene locus_tag LOCUS_16630 3987 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 4481 3984 gene locus_tag LOCUS_16640 4481 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 4803 4483 gene locus_tag LOCUS_16650 4803 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 >Feature sequence155 <1 1022 gene locus_tag LOCUS_16660 <1 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437109.1:MATE family efflux transporter 2298 1024 gene locus_tag LOCUS_16670 2298 1024 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964839.1 protein_id gnl|my_center|LOCUS_16670 3235 2411 gene locus_tag LOCUS_16680 3235 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 4801 3338 gene locus_tag LOCUS_16690 4801 3338 CDS product IS5-like element ISLca3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673997.1 protein_id gnl|my_center|LOCUS_16690 5166 4933 gene locus_tag LOCUS_16700 5166 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence156 375 1790 gene locus_tag LOCUS_16710 375 1790 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666065.1 protein_id gnl|my_center|LOCUS_16710 1787 2401 gene locus_tag LOCUS_16720 1787 2401 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134946.1 protein_id gnl|my_center|LOCUS_16720 2442 2975 gene locus_tag LOCUS_16730 2442 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 3021 3410 gene locus_tag LOCUS_16740 3021 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 3566 3697 gene locus_tag LOCUS_16750 3566 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 5176 3833 gene locus_tag LOCUS_16760 5176 3833 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272656.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence157 165 1844 gene locus_tag LOCUS_16770 gene pdcA 165 1844 CDS product c-di-GMP phosphodiesterase PdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902545.1 protein_id gnl|my_center|LOCUS_16770 2633 1848 gene locus_tag LOCUS_16780 2633 1848 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723203.1 protein_id gnl|my_center|LOCUS_16780 2816 4285 gene locus_tag LOCUS_16790 gene pap 2816 4285 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065389.1 protein_id gnl|my_center|LOCUS_16790 5024 4371 gene locus_tag LOCUS_16800 5024 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16800 >Feature sequence158 2112 943 gene locus_tag LOCUS_16810 2112 943 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966242.1 protein_id gnl|my_center|LOCUS_16810 3371 2262 gene locus_tag LOCUS_16820 3371 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 4341 3397 gene locus_tag LOCUS_16830 4341 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 4623 4405 gene locus_tag LOCUS_16840 4623 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence159 <1 1007 gene locus_tag LOCUS_16850 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679111.1:alpha-galactosidase 1062 2093 gene locus_tag LOCUS_16860 1062 2093 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459514.1 protein_id gnl|my_center|LOCUS_16860 3205 2126 gene locus_tag LOCUS_16870 3205 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 3300 4679 gene locus_tag LOCUS_16880 3300 4679 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_16880 4770 5024 gene locus_tag LOCUS_16890 4770 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 >Feature sequence160 1078 2574 gene locus_tag LOCUS_16900 gene malQ 1078 2574 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_16900 2658 3956 gene locus_tag LOCUS_16910 2658 3956 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399406.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence161 3686 162 gene locus_tag LOCUS_16920 3686 162 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963838.1 protein_id gnl|my_center|LOCUS_16920 4571 3783 gene locus_tag LOCUS_16930 4571 3783 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086430.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence162 941 318 gene locus_tag LOCUS_16940 941 318 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964741.1 protein_id gnl|my_center|LOCUS_16940 1260 1003 gene locus_tag LOCUS_16950 1260 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1508 1308 gene locus_tag LOCUS_16960 1508 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 2453 1659 gene locus_tag LOCUS_16970 2453 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 3050 2736 gene locus_tag LOCUS_16980 3050 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 3566 4882 gene locus_tag LOCUS_16990 3566 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence163 705 178 gene locus_tag LOCUS_17000 705 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 975 721 gene locus_tag LOCUS_17010 975 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1812 1087 gene locus_tag LOCUS_17020 1812 1087 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356899.1 protein_id gnl|my_center|LOCUS_17020 2203 1817 gene locus_tag LOCUS_17030 2203 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2435 