>Feature sequence01 1278 817 gene locus_tag LOCUS_00010 gene pal 1278 817 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596964.1 protein_id gnl|my_center|LOCUS_00010 3197 1458 gene locus_tag LOCUS_00020 3197 1458 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 protein_id gnl|my_center|LOCUS_00020 3608 3222 gene locus_tag LOCUS_00030 3608 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4535 3618 gene locus_tag LOCUS_00040 gene rsmH 4535 3618 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886328.1 protein_id gnl|my_center|LOCUS_00040 5005 4535 gene locus_tag LOCUS_00050 5005 4535 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388714.1 protein_id gnl|my_center|LOCUS_00050 5267 6385 gene locus_tag LOCUS_00060 gene dnaJ 5267 6385 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626618.1 protein_id gnl|my_center|LOCUS_00060 6977 6432 gene locus_tag LOCUS_00070 6977 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7282 7061 gene locus_tag LOCUS_00080 gene yacG 7282 7061 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537894.1 protein_id gnl|my_center|LOCUS_00080 8439 7282 gene locus_tag LOCUS_00090 8439 7282 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003024353.1 protein_id gnl|my_center|LOCUS_00090 9014 8436 gene locus_tag LOCUS_00100 9014 8436 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530196.1 protein_id gnl|my_center|LOCUS_00100 9449 9018 gene locus_tag LOCUS_00110 gene dksA 9449 9018 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390474.1 protein_id gnl|my_center|LOCUS_00110 10077 9547 gene locus_tag LOCUS_00120 10077 9547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10221 10760 gene locus_tag LOCUS_00130 10221 10760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 10770 11225 gene locus_tag LOCUS_00140 10770 11225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 13810 11318 gene locus_tag LOCUS_00150 13810 11318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14456 13971 gene locus_tag LOCUS_00160 gene rplI 14456 13971 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338021.1 protein_id gnl|my_center|LOCUS_00160 14699 14475 gene locus_tag LOCUS_00170 gene rpsR 14699 14475 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615089.1 protein_id gnl|my_center|LOCUS_00170 15043 14699 gene locus_tag LOCUS_00180 15043 14699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 15235 16797 gene locus_tag LOCUS_00190 15235 16797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 16882 17202 gene locus_tag LOCUS_00200 16882 17202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 17208 18728 gene locus_tag LOCUS_00210 17208 18728 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391336.1 protein_id gnl|my_center|LOCUS_00210 18740 20788 gene locus_tag LOCUS_00220 18740 20788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21224 20859 gene locus_tag LOCUS_00230 21224 20859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 21632 21237 gene locus_tag LOCUS_00240 21632 21237 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722273.1 protein_id gnl|my_center|LOCUS_00240 24319 21635 gene locus_tag LOCUS_00250 gene mutS 24319 21635 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391288.1 protein_id gnl|my_center|LOCUS_00250 24414 25829 gene locus_tag LOCUS_00260 24414 25829 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391290.1 protein_id gnl|my_center|LOCUS_00260 26528 25830 gene locus_tag LOCUS_00270 26528 25830 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337694.1 protein_id gnl|my_center|LOCUS_00270 28405 26540 gene locus_tag LOCUS_00280 gene ftsH 28405 26540 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388853.1 protein_id gnl|my_center|LOCUS_00280 30135 28498 gene locus_tag LOCUS_00290 gene recN 30135 28498 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388695.1 protein_id gnl|my_center|LOCUS_00290 30914 30177 gene locus_tag LOCUS_00300 30914 30177 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388696.1 protein_id gnl|my_center|LOCUS_00300 31773 30916 gene locus_tag LOCUS_00310 gene lpxC 31773 30916 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596080.1 protein_id gnl|my_center|LOCUS_00310 32984 32253 gene locus_tag LOCUS_00320 32984 32253 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388454.1 protein_id gnl|my_center|LOCUS_00320 33474 32992 gene locus_tag LOCUS_00330 33474 32992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 34097 33489 gene locus_tag LOCUS_00340 34097 33489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 34840 34172 gene locus_tag LOCUS_00350 gene cysE 34840 34172 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285050.1 protein_id gnl|my_center|LOCUS_00350 34931 35704 gene locus_tag LOCUS_00360 34931 35704 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389783.1 protein_id gnl|my_center|LOCUS_00360 36244 35705 gene locus_tag LOCUS_00370 36244 35705 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388397.1 protein_id gnl|my_center|LOCUS_00370 36316 37239 gene locus_tag LOCUS_00380 36316 37239 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391023.1 protein_id gnl|my_center|LOCUS_00380 37304 37921 gene locus_tag LOCUS_00390 37304 37921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 38337 37927 gene locus_tag LOCUS_00400 38337 37927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 38557 40785 gene locus_tag LOCUS_00410 gene ptsP 38557 40785 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388503.1 protein_id gnl|my_center|LOCUS_00410 40831 41751 gene locus_tag LOCUS_00420 40831 41751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 41828 43060 gene locus_tag LOCUS_00430 gene hisS 41828 43060 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388506.1 protein_id gnl|my_center|LOCUS_00430 43062 44135 gene locus_tag LOCUS_00440 gene prfA 43062 44135 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597801.1 protein_id gnl|my_center|LOCUS_00440 44210 44818 gene locus_tag LOCUS_00450 gene clpP 44210 44818 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389425.1 protein_id gnl|my_center|LOCUS_00450 44829 46103 gene locus_tag LOCUS_00460 gene clpX 44829 46103 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770751.1 protein_id gnl|my_center|LOCUS_00460 47232 46156 gene locus_tag LOCUS_00470 gene rlmN 47232 46156 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391076.1 protein_id gnl|my_center|LOCUS_00470 47744 47232 gene locus_tag LOCUS_00480 47744 47232 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 protein_id gnl|my_center|LOCUS_00480 47853 49109 gene locus_tag LOCUS_00490 47853 49109 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972173.1 protein_id gnl|my_center|LOCUS_00490 49695 49075 gene locus_tag LOCUS_00500 49695 49075 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385542.1 protein_id gnl|my_center|LOCUS_00500 50822 49704 gene locus_tag LOCUS_00510 50822 49704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 50989 52527 gene locus_tag LOCUS_00520 gene gpmI 50989 52527 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388989.1 protein_id gnl|my_center|LOCUS_00520 52555 53790 gene locus_tag LOCUS_00530 52555 53790 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083265.1 protein_id gnl|my_center|LOCUS_00530 53804 55138 gene locus_tag LOCUS_00540 53804 55138 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_00540 55139 55600 gene locus_tag LOCUS_00550 55139 55600 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360600.1 protein_id gnl|my_center|LOCUS_00550 56323 55631 gene locus_tag LOCUS_00560 56323 55631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 57715 56342 gene locus_tag LOCUS_00570 gene radA 57715 56342 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388165.1 protein_id gnl|my_center|LOCUS_00570 58483 57719 gene locus_tag LOCUS_00580 58483 57719 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_00580 59284 58496 gene locus_tag LOCUS_00590 59284 58496 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_00590 59760 59338 gene locus_tag LOCUS_00600 59760 59338 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918128.1 protein_id gnl|my_center|LOCUS_00600 60223 59771 gene locus_tag LOCUS_00610 gene tsaE 60223 59771 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596691.1 protein_id gnl|my_center|LOCUS_00610 61358 60228 gene locus_tag LOCUS_00620 61358 60228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 62282 61374 gene locus_tag LOCUS_00630 62282 61374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 62738 62301 gene locus_tag LOCUS_00640 62738 62301 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290819.1 protein_id gnl|my_center|LOCUS_00640 62868 64673 gene locus_tag LOCUS_00650 gene lepA 62868 64673 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626581.1 protein_id gnl|my_center|LOCUS_00650 65107 64697 gene locus_tag LOCUS_00660 65107 64697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 65192 65860 gene locus_tag LOCUS_00670 65192 65860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 66537 65857 gene locus_tag LOCUS_00680 66537 65857 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528482.1 protein_id gnl|my_center|LOCUS_00680 66692 66997 gene locus_tag LOCUS_00690 66692 66997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 67478 67068 gene locus_tag LOCUS_00700 67478 67068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 67928 67626 gene locus_tag LOCUS_00710 67928 67626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 68617 68186 gene locus_tag LOCUS_00720 68617 68186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 69069 68698 gene locus_tag LOCUS_00730 69069 68698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 69750 69205 gene locus_tag LOCUS_00740 69750 69205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 70406 69936 gene locus_tag LOCUS_00750 gene secB 70406 69936 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391357.1 protein_id gnl|my_center|LOCUS_00750 70530 71165 gene locus_tag LOCUS_00760 70530 71165 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968290.1 protein_id gnl|my_center|LOCUS_00760 71166 72341 gene locus_tag LOCUS_00770 71166 72341 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391354.1 protein_id gnl|my_center|LOCUS_00770 72334 72858 gene locus_tag LOCUS_00780 72334 72858 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528720.1 protein_id gnl|my_center|LOCUS_00780 73621 72863 gene locus_tag LOCUS_00790 73621 72863 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_00790 73706 74368 gene locus_tag LOCUS_00800 gene gmk 73706 74368 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086862.1 protein_id gnl|my_center|LOCUS_00800 74372 75301 gene locus_tag LOCUS_00810 gene cysK 74372 75301 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965533.1 protein_id gnl|my_center|LOCUS_00810 75357 76463 gene locus_tag LOCUS_00820 gene lptG 75357 76463 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720056.1 protein_id gnl|my_center|LOCUS_00820 77711 76467 gene locus_tag LOCUS_00830 gene aaxA 77711 76467 CDS product porin AaxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883666.1 protein_id gnl|my_center|LOCUS_00830 77844 78506 gene locus_tag LOCUS_00840 gene ruvA 77844 78506 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388843.1 protein_id gnl|my_center|LOCUS_00840 78510 79562 gene locus_tag LOCUS_00850 gene ruvB 78510 79562 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388844.1 protein_id gnl|my_center|LOCUS_00850 79565 80014 gene locus_tag LOCUS_00860 gene ybgC 79565 80014 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693784.1 protein_id gnl|my_center|LOCUS_00860 80017 80427 gene locus_tag LOCUS_00870 80017 80427 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854931.1 protein_id gnl|my_center|LOCUS_00870 80548 80472 gene locus_tag LOCUS_t00010 80548 80472 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 81708 80590 gene locus_tag LOCUS_00880 81708 80590 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_00880 81801 82310 gene locus_tag LOCUS_00890 81801 82310 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527882.1 protein_id gnl|my_center|LOCUS_00890 83273 82311 gene locus_tag LOCUS_00900 83273 82311 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391427.1 protein_id gnl|my_center|LOCUS_00900 83639 83430 gene locus_tag LOCUS_00910 83639 83430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 83914 83627 gene locus_tag LOCUS_00920 83914 83627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 83795 86038 gene locus_tag LOCUS_00930 gene glgB 83795 86038 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_00930 86042 88114 gene locus_tag LOCUS_00940 gene glgX 86042 88114 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389296.1 protein_id gnl|my_center|LOCUS_00940 88125 90275 gene locus_tag LOCUS_00950 gene malQ 88125 90275 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817357.1 protein_id gnl|my_center|LOCUS_00950 90350 90754 gene locus_tag LOCUS_00960 90350 90754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 90836 91360 gene locus_tag LOCUS_00970 90836 91360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 91371 91970 gene locus_tag LOCUS_00980 91371 91970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 93433 92039 gene locus_tag LOCUS_00990 gene der 93433 92039 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532848.1 protein_id gnl|my_center|LOCUS_00990 94758 93442 gene locus_tag LOCUS_01000 94758 93442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 95547 94780 gene locus_tag LOCUS_01010 95547 94780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 96804 95629 gene locus_tag LOCUS_01020 96804 95629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 96954 98087 gene locus_tag LOCUS_01030 96954 98087 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327568.1 protein_id gnl|my_center|LOCUS_01030 98103 100076 gene locus_tag LOCUS_01040 gene tkt 98103 100076 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529250.1 protein_id gnl|my_center|LOCUS_01040 100403 100825 gene locus_tag LOCUS_01050 100403 100825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 101102 100830 gene locus_tag LOCUS_01060 101102 100830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 102555 101104 gene locus_tag LOCUS_01070 gene atpD 102555 101104 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388981.1 protein_id gnl|my_center|LOCUS_01070 103486 102569 gene locus_tag LOCUS_01080 103486 102569 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389782.1 protein_id gnl|my_center|LOCUS_01080 105050 103500 gene locus_tag LOCUS_01090 gene atpA 105050 103500 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388979.1 protein_id gnl|my_center|LOCUS_01090 105603 105052 gene locus_tag LOCUS_01100 105603 105052 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169539095.1 protein_id gnl|my_center|LOCUS_01100 107801 105624 gene locus_tag LOCUS_01110 107801 105624 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972445.1 protein_id gnl|my_center|LOCUS_01110 108284 107814 gene locus_tag LOCUS_01120 108284 107814 CDS product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312611.1 protein_id gnl|my_center|LOCUS_01120 108415 109656 gene locus_tag LOCUS_01130 108415 109656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 109755 110252 gene locus_tag LOCUS_01140 109755 110252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 110366 112513 gene locus_tag LOCUS_01150 110366 112513 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193385014.1 protein_id gnl|my_center|LOCUS_01150 112566 113060 gene locus_tag LOCUS_01160 112566 113060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 113038 113415 gene locus_tag LOCUS_01170 gene acpS 113038 113415 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635063.1 protein_id gnl|my_center|LOCUS_01170 113472 114209 gene locus_tag LOCUS_01180 gene lepB 113472 114209 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389606.1 protein_id gnl|my_center|LOCUS_01180 114219 114884 gene locus_tag LOCUS_01190 gene rnc 114219 114884 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087822.1 protein_id gnl|my_center|LOCUS_01190 114871 115800 gene locus_tag LOCUS_01200 gene era 114871 115800 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974885.1 protein_id gnl|my_center|LOCUS_01200 116811 116233 gene locus_tag LOCUS_01210 116811 116233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 117184 117108 gene locus_tag LOCUS_t00020 117184 117108 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 118896 117256 gene locus_tag LOCUS_01220 118896 117256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 119818 118913 gene locus_tag LOCUS_01230 119818 118913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 121259 119895 gene locus_tag LOCUS_01240 gene tig 121259 119895 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922580.1 protein_id gnl|my_center|LOCUS_01240 121390 121306 gene locus_tag LOCUS_t00030 121390 121306 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 121531 123117 gene locus_tag LOCUS_01250 121531 123117 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390250.1 protein_id gnl|my_center|LOCUS_01250 123309 123620 gene locus_tag LOCUS_01260 123309 123620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 123625 125226 gene locus_tag LOCUS_01270 123625 125226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 125239 125835 gene locus_tag LOCUS_01280 125239 125835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 125877 126965 gene locus_tag LOCUS_01290 125877 126965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 127288 127046 gene locus_tag LOCUS_01300 127288 127046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 128427 127378 gene locus_tag LOCUS_01310 128427 127378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 128565 129167 gene locus_tag LOCUS_01320 128565 129167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 129172 129891 gene locus_tag LOCUS_01330 129172 129891 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439170.1 protein_id gnl|my_center|LOCUS_01330 130986 129895 gene locus_tag LOCUS_01340 130986 129895 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020079396.1 protein_id gnl|my_center|LOCUS_01340 133302 131110 gene locus_tag LOCUS_01350 133302 131110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 134861 133326 gene locus_tag LOCUS_01360 134861 133326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 135409 134921 gene locus_tag LOCUS_01370 135409 134921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 >Feature sequence02 1290 349 gene locus_tag LOCUS_01380 1290 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 1584 1300 gene locus_tag LOCUS_01390 1584 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 1739 2656 gene locus_tag LOCUS_01400 1739 2656 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918341.1 protein_id gnl|my_center|LOCUS_01400 2758 3633 gene locus_tag LOCUS_01410 gene rpoH 2758 3633 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388865.1 protein_id gnl|my_center|LOCUS_01410 4363 3605 gene locus_tag LOCUS_01420 4363 3605 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390702.1 protein_id gnl|my_center|LOCUS_01420 4950 4381 gene locus_tag LOCUS_01430 4950 4381 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440210.1 protein_id gnl|my_center|LOCUS_01430 5109 7766 gene locus_tag LOCUS_01440 5109 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 8239 7763 gene locus_tag LOCUS_01450 gene rnhA 8239 7763 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 protein_id gnl|my_center|LOCUS_01450 9305 8241 gene locus_tag LOCUS_01460 9305 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 10627 9365 gene locus_tag LOCUS_01470 10627 9365 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_01470 10713 11381 gene locus_tag LOCUS_01480 gene elbB 10713 11381 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390979.1 protein_id gnl|my_center|LOCUS_01480 11416 12849 gene locus_tag LOCUS_01490 gene gltX 11416 12849 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_01490 12938 13765 gene locus_tag LOCUS_01500 gene lpxA 12938 13765 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919777.1 protein_id gnl|my_center|LOCUS_01500 13874 15094 gene locus_tag LOCUS_01510 13874 15094 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531365.1 protein_id gnl|my_center|LOCUS_01510 15190 17655 gene locus_tag LOCUS_01520 15190 17655 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_01520 17754 18779 gene locus_tag LOCUS_01530 gene prfB 17754 18779 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148265477.1 protein_id gnl|my_center|LOCUS_01530 18772 19590 gene locus_tag LOCUS_01540 18772 19590 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444002.1 protein_id gnl|my_center|LOCUS_01540 19606 22806 gene locus_tag LOCUS_01550 19606 22806 CDS product AsmA-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389790.1 protein_id gnl|my_center|LOCUS_01550 22803 23294 gene locus_tag LOCUS_01560 22803 23294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 23515 23273 gene locus_tag LOCUS_01570 23515 23273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 24117 23500 gene locus_tag LOCUS_01580 24117 23500 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083957.1 protein_id gnl|my_center|LOCUS_01580 24278 24613 gene locus_tag LOCUS_01590 