>Feature sequence001 317 628 gene locus_tag LOCUS_0010 gene rpsJ 317 628 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897308.1 protein_id gnl|my_center|LOCUS_0010 813 1439 gene locus_tag LOCUS_0020 gene rplC 813 1439 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015720.1 protein_id gnl|my_center|LOCUS_0020 1470 2102 gene locus_tag LOCUS_0030 gene rplD 1470 2102 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904141.1 protein_id gnl|my_center|LOCUS_0030 2102 2389 gene locus_tag LOCUS_0040 gene rplW 2102 2389 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015719.1 protein_id gnl|my_center|LOCUS_0040 2459 3289 gene locus_tag LOCUS_0050 gene rplB 2459 3289 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904139.1 protein_id gnl|my_center|LOCUS_0050 3319 3597 gene locus_tag LOCUS_0060 gene rpsS 3319 3597 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897301.1 protein_id gnl|my_center|LOCUS_0060 3639 3971 gene locus_tag LOCUS_0070 gene rplV 3639 3971 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897300.1 protein_id gnl|my_center|LOCUS_0070 3989 4645 gene locus_tag LOCUS_0080 gene rpsC 3989 4645 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005892367.1 protein_id gnl|my_center|LOCUS_0080 4648 5070 gene locus_tag LOCUS_0090 gene rplP 4648 5070 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904138.1 protein_id gnl|my_center|LOCUS_0090 5070 5252 gene locus_tag LOCUS_0100 gene rpmC 5070 5252 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015718.1 protein_id gnl|my_center|LOCUS_0100 5299 5550 gene locus_tag LOCUS_0110 gene rpsQ 5299 5550 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904137.1 protein_id gnl|my_center|LOCUS_0110 5581 5949 gene locus_tag LOCUS_0120 gene rplN 5581 5949 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904136.1 protein_id gnl|my_center|LOCUS_0120 5974 6315 gene locus_tag LOCUS_0130 gene rplX 5974 6315 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897291.1 protein_id gnl|my_center|LOCUS_0130 6334 6885 gene locus_tag LOCUS_0140 gene rplE 6334 6885 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005892302.1 protein_id gnl|my_center|LOCUS_0140 6908 7195 gene locus_tag LOCUS_0150 gene rpsN 6908 7195 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015715.1 protein_id gnl|my_center|LOCUS_0150 7222 7617 gene locus_tag LOCUS_0160 gene rpsH 7222 7617 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904135.1 protein_id gnl|my_center|LOCUS_0160 7643 8200 gene locus_tag LOCUS_0170 gene rplF 7643 8200 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904134.1 protein_id gnl|my_center|LOCUS_0170 8230 8598 gene locus_tag LOCUS_0180 gene rplR 8230 8598 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904133.1 protein_id gnl|my_center|LOCUS_0180 8623 9126 gene locus_tag LOCUS_0190 gene rpsE 8623 9126 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015714.1 protein_id gnl|my_center|LOCUS_0190 9139 9324 gene locus_tag LOCUS_0200 gene rpmD 9139 9324 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005892817.1 protein_id gnl|my_center|LOCUS_0200 9326 9805 gene locus_tag LOCUS_0210 gene rplO 9326 9805 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899800.1 protein_id gnl|my_center|LOCUS_0210 9845 11125 gene locus_tag LOCUS_0220 gene secY 9845 11125 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904128.1 protein_id gnl|my_center|LOCUS_0220 11276 11917 gene locus_tag LOCUS_0230 11276 11917 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021125.1 protein_id gnl|my_center|LOCUS_0230 11942 12706 gene locus_tag LOCUS_0240 gene map 11942 12706 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017049.1 protein_id gnl|my_center|LOCUS_0240 12809 13030 gene locus_tag LOCUS_0250 gene infA 12809 13030 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899265.1 protein_id gnl|my_center|LOCUS_0250 13341 13697 gene locus_tag LOCUS_0260 gene rpsM 13341 13697 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903912.1 protein_id gnl|my_center|LOCUS_0260 >Feature sequence002 <1 1715 gene locus_tag LOCUS_0270 <1 1715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903183.1:penicillin-binding protein 2 1747 3645 gene locus_tag LOCUS_0280 1747 3645 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896361.1 protein_id gnl|my_center|LOCUS_0280 3675 3980 gene locus_tag LOCUS_0290 gene yhbY 3675 3980 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016989.1 protein_id gnl|my_center|LOCUS_0290 4003 4488 gene locus_tag LOCUS_0300 4003 4488 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_0300 4494 6317 gene locus_tag LOCUS_0310 gene dxs 4494 6317 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903179.1 protein_id gnl|my_center|LOCUS_0310 6358 7125 gene locus_tag LOCUS_0320 6358 7125 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903178.1 protein_id gnl|my_center|LOCUS_0320 7134 7943 gene locus_tag LOCUS_0330 7134 7943 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016988.1 protein_id gnl|my_center|LOCUS_0330 7940 9250 gene locus_tag LOCUS_0340 7940 9250 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494947.1 protein_id gnl|my_center|LOCUS_0340 9263 9928 gene locus_tag LOCUS_0350 gene rsmI 9263 9928 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903175.1 protein_id gnl|my_center|LOCUS_0350 9944 10807 gene locus_tag LOCUS_0360 gene ylqF 9944 10807 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016986.1 protein_id gnl|my_center|LOCUS_0360 10821 11642 gene locus_tag LOCUS_0370 10821 11642 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941313.1 protein_id gnl|my_center|LOCUS_0370 >Feature sequence003 2487 1132 gene locus_tag LOCUS_0380 gene dcuC 2487 1132 CDS product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262088.1 protein_id gnl|my_center|LOCUS_0380 4173 2560 gene locus_tag LOCUS_0390 4173 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0390 4881 4201 gene locus_tag LOCUS_0400 4881 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0400 5756 4905 gene locus_tag LOCUS_0410 5756 4905 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392335.1 protein_id gnl|my_center|LOCUS_0410 6783 5758 gene locus_tag LOCUS_0420 6783 5758 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_0420 7658 6783 gene locus_tag LOCUS_0430 7658 6783 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392333.1 protein_id gnl|my_center|LOCUS_0430 8098 7649 gene locus_tag LOCUS_0440 8098 7649 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_0440 10071 8086 gene locus_tag LOCUS_0450 10071 8086 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_0450 10512 10099 gene locus_tag LOCUS_0460 10512 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0460 11311 10529 gene locus_tag LOCUS_0470 11311 10529 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_0470 >Feature sequence004 1196 882 gene locus_tag LOCUS_0480 gene trxA 1196 882 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311093.1 protein_id gnl|my_center|LOCUS_0480 2561 1302 gene locus_tag LOCUS_0490 2561 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0490 3384 2551 gene locus_tag LOCUS_0500 gene folK 3384 2551 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016121.1 protein_id gnl|my_center|LOCUS_0500 3946 3395 gene locus_tag LOCUS_0510 gene folE 3946 3395 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895440.1 protein_id gnl|my_center|LOCUS_0510 4993 3971 gene locus_tag LOCUS_0520 4993 3971 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_0520 7119 5053 gene locus_tag LOCUS_0530 gene glyS 7119 5053 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016119.1 protein_id gnl|my_center|LOCUS_0530 8055 7186 gene locus_tag LOCUS_0540 gene glyQ 8055 7186 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903526.1 protein_id gnl|my_center|LOCUS_0540 8522 8052 gene locus_tag LOCUS_0550 gene lspA 8522 8052 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895436.1 protein_id gnl|my_center|LOCUS_0550 <11085 8531 gene locus_tag LOCUS_0560 <11085 8531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903528.1:isoleucine--tRNA ligase >Feature sequence005 188 817 gene locus_tag LOCUS_0570 188 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0570 817 1077 gene locus_tag LOCUS_0580 817 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0580 1074 2981 gene locus_tag LOCUS_0590 gene gyrB 1074 2981 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895130.1 protein_id gnl|my_center|LOCUS_0590 3063 5594 gene locus_tag LOCUS_0600 gene gyrA 3063 5594 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903616.1 protein_id gnl|my_center|LOCUS_0600 5629 6396 gene locus_tag LOCUS_0610 5629 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0610 6412 6870 gene locus_tag LOCUS_0620 6412 6870 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016060.1 protein_id gnl|my_center|LOCUS_0620 6912 7928 gene locus_tag LOCUS_0630 gene pheS 6912 7928 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895121.1 protein_id gnl|my_center|LOCUS_0630 >Feature sequence006 167 2347 gene locus_tag LOCUS_0640 167 2347 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898558.1 protein_id gnl|my_center|LOCUS_0640 2613 3437 gene locus_tag LOCUS_0650 gene lpxC 2613 3437 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058229301.1 protein_id gnl|my_center|LOCUS_0650 3471 3896 gene locus_tag LOCUS_0660 gene fabZ 3471 3896 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016509.1 protein_id gnl|my_center|LOCUS_0660 3913 4686 gene locus_tag LOCUS_0670 gene lpxA 3913 4686 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016510.1 protein_id gnl|my_center|LOCUS_0670 4686 5489 gene locus_tag LOCUS_0680 4686 5489 CDS product LpxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016511.1 protein_id gnl|my_center|LOCUS_0680 5502 6575 gene locus_tag LOCUS_0690 gene lpxB 5502 6575 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901943.1 protein_id gnl|my_center|LOCUS_0690 6572 8347 gene locus_tag LOCUS_0700 6572 8347 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016512.1 protein_id gnl|my_center|LOCUS_0700 8356 9123 gene locus_tag LOCUS_0710 8356 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_0710 >Feature sequence007 283 1818 gene locus_tag LOCUS_0720 283 1818 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_0720 1922 2854 gene locus_tag LOCUS_0730 1922 2854 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_0730 2870 3745 gene locus_tag LOCUS_0740 2870 3745 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_0740 3767 4756 gene locus_tag LOCUS_0750 3767 4756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_0750 4759 5733 gene locus_tag LOCUS_0760 4759 5733 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_0760 7269 5845 gene locus_tag LOCUS_0770 7269 5845 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861591.1 protein_id gnl|my_center|LOCUS_0770 8649 7306 gene locus_tag LOCUS_0780 8649 7306 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016888.1 protein_id gnl|my_center|LOCUS_0780 >Feature sequence008 <1 1335 gene locus_tag LOCUS_0790 <1 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016706.1:4-alpha-glucanotransferase 1362 3743 gene locus_tag LOCUS_0800 1362 3743 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016705.1 protein_id gnl|my_center|LOCUS_0800 3766 5700 gene locus_tag LOCUS_0810 gene glgB 3766 5700 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367106.1 protein_id gnl|my_center|LOCUS_0810 5723 6868 gene locus_tag LOCUS_0820 5723 6868 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626354.1 protein_id gnl|my_center|LOCUS_0820 6890 8056 gene locus_tag LOCUS_0830 gene glgD 6890 8056 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903377.1 protein_id gnl|my_center|LOCUS_0830 >Feature sequence009 45 1331 gene locus_tag LOCUS_0840 45 1331 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627853.1 protein_id gnl|my_center|LOCUS_0840 1362 2435 gene locus_tag LOCUS_0850 1362 2435 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017032.1 protein_id gnl|my_center|LOCUS_0850 2467 5520 gene locus_tag LOCUS_0860 2467 5520 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017033.1 protein_id gnl|my_center|LOCUS_0860 5537 5923 gene locus_tag LOCUS_0870 5537 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0870 <9063 5999 gene locus_tag LOCUS_0880 <9063 5999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048163.1:2-hydroxyacyl-CoA dehydratase >Feature sequence010 2923 356 gene locus_tag LOCUS_0890 gene xdh 2923 356 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891588.1 protein_id gnl|my_center|LOCUS_0890 4305 2938 gene locus_tag LOCUS_0900 gene hydA 4305 2938 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047948.1 protein_id gnl|my_center|LOCUS_0900 6019 4328 gene locus_tag LOCUS_0910 6019 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0910 7404 6073 gene locus_tag LOCUS_0920 7404 6073 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047949.1 protein_id gnl|my_center|LOCUS_0920 8759 7434 gene locus_tag LOCUS_0930 gene ssnA 8759 7434 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861868.1 protein_id gnl|my_center|LOCUS_0930 >Feature sequence011 40 417 gene locus_tag LOCUS_0940 40 417 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015712.1 protein_id gnl|my_center|LOCUS_0940 471 995 gene locus_tag LOCUS_0950 gene amaP 471 995 CDS product alkaline shock response membrane anchor protein AmaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058229291.1 protein_id gnl|my_center|LOCUS_0950 1007 1228 gene locus_tag LOCUS_0960 1007 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0960 1241 1639 gene locus_tag LOCUS_0970 gene nusB 1241 1639 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904113.1 protein_id gnl|my_center|LOCUS_0970 1826 2857 gene locus_tag LOCUS_0980 1826 2857 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016665.1 protein_id gnl|my_center|LOCUS_0980 2939 3133 gene locus_tag LOCUS_0990 2939 3133 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797412.1 protein_id gnl|my_center|LOCUS_0990 3133 5604 gene locus_tag LOCUS_1000 3133 5604 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861457.1 protein_id gnl|my_center|LOCUS_1000 5707 6282 gene locus_tag LOCUS_1010 5707 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1010 6295 6954 gene locus_tag LOCUS_1020 6295 6954 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460434.1 protein_id gnl|my_center|LOCUS_1020 6958 8364 gene locus_tag LOCUS_1030 6958 8364 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_1030 >Feature sequence012 33 989 gene locus_tag LOCUS_1040 33 989 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494586.1 protein_id gnl|my_center|LOCUS_1040 979 1599 gene locus_tag LOCUS_1050 979 1599 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626801.1 protein_id gnl|my_center|LOCUS_1050 1589 1951 gene locus_tag LOCUS_1060 1589 1951 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017105.1 protein_id gnl|my_center|LOCUS_1060 1941 2144 gene locus_tag LOCUS_1070 1941 2144 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898710.1 protein_id gnl|my_center|LOCUS_1070 2230 2754 gene locus_tag LOCUS_1080 2230 2754 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898707.1 protein_id gnl|my_center|LOCUS_1080 2768 3388 gene locus_tag LOCUS_1090 2768 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1090 3483 4235 gene locus_tag LOCUS_1100 gene tpiA 3483 4235 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902187.1 protein_id gnl|my_center|LOCUS_1100 4261 5778 gene locus_tag LOCUS_1110 gene gpmI 4261 5778 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_1110 7169 5835 gene locus_tag LOCUS_1120 7169 5835 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017139.1 protein_id gnl|my_center|LOCUS_1120 7379 8560 gene locus_tag LOCUS_1130 gene megL 7379 8560 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 protein_id gnl|my_center|LOCUS_1130 >Feature sequence013 222 944 gene locus_tag LOCUS_1140 222 944 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014894892.1 protein_id gnl|my_center|LOCUS_1140 988 2697 gene locus_tag LOCUS_1150 988 2697 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077417416.1 protein_id gnl|my_center|LOCUS_1150 2690 4141 gene locus_tag LOCUS_1160 2690 4141 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_1160 4268 5008 gene locus_tag LOCUS_1170 4268 5008 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002301131.1 protein_id gnl|my_center|LOCUS_1170 5072 6025 gene locus_tag LOCUS_1180 5072 6025 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903111.1 protein_id gnl|my_center|LOCUS_1180 6055 7197 gene locus_tag LOCUS_1190 6055 7197 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898687.1 protein_id gnl|my_center|LOCUS_1190 7248 8099 gene locus_tag LOCUS_1200 7248 8099 CDS product tagatose bisphosphate family class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358381.1 protein_id gnl|my_center|LOCUS_1200 >Feature sequence014 2360 1371 gene locus_tag LOCUS_1210 2360 1371 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_1210 2963 2379 gene locus_tag LOCUS_1220 gene rsxA 2963 2379 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_1220 3574 2966 gene locus_tag LOCUS_1230 3574 2966 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_1230 4107 3574 gene locus_tag LOCUS_1240 4107 3574 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015690.1 protein_id gnl|my_center|LOCUS_1240 5041 4097 gene locus_tag LOCUS_1250 5041 4097 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015691.1 protein_id gnl|my_center|LOCUS_1250 6397 5087 gene locus_tag LOCUS_1260 gene rsxC 6397 5087 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480691.1 protein_id gnl|my_center|LOCUS_1260 7051 6491 gene locus_tag LOCUS_1270 gene pth 7051 6491 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015693.1 protein_id gnl|my_center|LOCUS_1270 8275 7067 gene locus_tag LOCUS_1280 8275 7067 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902886.1 protein_id gnl|my_center|LOCUS_1280 >Feature sequence015 715 53 gene locus_tag LOCUS_1290 gene bioC 715 53 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016700.1 protein_id gnl|my_center|LOCUS_1290 1320 712 gene locus_tag LOCUS_1300 1320 712 CDS product DUF452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016699.1 protein_id gnl|my_center|LOCUS_1300 2416 1298 gene locus_tag LOCUS_1310 2416 1298 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626360.1 protein_id gnl|my_center|LOCUS_1310 3807 2437 gene locus_tag LOCUS_1320 gene bioA 3807 2437 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896848.1 protein_id gnl|my_center|LOCUS_1320 4494 3808 gene locus_tag LOCUS_1330 gene bioD 4494 3808 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016822.1 protein_id gnl|my_center|LOCUS_1330 5467 4481 gene locus_tag LOCUS_1340 gene bioB 5467 4481 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016821.1 protein_id gnl|my_center|LOCUS_1340 5619 5531 gene locus_tag LOCUS_t0010 5619 5531 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6821 5676 gene locus_tag LOCUS_1350 gene nagA 6821 5676 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902854.1 protein_id gnl|my_center|LOCUS_1350 <8125 7003 gene locus_tag LOCUS_1360 <8125 7003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_147373114.1:recombinase RecA >Feature sequence016 