2187 gene locus_tag LOCUS_17040 2435 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 2620 3684 gene locus_tag LOCUS_17050 2620 3684 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557353.1 protein_id gnl|my_center|LOCUS_17050 3695 4156 gene locus_tag LOCUS_17060 3695 4156 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966165.1 protein_id gnl|my_center|LOCUS_17060 4161 4790 gene locus_tag LOCUS_17070 gene upp 4161 4790 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence164 920 261 gene locus_tag LOCUS_17080 gene rpe 920 261 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965037.1 protein_id gnl|my_center|LOCUS_17080 1808 930 gene locus_tag LOCUS_17090 gene rsgA 1808 930 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_17090 3915 1816 gene locus_tag LOCUS_17100 gene pknB 3915 1816 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 protein_id gnl|my_center|LOCUS_17100 4656 3928 gene locus_tag LOCUS_17110 4656 3928 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence165 706 1092 gene locus_tag LOCUS_17120 706 1092 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461818.1 protein_id gnl|my_center|LOCUS_17120 1162 1299 gene locus_tag LOCUS_17130 1162 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1741 2100 gene locus_tag LOCUS_17140 1741 2100 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021109.1 protein_id gnl|my_center|LOCUS_17140 2114 3781 gene locus_tag LOCUS_17150 2114 3781 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence166 <1 1280 gene locus_tag LOCUS_17160 <1 1280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203684.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme 1277 2443 gene locus_tag LOCUS_17170 1277 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 2509 3186 gene locus_tag LOCUS_17180 2509 3186 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054641.1 protein_id gnl|my_center|LOCUS_17180 3167 3805 gene locus_tag LOCUS_17190 3167 3805 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740920.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence167 402 875 gene locus_tag LOCUS_17200 402 875 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 protein_id gnl|my_center|LOCUS_17200 862 1080 gene locus_tag LOCUS_17210 862 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1082 1441 gene locus_tag LOCUS_17220 1082 1441 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365398.1 protein_id gnl|my_center|LOCUS_17220 1511 1810 gene locus_tag LOCUS_17230 1511 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 1836 2129 gene locus_tag LOCUS_17240 1836 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 2147 3541 gene locus_tag LOCUS_17250 2147 3541 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680439.1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence168 434 1396 gene locus_tag LOCUS_17260 434 1396 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680111.1 protein_id gnl|my_center|LOCUS_17260 1421 2860 gene locus_tag LOCUS_17270 1421 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence169 1150 476 gene locus_tag LOCUS_17280 1150 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 2569 1151 gene locus_tag LOCUS_17290 2569 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 3797 2592 gene locus_tag LOCUS_17300 3797 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 4004 3816 gene locus_tag LOCUS_17310 4004 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 <4775 4145 gene locus_tag LOCUS_17320 <4775 4145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012027392.1:flotillin family protein >Feature sequence170 1030 98 gene locus_tag LOCUS_17330 1030 98 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986788.1 protein_id gnl|my_center|LOCUS_17330 1944 1033 gene locus_tag LOCUS_17340 gene truB 1944 1033 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_17340 2893 1946 gene locus_tag LOCUS_17350 2893 1946 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_17350 3260 2880 gene locus_tag LOCUS_17360 gene rbfA 3260 2880 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_17360 4747 3269 gene locus_tag LOCUS_17370 4747 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 >Feature sequence171 1313 384 gene locus_tag LOCUS_17380 gene gldA 1313 384 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_17380 3275 1491 gene locus_tag LOCUS_17390 3275 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 3532 4248 gene locus_tag LOCUS_17400 3532 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence172 <1 1907 gene locus_tag LOCUS_17410 <1 1907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965142.1:DNA mismatch repair protein MutS 1929 3866 gene locus_tag LOCUS_17420 gene mutL 1929 3866 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965141.1 protein_id gnl|my_center|LOCUS_17420 >Feature sequence173 388 1404 gene locus_tag LOCUS_17430 388 1404 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902246.1 protein_id gnl|my_center|LOCUS_17430 1427 2374 gene locus_tag LOCUS_17440 gene mreC 1427 2374 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438051.1 protein_id gnl|my_center|LOCUS_17440 2378 2899 gene locus_tag LOCUS_17450 gene mreD 2378 2899 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599731.