24278 24613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 25107 25430 gene locus_tag LOCUS_01600 25107 25430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 25417 26907 gene locus_tag LOCUS_01610 25417 26907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 26916 27173 gene locus_tag LOCUS_01620 26916 27173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 27173 27592 gene locus_tag LOCUS_01630 27173 27592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 27597 27926 gene locus_tag LOCUS_01640 27597 27926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 27926 28129 gene locus_tag LOCUS_01650 27926 28129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 28132 29637 gene locus_tag LOCUS_01660 28132 29637 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064788614.1 protein_id gnl|my_center|LOCUS_01660 29639 29860 gene locus_tag LOCUS_01670 29639 29860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 29877 30566 gene locus_tag LOCUS_01680 29877 30566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 30614 31444 gene locus_tag LOCUS_01690 30614 31444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 31453 31722 gene locus_tag LOCUS_01700 31453 31722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 31789 32358 gene locus_tag LOCUS_01710 31789 32358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 32355 34253 gene locus_tag LOCUS_01720 32355 34253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 34278 34655 gene locus_tag LOCUS_01730 34278 34655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 34667 34861 gene locus_tag LOCUS_01740 34667 34861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 35707 34877 gene locus_tag LOCUS_01750 35707 34877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 37150 35798 gene locus_tag LOCUS_01760 gene trmFO 37150 35798 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389510.1 protein_id gnl|my_center|LOCUS_01760 37266 38369 gene locus_tag LOCUS_01770 37266 38369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 38379 38990 gene locus_tag LOCUS_01780 38379 38990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 39864 39028 gene locus_tag LOCUS_01790 gene kdsA 39864 39028 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087568.1 protein_id gnl|my_center|LOCUS_01790 40509 39961 gene locus_tag LOCUS_01800 40509 39961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 41533 40598 gene locus_tag LOCUS_01810 41533 40598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 44112 41530 gene locus_tag LOCUS_01820 44112 41530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 44811 44125 gene locus_tag LOCUS_01830 44811 44125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 44958 45482 gene locus_tag LOCUS_01840 44958 45482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 45475 45936 gene locus_tag LOCUS_01850 45475 45936 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390191.1 protein_id gnl|my_center|LOCUS_01850 45917 46567 gene locus_tag LOCUS_01860 45917 46567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 46571 47518 gene locus_tag LOCUS_01870 46571 47518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 47543 48154 gene locus_tag LOCUS_01880 47543 48154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 48189 48413 gene locus_tag LOCUS_01890 48189 48413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 48429 48761 gene locus_tag LOCUS_01900 48429 48761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 49175 48765 gene locus_tag LOCUS_01910 49175 48765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 49337 49891 gene locus_tag LOCUS_01920 gene pagP 49337 49891 CDS product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170533.1 protein_id gnl|my_center|LOCUS_01920 50399 49956 gene locus_tag LOCUS_01930 gene ptsN 50399 49956 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 protein_id gnl|my_center|LOCUS_01930 50977 50411 gene locus_tag LOCUS_01940 gene raiA 50977 50411 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921424.1 protein_id gnl|my_center|LOCUS_01940 51834 51085 gene locus_tag LOCUS_01950 gene lptB 51834 51085 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387772.1 protein_id gnl|my_center|LOCUS_01950 52915 51836 gene locus_tag LOCUS_01960 52915 51836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 53880 52915 gene locus_tag LOCUS_01970 53880 52915 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920124.1 protein_id gnl|my_center|LOCUS_01970 54901 53963 gene locus_tag LOCUS_01980 54901 53963 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390378.1 protein_id gnl|my_center|LOCUS_01980 58340 54879 gene locus_tag LOCUS_01990 58340 54879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 59073 58345 gene locus_tag LOCUS_02000 59073 58345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 60894 59158 gene locus_tag LOCUS_02010 60894 59158 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267197.1 protein_id gnl|my_center|LOCUS_02010 62685 60898 gene locus_tag LOCUS_02020 62685 60898 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072991.1 protein_id gnl|my_center|LOCUS_02020 63680 62682 gene locus_tag LOCUS_02030 63680 62682 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948543.1 protein_id gnl|my_center|LOCUS_02030 64144 63677 gene locus_tag LOCUS_02040 64144 63677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 64545 64201 gene locus_tag LOCUS_02050 64545 64201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 66989 64617 gene locus_tag LOCUS_02060 gene lon 66989 64617 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389427.1 protein_id gnl|my_center|LOCUS_02060 67173 67910 gene locus_tag LOCUS_02070 67173 67910 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_02070 67900 69180 gene locus_tag LOCUS_02080 67900 69180 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388339.1 protein_id gnl|my_center|LOCUS_02080 69180 70136 gene locus_tag LOCUS_02090 gene lpxK 69180 70136 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388340.1 protein_id gnl|my_center|LOCUS_02090 70606 70157 gene locus_tag LOCUS_02100 70606 70157 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969419.1 protein_id gnl|my_center|LOCUS_02100 70741 72498 gene locus_tag LOCUS_02110 gene recJ 70741 72498 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 protein_id gnl|my_center|LOCUS_02110 72498 73202 gene locus_tag LOCUS_02120 72498 73202 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389482.1 protein_id gnl|my_center|LOCUS_02120 73389 75815 gene locus_tag LOCUS_02130 73389 75815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 76572 77318 gene locus_tag LOCUS_02140 76572 77318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 78015 77368 gene locus_tag LOCUS_02150 78015 77368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 78275 78760 gene locus_tag LOCUS_02160 78275 78760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 78935 78777 gene locus_tag LOCUS_02170 78935 78777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 79901 79284 gene locus_tag LOCUS_02180 79901 79284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 81578 80418 gene locus_tag LOCUS_02190 81578 80418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 82066 81746 gene locus_tag LOCUS_02200 82066 81746 CDS product DUF3768 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331421.1 protein_id gnl|my_center|LOCUS_02200 82320 82066 gene locus_tag LOCUS_02210 82320 82066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 82596 84383 gene locus_tag LOCUS_02220 82596 84383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 84899 85429 gene locus_tag LOCUS_02230 84899 85429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 85689 86144 gene locus_tag LOCUS_02240 85689 86144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 86879 86181 gene locus_tag LOCUS_02250 86879 86181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 87261 86833 gene locus_tag LOCUS_02260 87261 86833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 87473 87398 gene locus_tag LOCUS_t00040 87473 87398 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 87626 88411 gene locus_tag LOCUS_02270 87626 88411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 88437 89879 gene locus_tag LOCUS_02280 88437 89879 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678778.1 protein_id gnl|my_center|LOCUS_02280 90100 89894 gene locus_tag LOCUS_02290 90100 89894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 90649 90176 gene locus_tag LOCUS_02300 gene greA 90649 90176 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383382.1 protein_id gnl|my_center|LOCUS_02300 90896 91354 gene locus_tag LOCUS_02310 90896 91354 CDS product DUF3015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094783.1 protein_id gnl|my_center|LOCUS_02310 91377 93218 gene locus_tag LOCUS_02320 91377 93218 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268924.1 protein_id gnl|my_center|LOCUS_02320 93294 93379 gene locus_tag LOCUS_t00050 93294 93379 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 93487 94932 gene locus_tag LOCUS_02330 gene mgtE 93487 94932 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389748.1 protein_id gnl|my_center|LOCUS_02330 95020 95490 gene locus_tag LOCUS_02340 gene lspA 95020 95490 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390715.1 protein_id gnl|my_center|LOCUS_02340 95490 95687 gene locus_tag LOCUS_02350 95490 95687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 95689 97062 gene locus_tag LOCUS_02360 95689 97062 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857633.1 protein_id gnl|my_center|LOCUS_02360 97055 98434 gene locus_tag LOCUS_02370 97055 98434 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532354.1 protein_id gnl|my_center|LOCUS_02370 98427 100052 gene locus_tag LOCUS_02380 gene pgi 98427 100052 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932668.1 protein_id gnl|my_center|LOCUS_02380 100057 101889 gene locus_tag LOCUS_02390 gene mutL 100057 101889 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399508.1 protein_id gnl|my_center|LOCUS_02390 103004 101928 gene locus_tag LOCUS_02400 gene mnmA 103004 101928 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_02400 103159 106632 gene locus_tag LOCUS_02410 gene dnaE 103159 106632 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389457.1 protein_id gnl|my_center|LOCUS_02410 106634 107443 gene locus_tag LOCUS_02420 106634 107443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 107522 107598 gene locus_tag LOCUS_t00060 107522 107598 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 107972 108130 gene locus_tag LOCUS_02430 107972 108130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 108208 108606 gene locus_tag LOCUS_02440 108208 108606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 108609 109199 gene locus_tag LOCUS_02450 108609 109199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 109540 109746 gene locus_tag LOCUS_02460 109540 109746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 109874 110785 gene locus_tag LOCUS_02470 109874 110785 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693981.1 protein_id gnl|my_center|LOCUS_02470 111108 111263 gene locus_tag LOCUS_02480 111108 111263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 111486 111995 gene locus_tag LOCUS_02490 111486 111995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 112437 112138 gene locus_tag LOCUS_02500 112437 112138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 113360 112605 gene locus_tag LOCUS_02510 113360 112605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 113605 114879 gene locus_tag LOCUS_02520 113605 114879 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_02520 114929 117736 gene locus_tag LOCUS_02530 114929 117736 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059153920.1 protein_id gnl|my_center|LOCUS_02530 117749 117964 gene locus_tag LOCUS_02540 117749 117964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 117981 119279 gene locus_tag LOCUS_02550 117981 119279 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_02550 119317 119841 gene locus_tag LOCUS_02560 119317 119841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 119888 121927 gene locus_tag LOCUS_02570 119888 121927 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_02570 121954 125235 gene locus_tag LOCUS_02580 121954 125235 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081615318.1 protein_id gnl|my_center|LOCUS_02580 125261 125719 gene locus_tag LOCUS_02590 125261 125719 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_02590 125797 126420 gene locus_tag LOCUS_02600 125797 126420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 126678 126439 gene locus_tag LOCUS_02610 126678 126439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 126980 126675 gene locus_tag LOCUS_02620 126980 126675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 128677 127328 gene locus_tag LOCUS_02630 128677 127328 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_02630 129101 128943 gene locus_tag LOCUS_02640 129101 128943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 >Feature sequence03 234 1913 gene locus_tag LOCUS_02650 gene rpsA 234 1913 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388046.1 protein_id gnl|my_center|LOCUS_02650 2154 2480 gene locus_tag LOCUS_02660 2154 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 2814 2521 gene locus_tag LOCUS_02670 2814 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 3157 2816 gene locus_tag LOCUS_02680 3157 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 7742 3549 gene locus_tag LOCUS_02690 gene rpoC 7742 3549 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390504.1 protein_id gnl|my_center|LOCUS_02690 11965 7760 gene locus_tag LOCUS_02700 gene rpoB 11965 7760 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390505.1 protein_id gnl|my_center|LOCUS_02700 12274 12107 gene locus_tag LOCUS_02710 12274 12107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 12825 12394 gene locus_tag LOCUS_02720 12825 12394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 13177 12866 gene locus_tag LOCUS_02730 13177 12866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 13638 13459 gene locus_tag LOCUS_02740 13638 13459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 14306 13740 gene locus_tag LOCUS_02750 14306 13740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 15906 14896 gene locus_tag LOCUS_02760 15906 14896 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626433.1 protein_id gnl|my_center|LOCUS_02760 16396 16007 gene locus_tag LOCUS_02770 gene rpsK 16396 16007 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390415.1 protein_id gnl|my_center|LOCUS_02770 16781 16413 gene locus_tag LOCUS_02780 gene rpsM 16781 16413 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390416.1 protein_id gnl|my_center|LOCUS_02780 17597 16920 gene locus_tag LOCUS_02790 17597 16920 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_02790 18962 17613 gene locus_tag LOCUS_02800 gene secY 18962 17613 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390418.1 protein_id gnl|my_center|LOCUS_02800 19498 19043 gene locus_tag LOCUS_02810 gene rplO 19498 19043 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385304.1 protein_id gnl|my_center|LOCUS_02810 19785 19603 gene locus_tag LOCUS_02820 gene rpmD 19785 19603 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390420.1 protein_id gnl|my_center|LOCUS_02820 20354 19788 gene locus_tag LOCUS_02830 gene rpsE 20354 19788 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919144.1 protein_id gnl|my_center|LOCUS_02830 20728 20366 gene locus_tag LOCUS_02840 gene rplR 20728 20366 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390422.1 protein_id gnl|my_center|LOCUS_02840 21280 20741 gene locus_tag LOCUS_02850 gene rplF 21280 20741 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390423.1 protein_id gnl|my_center|LOCUS_02850 21691 21293 gene locus_tag LOCUS_02860 gene rpsH 21691 21293 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390424.1 protein_id gnl|my_center|LOCUS_02860 22009 21704 gene locus_tag LOCUS_02870 gene rpsN 22009 21704 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390425.1 protein_id gnl|my_center|LOCUS_02870 22563 22024 gene locus_tag LOCUS_02880 gene rplE 22563 22024 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919139.1 protein_id gnl|my_center|LOCUS_02880 22895 22581 gene locus_tag LOCUS_02890 gene rplX 22895 22581 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313975.1 protein_id gnl|my_center|LOCUS_02890 23263 22895 gene locus_tag LOCUS_02900 gene rplN 23263 22895 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390428.1 protein_id gnl|my_center|LOCUS_02900 23518 23282 gene locus_tag LOCUS_02910 gene rpsQ 23518 23282 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596215.1 protein_id gnl|my_center|LOCUS_02910 23726 23529 gene locus_tag LOCUS_02920 gene rpmC 23726 23529 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647192.1 protein_id gnl|my_center|LOCUS_02920 24154 23726 gene locus_tag LOCUS_02930 gene rplP 24154 23726 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390431.1 protein_id gnl|my_center|LOCUS_02930 24837 24169 gene locus_tag LOCUS_02940 gene rpsC 24837 24169 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_02940 25194 24841 gene locus_tag LOCUS_02950 gene rplV 25194 24841 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390433.1 protein_id gnl|my_center|LOCUS_02950 25472 25194 gene locus_tag LOCUS_02960 gene rpsS 25472 25194 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390434.1 protein_id gnl|my_center|LOCUS_02960 26321 25485 gene locus_tag LOCUS_02970 gene rplB 26321 25485 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390435.1 protein_id gnl|my_center|LOCUS_02970 26645 26325 gene locus_tag LOCUS_02980 26645 26325 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919129.1 protein_id gnl|my_center|LOCUS_02980 27262 26639 gene locus_tag LOCUS_02990 gene rplD 27262 26639 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390437.1 protein_id gnl|my_center|LOCUS_02990 28010 27282 gene locus_tag LOCUS_03000 gene rplC 28010 27282 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390498.1 protein_id gnl|my_center|LOCUS_03000 28377 28066 gene locus_tag LOCUS_03010 gene rpsJ 28377 28066 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909272.1 protein_id gnl|my_center|LOCUS_03010 28663 28511 gene locus_tag LOCUS_03020 28663 28511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 28685 29587 gene locus_tag LOCUS_03030 28685 29587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 30668 29577 gene locus_tag LOCUS_03040 gene hemW 30668 29577 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391386.1 protein_id gnl|my_center|LOCUS_03040 31505 30681 gene locus_tag LOCUS_03050 gene rsmA 31505 30681 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314585.1 protein_id gnl|my_center|LOCUS_03050 32553 31510 gene locus_tag LOCUS_03060 32553 31510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 34827 32566 gene locus_tag LOCUS_03070 gene lptD 34827 32566 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388193.1 protein_id gnl|my_center|LOCUS_03070 35947 34820 gene locus_tag LOCUS_03080 gene lptF 35947 34820 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391151.1 protein_id gnl|my_center|LOCUS_03080 36618 36040 gene locus_tag LOCUS_03090 36618 36040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 36769 38805 gene locus_tag LOCUS_03100 gene glgA 36769 38805 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836716.1 protein_id gnl|my_center|LOCUS_03100 39444 38800 gene locus_tag LOCUS_03110 gene nth 39444 38800 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968399.1 protein_id gnl|my_center|LOCUS_03110 40519 39446 gene locus_tag LOCUS_03120 gene tsaD 40519 39446 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626621.1 protein_id gnl|my_center|LOCUS_03120 40616 41632 gene locus_tag LOCUS_03130 40616 41632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 41632 43023 gene locus_tag LOCUS_03140 gene pfkC 41632 43023 CDS product ADP-specific phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249331.1 protein_id gnl|my_center|LOCUS_03140 43994 43026 gene locus_tag LOCUS_03150 gene virB11 43994 43026 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264003.1 protein_id gnl|my_center|LOCUS_03150 48236 44007 gene locus_tag LOCUS_03160 48236 44007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 51673 48239 gene locus_tag LOCUS_03170 51673 48239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 53277 51670 gene locus_tag LOCUS_03180 53277 51670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 54071 53319 gene locus_tag LOCUS_03190 54071 53319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 54276 54088 gene locus_tag LOCUS_03200 54276 54088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 55173 54424 gene locus_tag LOCUS_03210 55173 54424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 59904 55183 gene locus_tag LOCUS_03220 59904 55183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 61266 59917 gene locus_tag LOCUS_03230 61266 59917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 61964 61269 gene locus_tag LOCUS_03240 61964 61269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 62631 61957 gene locus_tag