21 968 gene locus_tag LOCUS_1370 21 968 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903111.1 protein_id gnl|my_center|LOCUS_1370 1147 2166 gene locus_tag LOCUS_1380 gene mglB 1147 2166 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903112.1 protein_id gnl|my_center|LOCUS_1380 2244 3755 gene locus_tag LOCUS_1390 gene mglA 2244 3755 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903113.1 protein_id gnl|my_center|LOCUS_1390 3789 4808 gene locus_tag LOCUS_1400 gene mglC 3789 4808 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016955.1 protein_id gnl|my_center|LOCUS_1400 4939 6732 gene locus_tag LOCUS_1410 4939 6732 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016615.1 protein_id gnl|my_center|LOCUS_1410 6744 8066 gene locus_tag LOCUS_1420 gene der 6744 8066 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016201.1 protein_id gnl|my_center|LOCUS_1420 >Feature sequence017 65 1345 gene locus_tag LOCUS_1430 65 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1430 1354 2442 gene locus_tag LOCUS_1440 gene mraY 1354 2442 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902299.1 protein_id gnl|my_center|LOCUS_1440 2518 3819 gene locus_tag LOCUS_1450 gene murD 2518 3819 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029597345.1 protein_id gnl|my_center|LOCUS_1450 3816 4892 gene locus_tag LOCUS_1460 gene murG 3816 4892 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626926.1 protein_id gnl|my_center|LOCUS_1460 4894 6249 gene locus_tag LOCUS_1470 gene murC 4894 6249 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626924.1 protein_id gnl|my_center|LOCUS_1470 6249 7103 gene locus_tag LOCUS_1480 gene murB 6249 7103 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898186.1 protein_id gnl|my_center|LOCUS_1480 7114 7980 gene locus_tag LOCUS_1490 7114 7980 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480619.1 protein_id gnl|my_center|LOCUS_1490 >Feature sequence018 1952 1401 gene locus_tag LOCUS_1500 1952 1401 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903986.1 protein_id gnl|my_center|LOCUS_1500 3161 1956 gene locus_tag LOCUS_1510 3161 1956 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015925.1 protein_id gnl|my_center|LOCUS_1510 3668 3171 gene locus_tag LOCUS_1520 3668 3171 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015926.1 protein_id gnl|my_center|LOCUS_1520 5833 3671 gene locus_tag LOCUS_1530 5833 3671 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015927.1 protein_id gnl|my_center|LOCUS_1530 6422 5838 gene locus_tag LOCUS_1540 gene coaE 6422 5838 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495251.1 protein_id gnl|my_center|LOCUS_1540 6989 6432 gene locus_tag LOCUS_1550 6989 6432 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_1550 7546 7040 gene locus_tag LOCUS_1560 7546 7040 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_1560 >Feature sequence019 156 1337 gene locus_tag LOCUS_1570 156 1337 CDS product DUF3798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868876.1 protein_id gnl|my_center|LOCUS_1570 1390 2979 gene locus_tag LOCUS_1580 1390 2979 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015905.1 protein_id gnl|my_center|LOCUS_1580 2972 4012 gene locus_tag LOCUS_1590 2972 4012 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903357.1 protein_id gnl|my_center|LOCUS_1590 4002 5114 gene locus_tag LOCUS_1600 4002 5114 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627593.1 protein_id gnl|my_center|LOCUS_1600 5114 5482 gene locus_tag LOCUS_1610 5114 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1610 5623 5793 gene locus_tag LOCUS_1620 5623 5793 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869128.1 protein_id gnl|my_center|LOCUS_1620 5855 6139 gene locus_tag LOCUS_1630 5855 6139 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015677.1 protein_id gnl|my_center|LOCUS_1630 6197 7210 gene locus_tag LOCUS_1640 gene aroF 6197 7210 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015676.1 protein_id gnl|my_center|LOCUS_1640 >Feature sequence020 392 72 gene locus_tag LOCUS_1650 392 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1650 1259 423 gene locus_tag LOCUS_1660 1259 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1660 2375 1290 gene locus_tag LOCUS_1670 2375 1290 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020498.1 protein_id gnl|my_center|LOCUS_1670 3708 2377 gene locus_tag LOCUS_1680 3708 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1680 4977 3721 gene locus_tag LOCUS_1690 4977 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1690 5689 4910 gene locus_tag LOCUS_1700 gene cps4B 5689 4910 CDS product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922734.1 protein_id gnl|my_center|LOCUS_1700 6474 5689 gene locus_tag LOCUS_1710 6474 5689 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986981.1 protein_id gnl|my_center|LOCUS_1710 7252 6506 gene locus_tag LOCUS_1720 7252 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1720 >Feature sequence021 <1 1249 gene locus_tag LOCUS_1730 <1 1249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003233752.1:ABC-F family ATP-binding cassette domain-containing protein 1806 1369 gene locus_tag LOCUS_1740 1806 1369 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357848.1 protein_id gnl|my_center|LOCUS_1740 1968 3215 gene locus_tag LOCUS_1750 gene sstT 1968 3215 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 protein_id gnl|my_center|LOCUS_1750 4427 3261 gene locus_tag LOCUS_1760 4427 3261 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016940.1 protein_id gnl|my_center|LOCUS_1760 5791 4502 gene locus_tag LOCUS_1770 5791 4502 CDS product serine dehydratase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902828.1 protein_id gnl|my_center|LOCUS_1770 <7364 5845 gene locus_tag LOCUS_1780 <7364 5845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903217.1:AbgT family transporter >Feature sequence022 858 124 gene locus_tag LOCUS_1790 858 124 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948182.1 protein_id gnl|my_center|LOCUS_1790 1424 879 gene locus_tag LOCUS_1800 1424 879 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032881713.1 protein_id gnl|my_center|LOCUS_1800 2493 1414 gene locus_tag LOCUS_1810 gene recA 2493 1414 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373114.1 protein_id gnl|my_center|LOCUS_1810 3484 2495 gene locus_tag LOCUS_1820 3484 2495 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016469.1 protein_id gnl|my_center|LOCUS_1820 4167 3481 gene locus_tag LOCUS_1830 4167 3481 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016468.1 protein_id gnl|my_center|LOCUS_1830 5177 4167 gene locus_tag LOCUS_1840 5177 4167 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 protein_id gnl|my_center|LOCUS_1840 6204 5164 gene locus_tag LOCUS_1850 6204 5164 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495222.1 protein_id gnl|my_center|LOCUS_1850 6979 6215 gene locus_tag LOCUS_1860 6979 6215 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898431.1 protein_id gnl|my_center|LOCUS_1860 >Feature sequence023 251 4693 gene locus_tag LOCUS_1870 251 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1870 4712 7129 gene locus_tag LOCUS_1880 4712 7129 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263809.1 protein_id gnl|my_center|LOCUS_1880 >Feature sequence024 74 1093 gene locus_tag LOCUS_1890 gene plsX 74 1093 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016179.1 protein_id gnl|my_center|LOCUS_1890 1102 2094 gene locus_tag LOCUS_1900 1102 2094 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016180.1 protein_id gnl|my_center|LOCUS_1900 2161 3072 gene locus_tag LOCUS_1910 gene fabD 2161 3072 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016181.1 protein_id gnl|my_center|LOCUS_1910 3135 3356 gene locus_tag LOCUS_1920 gene acpP 3135 3356 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902726.1 protein_id gnl|my_center|LOCUS_1920 3432 4670 gene locus_tag LOCUS_1930 gene fabF 3432 4670 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016182.1 protein_id gnl|my_center|LOCUS_1930 4686 5408 gene locus_tag LOCUS_1940 gene rnc 4686 5408 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797266.1 protein_id gnl|my_center|LOCUS_1940 5395 6420 gene locus_tag LOCUS_1950 5395 6420 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016184.1 protein_id gnl|my_center|LOCUS_1950 >Feature sequence025 <1 1256 gene locus_tag LOCUS_1960 <1 1256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005970668.1:amino acid carrier protein 1250 2011 gene locus_tag LOCUS_1970 1250 2011 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418385.1 protein_id gnl|my_center|LOCUS_1970 2184 3494 gene locus_tag LOCUS_1980 gene miaB 2184 3494 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016418.1 protein_id gnl|my_center|LOCUS_1980 3513 4766 gene locus_tag LOCUS_1990 gene rho 3513 4766 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016419.1 protein_id gnl|my_center|LOCUS_1990 4756 5754 gene locus_tag LOCUS_2000 4756 5754 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898353.1 protein_id gnl|my_center|LOCUS_2000 5767 6834 gene locus_tag LOCUS_2010 gene ispG 5767 6834 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902396.1 protein_id gnl|my_center|LOCUS_2010 >Feature sequence026 1779 379 gene locus_tag LOCUS_2020 gene atpD 1779 379 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016335.1 protein_id gnl|my_center|LOCUS_2020 2649 1798 gene locus_tag LOCUS_2030 gene atpG 2649 1798 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016336.1 protein_id gnl|my_center|LOCUS_2030 4166 2664 gene locus_tag LOCUS_2040 gene atpA 4166 