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence174 1154 519 gene locus_tag LOCUS_17460 1154 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2229 1168 gene locus_tag LOCUS_17470 gene hrcA 2229 1168 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_17470 3624 2386 gene locus_tag LOCUS_17480 gene hemW 3624 2386 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099423.1 protein_id gnl|my_center|LOCUS_17480 <4681 3629 gene locus_tag LOCUS_17490 <4681 3629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003416556.1:translation elongation factor 4 >Feature sequence175 485 1264 gene locus_tag LOCUS_17500 485 1264 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460804.1 protein_id gnl|my_center|LOCUS_17500 2430 1330 gene locus_tag LOCUS_17510 2430 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2650 3972 gene locus_tag LOCUS_17520 gene rsxC 2650 3972 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence176 1002 121 gene locus_tag LOCUS_17530 1002 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1439 999 gene locus_tag LOCUS_17540 1439 999 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963521.1 protein_id gnl|my_center|LOCUS_17540 1678 2625 gene locus_tag LOCUS_17550 1678 2625 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095592.1 protein_id gnl|my_center|LOCUS_17550 2618 4141 gene locus_tag LOCUS_17560 2618 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence177 1425 94 gene locus_tag LOCUS_17570 1425 94 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_17570 1606 2463 gene locus_tag LOCUS_17580 gene nudC 1606 2463 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102051.1 protein_id gnl|my_center|LOCUS_17580 2604 3947 gene locus_tag LOCUS_17590 2604 3947 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036258.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence178 113 760 gene locus_tag LOCUS_17600 113 760 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014076.1 protein_id gnl|my_center|LOCUS_17600 1617 2804 gene locus_tag LOCUS_17610 1617 2804 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967203.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence179 130 57 gene locus_tag LOCUS_t00160 130 57 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2250 217 gene locus_tag LOCUS_17620 2250 217 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_17620 2407 2907 gene locus_tag LOCUS_17630 2407 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 3380 2958 gene locus_tag LOCUS_17640 3380 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 3465 4247 gene locus_tag LOCUS_17650 gene murI 3465 4247 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475984.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence180 1595 123 gene locus_tag LOCUS_17660 1595 123 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_17660 2432 1596 gene locus_tag LOCUS_17670 gene dapF 2432 1596 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_17670 2598 3440 gene locus_tag LOCUS_17680 2598 3440 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966103.1 protein_id gnl|my_center|LOCUS_17680 <4357 3453 gene locus_tag LOCUS_17690 <4357 3453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393891.1:putative manganese-dependent inorganic diphosphatase >Feature sequence181 <1 687 gene locus_tag LOCUS_17700 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964227.1:methyl-accepting chemotaxis protein 773 2005 gene locus_tag LOCUS_17710 gene argJ 773 2005 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_17710 2063 2863 gene locus_tag LOCUS_17720 gene proC 2063 2863 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 protein_id gnl|my_center|LOCUS_17720 2936 3181 gene locus_tag LOCUS_17730 2936 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 3657 3214 gene locus_tag LOCUS_17740 3657 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 3837 3910 gene locus_tag LOCUS_t00170 3837 3910 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence182 3 1268 gene locus_tag LOCUS_17750 3 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 2013 1276 gene locus_tag LOCUS_17760 2013 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 2150 3562 gene locus_tag LOCUS_17770 2150 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence183 518 2197 gene locus_tag LOCUS_17780 518 2197 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_17780 2222 3094 gene locus_tag LOCUS_17790 2222 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 3098 3685 gene locus_tag LOCUS_17800 3098 3685 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889235.