LOCUS_03250 62631 61957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 64083 62653 gene locus_tag LOCUS_03260 64083 62653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 66590 64161 gene locus_tag LOCUS_03270 66590 64161 CDS product VirB4 family type IV secretion/conjugal transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599743.1 protein_id gnl|my_center|LOCUS_03270 66870 66580 gene locus_tag LOCUS_03280 66870 66580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 67387 66992 gene locus_tag LOCUS_03290 gene rbfA 67387 66992 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921462.1 protein_id gnl|my_center|LOCUS_03290 69907 67403 gene locus_tag LOCUS_03300 gene infB 69907 67403 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626661.1 protein_id gnl|my_center|LOCUS_03300 70507 69926 gene locus_tag LOCUS_03310 70507 69926 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385439.1 protein_id gnl|my_center|LOCUS_03310 72029 70518 gene locus_tag LOCUS_03320 gene nusA 72029 70518 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391526.1 protein_id gnl|my_center|LOCUS_03320 72559 72047 gene locus_tag LOCUS_03330 gene rimP 72559 72047 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338756.1 protein_id gnl|my_center|LOCUS_03330 73166 72681 gene locus_tag LOCUS_03340 gene mscL 73166 72681 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814614.1 protein_id gnl|my_center|LOCUS_03340 73693 73163 gene locus_tag LOCUS_03350 gene nusG 73693 73163 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390510.1 protein_id gnl|my_center|LOCUS_03350 73894 73697 gene locus_tag LOCUS_03360 gene secE 73894 73697 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007611620.1 protein_id gnl|my_center|LOCUS_03360 74214 74498 gene locus_tag LOCUS_03370 74214 74498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 75511 74876 gene locus_tag LOCUS_03380 75511 74876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 76740 75577 gene locus_tag LOCUS_03390 gene fucO 76740 75577 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013588.1 protein_id gnl|my_center|LOCUS_03390 77322 77119 gene locus_tag LOCUS_03400 77322 77119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 78653 77859 gene locus_tag LOCUS_03410 78653 77859 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_03410 79054 78979 gene locus_tag LOCUS_t00070 79054 78979 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 80064 79162 gene locus_tag LOCUS_03420 80064 79162 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083768.1 protein_id gnl|my_center|LOCUS_03420 80307 80065 gene locus_tag LOCUS_03430 80307 80065 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919931.1 protein_id gnl|my_center|LOCUS_03430 80472 81248 gene locus_tag LOCUS_03440 80472 81248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 81337 82092 gene locus_tag LOCUS_03450 81337 82092 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066860.1 protein_id gnl|my_center|LOCUS_03450 82093 82572 gene locus_tag LOCUS_03460 gene ruvC 82093 82572 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084351.1 protein_id gnl|my_center|LOCUS_03460 83123 83048 gene locus_tag LOCUS_t00080 83123 83048 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 83830 83198 gene locus_tag LOCUS_03470 83830 83198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 84382 84307 gene locus_tag LOCUS_t00090 84382 84307 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 85150 84509 gene locus_tag LOCUS_03480 85150 84509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 85545 85273 gene locus_tag LOCUS_03490 85545 85273 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_03490 87059 85788 gene locus_tag LOCUS_03500 87059 85788 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_03500 87423 89561 gene locus_tag LOCUS_03510 gene aas 87423 89561 CDS product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098558.1 protein_id gnl|my_center|LOCUS_03510 90260 89790 gene locus_tag LOCUS_03520 90260 89790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 90443 92431 gene locus_tag LOCUS_03530 gene parE 90443 92431 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390520.1 protein_id gnl|my_center|LOCUS_03530 93026 92484 gene locus_tag LOCUS_03540 93026 92484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 93507 93040 gene locus_tag LOCUS_03550 93507 93040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 95530 93635 gene locus_tag LOCUS_03560 95530 93635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 95667 96443 gene locus_tag LOCUS_03570 95667 96443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 96531 97175 gene locus_tag LOCUS_03580 96531 97175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 97318 97989 gene locus_tag LOCUS_03590 97318 97989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 98905 98015 gene locus_tag LOCUS_03600 98905 98015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 99375 99007 gene locus_tag LOCUS_03610 99375 99007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 101094 99388 gene locus_tag LOCUS_03620 101094 99388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 101777 101091 gene locus_tag LOCUS_03630 101777 101091 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389373.1 protein_id gnl|my_center|LOCUS_03630 103065 101785 gene locus_tag LOCUS_03640 gene serS 103065 101785 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887919.1 protein_id gnl|my_center|LOCUS_03640 103167 104183 gene locus_tag LOCUS_03650 gene trpS 103167 104183 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022349.1 protein_id gnl|my_center|LOCUS_03650 105144 104185 gene locus_tag LOCUS_03660 105144 104185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 105446 105213 gene locus_tag LOCUS_03670 105446 105213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 106325 105459 gene locus_tag LOCUS_03680 106325 105459 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 protein_id gnl|my_center|LOCUS_03680 107095 106322 gene locus_tag LOCUS_03690 107095 106322 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391374.1 protein_id gnl|my_center|LOCUS_03690 107709 107092 gene locus_tag LOCUS_03700 gene rsmG 107709 107092 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338804.1 protein_id gnl|my_center|LOCUS_03700 108601 107768 gene locus_tag LOCUS_03710 108601 107768 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939760.1 protein_id gnl|my_center|LOCUS_03710 110459 108609 gene locus_tag LOCUS_03720 gene mnmG 110459 108609 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266007.1 protein_id gnl|my_center|LOCUS_03720 111878 110532 gene locus_tag LOCUS_03730 gene mnmE 111878 110532 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596984.1 protein_id gnl|my_center|LOCUS_03730 112054 112722 gene locus_tag LOCUS_03740 112054 112722 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394499.1 protein_id gnl|my_center|LOCUS_03740 112824 114206 gene locus_tag LOCUS_03750 112824 114206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 115955 114318 gene locus_tag LOCUS_03760 gene groL 115955 114318 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388345.1 protein_id gnl|my_center|LOCUS_03760 116259 115972 gene locus_tag LOCUS_03770 gene groES 116259 115972 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171493.1 protein_id gnl|my_center|LOCUS_03770 117622 116369 gene locus_tag LOCUS_03780 gene rho 117622 116369 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391366.1 protein_id gnl|my_center|LOCUS_03780 118098 118781 gene locus_tag LOCUS_03790 gene dnaQ 118098 118781 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538049.1 protein_id gnl|my_center|LOCUS_03790 118831 119427 gene locus_tag LOCUS_03800 118831 119427 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158308.1 protein_id gnl|my_center|LOCUS_03800 119881 119429 gene locus_tag LOCUS_03810 119881 119429 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390049.1 protein_id gnl|my_center|LOCUS_03810 121151 119868 gene locus_tag LOCUS_03820 121151 119868 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089246.1 protein_id gnl|my_center|LOCUS_03820 122026 121154 gene locus_tag LOCUS_03830 gene hflC 122026 121154 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390051.1 protein_id gnl|my_center|LOCUS_03830 123132 122038 gene locus_tag LOCUS_03840 123132 122038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 123233 124228 gene locus_tag LOCUS_03850 123233 124228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 125683 124220 gene locus_tag LOCUS_03860 125683 124220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 126435 125683 gene locus_tag LOCUS_03870 126435 125683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 127108 126410 gene locus_tag LOCUS_03880 127108 126410 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003198.1 protein_id gnl|my_center|LOCUS_03880 127253 127119 gene locus_tag LOCUS_03890 127253 127119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 127354 127893 gene locus_tag LOCUS_03900 127354 127893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 128657 127905 gene locus_tag LOCUS_03910 128657 127905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 128826 128911 gene locus_tag LOCUS_t00100 128826 128911 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 128934 129007 gene locus_tag LOCUS_t00110 128934 129007 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence04 297 488 gene locus_tag LOCUS_03920 297 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 696 1118 gene locus_tag LOCUS_03930 gene infC 696 1118 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_03930 1345 1629 gene locus_tag LOCUS_03940 1345 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 3736 1835 gene locus_tag LOCUS_03950 gene dnaK 3736 1835 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391302.1 protein_id gnl|my_center|LOCUS_03950 5341 3842 gene locus_tag LOCUS_03960 5341 3842 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085901.1 protein_id gnl|my_center|LOCUS_03960 5951 5667 gene locus_tag LOCUS_03970 5951 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 6144 6302 gene locus_tag LOCUS_03980 6144 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 7923 6577 gene locus_tag LOCUS_03990 7923 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 8136 8558 gene locus_tag LOCUS_04000 8136 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 9151 10320 gene locus_tag LOCUS_04010 9151 10320 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_04010 10408 11454 gene locus_tag LOCUS_04020 10408 11454 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_04020 12115 11516 gene locus_tag LOCUS_04030 12115 11516 CDS product master DNA invertase Mpi family serine-type recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680425.1 protein_id gnl|my_center|LOCUS_04030 12407 12862 gene locus_tag LOCUS_04040 12407 12862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 12875 13552 gene locus_tag LOCUS_04050 12875 13552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 13565 13729 gene locus_tag LOCUS_04060 13565 13729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 13789 14010 gene locus_tag LOCUS_04070 13789 14010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 14525 14061 gene locus_tag LOCUS_04080 14525 14061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 14961 14536 gene locus_tag LOCUS_04090 14961 14536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 15692 15219 gene locus_tag LOCUS_04100 15692 15219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 16318 16242 gene locus_tag LOCUS_t00120 16318 16242 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19753 17021 gene locus_tag LOCUS_04110 19753 17021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 19946 21028 gene locus_tag LOCUS_04120 gene queA 19946 21028 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971794.1 protein_id gnl|my_center|LOCUS_04120 21085 22254 gene locus_tag LOCUS_04130 21085 22254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 23038 22238 gene locus_tag LOCUS_04140 gene lgt 23038 22238 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481391.1 protein_id gnl|my_center|LOCUS_04140 23275 23757 gene locus_tag LOCUS_04150 23275 23757 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 protein_id gnl|my_center|LOCUS_04150 23842 25920 gene locus_tag LOCUS_04160 gene ligA 23842 25920 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388694.1 protein_id gnl|my_center|LOCUS_04160 26658 25900 gene locus_tag LOCUS_04170 26658 25900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 29849 26661 gene locus_tag LOCUS_04180 29849 26661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 30296 29982 gene locus_tag LOCUS_04190 gene trxA 30296 29982 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596708.1 protein_id gnl|my_center|LOCUS_04190 33743 30390 gene locus_tag LOCUS_04200 gene addA 33743 30390 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_04200 36648 33736 gene locus_tag LOCUS_04210 gene addB 36648 33736 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 protein_id gnl|my_center|LOCUS_04210 37269 36688 gene locus_tag LOCUS_04220 gene rdgB 37269 36688 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970821.1 protein_id gnl|my_center|LOCUS_04220 37984 37271 gene locus_tag LOCUS_04230 gene rph 37984 37271 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241574.1 protein_id gnl|my_center|LOCUS_04230 39249 37987 gene locus_tag LOCUS_04240 39249 37987 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066784.1 protein_id gnl|my_center|LOCUS_04240 39778 39251 gene locus_tag LOCUS_04250 39778 39251 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391487.1 protein_id gnl|my_center|LOCUS_04250 39874 40008 gene locus_tag LOCUS_04260 39874 40008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 40005 40910 gene locus_tag LOCUS_04270 gene xerD 40005 40910 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970125.1 protein_id gnl|my_center|LOCUS_04270 41061 42770 gene locus_tag LOCUS_04280 41061 42770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 42818 43660 gene locus_tag LOCUS_04290 42818 43660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 43647 45239 gene locus_tag LOCUS_04300 43647 45239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 45268 46542 gene locus_tag LOCUS_04310 45268 46542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 46532 48019 gene locus_tag LOCUS_04320 46532 48019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 48029 49675 gene locus_tag LOCUS_04330 48029 49675 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537540.1 protein_id gnl|my_center|LOCUS_04330 49691 50803 gene locus_tag LOCUS_04340 49691 50803 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267066.1 protein_id gnl|my_center|LOCUS_04340 50808 51374 gene locus_tag LOCUS_04350 50808 51374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 52026 51610 gene locus_tag LOCUS_04360 52026 51610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 52803 52105 gene locus_tag LOCUS_04370 gene cmk 52803 52105 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083564.1 protein_id gnl|my_center|LOCUS_04370 52864 53598 gene locus_tag LOCUS_04380 52864 53598 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338653.1 protein_id gnl|my_center|LOCUS_04380 53600 54271 gene locus_tag LOCUS_04390 53600 54271 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_04390 54319 55137 gene locus_tag LOCUS_04400 gene rquA 54319 55137 CDS product rhodoquinone biosynthesis methyltransferase RquA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390975.1 protein_id gnl|my_center|LOCUS_04400 56265 55144 gene locus_tag LOCUS_04410 56265 55144 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391095.1 protein_id gnl|my_center|LOCUS_04410 57244 56249 gene locus_tag LOCUS_04420 57244 56249 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625895.1 protein_id gnl|my_center|LOCUS_04420 57429 58475 gene locus_tag LOCUS_04430 57429 58475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 58456 60303 gene locus_tag LOCUS_04440 58456 60303 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098136.1 protein_id gnl|my_center|LOCUS_04440 60300 61379 gene locus_tag LOCUS_04450 gene yejB 60300 61379 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390915.1 protein_id gnl|my_center|LOCUS_04450 61466 69937 gene locus_tag LOCUS_04460 61466 69937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 69951 70262 gene locus_tag LOCUS_04470 69951 70262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 70439 72490 gene locus_tag LOCUS_04480 70439 72490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 72808 74022 gene locus_tag LOCUS_04490 72808 74022 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_04490 74210 74464 gene locus_tag LOCUS_04500 74210 74464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 74839 74666 gene locus_tag LOCUS_04510 74839 74666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552967.1 protein_id gnl|my_center|LOCUS_04510 75725 75096 gene locus_tag LOCUS_04520 75725 75096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 76343 75738 gene locus_tag LOCUS_04530 76343 75738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 76764 76348 gene locus_tag LOCUS_04540 76764 76348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 77011 76784 gene locus_tag LOCUS_04550 77011 76784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 77937 77161 gene locus_tag LOCUS_04560 77937 77161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 78218 78027 gene locus_tag LOCUS_04570 78218 78027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 78390 79001 gene locus_tag LOCUS_04580 78390 79001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 79019 79969 gene locus_tag LOCUS_04590 79019 79969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 80092 80982 gene locus_tag LOCUS_04600 80092 80982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 84213 81091 gene locus_tag LOCUS_04610 84213 81091 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583655.1 protein_id gnl|my_center|LOCUS_04610 84992 84213 gene locus_tag LOCUS_04620 84992 84213 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582729.1 protein_id gnl|my_center|LOCUS_04620 85833 84997 gene locus_tag LOCUS_04630 gene tcmP 85833 84997 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445522.1 protein_id gnl|my_center|LOCUS_04630 88841 85836 gene locus_tag LOCUS_04640 88841 85836 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583653.1 protein_id gnl|my_center|LOCUS_04640 91649 88851 gene locus_tag LOCUS_04650 91649 88851 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804175.1 protein_id gnl|my_center|LOCUS_04650 92361 93746 gene locus_tag LOCUS_04660 92361 93746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 93980 94903 gene locus_tag LOCUS_04670 93980 94903 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072162.1 protein_id gnl|my_center|LOCUS_04670 95682 95089 gene locus_tag LOCUS_04680 95682 95089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 96341 96266 gene locus_tag LOCUS_t00130 96341 96266 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 96694 96452 gene locus_tag LOCUS_04690 96694 96452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 98919 97477 gene locus_tag LOCUS_04700 98919 97477 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421530.1 protein_id gnl|my_center|LOCUS_04700 99672 98932 gene locus_tag LOCUS_04710 99672 98932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 101432 99738 gene locus_tag LOCUS_04720 gene metG 101432 99738 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338224.1 protein_id gnl|my_center|LOCUS_04720 102572 101520 gene locus_tag LOCUS_04730 102572 101520 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080645.1 protein_id gnl|my_center|LOCUS_04730 103233 102574 gene locus_tag LOCUS_04740 103233 102574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 103380 104108 gene locus_tag LOCUS_04750 103380 104108 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244437.1 protein_id gnl|my_center|LOCUS_04750 105596 104166 gene locus_tag LOCUS_04760 105596 104166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 106915 105665 gene locus_tag LOCUS_04770 106915 105665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 107063 108034 gene locus_tag LOCUS_04780 107063 108034 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888774.1 protein_id gnl|my_center|LOCUS_04780 108038 108508 gene locus_tag LOCUS_04790 108038 108508 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888773.