2664 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016337.1 protein_id gnl|my_center|LOCUS_2040 4718 4194 gene locus_tag LOCUS_2050 gene atpH 4718 4194 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016338.1 protein_id gnl|my_center|LOCUS_2050 5221 4715 gene locus_tag LOCUS_2060 gene atpF 5221 4715 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902611.1 protein_id gnl|my_center|LOCUS_2060 5550 5278 gene locus_tag LOCUS_2070 gene atpE 5550 5278 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 protein_id gnl|my_center|LOCUS_2070 6448 5579 gene locus_tag LOCUS_2080 gene atpB 6448 5579 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796847.1 protein_id gnl|my_center|LOCUS_2080 6853 6476 gene locus_tag LOCUS_2090 6853 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2090 >Feature sequence027 <1 566 gene locus_tag LOCUS_2100 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000285667.1:acetamidase/formamidase family protein 1037 687 gene locus_tag LOCUS_2110 1037 687 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003048451.1 protein_id gnl|my_center|LOCUS_2110 1361 1056 gene locus_tag LOCUS_2120 1361 1056 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417897.1 protein_id gnl|my_center|LOCUS_2120 1621 3270 gene locus_tag LOCUS_2130 1621 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2130 3270 4754 gene locus_tag LOCUS_2140 3270 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2140 4812 5804 gene locus_tag LOCUS_2150 4812 5804 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103718.1 protein_id gnl|my_center|LOCUS_2150 >Feature sequence028 4639 2015 gene locus_tag LOCUS_2160 gene mutS 4639 2015 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494923.1 protein_id gnl|my_center|LOCUS_2160 5595 4639 gene locus_tag LOCUS_2170 5595 4639 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016583.1 protein_id gnl|my_center|LOCUS_2170 5772 6680 gene locus_tag LOCUS_2180 5772 6680 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023177.1 protein_id gnl|my_center|LOCUS_2180 >Feature sequence029 2215 299 gene locus_tag LOCUS_2190 gene thrS 2215 299 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626551.1 protein_id gnl|my_center|LOCUS_2190 6118 2252 gene locus_tag LOCUS_2200 6118 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495458.1 protein_id gnl|my_center|LOCUS_2200 6570 6253 gene locus_tag LOCUS_2210 gene trxA 6570 6253 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162959.1 protein_id gnl|my_center|LOCUS_2210 >Feature sequence030 212 1768 gene locus_tag LOCUS_2220 212 1768 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626662.1 protein_id gnl|my_center|LOCUS_2220 2096 2500 gene locus_tag LOCUS_2230 2096 2500 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016670.1 protein_id gnl|my_center|LOCUS_2230 2525 3670 gene locus_tag LOCUS_2240 2525 3670 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903462.1 protein_id gnl|my_center|LOCUS_2240 3730 4515 gene locus_tag LOCUS_2250 3730 4515 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903461.1 protein_id gnl|my_center|LOCUS_2250 4562 5572 gene locus_tag LOCUS_2260 4562 5572 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903460.1 protein_id gnl|my_center|LOCUS_2260 >Feature sequence031 <1 2583 gene locus_tag LOCUS_2270 <1 2583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016080.1:transcription-repair coupling factor 2601 3365 gene locus_tag LOCUS_2280 2601 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2280 3403 3693 gene locus_tag LOCUS_2290 3403 3693 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900912.1 protein_id gnl|my_center|LOCUS_2290 3693 4547 gene locus_tag LOCUS_2300 gene ispE 3693 4547 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016081.1 protein_id gnl|my_center|LOCUS_2300 4579 4860 gene locus_tag LOCUS_2310 4579 4860 CDS product septation protein SpoVG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016082.1 protein_id gnl|my_center|LOCUS_2310 5056 6417 gene locus_tag LOCUS_2320 5056 6417 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 protein_id gnl|my_center|LOCUS_2320 >Feature sequence032 382 1878 gene locus_tag LOCUS_2330 gene rbsA 382 1878 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463701.1 protein_id gnl|my_center|LOCUS_2330 1872 2798 gene locus_tag LOCUS_2340 gene rbsC 1872 2798 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463702.1 protein_id gnl|my_center|LOCUS_2340 2815 3687 gene locus_tag LOCUS_2350 gene rbsB 2815 3687 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737176.1 protein_id gnl|my_center|LOCUS_2350 4032 4949 gene locus_tag LOCUS_2360 4032 4949 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281520.1 protein_id gnl|my_center|LOCUS_2360 5065 6036 gene locus_tag LOCUS_2370 gene mgfK 5065 6036 CDS product gluconeogenesis morphogenetic factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244450.1 protein_id gnl|my_center|LOCUS_2370 >Feature sequence033 1846 329 gene locus_tag LOCUS_2380 1846 329 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_2380 3645 1936 gene locus_tag LOCUS_2390 3645 1936 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015730.1 protein_id gnl|my_center|LOCUS_2390 5787 3733 gene locus_tag LOCUS_2400 gene recG 5787 3733 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015732.1 protein_id gnl|my_center|LOCUS_2400 5904 6245 gene locus_tag LOCUS_2410 5904 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2410 >Feature sequence034 <1 1307 gene locus_tag LOCUS_2420 <1 1307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015993.1:DNA-directed RNA polymerase subunit beta 1415 5377 gene locus_tag LOCUS_2430 gene rpoC 1415 5377 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904068.1 protein_id gnl|my_center|LOCUS_2430 >Feature sequence035 1646 1284 gene locus_tag LOCUS_2440 gene rbfA 1646 1284 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903343.1 protein_id gnl|my_center|LOCUS_2440 3856 1676 gene locus_tag LOCUS_2450 gene infB 3856 1676 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894893.1 protein_id gnl|my_center|LOCUS_2450 4409 3879 gene locus_tag LOCUS_2460 4409 3879 CDS product DUF448 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903345.1 protein_id gnl|my_center|LOCUS_2460 5476 4412 gene locus_tag LOCUS_2470 gene nusA 5476 4412 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903346.1 protein_id gnl|my_center|LOCUS_2470 5982 5500 gene locus_tag LOCUS_2480 5982 5500 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015988.1 protein_id gnl|my_center|LOCUS_2480 >Feature sequence036 1724 69 gene locus_tag LOCUS_2490 1724 69 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896074.1 protein_id gnl|my_center|LOCUS_2490 2844 1714 gene locus_tag LOCUS_2500 2844 1714 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902588.1 protein_id gnl|my_center|LOCUS_2500 3943 2927 gene locus_tag LOCUS_2510 3943 2927 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660662.1 protein_id gnl|my_center|LOCUS_2510 5397 4117 gene locus_tag LOCUS_2520 5397 4117 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986437.1 protein_id gnl|my_center|LOCUS_2520 <6034 5410 gene locus_tag LOCUS_2530 <6034 5410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016563.1:MetQ/NlpA family ABC transporter substrate-binding protein >Feature sequence037 54 929 gene locus_tag LOCUS_2540 54 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2540 1984 1040 gene locus_tag LOCUS_2550 1984 1040 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005975400.1 protein_id gnl|my_center|LOCUS_2550 2750 1977 gene locus_tag LOCUS_2560 2750 1977 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903786.1 protein_id gnl|my_center|LOCUS_2560 4313 2763 gene locus_tag LOCUS_2570 4313 2763 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903785.1 protein_id gnl|my_center|LOCUS_2570 5169 4345 gene locus_tag LOCUS_2580 5169 4345 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903784.1 protein_id gnl|my_center|LOCUS_2580 <6024 5172 gene locus_tag LOCUS_2590 <6024 5172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015650.1:ABC transporter permease >Feature sequence038 1230 286 gene locus_tag LOCUS_2600 1230 286 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_2600 2421 1243 gene locus_tag LOCUS_2610 2421 1243 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582673.1 protein_id gnl|my_center|LOCUS_2610 2741 2439 gene locus_tag LOCUS_2620 2741 2439 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546290.1 protein_id gnl|my_center|LOCUS_2620 3316 2741 gene locus_tag LOCUS_2630 3316 2741 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_2630 4581 3406 gene locus_tag LOCUS_2640 4581 3406 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870329.1 protein_id gnl|my_center|LOCUS_2640 5836 4634 gene locus_tag LOCUS_2650 gene ilvA 5836 4634 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_2650 >Feature sequence039 <1 1244 gene locus_tag LOCUS_2660 <1 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902903.1:excinuclease ABC subunit UvrC 1261 2259 gene locus_tag LOCUS_2670 1261 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2670 2259 3770 gene locus_tag LOCUS_2680 2259 3770 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896598.1 protein_id gnl|my_center|LOCUS_2680 3836 4693 gene locus_tag LOCUS_2690 3836 4693 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480077.1 protein_id gnl|my_center|LOCUS_2690 4758 5189 gene locus_tag LOCUS_2700 4758 5189 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016892.1 protein_id gnl|my_center|LOCUS_2700 5239 5943 gene locus_tag LOCUS_2710 gene sfsA 5239 5943 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877131.1 