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence184 1383 889 gene locus_tag LOCUS_17810 1383 889 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966286.1 protein_id gnl|my_center|LOCUS_17810 2252 1404 gene locus_tag LOCUS_17820 2252 1404 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_17820 3231 2317 gene locus_tag LOCUS_17830 3231 2317 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948398.1 protein_id gnl|my_center|LOCUS_17830 3350 4054 gene locus_tag LOCUS_17840 3350 4054 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence185 536 360 gene locus_tag LOCUS_17850 536 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 1745 711 gene locus_tag LOCUS_17860 1745 711 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261738.1 protein_id gnl|my_center|LOCUS_17860 2599 1979 gene locus_tag LOCUS_17870 2599 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 3311 2631 gene locus_tag LOCUS_17880 3311 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 3879 3331 gene locus_tag LOCUS_17890 3879 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence186 169 696 gene locus_tag LOCUS_17900 169 696 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_17900 698 2104 gene locus_tag LOCUS_17910 698 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 2261 2344 gene locus_tag LOCUS_t00180 2261 2344 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2555 3898 gene locus_tag LOCUS_17920 gene ganB 2555 3898 CDS product arabinogalactan endo-beta-1,4-galactanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243128.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence187 1999 1526 gene locus_tag LOCUS_17930 1999 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 2961 1996 gene locus_tag LOCUS_17940 gene rsmH 2961 1996 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_17940 3395 2964 gene locus_tag LOCUS_17950 gene mraZ 3395 2964 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965432.1 protein_id gnl|my_center|LOCUS_17950 <4175 3635 gene locus_tag LOCUS_17960 <4175 3635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003242661.1:prolipoprotein diacylglyceryl transferase >Feature sequence188 1294 191 gene locus_tag LOCUS_17970 1294 191 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_17970 1700 1392 gene locus_tag LOCUS_17980 1700 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2807 1743 gene locus_tag LOCUS_17990 2807 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 3171 2959 gene locus_tag LOCUS_18000 3171 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 4031 3333 gene locus_tag LOCUS_18010 4031 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence189 793 656 gene locus_tag LOCUS_18020 793 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 1621 866 gene locus_tag LOCUS_18030 1621 866 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 protein_id gnl|my_center|LOCUS_18030 2448 1612 gene locus_tag LOCUS_18040 2448 1612 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723600.1 protein_id gnl|my_center|LOCUS_18040 4061 2562 gene locus_tag LOCUS_18050 gene spoIVA 4061 2562 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944577.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence190 75 1487 gene locus_tag LOCUS_18060 75 1487 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104219.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18060 1543 1701 gene locus_tag LOCUS_18070 1543 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1706 2872 gene locus_tag LOCUS_18080 1706 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence191 402 698 gene locus_tag LOCUS_18090 402 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 658 1182 gene locus_tag LOCUS_18100 658 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 1185 1814 gene locus_tag LOCUS_18110 1185 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1882 3474 gene locus_tag LOCUS_18120 1882 3474 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_18120 3492 3818 gene locus_tag LOCUS_18130 gene trxA 3492 3818 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence192 <4062 3503 gene locus_tag LOCUS_18140 <4062 3503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965103.1:flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase >Feature sequence193 1119 2852 gene locus_tag LOCUS_18150 1119 2852 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963863.1 protein_id gnl|my_center|LOCUS_18150 2993 3169 gene locus_tag LOCUS_18160 gene rpsU 2993 3169 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence194 765 412 gene locus_tag LOCUS_18170 gene rplS 765 412 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_18170 2366 936 gene locus_tag LOCUS_18180 2366 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 2887 2381 gene locus_tag LOCUS_18190 gene rimM 2887 2381 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_18190 3218 2988 gene locus_tag LOCUS_18200 3218 2988 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_18200 3486 3241 gene locus_tag LOCUS_18210 gene rpsP 3486 3241 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220815.1 protein_id gnl|my_center|LOCUS_18210 >Feature sequence195 <1 1387 gene locus_tag LOCUS_18220 <1 1387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243833.1:two-component system sensor histidine kinase YesM 1438 3027 gene locus_tag LOCUS_18230 1438 3027 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723174.