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence05 546 809 gene locus_tag LOCUS_04800 546 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 846 1046 gene locus_tag LOCUS_04810 846 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 1301 1729 gene locus_tag LOCUS_04820 1301 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 1782 2072 gene locus_tag LOCUS_04830 gene iss 1782 2072 CDS product increased serum survival lipoprotein Iss inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738422.1 protein_id gnl|my_center|LOCUS_04830 2664 2524 gene locus_tag LOCUS_04840 2664 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 2795 2637 gene locus_tag LOCUS_04850 2795 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 3001 2807 gene locus_tag LOCUS_04860 3001 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 3490 3011 gene locus_tag LOCUS_04870 3490 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 3753 3487 gene locus_tag LOCUS_04880 3753 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 4370 3756 gene locus_tag LOCUS_04890 4370 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 4936 4370 gene locus_tag LOCUS_04900 4936 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 5296 4937 gene locus_tag LOCUS_04910 5296 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 5479 5297 gene locus_tag LOCUS_04920 5479 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 5758 5489 gene locus_tag LOCUS_04930 5758 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 6693 5767 gene locus_tag LOCUS_04940 6693 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 7064 7273 gene locus_tag LOCUS_04950 7064 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 7923 7504 gene locus_tag LOCUS_04960 7923 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 8332 7910 gene locus_tag LOCUS_04970 8332 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 8565 8329 gene locus_tag LOCUS_04980 8565 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 9294 8596 gene locus_tag LOCUS_04990 9294 8596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 9414 9908 gene locus_tag LOCUS_05000 9414 9908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 11406 9820 gene locus_tag LOCUS_05010 11406 9820 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968391.1 protein_id gnl|my_center|LOCUS_05010 12428 11403 gene locus_tag LOCUS_05020 12428 11403 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390916.1 protein_id gnl|my_center|LOCUS_05020 14356 12428 gene locus_tag LOCUS_05030 14356 12428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 15080 14466 gene locus_tag LOCUS_05040 gene rpsD 15080 14466 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532142.1 protein_id gnl|my_center|LOCUS_05040 15278 17020 gene locus_tag LOCUS_05050 15278 17020 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948187.1 protein_id gnl|my_center|LOCUS_05050 17099 17719 gene locus_tag LOCUS_05060 17099 17719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 18015 17788 gene locus_tag LOCUS_05070 18015 17788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 18341 18036 gene locus_tag LOCUS_05080 18341 18036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 19111 18731 gene locus_tag LOCUS_05090 19111 18731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 19448 19639 gene locus_tag LOCUS_05100 19448 19639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 20840 20028 gene locus_tag LOCUS_05110 20840 20028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 22303 21524 gene locus_tag LOCUS_05120 22303 21524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 23052 22977 gene locus_tag LOCUS_t00140 23052 22977 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 23695 23126 gene locus_tag LOCUS_05130 23695 23126 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057359.1 protein_id gnl|my_center|LOCUS_05130 23860 24543 gene locus_tag LOCUS_05140 23860 24543 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388283.1 protein_id gnl|my_center|LOCUS_05140 25830 24619 gene locus_tag LOCUS_05150 25830 24619 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_05150 27927 25843 gene locus_tag LOCUS_05160 gene recG 27927 25843 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531908.1 protein_id gnl|my_center|LOCUS_05160 28019 31483 gene locus_tag LOCUS_05170 gene mfd 28019 31483 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389416.1 protein_id gnl|my_center|LOCUS_05170 31842 31480 gene locus_tag LOCUS_05180 31842 31480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 32577 31855 gene locus_tag LOCUS_05190 32577 31855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216122.1 protein_id gnl|my_center|LOCUS_05190 33817 32570 gene locus_tag LOCUS_05200 33817 32570 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971521.1 protein_id gnl|my_center|LOCUS_05200 35736 33949 gene locus_tag LOCUS_05210 35736 33949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 37104 35836 gene locus_tag LOCUS_05220 gene ftsA 37104 35836 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388700.1 protein_id gnl|my_center|LOCUS_05220 37842 37117 gene locus_tag LOCUS_05230 37842 37117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 38911 37985 gene locus_tag LOCUS_05240 gene murB 38911 37985 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388703.1 protein_id gnl|my_center|LOCUS_05240 40025 38913 gene locus_tag LOCUS_05250 gene murG 40025 38913 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388705.1 protein_id gnl|my_center|LOCUS_05250 41142 40015 gene locus_tag LOCUS_05260 41142 40015 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388706.1 protein_id gnl|my_center|LOCUS_05260 42201 41143 gene locus_tag LOCUS_05270 gene mraY 42201 41143 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388708.1 protein_id gnl|my_center|LOCUS_05270 42358 43155 gene locus_tag LOCUS_05280 42358 43155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 43418 43236 gene locus_tag LOCUS_05290 43418 43236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 43711 43415 gene locus_tag LOCUS_05300 43711 43415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 45607 43802 gene locus_tag LOCUS_05310 45607 43802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 46331 45858 gene locus_tag LOCUS_05320 46331 45858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 46974 46498 gene locus_tag LOCUS_05330 gene rpsI 46974 46498 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390000.1 protein_id gnl|my_center|LOCUS_05330 47441 46974 gene locus_tag LOCUS_05340 gene rplM 47441 46974 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720164.1 protein_id gnl|my_center|LOCUS_05340 48312 47674 gene locus_tag LOCUS_05350 48312 47674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 49137 48322 gene locus_tag LOCUS_05360 gene kdsB 49137 48322 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787574.1 protein_id gnl|my_center|LOCUS_05360 50629 49154 gene locus_tag LOCUS_05370 50629 49154 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974964.1 protein_id gnl|my_center|LOCUS_05370 50783 52447 gene locus_tag LOCUS_05380 50783 52447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 52444 52863 gene locus_tag LOCUS_05390 52444 52863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 52856 53806 gene locus_tag LOCUS_05400 52856 53806 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388203.1 protein_id gnl|my_center|LOCUS_05400 53861 54793 gene locus_tag LOCUS_05410 gene trxB 53861 54793 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390648.1 protein_id gnl|my_center|LOCUS_05410 56002 54794 gene locus_tag LOCUS_05420 56002 54794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 56104 56189 gene locus_tag LOCUS_t00150 56104 56189 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 57712 56291 gene locus_tag LOCUS_05430 57712 56291 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011342568.1 protein_id gnl|my_center|LOCUS_05430 58018 57725 gene locus_tag LOCUS_05440 58018 57725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 58562 58038 gene locus_tag LOCUS_05450 58562 58038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 61157 58629 gene locus_tag LOCUS_05460 61157 58629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 61467 61664 gene locus_tag LOCUS_05470 gene rpmI 61467 61664 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232040.1 protein_id gnl|my_center|LOCUS_05470 61677 62036 gene locus_tag LOCUS_05480 gene rplT 61677 62036 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528310.1 protein_id gnl|my_center|LOCUS_05480 62123 63223 gene locus_tag LOCUS_05490 gene pheS 62123 63223 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391270.1 protein_id gnl|my_center|LOCUS_05490 63220 65613 gene locus_tag LOCUS_05500 gene pheT 63220 65613 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391271.1 protein_id gnl|my_center|LOCUS_05500 66059 66241 gene locus_tag LOCUS_05510 66059 66241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 66350 69175 gene locus_tag LOCUS_05520 gene gyrA 66350 69175 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389497.1 protein_id gnl|my_center|LOCUS_05520 69591 69259 gene locus_tag LOCUS_05530 69591 69259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 69974 69690 gene locus_tag LOCUS_05540 69974 69690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 70151 71968 gene locus_tag LOCUS_05550 70151 71968 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390041.1 protein_id gnl|my_center|LOCUS_05550 72106 72567 gene locus_tag LOCUS_05560 72106 72567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 72827 73843 gene locus_tag LOCUS_05570 72827 73843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 73847 74107 gene locus_tag LOCUS_05580 73847 74107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 75250 74141 gene locus_tag LOCUS_05590 75250 74141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 76031 75303 gene locus_tag LOCUS_05600 76031 75303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 76763 76032 gene locus_tag LOCUS_05610 76763 76032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 77941 76883 gene locus_tag LOCUS_05620 77941 76883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 78795 77938 gene locus_tag LOCUS_05630 78795 77938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 80287 78782 gene locus_tag LOCUS_05640 80287 78782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 81157 80309 gene locus_tag LOCUS_05650 81157 80309 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021650009.1 protein_id gnl|my_center|LOCUS_05650 81963 81163 gene locus_tag LOCUS_05660 81963 81163 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282880.1 protein_id gnl|my_center|LOCUS_05660 82515 81964 gene locus_tag LOCUS_05670 gene rfbC 82515 81964 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202142.1 protein_id gnl|my_center|LOCUS_05670 83059 82616 gene locus_tag LOCUS_05680 83059 82616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 83868 83206 gene locus_tag LOCUS_05690 83868 83206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 83966 84421 gene locus_tag LOCUS_05700 83966 84421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 85147 84422 gene locus_tag LOCUS_05710 gene trmB 85147 84422 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391524.1 protein_id gnl|my_center|LOCUS_05710 85710 85231 gene locus_tag LOCUS_05720 85710 85231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 88235 85941 gene locus_tag LOCUS_05730 88235 85941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 89955 88981 gene locus_tag LOCUS_05740 89955 88981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 90193 90795 gene locus_tag LOCUS_05750 90193 90795 CDS product master DNA invertase Mpi family serine-type recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680425.1 protein_id gnl|my_center|LOCUS_05750 91168 91094 gene locus_tag LOCUS_t00160 91168 91094 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 91302 91682 gene locus_tag LOCUS_05760 91302 91682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 92715 93101 gene locus_tag LOCUS_05770 92715 93101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 93189 93476 gene locus_tag LOCUS_05780 93189 93476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 93581 94033 gene locus_tag LOCUS_05790 93581 94033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 96534 94081 gene locus_tag LOCUS_05800 gene topA 96534 94081 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390950.1 protein_id gnl|my_center|LOCUS_05800 97672 96545 gene locus_tag LOCUS_05810 gene dprA 97672 96545 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 protein_id gnl|my_center|LOCUS_05810 98323 97673 gene locus_tag LOCUS_05820 gene plsY 98323 97673 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390940.1 protein_id gnl|my_center|LOCUS_05820 98491 99216 gene locus_tag LOCUS_05830 gene pyrH 98491 99216 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598633.1 protein_id gnl|my_center|LOCUS_05830 99227 99790 gene locus_tag LOCUS_05840 gene frr 99227 99790 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389464.1 protein_id gnl|my_center|LOCUS_05840 99804 100514 gene locus_tag LOCUS_05850 99804 100514 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424529.1 protein_id gnl|my_center|LOCUS_05850 100501 101310 gene locus_tag LOCUS_05860 100501 101310 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389466.1 protein_id gnl|my_center|LOCUS_05860 101323 102459 gene locus_tag LOCUS_05870 gene rseP 101323 102459 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389468.1 protein_id gnl|my_center|LOCUS_05870 102498 104750 gene locus_tag LOCUS_05880 gene bamA 102498 104750 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440405.1 protein_id gnl|my_center|LOCUS_05880 104762 105775 gene locus_tag LOCUS_05890 gene lpxD 104762 105775 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443878.1 protein_id gnl|my_center|LOCUS_05890 105793 106245 gene locus_tag LOCUS_05900 gene fabZ 105793 106245 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545346.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence06 2137 1535 gene locus_tag LOCUS_05910 2137 1535 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391445.1 protein_id gnl|my_center|LOCUS_05910 2271 2960 gene locus_tag LOCUS_05920 2271 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 3853 2957 gene locus_tag LOCUS_05930 gene galU 3853 2957 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389966.1 protein_id gnl|my_center|LOCUS_05930 8275 3929 gene locus_tag LOCUS_05940 8275 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 8411 9205 gene locus_tag LOCUS_05950 8411 9205 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529629.1 protein_id gnl|my_center|LOCUS_05950 9205 10512 gene locus_tag LOCUS_05960 gene deoA 9205 10512 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261273.1 protein_id gnl|my_center|LOCUS_05960 11652 10513 gene locus_tag LOCUS_05970 gene rodA 11652 10513 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391426.1 protein_id gnl|my_center|LOCUS_05970 13467 11659 gene locus_tag LOCUS_05980 gene mrdA 13467 11659 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_05980 13982 13464 gene locus_tag LOCUS_05990 13982 13464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 14838 13993 gene locus_tag LOCUS_06000 gene mreC 14838 13993 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388230.1 protein_id gnl|my_center|LOCUS_06000 15917 14877 gene locus_tag LOCUS_06010 15917 14877 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625945.1 protein_id gnl|my_center|LOCUS_06010 16907 15981 gene locus_tag LOCUS_06020 gene miaA 16907 15981 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089244.1 protein_id gnl|my_center|LOCUS_06020 16985 17764 gene locus_tag LOCUS_06030 16985 17764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 17769 19166 gene locus_tag LOCUS_06040 17769 19166 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_06040 19527 19300 gene locus_tag LOCUS_06050 19527 19300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 20080 19934 gene locus_tag LOCUS_06060 20080 19934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 21654 20713 gene locus_tag LOCUS_06070 21654 20713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 22078 22004 gene locus_tag LOCUS_t00170 22078 22004 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 23267 22122 gene locus_tag LOCUS_06080 23267 22122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 24746 23274 gene locus_tag LOCUS_06090 gene lysS 24746 23274 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015229441.1 protein_id gnl|my_center|LOCUS_06090 24889 25542 gene locus_tag LOCUS_06100 gene lexA 24889 25542 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240339.1 protein_id gnl|my_center|LOCUS_06100 25715 26080 gene locus_tag LOCUS_06110 25715 26080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 26159 26503 gene locus_tag LOCUS_06120 26159 26503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 26532 27833 gene locus_tag LOCUS_06130 26532 27833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 28984 28403 gene locus_tag LOCUS_06140 28984 28403 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087459.1 protein_id gnl|my_center|LOCUS_06140 29996 29031 gene locus_tag LOCUS_06150 29996 29031 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261591.1 protein_id gnl|my_center|LOCUS_06150 31530 29983 gene locus_tag LOCUS_06160 31530 29983 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261592.1 protein_id gnl|my_center|LOCUS_06160 32108 31554 gene locus_tag LOCUS_06170 32108 31554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 32237 33598 gene locus_tag LOCUS_06180 32237 33598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 33585 35666 gene locus_tag LOCUS_06190 33585 35666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 35666 36982 gene locus_tag LOCUS_06200 35666 36982 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_06200 37004 37900 gene locus_tag LOCUS_06210 37004 37900 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971647.1 protein_id gnl|my_center|LOCUS_06210 37904 40039 gene locus_tag LOCUS_06220 37904 40039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 40036 40533 gene locus_tag LOCUS_06230 40036 40533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 40617 40901 gene locus_tag LOCUS_06240 40617 40901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 40903 41568 gene locus_tag LOCUS_06250 40903 41568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 43011 41698 gene locus_tag LOCUS_06260 gene tolB 43011 41698 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388849.1 protein_id gnl|my_center|LOCUS_06260 43096 43563 gene locus_tag LOCUS_06270 gene ruvX 43096 43563 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384481.1 protein_id gnl|my_center|LOCUS_06270 44252 43521 gene locus_tag LOCUS_06280 44252 43521 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388715.1 protein_id gnl|my_center|LOCUS_06280 44542 44255 gene locus_tag LOCUS_06290 44542 44255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 45528 44605 gene locus_tag LOCUS_06300 45528 44605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 45660 46463 gene locus_tag LOCUS_06310 45660 46463 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389537.1 protein_id gnl|my_center|LOCUS_06310 46457 47521 gene locus_tag LOCUS_06320 46457 47521 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596041.1 protein_id gnl|my_center|LOCUS_06320 47615 47782 gene locus_tag LOCUS_06330 gene rpmG 47615 47782 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810296.1 protein_id gnl|my_center|LOCUS_06330 48758 47835 gene locus_tag LOCUS_06340 48758 47835 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388975.1 protein_id gnl|my_center|LOCUS_06340 51568 48755 gene locus_tag LOCUS_06350 gene uvrA 51568 48755 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389505.1 protein_id gnl|my_center|LOCUS_06350 52179 51673 gene locus_tag LOCUS_06360 52179 51673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 52726 52259 gene locus_tag LOCUS_06370 52726 52259 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254662.1 protein_id gnl|my_center|LOCUS_06370 53754 52723 gene locus_tag LOCUS_06380 gene holA 53754 52723 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921578.1 protein_id gnl|my_center|LOCUS_06380 54307 53744 gene locus_tag LOCUS_06390 gene lptE 54307 53744 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391377.1 protein_id gnl|my_center|LOCUS_06390 56756 54297 gene locus_tag LOCUS_06400 gene leuS 56756 54297 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_06400 56885 58153 gene locus_tag LOCUS_06410 56885 58153 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391407.1 protein_id gnl|my_center|LOCUS_06410 58221 59285 gene locus_tag LOCUS_06420 58221 59285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 59278 60633 gene locus_tag LOCUS_06430 59278 60633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 60731 61195 gene locus_tag LOCUS_06440 gene ssb 60731 61195 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919343.1 protein_id gnl|my_center|LOCUS_06440 61380 61988 gene locus_tag LOCUS_06450 61380 61988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 63060 62134 gene locus_tag LOCUS_06460 gene tsf 63060 62134 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389462.1 protein_id gnl|my_center|LOCUS_06460 63945 63133 gene locus_tag LOCUS_06470 gene rpsB 63945 63133 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389461.1 protein_id gnl|my_center|LOCUS_06470 64635 64192 gene locus_tag LOCUS_06480 64635 64192 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194406.1 protein_id gnl|my_center|LOCUS_06480 64778 66166 gene locus_tag LOCUS_06490 gene asnS 64778 66166 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937318.1 protein_id gnl|my_center|LOCUS_06490 66176 66619 gene locus_tag LOCUS_06500 66176 66619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 66699 67607 gene locus_tag LOCUS_06510 gene rpoH 66699 67607 