protein_id gnl|my_center|LOCUS_2710 >Feature sequence040 400 1143 gene locus_tag LOCUS_2720 400 1143 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894460.1 protein_id gnl|my_center|LOCUS_2720 1177 2682 gene locus_tag LOCUS_2730 gene glpK 1177 2682 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015864.1 protein_id gnl|my_center|LOCUS_2730 2824 4269 gene locus_tag LOCUS_2740 2824 4269 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895612.1 protein_id gnl|my_center|LOCUS_2740 4271 5533 gene locus_tag LOCUS_2750 4271 5533 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016211.1 protein_id gnl|my_center|LOCUS_2750 >Feature sequence041 388 1272 gene locus_tag LOCUS_2760 388 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862019.1 protein_id gnl|my_center|LOCUS_2760 1322 2254 gene locus_tag LOCUS_2770 1322 2254 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021363110.1 protein_id gnl|my_center|LOCUS_2770 2508 3518 gene locus_tag LOCUS_2780 2508 3518 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016565.1 protein_id gnl|my_center|LOCUS_2780 3508 4155 gene locus_tag LOCUS_2790 3508 4155 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016564.1 protein_id gnl|my_center|LOCUS_2790 4195 4977 gene locus_tag LOCUS_2800 4195 4977 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016563.1 protein_id gnl|my_center|LOCUS_2800 5005 5778 gene locus_tag LOCUS_2810 5005 5778 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016563.1 protein_id gnl|my_center|LOCUS_2810 >Feature sequence042 1810 569 gene locus_tag LOCUS_2820 1810 569 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047697.1 protein_id gnl|my_center|LOCUS_2820 2137 1877 gene locus_tag LOCUS_2830 2137 1877 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385299.1 protein_id gnl|my_center|LOCUS_2830 3520 2318 gene locus_tag LOCUS_2840 3520 2318 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986414.1 protein_id gnl|my_center|LOCUS_2840 5724 3658 gene locus_tag LOCUS_2850 5724 3658 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986498.1 protein_id gnl|my_center|LOCUS_2850 >Feature sequence043 <1 1021 gene locus_tag LOCUS_2860 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582622.1:AAA family ATPase 1035 1745 gene locus_tag LOCUS_2870 1035 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2870 1805 4087 gene locus_tag LOCUS_2880 1805 4087 CDS product bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764496.1 protein_id gnl|my_center|LOCUS_2880 4341 5618 gene locus_tag LOCUS_2890 gene thiC 4341 5618 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047970.1 protein_id gnl|my_center|LOCUS_2890 >Feature sequence044 880 299 gene locus_tag LOCUS_2900 880 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2900 1518 880 gene locus_tag LOCUS_2910 1518 880 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963678.1 protein_id gnl|my_center|LOCUS_2910 2949 1534 gene locus_tag LOCUS_2920 2949 1534 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289668.1 protein_id gnl|my_center|LOCUS_2920 4180 2990 gene locus_tag LOCUS_2930 4180 2990 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975716.1 protein_id gnl|my_center|LOCUS_2930 5611 4202 gene locus_tag LOCUS_2940 5611 4202 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785076.1 protein_id gnl|my_center|LOCUS_2940 >Feature sequence045 127 1458 gene locus_tag LOCUS_2950 127 1458 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944264.1 protein_id gnl|my_center|LOCUS_2950 2177 1503 gene locus_tag LOCUS_2960 gene deoC 2177 1503 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453154.1 protein_id gnl|my_center|LOCUS_2960 3376 2186 gene locus_tag LOCUS_2970 gene deoB 3376 2186 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046079.1 protein_id gnl|my_center|LOCUS_2970 4100 3390 gene locus_tag LOCUS_2980 gene deoD 4100 3390 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020631.1 protein_id gnl|my_center|LOCUS_2980 4534 4118 gene locus_tag LOCUS_2990 4534 4118 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086294.1 protein_id gnl|my_center|LOCUS_2990 <5757 4597 gene locus_tag LOCUS_3000 <5757 4597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001159687.1:NupC/NupG family nucleoside CNT transporter >Feature sequence046 <1 2906 gene locus_tag LOCUS_3010 <1 2906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_150547447.1:autotransporter outer membrane beta-barrel domain-containing protein 48 205 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aatggaataggttataattatgg 3020 3382 gene locus_tag LOCUS_3020 3020 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3020 3563 4519 gene locus_tag LOCUS_3030 3563 4519 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_3030 4520 5443 gene locus_tag LOCUS_3040 gene rbsK 4520 5443 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113483.1 protein_id gnl|my_center|LOCUS_3040 >Feature sequence047 4463 3261 gene locus_tag LOCUS_3050 4463 3261 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016959.1 protein_id gnl|my_center|LOCUS_3050 5489 4491 gene locus_tag LOCUS_3060 gene pta 5489 4491 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627902.1 protein_id gnl|my_center|LOCUS_3060 >Feature sequence048 2228 1734 gene locus_tag LOCUS_3070 2228 1734 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890795.1 protein_id gnl|my_center|LOCUS_3070 2937 2242 gene locus_tag LOCUS_3080 2937 2242 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017120.1 protein_id gnl|my_center|LOCUS_3080 3050 3418 gene locus_tag LOCUS_3090 3050 3418 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016333.1 protein_id gnl|my_center|LOCUS_3090 3588 4508 gene locus_tag LOCUS_3100 gene glsA 3588 4508 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903278.1 protein_id gnl|my_center|LOCUS_3100 >Feature sequence049 1713 211 gene locus_tag LOCUS_3110 gene purH 1713 211 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385254.1 protein_id gnl|my_center|LOCUS_3110 2306 1728 gene locus_tag LOCUS_3120 gene purN 2306 1728 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047940.1 protein_id gnl|my_center|LOCUS_3120 3295 2294 gene locus_tag LOCUS_3130 gene purM 3295 2294 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016807.1 protein_id gnl|my_center|LOCUS_3130 4723 3323 gene locus_tag LOCUS_3140 gene purF 4723 3323 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_3140 5436 4723 gene locus_tag LOCUS_3150 5436 4723 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016809.1 protein_id gnl|my_center|LOCUS_3150 >Feature sequence050 3179 123 gene locus_tag LOCUS_3160 3179 123 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016443.1 protein_id gnl|my_center|LOCUS_3160 4304 3189 gene locus_tag LOCUS_3170 4304 3189 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016444.1 protein_id gnl|my_center|LOCUS_3170 5427 4309 gene locus_tag LOCUS_3180 5427 4309 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626657.1 protein_id gnl|my_center|LOCUS_3180 >Feature sequence051 <1 2021 gene locus_tag LOCUS_3190 <1 2021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015784.1:NAD-dependent DNA ligase LigA 2112 4781 gene locus_tag LOCUS_3200 gene secA 2112 4781 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015785.1 protein_id gnl|my_center|LOCUS_3200 >Feature sequence052 22 1386 gene locus_tag LOCUS_3210 22 1386 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_3210 1383 1859 gene locus_tag LOCUS_3220 1383 1859 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627048.1 protein_id gnl|my_center|LOCUS_3220 1984 5400 gene locus_tag LOCUS_3230 gene dnaE 1984 5400 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017116.1 protein_id gnl|my_center|LOCUS_3230 >Feature sequence053 <1 652 gene locus_tag LOCUS_3240 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921904.1:L-fucose:H+ symporter permease 702 1850 gene locus_tag LOCUS_3250 gene fucO 702 1850 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766959.1 protein_id gnl|my_center|LOCUS_3250 1862 3259 gene locus_tag LOCUS_3260 1862 3259 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388551.1 protein_id gnl|my_center|LOCUS_3260 3278 5053 gene locus_tag LOCUS_3270 gene fucI 3278 5053 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_3270 >Feature sequence054 <1 561 gene locus_tag LOCUS_3280 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016594.1:DNA polymerase I 570 1472 gene locus_tag LOCUS_3290 gene whiA 570 1472 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902471.1 protein_id gnl|my_center|LOCUS_3290 1475 2431 gene locus_tag LOCUS_3300 1475 2431 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016595.1 protein_id gnl|my_center|LOCUS_3300 2406 3077 gene locus_tag LOCUS_3310 2406 3077 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902469.1 protein_id gnl|my_center|LOCUS_3310 3115 4575 gene locus_tag LOCUS_3320 gene murJ 3115 4575 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016596.1 protein_id gnl|my_center|LOCUS_3320 >Feature sequence055 142 2796 gene locus_tag LOCUS_3330 gene adhE 142 2796 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836312.1 protein_id gnl|my_center|LOCUS_3330 3845 2853 gene locus_tag LOCUS_3340 gene trpS 3845 2853 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 protein_id gnl|my_center|LOCUS_3340 5034 3898 gene locus_tag LOCUS_3350 5034 3898 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_3350 >Feature sequence056 137 757 gene locus_tag LOCUS_3360 137 757 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903598.1 protein_id gnl|my_center|LOCUS_3360 764 1495 gene locus_tag LOCUS_3370 764 1495 