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence196 195 2102 gene locus_tag LOCUS_18240 gene treP 195 2102 CDS product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514332.1 protein_id gnl|my_center|LOCUS_18240 2113 3765 gene locus_tag LOCUS_18250 gene treC 2113 3765 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986524.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence197 1417 3078 gene locus_tag LOCUS_18260 gene hcp 1417 3078 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966698.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence198 751 1377 gene locus_tag LOCUS_18270 751 1377 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422086.1 protein_id gnl|my_center|LOCUS_18270 1451 1936 gene locus_tag LOCUS_18280 gene cobO 1451 1936 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942222.1 protein_id gnl|my_center|LOCUS_18280 2226 3113 gene locus_tag LOCUS_18290 gene dapA 2226 3113 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence199 >Feature sequence200 3264 2077 gene locus_tag LOCUS_18300 3264 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 >Feature sequence201 299 475 gene locus_tag LOCUS_18310 299 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 521 694 gene locus_tag LOCUS_18320 521 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 1638 727 gene locus_tag LOCUS_18330 1638 727 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261960.1 protein_id gnl|my_center|LOCUS_18330 3172 2210 gene locus_tag LOCUS_18340 3172 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 <3724 3186 gene locus_tag LOCUS_18350 <3724 3186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081360963.1:sodium:proton antiporter >Feature sequence202 163 235 gene locus_tag LOCUS_t00190 163 235 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 628 1332 gene locus_tag LOCUS_18360 628 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1329 2231 gene locus_tag LOCUS_18370 1329 2231 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263217.1 protein_id gnl|my_center|LOCUS_18370 2512 2745 gene locus_tag LOCUS_18380 2512 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence203 728 3 gene locus_tag LOCUS_18390 728 3 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860778.1 protein_id gnl|my_center|LOCUS_18390 2176 725 gene locus_tag LOCUS_18400 2176 725 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987157.1 protein_id gnl|my_center|LOCUS_18400 2958 2764 gene locus_tag LOCUS_18410 2958 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 3709 3062 gene locus_tag LOCUS_18420 3709 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence204 3 827 gene locus_tag LOCUS_18430 3 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 831 1352 gene locus_tag LOCUS_18440 gene nrdG 831 1352 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_18440 1355 1696 gene locus_tag LOCUS_18450 1355 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1693 2862 gene locus_tag LOCUS_18460 1693 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 <3686 2926 gene locus_tag LOCUS_18470 <3686 2926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461003.1:aldolase catalytic domain-containing protein >Feature sequence205 349 56 gene locus_tag LOCUS_18480 349 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18480 928 578 gene locus_tag LOCUS_18490 928 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1621 1091 gene locus_tag LOCUS_18500 gene raiA 1621 1091 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_18500 2694 1735 gene locus_tag LOCUS_18510 gene rsiV 2694 1735 CDS product anti-sigma-V factor RsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398482.1 protein_id gnl|my_center|LOCUS_18510 3173 2691 gene locus_tag LOCUS_18520 3173 2691 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436663.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence206 1643 768 gene locus_tag LOCUS_18530 1643 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 >Feature sequence207 175 723 gene locus_tag LOCUS_18540 175 723 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_18540 1515 772 gene locus_tag LOCUS_18550 1515 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 2797 1517 gene locus_tag LOCUS_18560 2797 1517 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856534.1 protein_id gnl|my_center|LOCUS_18560 3332 2847 gene locus_tag LOCUS_18570 3332 2847 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948692.