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388776.1 protein_id gnl|my_center|LOCUS_06510 67615 68457 gene locus_tag LOCUS_06520 67615 68457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 68588 69145 gene locus_tag LOCUS_06530 68588 69145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 69130 69774 gene locus_tag LOCUS_06540 69130 69774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 69767 70216 gene locus_tag LOCUS_06550 69767 70216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 70764 70207 gene locus_tag LOCUS_06560 70764 70207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 71359 70766 gene locus_tag LOCUS_06570 71359 70766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 71455 72228 gene locus_tag LOCUS_06580 71455 72228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 72904 72233 gene locus_tag LOCUS_06590 72904 72233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 73081 73746 gene locus_tag LOCUS_06600 73081 73746 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020623.1 protein_id gnl|my_center|LOCUS_06600 73743 74489 gene locus_tag LOCUS_06610 73743 74489 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903177.1 protein_id gnl|my_center|LOCUS_06610 74501 75727 gene locus_tag LOCUS_06620 gene hydF 74501 75727 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939056.1 protein_id gnl|my_center|LOCUS_06620 75798 76655 gene locus_tag LOCUS_06630 75798 76655 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976283.1 protein_id gnl|my_center|LOCUS_06630 76657 77205 gene locus_tag LOCUS_06640 76657 77205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 78002 77202 gene locus_tag LOCUS_06650 78002 77202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 78724 78014 gene locus_tag LOCUS_06660 78724 78014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 78886 79176 gene locus_tag LOCUS_06670 78886 79176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 79195 79773 gene locus_tag LOCUS_06680 79195 79773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 79783 80895 gene locus_tag LOCUS_06690 gene ychF 79783 80895 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391495.1 protein_id gnl|my_center|LOCUS_06690 81487 80945 gene locus_tag LOCUS_06700 81487 80945 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387958.1 protein_id gnl|my_center|LOCUS_06700 81620 82459 gene locus_tag LOCUS_06710 gene mutM 81620 82459 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391546.1 protein_id gnl|my_center|LOCUS_06710 82470 82835 gene locus_tag LOCUS_06720 82470 82835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 82941 83201 gene locus_tag LOCUS_06730 gene rpsT 82941 83201 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391549.1 protein_id gnl|my_center|LOCUS_06730 83451 84911 gene locus_tag LOCUS_06740 gene dnaA 83451 84911 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387762.1 protein_id gnl|my_center|LOCUS_06740 85033 86151 gene locus_tag LOCUS_06750 gene dnaN 85033 86151 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387763.1 protein_id gnl|my_center|LOCUS_06750 86153 87358 gene locus_tag LOCUS_06760 gene recF 86153 87358 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651375.1 protein_id gnl|my_center|LOCUS_06760 87957 87355 gene locus_tag LOCUS_06770 gene recR 87957 87355 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527928.1 protein_id gnl|my_center|LOCUS_06770 88287 87967 gene locus_tag LOCUS_06780 88287 87967 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710027.1 protein_id gnl|my_center|LOCUS_06780 90037 88289 gene locus_tag LOCUS_06790 90037 88289 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338432.1 protein_id gnl|my_center|LOCUS_06790 91485 90211 gene locus_tag LOCUS_06800 91485 90211 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626639.1 protein_id gnl|my_center|LOCUS_06800 91641 92477 gene locus_tag LOCUS_06810 gene rsmI 91641 92477 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941314.1 protein_id gnl|my_center|LOCUS_06810 92467 92826 gene locus_tag LOCUS_06820 92467 92826 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479720.1 protein_id gnl|my_center|LOCUS_06820 93570 92830 gene locus_tag LOCUS_06830 gene truA 93570 92830 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596764.1 protein_id gnl|my_center|LOCUS_06830 94665 93646 gene locus_tag LOCUS_06840 94665 93646 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140212.1 protein_id gnl|my_center|LOCUS_06840 95533 94820 gene locus_tag LOCUS_06850 gene phoB 95533 94820 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388361.1 protein_id gnl|my_center|LOCUS_06850 96181 95546 gene locus_tag LOCUS_06860 gene rpe 96181 95546 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902077.1 protein_id gnl|my_center|LOCUS_06860 96341 96838 gene locus_tag LOCUS_06870 96341 96838 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762757.1 protein_id gnl|my_center|LOCUS_06870 96926 97903 gene locus_tag LOCUS_06880 96926 97903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence07 962 228 gene locus_tag LOCUS_06890 962 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 2034 1150 gene locus_tag LOCUS_06900 2034 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 2150 2869 gene locus_tag LOCUS_06910 gene recO 2150 2869 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722424.1 protein_id gnl|my_center|LOCUS_06910 2887 5109 gene locus_tag LOCUS_06920 gene parC 2887 5109 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389601.1 protein_id gnl|my_center|LOCUS_06920 5113 5805 gene locus_tag LOCUS_06930 5113 5805 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244067.1 protein_id gnl|my_center|LOCUS_06930 5877 6182 gene locus_tag LOCUS_06940 5877 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 6308 7537 gene locus_tag LOCUS_06950 6308 7537 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389621.1 protein_id gnl|my_center|LOCUS_06950 7548 7988 gene locus_tag LOCUS_06960 7548 7988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 8001 8489 gene locus_tag LOCUS_06970 gene smpB 8001 8489 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379627.1 protein_id gnl|my_center|LOCUS_06970 9325 8546 gene locus_tag LOCUS_06980 9325 8546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 9634 9386 gene locus_tag LOCUS_06990 9634 9386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 9919 9728 gene locus_tag LOCUS_07000 9919 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 10560 10093 gene locus_tag LOCUS_07010 10560 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 10762 10686 gene locus_tag LOCUS_t00180 10762 10686 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11961 10891 gene locus_tag LOCUS_07020 11961 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 12046 12546 gene locus_tag LOCUS_07030 12046 12546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 12543 12935 gene locus_tag LOCUS_07040 gene rplU 12543 12935 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388997.1 protein_id gnl|my_center|LOCUS_07040 12956 13210 gene locus_tag LOCUS_07050 gene rpmA 12956 13210 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388996.1 protein_id gnl|my_center|LOCUS_07050 13297 14364 gene locus_tag LOCUS_07060 gene obgE 13297 14364 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388995.1 protein_id gnl|my_center|LOCUS_07060 14380 14733 gene locus_tag LOCUS_07070 14380 14733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 17116 14993 gene locus_tag LOCUS_07080 gene pnp 17116 14993 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970644.1 protein_id gnl|my_center|LOCUS_07080 17491 17222 gene locus_tag LOCUS_07090 gene rpsO 17491 17222 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391531.1 protein_id gnl|my_center|LOCUS_07090 18417 17509 gene locus_tag LOCUS_07100 gene truB 18417 17509 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917926.1 protein_id gnl|my_center|LOCUS_07100 18939 18421 gene locus_tag LOCUS_07110 18939 18421 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_07110 19487 18936 gene locus_tag LOCUS_07120 19487 18936 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_07120 19573 20589 gene locus_tag LOCUS_07130 19573 20589 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965507.1 protein_id gnl|my_center|LOCUS_07130 20589 20891 gene locus_tag LOCUS_07140 20589 20891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 20891 22249 gene locus_tag LOCUS_07150 20891 22249 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390030.1 protein_id gnl|my_center|LOCUS_07150 22464 25550 gene locus_tag LOCUS_07160 gene ileS 22464 25550 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596290.1 protein_id gnl|my_center|LOCUS_07160 26382 25810 gene locus_tag LOCUS_07170 26382 25810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 27022 26567 gene locus_tag LOCUS_07180 gene guaD 27022 26567 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245084.1 protein_id gnl|my_center|LOCUS_07180 27439 27026 gene locus_tag LOCUS_07190 27439 27026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 28766 27558 gene locus_tag LOCUS_07200 28766 27558 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066872.1 protein_id gnl|my_center|LOCUS_07200 29852 28836 gene locus_tag LOCUS_07210 gene gap 29852 28836 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084339.1 protein_id gnl|my_center|LOCUS_07210 30128 32299 gene locus_tag LOCUS_07220 30128 32299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 32425 32835 gene locus_tag LOCUS_07230 32425 32835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07230 33039 33227 gene locus_tag LOCUS_07240 33039 33227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 33587 33228 gene locus_tag LOCUS_07250 33587 33228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 34606 33659 gene locus_tag LOCUS_07260 34606 33659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 37432 34706 gene locus_tag LOCUS_07270 gene secA 37432 34706 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387988.1 protein_id gnl|my_center|LOCUS_07270 37603 38715 gene locus_tag LOCUS_07280 37603 38715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 39289 38783 gene locus_tag LOCUS_07290 39289 38783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 40254 39298 gene locus_tag LOCUS_07300 40254 39298 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_07300 40462 40538 gene locus_tag LOCUS_t00190 40462 40538 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 40813 40628 gene locus_tag LOCUS_07310 40813 40628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 40815 41804 gene locus_tag LOCUS_07320 gene hydE 40815 41804 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964939.1 protein_id gnl|my_center|LOCUS_07320 41901 42089 gene locus_tag LOCUS_07330 41901 42089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 42360 42587 gene locus_tag LOCUS_07340 42360 42587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07340 43616 42744 gene locus_tag LOCUS_07350 43616 42744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 44356 43985 gene locus_tag LOCUS_07360 44356 43985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 44621 46090 gene locus_tag LOCUS_07370 44621 46090 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388169.1 protein_id gnl|my_center|LOCUS_07370 46083 46601 gene locus_tag LOCUS_07380 46083 46601 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311232.1 protein_id gnl|my_center|LOCUS_07380 46567 47277 gene locus_tag LOCUS_07390 46567 47277 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083731.1 protein_id gnl|my_center|LOCUS_07390 47360 48361 gene locus_tag LOCUS_07400 47360 48361 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388951.1 protein_id gnl|my_center|LOCUS_07400 48371 50770 gene locus_tag LOCUS_07410 48371 50770 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531144.1 protein_id gnl|my_center|LOCUS_07410 50812 50887 gene locus_tag LOCUS_t00200 50812 50887 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 51629 51811 gene locus_tag LOCUS_07420 51629 51811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 51875 52171 gene locus_tag LOCUS_07430 51875 52171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 52183 52347 gene locus_tag LOCUS_07440 52183 52347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 52717 53052 gene locus_tag LOCUS_07450 52717 53052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 53471 52944 gene locus_tag LOCUS_07460 53471 52944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 53429 53749 gene locus_tag LOCUS_07470 53429 53749 CDS product DUF3768 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331421.1 protein_id gnl|my_center|LOCUS_07470 53919 54899 gene locus_tag LOCUS_07480 53919 54899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 55623 56165 gene locus_tag LOCUS_07490 55623 56165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 56584 56162 gene locus_tag LOCUS_07500 56584 56162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 56989 56669 gene locus_tag LOCUS_07510 56989 56669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence08 1115 126 gene locus_tag LOCUS_07520 gene mltG 1115 126 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388178.1 protein_id gnl|my_center|LOCUS_07520 2387 1119 gene locus_tag LOCUS_07530 gene fabF 2387 1119 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388177.1 protein_id gnl|my_center|LOCUS_07530 2713 2480 gene locus_tag LOCUS_07540 2713 2480 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388176.1 protein_id gnl|my_center|LOCUS_07540 2962 3909 gene locus_tag LOCUS_07550 2962 3909 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228449.1 protein_id gnl|my_center|LOCUS_07550 3996 5036 gene locus_tag LOCUS_07560 gene mtaB 3996 5036 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388937.1 protein_id gnl|my_center|LOCUS_07560 5029 5973 gene locus_tag LOCUS_07570 5029 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 5961 7262 gene locus_tag LOCUS_07580 5961 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 7234 8064 gene locus_tag LOCUS_07590 7234 8064 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275350.1 protein_id gnl|my_center|LOCUS_07590 8086 8910 gene locus_tag LOCUS_07600 8086 8910 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387778.1 protein_id gnl|my_center|LOCUS_07600 8946 9031 gene locus_tag LOCUS_t00210 8946 9031 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9627 10187 gene locus_tag LOCUS_07610 9627 10187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 10193 11779 gene locus_tag LOCUS_07620 10193 11779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 11760 12380 gene locus_tag LOCUS_07630 11760 12380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 12507 13871 gene locus_tag LOCUS_07640 12507 13871 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_07640 14582 13872 gene locus_tag LOCUS_07650 14582 13872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 14770 14579 gene locus_tag LOCUS_07660 14770 14579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 14949 14874 gene locus_tag LOCUS_t00220 14949 14874 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 15085 16242 gene locus_tag LOCUS_07670 15085 16242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 16242 16985 gene locus_tag LOCUS_07680 16242 16985 CDS product division plane positioning ATPase MipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382920.1 protein_id gnl|my_center|LOCUS_07680 17015 18637 gene locus_tag LOCUS_07690 17015 18637 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337820.1 protein_id gnl|my_center|LOCUS_07690 18658 21243 gene locus_tag LOCUS_07700 18658 21243 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390447.1 protein_id gnl|my_center|LOCUS_07700 21243 21971 gene locus_tag LOCUS_07710 gene hdaA 21243 21971 CDS product DnaA regulatory inactivator HdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312857.1 protein_id gnl|my_center|LOCUS_07710 21974 23557 gene locus_tag LOCUS_07720 21974 23557 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105582.1 protein_id gnl|my_center|LOCUS_07720 23611 24222 gene locus_tag LOCUS_07730 23611 24222 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706713.1 protein_id gnl|my_center|LOCUS_07730 24224 25363 gene locus_tag LOCUS_07740 24224 25363 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211643.1 protein_id gnl|my_center|LOCUS_07740 25385 28507 gene locus_tag LOCUS_07750 25385 28507 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967876.1 protein_id gnl|my_center|LOCUS_07750 29098 28562 gene locus_tag LOCUS_07760 29098 28562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 29464 29114 gene locus_tag LOCUS_07770 29464 29114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 31974 29470 gene locus_tag LOCUS_07780 gene clpB 31974 29470 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529464.1 protein_id gnl|my_center|LOCUS_07780 32557 32868 gene locus_tag LOCUS_07790 32557 32868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 32865 33338 gene locus_tag LOCUS_07800 32865 33338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 33978 33340 gene locus_tag LOCUS_07810 33978 33340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 33973 34200 gene locus_tag LOCUS_07820 33973 34200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 34284 34209 gene locus_tag LOCUS_t00230 34284 34209 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 34423 34902 gene locus_tag LOCUS_07830 34423 34902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 34895 35266 gene locus_tag LOCUS_07840 34895 35266 CDS product protease inhibitor I42 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085581.1 protein_id gnl|my_center|LOCUS_07840 35335 35526 gene locus_tag LOCUS_07850 35335 35526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 35628 35795 gene locus_tag LOCUS_07860 35628 35795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 35978 36682 gene locus_tag LOCUS_07870 35978 36682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 37118 36735 gene locus_tag LOCUS_07880 gene rplS 37118 36735 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388943.1 protein_id gnl|my_center|LOCUS_07880 37848 37156 gene locus_tag LOCUS_07890 gene trmD 37848 37156 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388942.1 protein_id gnl|my_center|LOCUS_07890 38387 37842 gene locus_tag LOCUS_07900 gene rimM 38387 37842 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528858.1 protein_id gnl|my_center|LOCUS_07900 38799 38422 gene locus_tag LOCUS_07910 gene rpsP 38799 38422 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388940.1 protein_id gnl|my_center|LOCUS_07910 40237 38849 gene locus_tag LOCUS_07920 gene ffh 40237 38849 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388939.1 protein_id gnl|my_center|LOCUS_07920 40499 40771 gene locus_tag LOCUS_07930 40499 40771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 41210 40833 gene locus_tag LOCUS_07940 41210 40833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 42531 41236 gene locus_tag LOCUS_07950 gene hflX 42531 41236 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389375.1 protein_id gnl|my_center|LOCUS_07950 42756 42538 gene locus_tag LOCUS_07960 gene hfq 42756 42538 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389374.1 protein_id gnl|my_center|LOCUS_07960 44324 42870 gene locus_tag LOCUS_07970 gene gatB 44324 42870 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390923.1 protein_id gnl|my_center|LOCUS_07970 45781 44327 gene locus_tag LOCUS_07980 gene gatA 45781 44327 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971541.1 protein_id gnl|my_center|LOCUS_07980 46068 45781 gene locus_tag LOCUS_07990 gene gatC 46068 45781 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531787.1 protein_id gnl|my_center|LOCUS_07990 47834 46083 gene locus_tag LOCUS_08000 47834 46083 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390371.1 protein_id gnl|my_center|LOCUS_08000 48745 47915 gene locus_tag LOCUS_08010 gene fabI 48745 47915 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390374.1 protein_id gnl|my_center|LOCUS_08010 48847 49734 gene locus_tag LOCUS_08020 48847 49734 CDS product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456793.1 protein_id gnl|my_center|LOCUS_08020 49868 50893 gene locus_tag LOCUS_08030 gene recA 49868 50893 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390446.1 protein_id gnl|my_center|LOCUS_08030 51521 51003 gene locus_tag LOCUS_08040 51521 51003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 51651 52151 gene locus_tag LOCUS_08050 51651 52151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 52118 52270 gene locus_tag LOCUS_08060 52118 52270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence09 868 155 gene locus_tag LOCUS_08070 868 155 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196980.1 protein_id gnl|my_center|LOCUS_08070 1084 875 gene locus_tag LOCUS_08080 1084 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 3148 1115 gene locus_tag LOCUS_08090 3148 1115 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 protein_id gnl|my_center|LOCUS_08090 4328 3537 gene locus_tag LOCUS_08100 gene pssA 4328 3537 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_08100 5035 4328 gene locus_tag LOCUS_08110 5035 4328 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338435.1 