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367405.1 protein_id gnl|my_center|LOCUS_3370 1506 2876 gene locus_tag LOCUS_3380 gene mnmE 1506 2876 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016067.1 protein_id gnl|my_center|LOCUS_3380 2939 4786 gene locus_tag LOCUS_3390 gene mnmG 2939 4786 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016068.1 protein_id gnl|my_center|LOCUS_3390 >Feature sequence057 <1 2573 gene locus_tag LOCUS_3400 <1 2573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016588.1:alanine--tRNA ligase 2583 3002 gene locus_tag LOCUS_3410 gene ruvX 2583 3002 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902478.1 protein_id gnl|my_center|LOCUS_3410 3017 4249 gene locus_tag LOCUS_3420 gene secD 3017 4249 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902477.1 protein_id gnl|my_center|LOCUS_3420 4240 5190 gene locus_tag LOCUS_3430 gene secF 4240 5190 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016589.1 protein_id gnl|my_center|LOCUS_3430 >Feature sequence058 1412 489 gene locus_tag LOCUS_3440 1412 489 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861782.1 protein_id gnl|my_center|LOCUS_3440 2651 1416 gene locus_tag LOCUS_3450 2651 1416 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948940.1 protein_id gnl|my_center|LOCUS_3450 3067 2651 gene locus_tag LOCUS_3460 3067 2651 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948939.1 protein_id gnl|my_center|LOCUS_3460 5152 3074 gene locus_tag LOCUS_3470 5152 3074 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117877.1 protein_id gnl|my_center|LOCUS_3470 >Feature sequence059 2025 79 gene locus_tag LOCUS_3480 gene pepF 2025 79 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903691.1 protein_id gnl|my_center|LOCUS_3480 3294 2038 gene locus_tag LOCUS_3490 3294 2038 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903692.1 protein_id gnl|my_center|LOCUS_3490 3700 3323 gene locus_tag LOCUS_3500 3700 3323 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016728.1 protein_id gnl|my_center|LOCUS_3500 4349 3720 gene locus_tag LOCUS_3510 4349 3720 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903694.1 protein_id gnl|my_center|LOCUS_3510 5182 4358 gene locus_tag LOCUS_3520 5182 4358 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903695.1 protein_id gnl|my_center|LOCUS_3520 >Feature sequence060 178 1332 gene locus_tag LOCUS_3530 178 1332 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_3530 1483 2367 gene locus_tag LOCUS_3540 1483 2367 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626888.1 protein_id gnl|my_center|LOCUS_3540 2380 3357 gene locus_tag LOCUS_3550 2380 3357 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_3550 3347 4198 gene locus_tag LOCUS_3560 3347 4198 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017145.1 protein_id gnl|my_center|LOCUS_3560 4198 4920 gene locus_tag LOCUS_3570 4198 4920 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902265.1 protein_id gnl|my_center|LOCUS_3570 >Feature sequence061 124 1788 gene locus_tag LOCUS_3580 gene phoR 124 1788 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_3580 1861 2568 gene locus_tag LOCUS_3590 1861 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016516.1 protein_id gnl|my_center|LOCUS_3590 2688 3122 gene locus_tag LOCUS_3600 gene rplM 2688 3122 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901604.1 protein_id gnl|my_center|LOCUS_3600 3133 3537 gene locus_tag LOCUS_3610 gene rpsI 3133 3537 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901602.1 protein_id gnl|my_center|LOCUS_3610 4924 3650 gene locus_tag LOCUS_3620 gene brnQ 4924 3650 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016106.1 protein_id gnl|my_center|LOCUS_3620 >Feature sequence062 1027 140 gene locus_tag LOCUS_3630 1027 140 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017072.1 protein_id gnl|my_center|LOCUS_3630 1232 1029 gene locus_tag LOCUS_3640 gene xseB 1232 1029 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899316.1 protein_id gnl|my_center|LOCUS_3640 1789 1241 gene locus_tag LOCUS_3650 gene rsmD 1789 1241 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017073.1 protein_id gnl|my_center|LOCUS_3650 2834 1803 gene locus_tag LOCUS_3660 gene queA 2834 1803 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627822.1 protein_id gnl|my_center|LOCUS_3660 3970 2834 gene locus_tag LOCUS_3670 gene prmC 3970 2834 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495074.1 protein_id gnl|my_center|LOCUS_3670 5048 3972 gene locus_tag LOCUS_3680 gene prfA 5048 3972 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796873.1 protein_id gnl|my_center|LOCUS_3680 >Feature sequence063 1553 876 gene locus_tag LOCUS_3690 gene radC 1553 876 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016743.1 protein_id gnl|my_center|LOCUS_3690 2630 1578 gene locus_tag LOCUS_3700 gene cobT 2630 1578 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016744.1 protein_id gnl|my_center|LOCUS_3700 3217 2636 gene locus_tag LOCUS_3710 3217 2636 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903719.1 protein_id gnl|my_center|LOCUS_3710 3999 3226 gene locus_tag LOCUS_3720 gene cobS 3999 3226 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016745.1 protein_id gnl|my_center|LOCUS_3720 4579 4016 gene locus_tag LOCUS_3730 gene cobU 4579 4016 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016746.1 protein_id gnl|my_center|LOCUS_3730 >Feature sequence064 50 364 gene locus_tag LOCUS_3740 50 364 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422696.1 protein_id gnl|my_center|LOCUS_3740 384 1346 gene locus_tag LOCUS_3750 384 1346 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895213.1 protein_id gnl|my_center|LOCUS_3750 1369 2655 gene locus_tag LOCUS_3760 gene celB 1369 2655 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098234.1 protein_id gnl|my_center|LOCUS_3760 2677 2982 gene locus_tag LOCUS_3770 2677 2982 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417897.1 protein_id gnl|my_center|LOCUS_3770 3052 4443 gene locus_tag LOCUS_3780 gene pepV 3052 4443 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 protein_id gnl|my_center|LOCUS_3780 >Feature sequence065 <1 1268 gene locus_tag LOCUS_3790 <1 1268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016153.1:molecular chaperone DnaK 1369 2241 gene locus_tag LOCUS_3800 1369 2241 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127403.1 protein_id gnl|my_center|LOCUS_3800 2307 3488 gene locus_tag LOCUS_3810 gene dnaJ 2307 3488 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016154.1 protein_id gnl|my_center|LOCUS_3810 3555 3827 gene locus_tag LOCUS_3820 gene yajC 3555 3827 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017079.1 protein_id gnl|my_center|LOCUS_3820 3944 4951 gene locus_tag LOCUS_3830 3944 4951 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491986.1 protein_id gnl|my_center|LOCUS_3830 >Feature sequence066 45 1319 gene locus_tag LOCUS_3840 gene hacA 45 1319 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_3840 1321 1812 gene locus_tag LOCUS_3850 1321 1812 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878133.1 protein_id gnl|my_center|LOCUS_3850 1829 2980 gene locus_tag LOCUS_3860 1829 2980 CDS product PrpF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928924.1 protein_id gnl|my_center|LOCUS_3860 3281 4456 gene locus_tag LOCUS_3870 3281 4456 CDS product IS110-like element ISFnu4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015895.1 protein_id gnl|my_center|LOCUS_3870 >Feature sequence067 223 2493 gene locus_tag LOCUS_3880 223 2493 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438236.1 protein_id gnl|my_center|LOCUS_3880 2647 4563 gene locus_tag LOCUS_3890 gene recQ 2647 4563 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898541.1 protein_id gnl|my_center|LOCUS_3890 >Feature sequence068 50 2215 gene locus_tag LOCUS_3900 50 2215 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895431.1 protein_id gnl|my_center|LOCUS_3900 2221 4629 gene locus_tag LOCUS_3910 2221 4629 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367423.1 protein_id gnl|my_center|LOCUS_3910 >Feature sequence069 923 222 gene locus_tag LOCUS_3920 gene rsmG 923 222 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015789.1 protein_id gnl|my_center|LOCUS_3920 2808 925 gene locus_tag LOCUS_3930 gene mnmG 2808 925 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015790.1 protein_id gnl|my_center|LOCUS_3930 3480 2824 gene locus_tag LOCUS_3940 3480 2824 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904246.1 protein_id gnl|my_center|LOCUS_3940 <4856 3501 gene locus_tag LOCUS_3950 <4856 3501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015791.1:TrkH family potassium uptake protein >Feature sequence070 2105 576 gene locus_tag LOCUS_3960 2105 576 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_3960 3045 2254 gene locus_tag LOCUS_3970 3045 2254 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901801.1 protein_id gnl|my_center|LOCUS_3970 3889 3038 gene locus_tag LOCUS_3980 3889 3038 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016023.1 protein_id gnl|my_center|LOCUS_3980 4827 3904 gene locus_tag LOCUS_3990 4827 3904 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495574.1 protein_id gnl|my_center|LOCUS_3990 >Feature sequence071 519 319 gene locus_tag LOCUS_4000 519 319 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902519.1 protein_id gnl|my_center|LOCUS_4000 1570 602 gene locus_tag LOCUS_4010 1570 602 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016738.1 protein_id gnl|my_center|LOCUS_4010 2416 1580 gene locus_tag LOCUS_4020 gene kdsA 2416 1580 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 