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence208 <1 554 gene locus_tag LOCUS_18580 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258123.1:dipeptide ABC transporter ATP-binding protein 607 2340 gene locus_tag LOCUS_18590 607 2340 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812007.1 protein_id gnl|my_center|LOCUS_18590 2708 2412 gene locus_tag LOCUS_18600 2708 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 2806 3531 gene locus_tag LOCUS_18610 2806 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence209 2953 755 gene locus_tag LOCUS_18620 gene tlpA 2953 755 CDS product methyl-accepting chemotaxis protein TlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243846.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence210 55 738 gene locus_tag LOCUS_18630 55 738 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929879.1 protein_id gnl|my_center|LOCUS_18630 741 1967 gene locus_tag LOCUS_18640 741 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1995 2447 gene locus_tag LOCUS_18650 1995 2447 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060880.1 protein_id gnl|my_center|LOCUS_18650 2466 3389 gene locus_tag LOCUS_18660 2466 3389 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence211 3 2564 gene locus_tag LOCUS_18670 3 2564 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106612643.1 protein_id gnl|my_center|LOCUS_18670 2521 3486 gene locus_tag LOCUS_18680 2521 3486 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence212 1 804 gene locus_tag LOCUS_18690 1 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 817 2193 gene locus_tag LOCUS_18700 gene melB 817 2193 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028114.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence213 687 184 gene locus_tag LOCUS_18710 687 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 841 1887 gene locus_tag LOCUS_18720 841 1887 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_18720 2199 1948 gene locus_tag LOCUS_18730 2199 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 3247 2201 gene locus_tag LOCUS_18740 3247 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence214 389 51 gene locus_tag LOCUS_18750 gene cas2 389 51 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384683.1 protein_id gnl|my_center|LOCUS_18750 1392 361 gene locus_tag LOCUS_18760 gene cas1c 1392 361 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922509.1 protein_id gnl|my_center|LOCUS_18760 2069 1389 gene locus_tag LOCUS_18770 gene cas4 2069 1389 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_18770 2952 2089 gene locus_tag LOCUS_18780 gene cas7c 2952 2089 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence215 67 1572 gene locus_tag LOCUS_18790 gene cobA 67 1572 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898657.1 protein_id gnl|my_center|LOCUS_18790 >Feature sequence216 <1 1066 gene locus_tag LOCUS_18800 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048012.1:DUF1538 domain-containing protein 1092 1790 gene locus_tag LOCUS_18810 1092 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence217 <1 754 gene locus_tag LOCUS_18820 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003393780.1:signal recognition particle-docking protein FtsY 732 1949 gene locus_tag LOCUS_18830 gene ilvA 732 1949 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_18830 2017 2370 gene locus_tag LOCUS_18840 2017 2370 CDS product YlxM family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392480.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence218 394 1680 gene locus_tag LOCUS_18850 gene hisD 394 1680 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949111.1 protein_id gnl|my_center|LOCUS_18850 1714 2304 gene locus_tag LOCUS_18860 gene hisB 1714 2304 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964256.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence219 137 2323 gene locus_tag LOCUS_18870 gene nrdD 137 2323 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263171.1 protein_id gnl|my_center|LOCUS_18870 2327 3205 gene locus_tag LOCUS_18880 gene srtB 2327 3205 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242427.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence220 2807 1914 gene locus_tag LOCUS_18890 gene hemC 2807 1914 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861963.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence221 1601 396 gene locus_tag LOCUS_18900 1601 396 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948019.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence222 1271 552 gene locus_tag LOCUS_18910 1271 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 1457 1332 gene locus_tag LOCUS_18920 1457 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 1733 2647 gene locus_tag LOCUS_18930 gene trxB 1733 2647 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681998.