protein_id gnl|my_center|LOCUS_08110 5204 5290 gene locus_tag LOCUS_t00240 5204 5290 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5799 6137 gene locus_tag LOCUS_08120 5799 6137 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027987.1 protein_id gnl|my_center|LOCUS_08120 6424 6206 gene locus_tag LOCUS_08130 6424 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 7891 6530 gene locus_tag LOCUS_08140 7891 6530 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042593394.1 protein_id gnl|my_center|LOCUS_08140 9842 7902 gene locus_tag LOCUS_08150 9842 7902 CDS product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697391.1 protein_id gnl|my_center|LOCUS_08150 11017 9842 gene locus_tag LOCUS_08160 11017 9842 CDS product MacA family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951265.1 protein_id gnl|my_center|LOCUS_08160 11469 11020 gene locus_tag LOCUS_08170 11469 11020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 14057 11619 gene locus_tag LOCUS_08180 14057 11619 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_08180 14207 15595 gene locus_tag LOCUS_08190 14207 15595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 15687 17171 gene locus_tag LOCUS_08200 15687 17171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 17229 19196 gene locus_tag LOCUS_08210 17229 19196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 19376 20260 gene locus_tag LOCUS_08220 gene hutG 19376 20260 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169047.1 protein_id gnl|my_center|LOCUS_08220 20419 21021 gene locus_tag LOCUS_08230 20419 21021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 21030 21767 gene locus_tag LOCUS_08240 21030 21767 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402843.1 protein_id gnl|my_center|LOCUS_08240 21887 24313 gene locus_tag LOCUS_08250 21887 24313 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_08250 24905 24360 gene locus_tag LOCUS_08260 24905 24360 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052021.1 protein_id gnl|my_center|LOCUS_08260 25794 24907 gene locus_tag LOCUS_08270 25794 24907 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477402.1 protein_id gnl|my_center|LOCUS_08270 25959 27710 gene locus_tag LOCUS_08280 25959 27710 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107752.1 protein_id gnl|my_center|LOCUS_08280 27730 28344 gene locus_tag LOCUS_08290 27730 28344 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_08290 30246 28429 gene locus_tag LOCUS_08300 30246 28429 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337826.1 protein_id gnl|my_center|LOCUS_08300 30792 30295 gene locus_tag LOCUS_08310 30792 30295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921482.1 protein_id gnl|my_center|LOCUS_08310 31482 30985 gene locus_tag LOCUS_08320 31482 30985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 31726 31799 gene locus_tag LOCUS_t00250 31726 31799 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 32711 32214 gene locus_tag LOCUS_08330 32711 32214 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029744075.1 protein_id gnl|my_center|LOCUS_08330 34611 32701 gene locus_tag LOCUS_08340 34611 32701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 35289 34687 gene locus_tag LOCUS_08350 35289 34687 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_08350 35554 37128 gene locus_tag LOCUS_08360 gene murJ 35554 37128 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391285.1 protein_id gnl|my_center|LOCUS_08360 37121 38179 gene locus_tag LOCUS_08370 37121 38179 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073652.1 protein_id gnl|my_center|LOCUS_08370 38183 38722 gene locus_tag LOCUS_08380 38183 38722 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639868.1 protein_id gnl|my_center|LOCUS_08380 38773 39654 gene locus_tag LOCUS_08390 38773 39654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 39638 40357 gene locus_tag LOCUS_08400 gene gloB 39638 40357 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529378.1 protein_id gnl|my_center|LOCUS_08400 40366 41991 gene locus_tag LOCUS_08410 40366 41991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 42055 42276 gene locus_tag LOCUS_08420 gene infA 42055 42276 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004617696.1 protein_id gnl|my_center|LOCUS_08420 42795 42382 gene locus_tag LOCUS_08430 42795 42382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 43010 42795 gene locus_tag LOCUS_08440 43010 42795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 43221 43427 gene locus_tag LOCUS_08450 43221 43427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 43879 43487 gene locus_tag LOCUS_08460 43879 43487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 44421 43945 gene locus_tag LOCUS_08470 44421 43945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 >Feature sequence10 208 1053 gene locus_tag LOCUS_08480 208 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1140 1331 gene locus_tag LOCUS_08490 1140 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 1318 3456 gene locus_tag LOCUS_08500 1318 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 3456 4778 gene locus_tag LOCUS_08510 3456 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4796 5518 gene locus_tag LOCUS_08520 4796 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 5511 7094 gene locus_tag LOCUS_08530 5511 7094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 7107 9308 gene locus_tag LOCUS_08540 7107 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 9477 10421 gene locus_tag LOCUS_08550 9477 10421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 10534 12243 gene locus_tag LOCUS_08560 10534 12243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 12268 12828 gene locus_tag LOCUS_08570 12268 12828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 12841 14109 gene locus_tag LOCUS_08580 12841 14109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 14123 14797 gene locus_tag LOCUS_08590 14123 14797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 16620 14833 gene locus_tag LOCUS_08600 16620 14833 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392712.1 protein_id gnl|my_center|LOCUS_08600 16742 17500 gene locus_tag LOCUS_08610 16742 17500 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085310.1 protein_id gnl|my_center|LOCUS_08610 17581 18345 gene locus_tag LOCUS_08620 17581 18345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 18432 19085 gene locus_tag LOCUS_08630 18432 19085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 19413 19207 gene locus_tag LOCUS_08640 gene rpsU 19413 19207 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388798.1 protein_id gnl|my_center|LOCUS_08640 19716 19504 gene locus_tag LOCUS_08650 19716 19504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 19856 20941 gene locus_tag LOCUS_08660 19856 20941 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388802.1 protein_id gnl|my_center|LOCUS_08660 21019 21303 gene locus_tag LOCUS_08670 gene rpmB 21019 21303 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527451.1 protein_id gnl|my_center|LOCUS_08670 23590 21509 gene locus_tag LOCUS_08680 gene rpoD 23590 21509 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390632.1 protein_id gnl|my_center|LOCUS_08680 25513 23747 gene locus_tag LOCUS_08690 gene dnaG 25513 23747 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390633.1 protein_id gnl|my_center|LOCUS_08690 25999 25547 gene locus_tag LOCUS_08700 25999 25547 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090104.1 protein_id gnl|my_center|LOCUS_08700 27895 26018 gene locus_tag LOCUS_08710 gene ppiD 27895 26018 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969376.1 protein_id gnl|my_center|LOCUS_08710 28049 28804 gene locus_tag LOCUS_08720 gene tpiA 28049 28804 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389642.1 protein_id gnl|my_center|LOCUS_08720 28828 29235 gene locus_tag LOCUS_08730 28828 29235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 29307 29774 gene locus_tag LOCUS_08740 29307 29774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08740 30077 29907 gene locus_tag LOCUS_08750 30077 29907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 30397 30609 gene locus_tag LOCUS_08760 30397 30609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 30706 30987 gene locus_tag LOCUS_08770 30706 30987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 31053 31238 gene locus_tag LOCUS_08780 31053 31238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 31935 31453 gene locus_tag LOCUS_08790 gene pgpA 31935 31453 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261429.1 protein_id gnl|my_center|LOCUS_08790 34560 31948 gene locus_tag LOCUS_08800 gene adhE 34560 31948 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056082.1 protein_id gnl|my_center|LOCUS_08800 34727 35020 gene locus_tag LOCUS_08810 34727 35020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 35111 36376 gene locus_tag LOCUS_08820 35111 36376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 36425 36679 gene locus_tag LOCUS_08830 36425 36679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 40163 36819 gene locus_tag LOCUS_08840 40163 36819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 41047 40175 gene locus_tag LOCUS_08850 41047 40175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 41214 43196 gene locus_tag LOCUS_08860 gene uvrB 41214 43196 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470604.1 protein_id gnl|my_center|LOCUS_08860 43215 43655 gene locus_tag LOCUS_08870 gene rlmH 43215 43655 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383438.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence11 1442 2320 gene locus_tag LOCUS_08880 1442 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 2690 2926 gene locus_tag LOCUS_08890 2690 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 2923 3141 gene locus_tag LOCUS_08900 2923 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 3394 4515 gene locus_tag LOCUS_08910 3394 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 4841 4993 gene locus_tag LOCUS_08920 4841 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 5012 5647 gene locus_tag LOCUS_08930 5012 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 5651 6445 gene locus_tag LOCUS_08940 5651 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 6692 6618 gene locus_tag LOCUS_t00260 6692 6618 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7329 7111 gene locus_tag LOCUS_08950 7329 7111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 7428 7589 gene locus_tag LOCUS_08960 7428 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 7705 8136 gene locus_tag LOCUS_08970 7705 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 9159 8218 gene locus_tag LOCUS_08980 9159 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08980 10726 9182 gene locus_tag LOCUS_08990 10726 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08990 11122 10739 gene locus_tag LOCUS_09000 gene yajC 11122 10739 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722646.1 protein_id gnl|my_center|LOCUS_09000 12062 11211 gene locus_tag LOCUS_09010 12062 11211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 12233 13678 gene locus_tag LOCUS_09020 gene sufB 12233 13678 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390323.1 protein_id gnl|my_center|LOCUS_09020 13706 14464 gene locus_tag LOCUS_09030 gene sufC 13706 14464 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390322.1 protein_id gnl|my_center|LOCUS_09030 14465 15703 gene locus_tag LOCUS_09040 gene sufD 14465 15703 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946340.1 protein_id gnl|my_center|LOCUS_09040 15693 16223 gene locus_tag LOCUS_09050 15693 16223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 16213 16944 gene locus_tag LOCUS_09060 16213 16944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 16953 17255 gene locus_tag LOCUS_09070 16953 17255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 17262 17984 gene locus_tag LOCUS_09080 17262 17984 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390994.1 protein_id gnl|my_center|LOCUS_09080 18028 18249 gene locus_tag LOCUS_09090 18028 18249 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390993.1 protein_id gnl|my_center|LOCUS_09090 18273 18767 gene locus_tag LOCUS_09100 18273 18767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 18760 19404 gene locus_tag LOCUS_09110 18760 19404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 19475 20692 gene locus_tag LOCUS_09120 19475 20692 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650905.1 protein_id gnl|my_center|LOCUS_09120 20697 21122 gene locus_tag LOCUS_09130 20697 21122 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390319.1 protein_id gnl|my_center|LOCUS_09130 21124 21531 gene locus_tag LOCUS_09140 21124 21531 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626602.1 protein_id gnl|my_center|LOCUS_09140 21541 22743 gene locus_tag LOCUS_09150 gene sucC 21541 22743 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 protein_id gnl|my_center|LOCUS_09150 22743 23621 gene locus_tag LOCUS_09160 gene sucD 22743 23621 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918227.1 protein_id gnl|my_center|LOCUS_09160 23618 24337 gene locus_tag LOCUS_09170 23618 24337 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 protein_id gnl|my_center|LOCUS_09170 24413 25564 gene locus_tag LOCUS_09180 24413 25564 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263944.1 protein_id gnl|my_center|LOCUS_09180 25565 28711 gene locus_tag LOCUS_09190 25565 28711 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967876.1 protein_id gnl|my_center|LOCUS_09190 28704 30143 gene locus_tag LOCUS_09200 28704 30143 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924853.1 protein_id gnl|my_center|LOCUS_09200 30555 30070 gene locus_tag LOCUS_09210 30555 30070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 31223 30558 gene locus_tag LOCUS_09220 31223 30558 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_09220 32233 31226 gene locus_tag LOCUS_09230 32233 31226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 32389 33138 gene locus_tag LOCUS_09240 32389 33138 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440322.1 protein_id gnl|my_center|LOCUS_09240 33131 34276 gene locus_tag LOCUS_09250 33131 34276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 34433 34882 gene locus_tag LOCUS_09260 gene rplQ 34433 34882 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385298.1 protein_id gnl|my_center|LOCUS_09260 35187 34897 gene locus_tag LOCUS_09270 35187 34897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 35585 35510 gene locus_tag LOCUS_t00270 35585 35510 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 35768 36265 gene locus_tag LOCUS_09280 gene accB 35768 36265 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919749.1 protein_id gnl|my_center|LOCUS_09280 36283 37629 gene locus_tag LOCUS_09290 gene accC 36283 37629 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390188.1 protein_id gnl|my_center|LOCUS_09290 37636 38352 gene locus_tag LOCUS_09300 37636 38352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 38407 38985 gene locus_tag LOCUS_09310 38407 38985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 39010 39702 gene locus_tag LOCUS_09320 39010 39702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 39706 40755 gene locus_tag LOCUS_09330 39706 40755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 40865 40993 gene locus_tag LOCUS_09340 40865 40993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 41010 41498 gene locus_tag LOCUS_09350 41010 41498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence12 5145 1426 gene locus_tag LOCUS_09360 5145 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 6506 5352 gene locus_tag LOCUS_09370 6506 5352 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532708.1 protein_id gnl|my_center|LOCUS_09370 6750 7490 gene locus_tag LOCUS_09380 6750 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 7503 8111 gene locus_tag LOCUS_09390 7503 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 8865 8275 gene locus_tag LOCUS_09400 8865 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 9252 8998 gene locus_tag LOCUS_09410 9252 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 9532 9272 gene locus_tag LOCUS_09420 9532 9272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 11095 9623 gene locus_tag LOCUS_09430 gene aaxC 11095 9623 CDS product arginine/agmatine antiporter AaxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892188.1 protein_id gnl|my_center|LOCUS_09430 11751 11170 gene locus_tag LOCUS_09440 gene aaxB 11751 11170 CDS product pyruvoyl-dependent arginine decarboxylase AaxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883665.1 protein_id gnl|my_center|LOCUS_09440 11929 12201 gene locus_tag LOCUS_09450 gene csoR 11929 12201 CDS product copper-sensing transcriptional repressor CsoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228404.1 protein_id gnl|my_center|LOCUS_09450 12201 12857 gene locus_tag LOCUS_09460 12201 12857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 13067 12867 gene locus_tag LOCUS_09470 13067 12867 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704936.1 protein_id gnl|my_center|LOCUS_09470 13861 13124 gene locus_tag LOCUS_09480 gene fabG 13861 13124 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_09480 14831 13887 gene locus_tag LOCUS_09490 gene fabD 14831 13887 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388174.1 protein_id gnl|my_center|LOCUS_09490 14992 17250 gene locus_tag LOCUS_09500 14992 17250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 17829 17245 gene locus_tag LOCUS_09510 17829 17245 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161533195.1 protein_id gnl|my_center|LOCUS_09510 18454 17864 gene locus_tag LOCUS_09520 18454 17864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 19372 18524 gene locus_tag LOCUS_09530 gene folD 19372 18524 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722487.1 protein_id gnl|my_center|LOCUS_09530 19701 19384 gene locus_tag LOCUS_09540 19701 19384 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242528.1 protein_id gnl|my_center|LOCUS_09540 19990 19688 gene locus_tag LOCUS_09550 19990 19688 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310858.1 protein_id gnl|my_center|LOCUS_09550 21071 20022 gene locus_tag LOCUS_09560 21071 20022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 21530 21084 gene locus_tag LOCUS_09570 21530 21084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 21743 23041 gene locus_tag LOCUS_09580 gene miaB 21743 23041 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391517.1 protein_id gnl|my_center|LOCUS_09580 23043 24011 gene locus_tag LOCUS_09590 23043 24011 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391518.1 protein_id gnl|my_center|LOCUS_09590 23992 24522 gene locus_tag LOCUS_09600 gene ybeY 23992 24522 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970840.1 protein_id gnl|my_center|LOCUS_09600 24519 25379 gene locus_tag LOCUS_09610 24519 25379 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 protein_id gnl|my_center|LOCUS_09610 25354 26874 gene locus_tag LOCUS_09620 gene lnt 25354 26874 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391521.1 protein_id gnl|my_center|LOCUS_09620 27886 26918 gene locus_tag LOCUS_09630 27886 26918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 30705 28072 gene locus_tag LOCUS_09640 gene alaS 30705 28072 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532150.1 protein_id gnl|my_center|LOCUS_09640 31288 30806 gene locus_tag LOCUS_09650 31288 30806 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574643.1 protein_id gnl|my_center|LOCUS_09650 31446 33329 gene locus_tag LOCUS_09660 gene rnjA 31446 33329 CDS product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245660.1 protein_id gnl|my_center|LOCUS_09660 33340 34143 gene locus_tag LOCUS_09670 gene map 33340 34143 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388491.1 protein_id gnl|my_center|LOCUS_09670 34148 34843 gene locus_tag LOCUS_09680 gene radC 34148 34843 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385427.1 protein_id gnl|my_center|LOCUS_09680 35059 35135 gene locus_tag LOCUS_t00280 35059 35135 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 35771 35379 gene locus_tag LOCUS_09690 35771 35379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 36407 37357 gene locus_tag LOCUS_09700 36407 37357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 37865 38428 gene locus_tag LOCUS_09710 37865 38428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 38462 40141 gene locus_tag LOCUS_09720 gene ettA 38462 40141 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_09720 40151 40597 gene locus_tag LOCUS_09730 40151 40597 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001861299.