protein_id gnl|my_center|LOCUS_4020 3871 2426 gene locus_tag LOCUS_4030 3871 2426 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016996.1 protein_id gnl|my_center|LOCUS_4030 4236 3883 gene locus_tag LOCUS_4040 4236 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4040 <4825 4321 gene locus_tag LOCUS_4050 <4825 4321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003416528.1:uracil-DNA glycosylase >Feature sequence072 1746 13 gene locus_tag LOCUS_4060 1746 13 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438014.1 protein_id gnl|my_center|LOCUS_4060 2855 1959 gene locus_tag LOCUS_4070 gene era 2855 1959 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016271.1 protein_id gnl|my_center|LOCUS_4070 3647 2856 gene locus_tag LOCUS_4080 gene xerD 3647 2856 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986427.1 protein_id gnl|my_center|LOCUS_4080 <4725 3649 gene locus_tag LOCUS_4090 <4725 3649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016269.1:DNA repair protein RecN >Feature sequence073 2184 604 gene locus_tag LOCUS_4100 2184 604 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779462.1 protein_id gnl|my_center|LOCUS_4100 2941 2201 gene locus_tag LOCUS_4110 gene kdsB 2941 2201 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016663.1 protein_id gnl|my_center|LOCUS_4110 3046 3816 gene locus_tag LOCUS_4120 3046 3816 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_4120 3788 4465 gene locus_tag LOCUS_4130 3788 4465 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903437.1 protein_id gnl|my_center|LOCUS_4130 >Feature sequence074 454 2019 gene locus_tag LOCUS_4140 454 2019 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_4140 2036 3211 gene locus_tag LOCUS_4150 2036 3211 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_4150 >Feature sequence075 918 61 gene locus_tag LOCUS_4160 918 61 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903458.1 protein_id gnl|my_center|LOCUS_4160 1558 959 gene locus_tag LOCUS_4170 1558 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4170 4187 1839 gene locus_tag LOCUS_4180 4187 1839 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903647.1 protein_id gnl|my_center|LOCUS_4180 >Feature sequence076 36 161 gene locus_tag LOCUS_4190 36 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4190 134 820 gene locus_tag LOCUS_4200 134 820 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017071.1 protein_id gnl|my_center|LOCUS_4200 820 1641 gene locus_tag LOCUS_4210 820 1641 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017070.1 protein_id gnl|my_center|LOCUS_4210 1686 2837 gene locus_tag LOCUS_4220 gene dxr 1686 2837 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373191.1 protein_id gnl|my_center|LOCUS_4220 2839 3510 gene locus_tag LOCUS_4230 2839 3510 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017068.1 protein_id gnl|my_center|LOCUS_4230 3522 4541 gene locus_tag LOCUS_4240 3522 4541 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017067.1 protein_id gnl|my_center|LOCUS_4240 >Feature sequence077 166 519 gene locus_tag LOCUS_4250 166 519 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_4250 537 1646 gene locus_tag LOCUS_4260 537 1646 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922322.1 protein_id gnl|my_center|LOCUS_4260 1711 1977 gene locus_tag LOCUS_4270 1711 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4270 1977 2858 gene locus_tag LOCUS_4280 gene citE 1977 2858 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898727.1 protein_id gnl|my_center|LOCUS_4280 2879 4435 gene locus_tag LOCUS_4290 gene citF 2879 4435 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017113.1 protein_id gnl|my_center|LOCUS_4290 >Feature sequence078 59 1375 gene locus_tag LOCUS_4300 59 1375 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017097.1 protein_id gnl|my_center|LOCUS_4300 1377 2291 gene locus_tag LOCUS_4310 1377 2291 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017098.1 protein_id gnl|my_center|LOCUS_4310 2291 3052 gene locus_tag LOCUS_4320 2291 3052 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017099.1 protein_id gnl|my_center|LOCUS_4320 3049 3783 gene locus_tag LOCUS_4330 3049 3783 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017100.1 protein_id gnl|my_center|LOCUS_4330 >Feature sequence079 <1 712 gene locus_tag LOCUS_4340 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016846.1:pitrilysin family protein 725 1165 gene locus_tag LOCUS_4350 gene dut 725 1165 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016845.1 protein_id gnl|my_center|LOCUS_4350 1176 2282 gene locus_tag LOCUS_4360 gene rodA 1176 2282 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016844.1 protein_id gnl|my_center|LOCUS_4360 2294 3172 gene locus_tag LOCUS_4370 2294 3172 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016843.1 protein_id gnl|my_center|LOCUS_4370 3193 4494 gene locus_tag LOCUS_4380 3193 4494 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896779.1 protein_id gnl|my_center|LOCUS_4380 >Feature sequence080 656 75 gene locus_tag LOCUS_4390 656 75 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896752.1 protein_id gnl|my_center|LOCUS_4390 2729 675 gene locus_tag LOCUS_4400 gene kdpB 2729 675 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966942.1 protein_id gnl|my_center|LOCUS_4400 4368 2737 gene locus_tag LOCUS_4410 gene kdpA 4368 2737 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161471071.1 protein_id gnl|my_center|LOCUS_4410 >Feature sequence081 <1 1064 gene locus_tag LOCUS_4420 <1 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003429883.1:glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit 1117 4323 gene locus_tag LOCUS_4430 gene carB 1117 4323 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_4430 >Feature sequence082 815 2233 gene locus_tag LOCUS_4440 gene cysS 815 2233 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015680.1 protein_id gnl|my_center|LOCUS_4440 2221 2610 gene locus_tag LOCUS_4450 2221 2610 CDS product mini-ribonuclease 3-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902248.1 protein_id gnl|my_center|LOCUS_4450 2600 3634 gene locus_tag LOCUS_4460 2600 3634 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902246.1 protein_id gnl|my_center|LOCUS_4460 >Feature sequence083 136 2046 gene locus_tag LOCUS_4470 gene mutL 136 2046 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495553.1 protein_id gnl|my_center|LOCUS_4470 2057 2524 gene locus_tag LOCUS_4480 2057 2524 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016410.1 protein_id gnl|my_center|LOCUS_4480 2558 2899 gene locus_tag LOCUS_4490 2558 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4490 2899 3270 gene locus_tag LOCUS_4500 2899 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4500 >Feature sequence084 338 556 gene locus_tag LOCUS_4510 338 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4510 553 978 gene locus_tag LOCUS_4520 553 978 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476578.1 protein_id gnl|my_center|LOCUS_4520 978 3806 gene locus_tag LOCUS_4530 978 3806 CDS product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015950.1 protein_id gnl|my_center|LOCUS_4530 <4386 3819 gene locus_tag LOCUS_4540 <4386 3819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009968074.1:two-component system response regulator MaeM >Feature sequence085 <1 825 gene locus_tag LOCUS_4550 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016682.1:TonB-dependent receptor 854 1807 gene locus_tag LOCUS_4560 854 1807 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948718.1 protein_id gnl|my_center|LOCUS_4560 1797 2765 gene locus_tag LOCUS_4570 1797 2765 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861283.1 protein_id gnl|my_center|LOCUS_4570 2762 3517 gene locus_tag LOCUS_4580 2762 3517 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948720.1 protein_id gnl|my_center|LOCUS_4580 >Feature sequence086 692 1495 gene locus_tag LOCUS_4590 gene proB 692 1495 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_4590 1505 2752 gene locus_tag LOCUS_4600 1505 2752 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704295.1 protein_id gnl|my_center|LOCUS_4600 3389 2814 gene locus_tag LOCUS_4610 3389 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4610 4257 3400 gene locus_tag LOCUS_4620 4257 3400 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948436.1 protein_id gnl|my_center|LOCUS_4620 >Feature sequence087 3282 2086 gene locus_tag LOCUS_4630 3282 2086 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015639.1 protein_id gnl|my_center|LOCUS_4630 3956 3297 gene locus_tag LOCUS_4640 gene ribE 3956 3297 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015638.1 protein_id gnl|my_center|LOCUS_4640 >Feature sequence088 1 1149 gene locus_tag LOCUS_4650 1 1149 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359361.1 protein_id gnl|my_center|LOCUS_4650 2374 1196 gene locus_tag LOCUS_4660 2374 1196 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_4660 3563 2505 gene locus_tag LOCUS_4670 gene mnmA 3563 2505 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627079.1 protein_id gnl|my_center|LOCUS_4670 4268 3567 gene locus_tag LOCUS_4680 4268 3567 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015921.1 protein_id gnl|my_center|LOCUS_4680 >Feature sequence089 766 128 gene locus_tag LOCUS_4690 766 128 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015966.1 protein_id gnl|my_center|LOCUS_4690 1816 845 gene locus_tag LOCUS_4700 1816 845 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903312.1 protein_id gnl|my_center|LOCUS_4700 3169 1820 gene locus_tag LOCUS_4710 gene glmU 3169 1820 