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence223 216 725 gene locus_tag LOCUS_18940 216 725 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_18940 1297 791 gene locus_tag LOCUS_18950 gene ilvN 1297 791 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006862451.1 protein_id gnl|my_center|LOCUS_18950 3029 1308 gene locus_tag LOCUS_18960 gene ilvB 3029 1308 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458814.1 protein_id gnl|my_center|LOCUS_18960 >Feature sequence224 2287 953 gene locus_tag LOCUS_18970 2287 953 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017864221.1 protein_id gnl|my_center|LOCUS_18970 3059 2391 gene locus_tag LOCUS_18980 3059 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence225 <1 1758 gene locus_tag LOCUS_18990 <1 1758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986733.1:aminopeptidase P family N-terminal domain-containing protein >Feature sequence226 1429 236 gene locus_tag LOCUS_19000 1429 236 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964253.1 protein_id gnl|my_center|LOCUS_19000 2056 1523 gene locus_tag LOCUS_19010 gene recU 2056 1523 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460152.1 protein_id gnl|my_center|LOCUS_19010 <3035 2060 gene locus_tag LOCUS_19020 <3035 2060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949019.1:RluA family pseudouridine synthase >Feature sequence227 2437 647 gene locus_tag LOCUS_19030 2437 647 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294013.1 protein_id gnl|my_center|LOCUS_19030 2689 2555 gene locus_tag LOCUS_19040 2689 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence228 1271 78 gene locus_tag LOCUS_19050 gene coaBC 1271 78 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047883.1 protein_id gnl|my_center|LOCUS_19050 1711 1358 gene locus_tag LOCUS_19060 1711 1358 CDS product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775211.1 protein_id gnl|my_center|LOCUS_19060 2688 1867 gene locus_tag LOCUS_19070 2688 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 >Feature sequence229 1088 129 gene locus_tag LOCUS_19080 1088 129 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_19080 1156 2400 gene locus_tag LOCUS_19090 1156 2400 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence230 1004 144 gene locus_tag LOCUS_19100 gene atpG 1004 144 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_19100 2540 1032 gene locus_tag LOCUS_19110 gene atpA 2540 1032 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462231.1 protein_id gnl|my_center|LOCUS_19110 >Feature sequence231 2362 1181 gene locus_tag LOCUS_19120 2362 1181 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence232 1185 403 gene locus_tag LOCUS_19130 1185 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 1099 1449 gene locus_tag LOCUS_19140 1099 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 1451 1624 gene locus_tag LOCUS_19150 1451 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 1678 2007 gene locus_tag LOCUS_19160 1678 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 2053 2232 gene locus_tag LOCUS_19170 2053 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 2401 2754 gene locus_tag LOCUS_19180 2401 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence233 <1 973 gene locus_tag LOCUS_19190 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986979.1:UDP-galactopyranose mutase 2334 1036 gene locus_tag LOCUS_19200 gene fliD 2334 1036 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073119.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence234 272 865 gene locus_tag LOCUS_19210 272 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19210 >Feature sequence235 1057 893 gene locus_tag LOCUS_19220 1057 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 1708 1079 gene locus_tag LOCUS_19230 1708 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19230 2474 1701 gene locus_tag LOCUS_19240 2474 1701 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619138.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence236 2467 599 gene locus_tag LOCUS_19250 2467 599 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence237 2049 745 gene locus_tag LOCUS_19260 gene thiC 2049 745 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966296.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence238 <1 663 gene locus_tag LOCUS_19270 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001000816.1:ATP-dependent DNA helicase RecG 933 736 gene locus_tag LOCUS_19280 933 736 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_19280 <2564 1013 gene locus_tag LOCUS_19290 <2564 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861612.1:NFACT RNA binding domain-containing protein >Feature sequence239 447 73 gene locus_tag LOCUS_19300 447 73 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668289.1 protein_id gnl|my_center|LOCUS_19300 1317 478 gene locus_tag LOCUS_19310 1317 478 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986367.1 protein_id gnl|my_center|LOCUS_19310 2032 1325 gene locus_tag LOCUS_19320 2032 1325 CDS product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966854.1 protein_id gnl|my_center|LOCUS_19320 2171 2099 gene locus_tag LOCUS_t00200 2171 2099 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38