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence13 727 1479 gene locus_tag LOCUS_09740 727 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1513 2217 gene locus_tag LOCUS_09750 1513 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 5389 2270 gene locus_tag LOCUS_09760 5389 2270 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 protein_id gnl|my_center|LOCUS_09760 6580 5396 gene locus_tag LOCUS_09770 6580 5396 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_09770 7041 6805 gene locus_tag LOCUS_09780 7041 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 7485 7240 gene locus_tag LOCUS_09790 7485 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 7518 7928 gene locus_tag LOCUS_09800 7518 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 8068 8571 gene locus_tag LOCUS_09810 8068 8571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 9367 8609 gene locus_tag LOCUS_09820 9367 8609 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596814.1 protein_id gnl|my_center|LOCUS_09820 9518 11533 gene locus_tag LOCUS_09830 9518 11533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 11536 12498 gene locus_tag LOCUS_09840 gene dusB 11536 12498 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_09840 12500 13858 gene locus_tag LOCUS_09850 gene trkA 12500 13858 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_09850 13860 14582 gene locus_tag LOCUS_09860 gene cobB 13860 14582 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105862.1 protein_id gnl|my_center|LOCUS_09860 14584 15234 gene locus_tag LOCUS_09870 14584 15234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 15578 15348 gene locus_tag LOCUS_09880 15578 15348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 15808 16818 gene locus_tag LOCUS_09890 gene metK 15808 16818 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852836.1 protein_id gnl|my_center|LOCUS_09890 17725 16862 gene locus_tag LOCUS_09900 17725 16862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 18710 17784 gene locus_tag LOCUS_09910 18710 17784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 18990 18700 gene locus_tag LOCUS_09920 18990 18700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 19234 19671 gene locus_tag LOCUS_09930 gene rplK 19234 19671 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390509.1 protein_id gnl|my_center|LOCUS_09930 19676 20359 gene locus_tag LOCUS_09940 gene rplA 19676 20359 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390508.1 protein_id gnl|my_center|LOCUS_09940 20427 21149 gene locus_tag LOCUS_09950 20427 21149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 21222 22277 gene locus_tag LOCUS_09960 21222 22277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 22783 22692 gene locus_tag LOCUS_t00290 22783 22692 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 23009 22920 gene locus_tag LOCUS_t00300 23009 22920 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 23163 23993 gene locus_tag LOCUS_09970 23163 23993 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_09970 24898 23990 gene locus_tag LOCUS_09980 gene fmt 24898 23990 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383426.1 protein_id gnl|my_center|LOCUS_09980 25426 24905 gene locus_tag LOCUS_09990 gene def 25426 24905 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310211.1 protein_id gnl|my_center|LOCUS_09990 25916 25413 gene locus_tag LOCUS_10000 gene nusB 25916 25413 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707539.1 protein_id gnl|my_center|LOCUS_10000 26397 25909 gene locus_tag LOCUS_10010 gene nrdR 26397 25909 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389579.1 protein_id gnl|my_center|LOCUS_10010 27580 26471 gene locus_tag LOCUS_10020 27580 26471 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087104.1 protein_id gnl|my_center|LOCUS_10020 27663 28910 gene locus_tag LOCUS_10030 gene tyrS 27663 28910 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389785.1 protein_id gnl|my_center|LOCUS_10030 29905 28970 gene locus_tag LOCUS_10040 29905 28970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 30920 29982 gene locus_tag LOCUS_10050 30920 29982 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318876.1 protein_id gnl|my_center|LOCUS_10050 31911 30934 gene locus_tag LOCUS_10060 31911 30934 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948545.1 protein_id gnl|my_center|LOCUS_10060 32033 34312 gene locus_tag LOCUS_10070 32033 34312 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389289.1 protein_id gnl|my_center|LOCUS_10070 34809 34351 gene locus_tag LOCUS_10080 gene bamE 34809 34351 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389352.1 protein_id gnl|my_center|LOCUS_10080 34868 35386 gene locus_tag LOCUS_10090 34868 35386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 35538 35726 gene locus_tag LOCUS_10100 gene rpmF 35538 35726 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389355.1 protein_id gnl|my_center|LOCUS_10100 35752 36804 gene locus_tag LOCUS_10110 gene plsX 35752 36804 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389356.1 protein_id gnl|my_center|LOCUS_10110 36791 37768 gene locus_tag LOCUS_10120 36791 37768 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971448.1 protein_id gnl|my_center|LOCUS_10120 37860 38144 gene locus_tag LOCUS_10130 gene ihfA 37860 38144 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719760.1 protein_id gnl|my_center|LOCUS_10130 38156 38566 gene locus_tag LOCUS_10140 38156 38566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 38821 39030 gene locus_tag LOCUS_10150 38821 39030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence14 79 681 gene locus_tag LOCUS_10160 79 681 CDS product master DNA invertase Mpi family serine-type recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680425.1 protein_id gnl|my_center|LOCUS_10160 765 1199 gene locus_tag LOCUS_10170 765 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1407 1925 gene locus_tag LOCUS_10180 1407 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 2903 1968 gene locus_tag LOCUS_10190 2903 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 4145 2916 gene locus_tag LOCUS_10200 4145 2916 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071664104.1 protein_id gnl|my_center|LOCUS_10200 4353 4147 gene locus_tag LOCUS_10210 4353 4147 CDS product type II toxin-antitoxin system Y4mF family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875278.1 protein_id gnl|my_center|LOCUS_10210 5608 4424 gene locus_tag LOCUS_10220 5608 4424 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_10220 6374 6787 gene locus_tag LOCUS_10230 6374 6787 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002661617.1 protein_id gnl|my_center|LOCUS_10230 7298 6843 gene locus_tag LOCUS_10240 7298 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 7543 8295 gene locus_tag LOCUS_10250 7543 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 8479 9312 gene locus_tag LOCUS_10260 8479 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 9314 10492 gene locus_tag LOCUS_10270 9314 10492 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_10270 11516 10722 gene locus_tag LOCUS_10280 11516 10722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 12058 15555 gene locus_tag LOCUS_10290 12058 15555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 15575 15895 gene locus_tag LOCUS_10300 15575 15895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 15971 17062 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agcatatcagagattgattgaacggtcaactataac 18060 17140 gene locus_tag LOCUS_10310 gene cas1 18060 17140 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002797819.1 protein_id gnl|my_center|LOCUS_10310 18667 18170 gene locus_tag LOCUS_10320 18667 18170 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_10320 18804 18728 gene locus_tag LOCUS_t00310 18804 18728 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 19042 20439 gene locus_tag LOCUS_10330 19042 20439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 20517 21053 gene locus_tag LOCUS_10340 20517 21053 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_10340 21243 21803 gene locus_tag LOCUS_10350 21243 21803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 22821 21856 gene locus_tag LOCUS_10360 22821 21856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 22799 23047 gene locus_tag LOCUS_10370 22799 23047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 23698 24099 gene locus_tag LOCUS_10380 23698 24099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 24321 24881 gene locus_tag LOCUS_10390 24321 24881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 25907 24987 gene locus_tag LOCUS_10400 25907 24987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 25878 26414 gene locus_tag LOCUS_10410 25878 26414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 26714 27844 gene locus_tag LOCUS_10420 26714 27844 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966309.1 protein_id gnl|my_center|LOCUS_10420 27904 28239 gene locus_tag LOCUS_10430 27904 28239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 28303 28614 gene locus_tag LOCUS_10440 28303 28614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 29304 28615 gene locus_tag LOCUS_10450 29304 28615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 29398 30954 gene locus_tag LOCUS_10460 29398 30954 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_10460 31155 33128 gene locus_tag LOCUS_10470 31155 33128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 33276 33647 gene locus_tag LOCUS_10480 gene rpsL 33276 33647 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390503.1 protein_id gnl|my_center|LOCUS_10480 33659 34129 gene locus_tag LOCUS_10490 gene rpsG 33659 34129 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507761.1 protein_id gnl|my_center|LOCUS_10490 34148 36226 gene locus_tag LOCUS_10500 gene fusA 34148 36226 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390501.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence15 1141 767 gene locus_tag LOCUS_10510 gene rplL 1141 767 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390506.1 protein_id gnl|my_center|LOCUS_10510 1681 1199 gene locus_tag LOCUS_10520 gene rplJ 1681 1199 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390507.1 protein_id gnl|my_center|LOCUS_10520 2578 1940 gene locus_tag LOCUS_10530 2578 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5226 2590 gene locus_tag LOCUS_10540 5226 2590 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389549.1 protein_id gnl|my_center|LOCUS_10540 5621 5328 gene locus_tag LOCUS_10550 5621 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 7025 5673 gene locus_tag LOCUS_10560 7025 5673 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626249.1 protein_id gnl|my_center|LOCUS_10560 7163 9655 gene locus_tag LOCUS_10570 7163 9655 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_10570 11675 9753 gene locus_tag LOCUS_10580 gene thrS 11675 9753 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391234.1 protein_id gnl|my_center|LOCUS_10580 12850 11678 gene locus_tag LOCUS_10590 12850 11678 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470668.1 protein_id gnl|my_center|LOCUS_10590 12898 13659 gene locus_tag LOCUS_10600 12898 13659 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391124.1 protein_id gnl|my_center|LOCUS_10600 14551 13676 gene locus_tag LOCUS_10610 gene accD 14551 13676 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626593.1 protein_id gnl|my_center|LOCUS_10610 14938 14552 gene locus_tag LOCUS_10620 14938 14552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 15241 14963 gene locus_tag LOCUS_10630 gene ihfB 15241 14963 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339437.1 protein_id gnl|my_center|LOCUS_10630 15994 15335 gene locus_tag LOCUS_10640 gene tsaB 15994 15335 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970837.1 protein_id gnl|my_center|LOCUS_10640 16084 17724 gene locus_tag LOCUS_10650 16084 17724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 17794 18669 gene locus_tag LOCUS_10660 17794 18669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 18740 19138 gene locus_tag LOCUS_10670 18740 19138 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639920.1 protein_id gnl|my_center|LOCUS_10670 19142 19420 gene locus_tag LOCUS_10680 19142 19420 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330408.1 protein_id gnl|my_center|LOCUS_10680 20422 19997 gene locus_tag LOCUS_10690 20422 19997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 20920 20636 gene locus_tag LOCUS_10700 20920 20636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 21774 21025 gene locus_tag LOCUS_10710 21774 21025 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596759.1 protein_id gnl|my_center|LOCUS_10710 25393 21845 gene locus_tag LOCUS_10720 25393 21845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 25549 26436 gene locus_tag LOCUS_10730 25549 26436 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196382.1 protein_id gnl|my_center|LOCUS_10730 26499 27398 gene locus_tag LOCUS_10740 26499 27398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 27719 27408 gene locus_tag LOCUS_10750 27719 27408 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169602550.1 protein_id gnl|my_center|LOCUS_10750 27849 29186 gene locus_tag LOCUS_10760 27849 29186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 29193 29612 gene locus_tag LOCUS_10770 29193 29612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 29672 30022 gene locus_tag LOCUS_10780 29672 30022 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115283.1 protein_id gnl|my_center|LOCUS_10780 30570 30013 gene locus_tag LOCUS_10790 30570 30013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 32613 30595 gene locus_tag LOCUS_10800 32613 30595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 32801 33352 gene locus_tag LOCUS_10810 32801 33352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 33342 35126 gene locus_tag LOCUS_10820 33342 35126 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390041.1 protein_id gnl|my_center|LOCUS_10820 35377 35198 gene locus_tag LOCUS_10830 35377 35198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 35551 35411 gene locus_tag LOCUS_10840 35551 35411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence16 5676 2119 gene locus_tag LOCUS_10850 gene nifJ 5676 2119 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940774.1 protein_id gnl|my_center|LOCUS_10850 5863 6846 gene locus_tag LOCUS_10860 gene galE 5863 6846 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931718.1 protein_id gnl|my_center|LOCUS_10860 6857 7615 gene locus_tag LOCUS_10870 6857 7615 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925340.1 protein_id gnl|my_center|LOCUS_10870 7707 7797 gene locus_tag LOCUS_t00320 7707 7797 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8078 8668 gene locus_tag LOCUS_10880 8078 8668 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033534649.1 protein_id gnl|my_center|LOCUS_10880 9210 8644 gene locus_tag LOCUS_10890 9210 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 11363 9483 gene locus_tag LOCUS_10900 11363 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 11993 11442 gene locus_tag LOCUS_10910 gene rsmD 11993 11442 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090226.1 protein_id gnl|my_center|LOCUS_10910 12722 12000 gene locus_tag LOCUS_10920 12722 12000 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388410.1 protein_id gnl|my_center|LOCUS_10920 12789 13286 gene locus_tag LOCUS_10930 12789 13286 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971070.1 protein_id gnl|my_center|LOCUS_10930 13312 14595 gene locus_tag LOCUS_10940 13312 14595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 15280 15717 gene locus_tag LOCUS_10950 15280 15717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 15717 15926 gene locus_tag LOCUS_10960 15717 15926 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089261.1 protein_id gnl|my_center|LOCUS_10960 16893 15916 gene locus_tag LOCUS_10970 16893 15916 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938071.1 protein_id gnl|my_center|LOCUS_10970 18559 16883 gene locus_tag LOCUS_10980 18559 16883 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 protein_id gnl|my_center|LOCUS_10980 19295 18576 gene locus_tag LOCUS_10990 19295 18576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 20713 19295 gene locus_tag LOCUS_11000 gene nuoN 20713 19295 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640367.1 protein_id gnl|my_center|LOCUS_11000 22144 20729 gene locus_tag LOCUS_11010 22144 20729 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 protein_id gnl|my_center|LOCUS_11010 23456 22146 gene locus_tag LOCUS_11020 23456 22146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 25405 23675 gene locus_tag LOCUS_11030 25405 23675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 23717 23792 gene locus_tag LOCUS_t00330 23717 23792 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 25538 25332 gene locus_tag LOCUS_11040 25538 25332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 26191 25664 gene locus_tag LOCUS_11050 26191 25664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 26755 26243 gene locus_tag LOCUS_11060 26755 26243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 27206 26766 gene locus_tag LOCUS_11070 27206 26766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 27974 29389 gene locus_tag LOCUS_11080 27974 29389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 30359 29538 gene locus_tag LOCUS_11090 30359 29538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 31017 30361 gene locus_tag LOCUS_11100 31017 30361 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108571.1 protein_id gnl|my_center|LOCUS_11100 32120 31536 gene locus_tag LOCUS_11110 32120 31536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 32346 32185 gene locus_tag LOCUS_11120 32346 32185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 32672 32346 gene locus_tag LOCUS_11130 32672 32346 CDS product DUF3768 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331421.1 protein_id gnl|my_center|LOCUS_11130 33189 32665 gene locus_tag LOCUS_11140 33189 32665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 34542 33364 gene locus_tag LOCUS_11150 34542 33364 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165271498.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence17 3788 468 gene locus_tag LOCUS_11160 3788 468 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143843.1 protein_id gnl|my_center|LOCUS_11160 4864 3806 gene locus_tag LOCUS_11170 4864 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 5828 4854 gene locus_tag LOCUS_11180 5828 4854 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109063.1 protein_id gnl|my_center|LOCUS_11180 6059 6649 gene locus_tag LOCUS_11190 6059 6649 CDS product master DNA invertase Mpi family serine-type recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680425.1 protein_id gnl|my_center|LOCUS_11190 8598 6640 gene locus_tag LOCUS_11200 8598 6640 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681134.1 protein_id gnl|my_center|LOCUS_11200 8724 8921 gene locus_tag LOCUS_11210 8724 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 9467 9147 gene locus_tag LOCUS_11220 9467 9147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 10680 9478 gene locus_tag LOCUS_11230 10680 9478 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_11230 10884 12206 gene locus_tag LOCUS_11240 10884 12206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 13507 12689 gene locus_tag LOCUS_11250 gene blaCDD 13507 12689 CDS product CDD family class D beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021358847.1 protein_id gnl|my_center|LOCUS_11250 13773 13594 gene locus_tag LOCUS_11260 13773 13594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 14629 14063 gene locus_tag LOCUS_11270 14629 14063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 14876 15085 gene locus_tag LOCUS_11280 14876 15085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 15379 15687 gene locus_tag LOCUS_11290 15379 15687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 15680 15979 gene locus_tag LOCUS_11300 15680 15979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 16465 16202 gene locus_tag LOCUS_11310 16465 16202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 17001 16510 gene locus_tag LOCUS_11320 17001 16510 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372695.1 protein_id gnl|my_center|LOCUS_11320 17515 17042 gene locus_tag LOCUS_11330 17515 17042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 18090 17623 gene locus_tag LOCUS_11340 18090 17623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 23056 18899 gene locus_tag LOCUS_11350 23056 18899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 23758 23279 gene locus_tag LOCUS_11360 23758 23279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 23736 23915 gene locus_tag LOCUS_11370 23736 23915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 24377 23919 gene locus_tag LOCUS_11380 24377 23919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 24569 25693 gene locus_tag LOCUS_11390 gene tgt 24569 25693 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337793.1 protein_id gnl|my_center|LOCUS_11390 25696 26637 gene locus_tag LOCUS_11400 25696 26637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 26651 28411 gene locus_tag LOCUS_11410 26651 28411 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444571.1 protein_id gnl|my_center|LOCUS_11410 28497 29546 gene locus_tag LOCUS_11420 gene fba 28497 29546 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388354.1 protein_id gnl|my_center|LOCUS_11420 29782 29609 gene locus_tag LOCUS_11430 29782 29609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence18 1494 136 gene locus_tag LOCUS_11440 1494 136 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389881.1 protein_id gnl|my_center|LOCUS_11440 2209 1517 gene locus_tag LOCUS_11450 2209 1517 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389880.1 protein_id gnl|my_center|LOCUS_11450 2985 2218 gene locus_tag LOCUS_11460 2985 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 4849 3047 gene locus_tag LOCUS_11470 gene uvrC 4849 3047 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389875.1 protein_id gnl|my_center|LOCUS_11470 5173 4853 gene locus_tag LOCUS_11480 5173 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 6204 5170 gene locus_tag LOCUS_11490 6204 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 7391 6225 gene locus_tag LOCUS_11500 7391 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 7516 9327 gene locus_tag LOCUS_11510 7516 9327 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388768.1 protein_id gnl|my_center|LOCUS_11510 9400 9987 gene locus_tag LOCUS_11520 9400 9987 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932204.1 protein_id gnl|my_center|LOCUS_11520 10548 11285 gene locus_tag LOCUS_11530 10548 11285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 11289 11714 gene locus_tag LOCUS_11540 gene tolR 11289 11714 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388847.1 protein_id gnl|my_center|LOCUS_11540 11720 12709 gene locus_tag LOCUS_11550 11720 12709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 13503 12706 gene locus_tag LOCUS_11560 13503 12706 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388840.1 protein_id gnl|my_center|LOCUS_11560 14080 13712 gene locus_tag LOCUS_11570 14080 13712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 14315 14055 gene locus_tag LOCUS_11580 14315 14055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 14403 14948 gene locus_tag LOCUS_11590 14403 14948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 14998 15561 gene locus_tag LOCUS_11600 gene efp 14998 15561 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388832.1 protein_id gnl|my_center|LOCUS_11600 15561 16349 gene locus_tag LOCUS_11610 15561 16349 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_11610 16444 16674 gene locus_tag LOCUS_11620 gene rpmE 16444 16674 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388827.1 protein_id gnl|my_center|LOCUS_11620 16823 17560 gene locus_tag LOCUS_11630 16823 17560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 18875 17625 gene locus_tag LOCUS_11640 18875 17625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 19803 18883 gene locus_tag LOCUS_11650 19803 18883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 19938 20375 gene locus_tag LOCUS_11660 19938 20375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 20443 22221 gene locus_tag LOCUS_11670 gene msbA 20443 22221 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence19 155 682 gene locus_tag LOCUS_11680 155 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1241 1825 gene locus_tag LOCUS_11690 1241 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 2833 2759 gene locus_tag LOCUS_t00340 2833 2759 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3757 2906 gene locus_tag LOCUS_11700 3757 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3848 5212 gene locus_tag LOCUS_11710 3848 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 5395 6171 gene locus_tag LOCUS_11720 5395 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 6321 7220 gene locus_tag LOCUS_11730 6321 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 7236 8504 gene locus_tag LOCUS_11740 7236 8504 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114332.1 protein_id gnl|my_center|LOCUS_11740 8581 9420 gene locus_tag LOCUS_11750 8581 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 9430 10572 gene locus_tag LOCUS_11760 9430 10572 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_11760 10573 11220 gene locus_tag LOCUS_11770 gene tmk 10573 11220 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919690.1 protein_id gnl|my_center|LOCUS_11770 11217 12290 gene locus_tag LOCUS_11780 11217 12290 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087288.1 protein_id gnl|my_center|LOCUS_11780 12292 13098 gene locus_tag LOCUS_11790 12292 13098 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_11790 13086 13877 gene locus_tag LOCUS_11800 13086 13877 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389389.1 protein_id gnl|my_center|LOCUS_11800 13881 14756 gene locus_tag LOCUS_11810 13881 14756 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024060.1 protein_id gnl|my_center|LOCUS_11810 17408 15381 gene locus_tag LOCUS_11820 17408 15381 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 protein_id gnl|my_center|LOCUS_11820 18590 17409 gene locus_tag LOCUS_11830 gene lpxB 18590 17409 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389474.1 protein_id gnl|my_center|LOCUS_11830 19416 18577 gene locus_tag LOCUS_11840 gene lpxI 19416 18577 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389473.1 protein_id gnl|my_center|LOCUS_11840 19577 19807 gene locus_tag LOCUS_11850 19577 19807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 20008 20451 gene locus_tag LOCUS_11860 20008 20451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence20 534 166 gene locus_tag LOCUS_11870 gene ygiW 534 166 CDS product OB fold stress tolerance protein YgiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712658.1 protein_id gnl|my_center|LOCUS_11870 668 2803 gene locus_tag LOCUS_11880 668 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 2991 2917 gene locus_tag LOCUS_t00350 2991 2917 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3075 3001 gene locus_tag LOCUS_t00360 3075 3001 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3229 3663 gene locus_tag LOCUS_11890 gene rpiB 3229 3663 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080405.1 protein_id gnl|my_center|LOCUS_11890 3670 4926 gene locus_tag LOCUS_11900 3670 4926 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338519.1 protein_id gnl|my_center|LOCUS_11900 6474 4930 gene locus_tag LOCUS_11910 6474 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 7160 6474 gene locus_tag LOCUS_11920 7160 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 7257 8276 gene locus_tag LOCUS_11930 7257 8276 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002242382.1 protein_id gnl|my_center|LOCUS_11930 8273 8686 gene locus_tag LOCUS_11940 8273 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 8687 9532 gene locus_tag LOCUS_11950 8687 9532 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_11950 9522 10847 gene locus_tag LOCUS_11960 gene rsxC 9522 10847 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788158.1 protein_id gnl|my_center|LOCUS_11960 10859 11857 gene locus_tag LOCUS_11970 10859 11857 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_11970 11857 12447 gene locus_tag LOCUS_11980 11857 12447 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_11980 12444 13040 gene locus_tag LOCUS_11990 12444 13040 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_11990 13047 13628 gene locus_tag LOCUS_12000 gene rsxA 13047 13628 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761247.1 protein_id gnl|my_center|LOCUS_12000 14265 13633 gene locus_tag LOCUS_12010 14265 13633 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_12010 14425 14988 gene locus_tag LOCUS_12020 14425 14988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 15784 15155 gene locus_tag LOCUS_12030 15784 15155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 16508 15903 gene locus_tag LOCUS_12040 16508 15903 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775732.1 protein_id gnl|my_center|LOCUS_12040 17969 16539 gene locus_tag LOCUS_12050 gene pyk 17969 16539 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390218.1 protein_id gnl|my_center|LOCUS_12050 18125 18367 gene locus_tag LOCUS_12060 18125 18367 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970195.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence21 493 41 gene locus_tag LOCUS_12070 493 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1436 486 gene locus_tag LOCUS_12080 1436 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1604 2836 gene locus_tag LOCUS_12090 1604 2836 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063044.1 protein_id gnl|my_center|LOCUS_12090 3332 2880 gene locus_tag LOCUS_12100 3332 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 5047 3350 gene locus_tag LOCUS_12110 5047 3350 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 protein_id gnl|my_center|LOCUS_12110 5916 5047 gene locus_tag LOCUS_12120 5916 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 6001 6762 gene locus_tag LOCUS_12130 6001 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 6831 7145 gene locus_tag LOCUS_12140 6831 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 7203 7835 gene locus_tag LOCUS_12150 7203 7835 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390957.1 protein_id gnl|my_center|LOCUS_12150 9194 7815 gene locus_tag LOCUS_12160 9194 7815 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640355.1 protein_id gnl|my_center|LOCUS_12160 11662 9164 gene locus_tag LOCUS_12170 11662 9164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 12890 13024 gene locus_tag LOCUS_12180 12890 13024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 13156 13983 gene locus_tag LOCUS_12190 13156 13983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 14118 14834 gene locus_tag LOCUS_12200 14118 14834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 14856 15443 gene locus_tag LOCUS_12210 14856 15443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 16069 15503 gene locus_tag LOCUS_12220 16069 15503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence22 1587 559 gene locus_tag LOCUS_12230 1587 559 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625876.1 protein_id gnl|my_center|LOCUS_12230 1914 1675 gene locus_tag LOCUS_12240 1914 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2066 3904 gene locus_tag LOCUS_12250 gene htpG 2066 3904 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387833.1 protein_id gnl|my_center|LOCUS_12250 4049 6736 gene locus_tag LOCUS_12260 gene ppdK 4049 6736 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390706.1 protein_id gnl|my_center|LOCUS_12260 6867 8297 gene locus_tag LOCUS_12270 6867 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 8579 8503 gene locus_tag LOCUS_t00370 8579 8503 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8723 8799 gene locus_tag LOCUS_t00380 8723 8799 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9629 8949 gene locus_tag LOCUS_12280 9629 8949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 10869 9616 gene locus_tag LOCUS_12290 10869 9616 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_12290 12358 11186 gene locus_tag LOCUS_12300 12358 11186 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_12300 12657 12355 gene locus_tag LOCUS_12310 12657 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 13111 12731 gene locus_tag LOCUS_12320 13111 12731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 13699 13115 gene locus_tag LOCUS_12330 13699 13115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 13926 13765 gene locus_tag LOCUS_12340 13926 13765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 14252 13926 gene locus_tag LOCUS_12350 14252 13926 CDS product DUF3768 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331421.1 protein_id gnl|my_center|LOCUS_12350 14769 14245 gene locus_tag LOCUS_12360 14769 14245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 15230 15048 gene locus_tag LOCUS_12370 15230 15048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence23 2888 2130 gene locus_tag LOCUS_12380 2888 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 4289 2973 gene locus_tag LOCUS_12390 4289 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 5574 4597 gene locus_tag LOCUS_12400 5574 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 5653 5958 gene locus_tag LOCUS_12410 5653 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 6011 6199 gene locus_tag LOCUS_12420 6011 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 6199 6498 gene locus_tag LOCUS_12430 6199 6498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 6554 7510 gene locus_tag LOCUS_12440 6554 7510 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085412.1 protein_id gnl|my_center|LOCUS_12440 7511 8074 gene locus_tag LOCUS_12450 7511 8074 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003319037.1 protein_id gnl|my_center|LOCUS_12450 9175 8084 gene locus_tag LOCUS_12460 9175 8084 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390013.1 protein_id gnl|my_center|LOCUS_12460 10233 9172 gene locus_tag LOCUS_12470 10233 9172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 10383 11384 gene locus_tag LOCUS_12480 gene pta 10383 11384 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130342.1 protein_id gnl|my_center|LOCUS_12480 11415 12596 gene locus_tag LOCUS_12490 gene ackA 11415 12596 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_12490 12851 12672 gene locus_tag LOCUS_12500 12851 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 13180 12854 gene locus_tag LOCUS_12510 13180 12854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence24 1762 341 gene locus_tag LOCUS_12520 gene hydG 1762 341 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_12520 2114 1881 gene locus_tag LOCUS_12530 2114 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 2272 2535 gene locus_tag LOCUS_12540 2272 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 2535 3032 gene locus_tag LOCUS_12550 2535 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 3025 3600 gene locus_tag LOCUS_12560 3025 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 4363 3659 gene locus_tag LOCUS_12570 4363 3659 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387998.1 protein_id gnl|my_center|LOCUS_12570 5300 4323 gene locus_tag LOCUS_12580 5300 4323 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086746.1 protein_id gnl|my_center|LOCUS_12580 6387 5290 gene locus_tag LOCUS_12590 6387 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 7480 6377 gene locus_tag LOCUS_12600 gene ccrM 7480 6377 CDS product adenine-specific DNA-methyltransferase CcrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918266.1 protein_id gnl|my_center|LOCUS_12600 8232 7570 gene locus_tag LOCUS_12610 8232 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 8350 9045 gene locus_tag LOCUS_12620 gene ftsE 8350 9045 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626546.1 protein_id gnl|my_center|LOCUS_12620 9038 9952 gene locus_tag LOCUS_12630 9038 9952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 9954 10550 gene locus_tag LOCUS_12640 9954 10550 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391004.1 protein_id gnl|my_center|LOCUS_12640 10553 11326 gene locus_tag LOCUS_12650 10553 11326 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626547.1 protein_id gnl|my_center|LOCUS_12650 11365 11453 gene locus_tag LOCUS_t00390 11365 11453 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence25 4878 3118 gene locus_tag LOCUS_12660 gene aspS 4878 3118 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_12660 5009 6184 gene locus_tag LOCUS_12670 gene rnd 5009 6184 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_12670 6493 6212 gene locus_tag LOCUS_12680 6493 6212 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053149.1 protein_id gnl|my_center|LOCUS_12680 6679 7560 gene locus_tag LOCUS_12690 gene ybgF 6679 7560 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388851.1 protein_id gnl|my_center|LOCUS_12690 7551 8633 gene locus_tag LOCUS_12700 7551 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 8630 9277 gene locus_tag LOCUS_12710 8630 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 9353 10675 gene locus_tag LOCUS_12720 gene gltX 9353 10675 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388446.1 protein_id gnl|my_center|LOCUS_12720 10677 12056 gene locus_tag LOCUS_12730 gene cysS 10677 12056 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388447.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence26 3511 464 gene locus_tag LOCUS_12740 3511 464 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202280.1 protein_id gnl|my_center|LOCUS_12740 5500 3524 gene locus_tag LOCUS_12750 5500 3524 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197693007.1 protein_id gnl|my_center|LOCUS_12750 6566 5493 gene locus_tag LOCUS_12760 6566 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 7212 6559 gene locus_tag LOCUS_12770 7212 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 10424 7212 gene locus_tag LOCUS_12780 10424 7212 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence27 3000 559 gene locus_tag LOCUS_12790 gene gyrB 3000 559 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387765.1 protein_id gnl|my_center|LOCUS_12790 5827 3122 gene locus_tag LOCUS_12800 gene polA 5827 3122 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391261.1 protein_id gnl|my_center|LOCUS_12800 5915 7756 gene locus_tag LOCUS_12810 5915 7756 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083732.1 protein_id gnl|my_center|LOCUS_12810 8541 7897 gene locus_tag LOCUS_12820 8541 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence28 476 403 gene locus_tag LOCUS_t00400 476 403 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 881 489 gene locus_tag LOCUS_12830 881 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1021 2247 gene locus_tag LOCUS_12840 1021 2247 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_12840 2353 3219 gene locus_tag LOCUS_12850 2353 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 4949 3222 gene locus_tag LOCUS_12860 gene argS 4949 3222 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921188.1 protein_id gnl|my_center|LOCUS_12860 5282 4965 gene locus_tag LOCUS_12870 5282 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 5342 5950 gene locus_tag LOCUS_12880 5342 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 5964 6503 gene locus_tag LOCUS_12890 5964 6503 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060742.1 protein_id gnl|my_center|LOCUS_12890 6617 8134 gene locus_tag LOCUS_12900 gene proS 6617 8134 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921836.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence29 1032 58 gene locus_tag LOCUS_12910 1032 58 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161745.1 protein_id gnl|my_center|LOCUS_12910 1491 1132 gene locus_tag LOCUS_12920 1491 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 2208 1576 gene locus_tag LOCUS_12930 2208 1576 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_12930 2519 3799 gene locus_tag LOCUS_12940 gene eno 2519 3799 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389638.1 protein_id gnl|my_center|LOCUS_12940 3929 4234 gene locus_tag LOCUS_12950 3929 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 5082 4381 gene locus_tag LOCUS_12960 5082 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 5216 5422 gene locus_tag LOCUS_12970 5216 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 6382 5453 gene locus_tag LOCUS_12980 gene yhdJ 6382 5453 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258883.1 protein_id gnl|my_center|LOCUS_12980 8319 6499 gene locus_tag LOCUS_12990 gene typA 8319 6499 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence30 3540 781 gene locus_tag LOCUS_13000 3540 781 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680808.1 protein_id gnl|my_center|LOCUS_13000 4612 3638 gene locus_tag LOCUS_13010 4612 3638 CDS product DUF3644 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933110.1 protein_id gnl|my_center|LOCUS_13010 5529 4633 gene locus_tag LOCUS_13020 5529 4633 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence31 2129 423 gene locus_tag LOCUS_13030 gene yidC 2129 423 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391086.1 protein_id gnl|my_center|LOCUS_13030 2432 2184 gene locus_tag LOCUS_13040 gene yidD 2432 2184 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_13040 2781 2416 gene locus_tag LOCUS_13050 2781 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 2929 2795 gene locus_tag LOCUS_13060 gene rpmH 2929 2795 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008542748.1 protein_id gnl|my_center|LOCUS_13060 3805 3086 gene locus_tag LOCUS_13070 3805 3086 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508710.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence32 33 515 gene locus_tag LOCUS_13080 33 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 939 1769 gene locus_tag LOCUS_13090 939 1769 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900005.1 protein_id gnl|my_center|LOCUS_13090 2932 1772 gene locus_tag LOCUS_13100 2932 1772 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962560.1 protein_id gnl|my_center|LOCUS_13100 3338 2943 gene locus_tag LOCUS_13110 3338 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence33 196 1617 gene locus_tag LOCUS_13120 196 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1804 3081 gene locus_tag LOCUS_13130 1804 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130