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015965.1 protein_id gnl|my_center|LOCUS_4710 3810 3259 gene locus_tag LOCUS_4720 3810 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4720 >Feature sequence090 1090 500 gene locus_tag LOCUS_4730 gene ruvA 1090 500 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902889.1 protein_id gnl|my_center|LOCUS_4730 <4225 1315 gene locus_tag LOCUS_4740 <4225 1315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201626200.1:excinuclease ABC subunit UvrA >Feature sequence091 <1 679 gene locus_tag LOCUS_4750 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016291.1:replication-associated recombination protein A 693 1934 gene locus_tag LOCUS_4760 gene hisS 693 1934 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016292.1 protein_id gnl|my_center|LOCUS_4760 2028 3824 gene locus_tag LOCUS_4770 gene aspS 2028 3824 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016293.1 protein_id gnl|my_center|LOCUS_4770 >Feature sequence092 78 2306 gene locus_tag LOCUS_4780 gene pflB 78 2306 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903513.1 protein_id gnl|my_center|LOCUS_4780 2356 3084 gene locus_tag LOCUS_4790 gene pflA 2356 3084 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903514.1 protein_id gnl|my_center|LOCUS_4790 >Feature sequence093 450 983 gene locus_tag LOCUS_4800 gene hslV 450 983 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081403.1 protein_id gnl|my_center|LOCUS_4800 999 2114 gene locus_tag LOCUS_4810 gene yqeH 999 2114 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016880.1 protein_id gnl|my_center|LOCUS_4810 2118 2609 gene locus_tag LOCUS_4820 2118 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4820 2640 4028 gene locus_tag LOCUS_4830 2640 4028 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583433.1 protein_id gnl|my_center|LOCUS_4830 >Feature sequence094 14 496 gene locus_tag LOCUS_4840 14 496 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_4840 537 2315 gene locus_tag LOCUS_4850 gene nuoF 537 2315 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_4850 2334 4091 gene locus_tag LOCUS_4860 2334 4091 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868906.1 protein_id gnl|my_center|LOCUS_4860 >Feature sequence095 720 79 gene locus_tag LOCUS_4870 720 79 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902631.1 protein_id gnl|my_center|LOCUS_4870 1410 748 gene locus_tag LOCUS_4880 1410 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627794.1 protein_id gnl|my_center|LOCUS_4880 2545 1391 gene locus_tag LOCUS_4890 2545 1391 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016322.1 protein_id gnl|my_center|LOCUS_4890 3633 2545 gene locus_tag LOCUS_4900 3633 2545 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627795.1 protein_id gnl|my_center|LOCUS_4900 4036 3644 gene locus_tag LOCUS_4910 4036 3644 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016324.1 protein_id gnl|my_center|LOCUS_4910 >Feature sequence096 997 922 gene locus_tag LOCUS_t0020 997 922 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1742 1038 gene locus_tag LOCUS_4920 1742 1038 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015967.1 protein_id gnl|my_center|LOCUS_4920 2718 1909 gene locus_tag LOCUS_4930 2718 1909 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903844.1 protein_id gnl|my_center|LOCUS_4930 3556 2783 gene locus_tag LOCUS_4940 3556 2783 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627435.1 protein_id gnl|my_center|LOCUS_4940 <4052 3549 gene locus_tag LOCUS_4950 <4052 3549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015835.1:ABC transporter permease >Feature sequence097 <1 1049 gene locus_tag LOCUS_4960 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016113.1:carboxypeptidase M32 1061 2875 gene locus_tag LOCUS_4970 1061 2875 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016920.1 protein_id gnl|my_center|LOCUS_4970 2899 3450 gene locus_tag LOCUS_4980 2899 3450 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016918.1 protein_id gnl|my_center|LOCUS_4980 >Feature sequence098 130 378 gene locus_tag LOCUS_4990 130 378 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583796.1 protein_id gnl|my_center|LOCUS_4990 371 937 gene locus_tag LOCUS_5000 gene gmk 371 937 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904066.1 protein_id gnl|my_center|LOCUS_5000 952 1167 gene locus_tag LOCUS_5010 952 1167 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894911.1 protein_id gnl|my_center|LOCUS_5010 1160 2152 gene locus_tag LOCUS_5020 1160 2152 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894909.1 protein_id gnl|my_center|LOCUS_5020 <4044 2221 gene locus_tag LOCUS_5030 <4044 2221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_171280290.1:PTS fructose transporter subunit EIIC >Feature sequence099 1408 47 gene locus_tag LOCUS_5040 1408 47 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401544.1 protein_id gnl|my_center|LOCUS_5040 2951 1410 gene locus_tag LOCUS_5050 2951 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268198.1 protein_id gnl|my_center|LOCUS_5050 3697 2969 gene locus_tag LOCUS_5060 3697 2969 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930423.1 protein_id gnl|my_center|LOCUS_5060 >Feature sequence100 513 160 gene locus_tag LOCUS_5070 513 160 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171487421.1 protein_id gnl|my_center|LOCUS_5070 648 2606 gene locus_tag LOCUS_5080 648 2606 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015907.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_5080 2699 3079 gene locus_tag LOCUS_5090 2699 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_5090 3098 3388 gene locus_tag LOCUS_5100 3098 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5100 3385 3924 gene locus_tag LOCUS_5110 3385 3924 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393699.1 protein_id gnl|my_center|LOCUS_5110 >Feature sequence101 1441 86 gene locus_tag LOCUS_5120 1441 86 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016888.1 protein_id gnl|my_center|LOCUS_5120 2068 1655 gene locus_tag LOCUS_5130 2068 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5130 3291 2071 gene locus_tag LOCUS_5140 gene hydF 3291 2071 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_5140 3935 3342 gene locus_tag LOCUS_5150 gene recR 3935 3342 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016369.1 protein_id gnl|my_center|LOCUS_5150 >Feature sequence102 1328 165 gene locus_tag LOCUS_5160 gene earP 1328 165 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016605.1 protein_id gnl|my_center|LOCUS_5160 2268 1309 gene locus_tag LOCUS_5170 2268 1309 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016600.1 protein_id gnl|my_center|LOCUS_5170 >Feature sequence103 1348 167 gene locus_tag LOCUS_5180 1348 167 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861662.1 protein_id gnl|my_center|LOCUS_5180 2842 1502 gene locus_tag LOCUS_5190 2842 1502 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_5190 <4021 2996 gene locus_tag LOCUS_5200 <4021 2996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812114.1:D-aminoacylase >Feature sequence104 <1 1393 gene locus_tag LOCUS_5210 <1 1393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016921.1:S9 family peptidase 1499 2611 gene locus_tag LOCUS_5220 1499 2611 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963544.1 protein_id gnl|my_center|LOCUS_5220 >Feature sequence105 953 877 gene locus_tag LOCUS_t0030 953 877 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1237 1076 gene locus_tag LOCUS_5230 1237 1076 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_5230 1663 1283 gene locus_tag LOCUS_5240 1663 1283 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048271.1 protein_id gnl|my_center|LOCUS_5240 2115 1696 gene locus_tag LOCUS_5250 2115 1696 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904077.1 protein_id gnl|my_center|LOCUS_5250 2658 2209 gene locus_tag LOCUS_5260 2658 2209 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015995.1 protein_id gnl|my_center|LOCUS_5260 3398 2667 gene locus_tag LOCUS_5270 gene truA 3398 2667 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627073.1 protein_id gnl|my_center|LOCUS_5270 3543 3460 gene locus_tag LOCUS_t0040 3543 3460 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3624 3549 gene locus_tag LOCUS_t0050 3624 3549 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3717 3642 gene locus_tag LOCUS_t0060 3717 3642 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3816 3740 gene locus_tag LOCUS_t0070 3816 3740 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3898 3823 gene locus_tag LOCUS_t0080 3898 3823 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3983 3907 gene locus_tag LOCUS_t0090 3983 3907 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence106 592 122 gene locus_tag LOCUS_5280 592 122 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898570.1 protein_id gnl|my_center|LOCUS_5280 852 1184 gene locus_tag LOCUS_5290 852 1184 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429379.1 protein_id gnl|my_center|LOCUS_5290 1222 1776 gene locus_tag LOCUS_5300 1222 1776 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434976.1 protein_id gnl|my_center|LOCUS_5300 2209 1778 gene locus_tag LOCUS_5310 2209 1778 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965636.1 protein_id gnl|my_center|LOCUS_5310 2616 2212 gene locus_tag LOCUS_5320 2616 2212 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015893.1 protein_id gnl|my_center|LOCUS_5320 2714 3880 gene locus_tag LOCUS_5330 2714 3880 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016855.1 protein_id gnl|my_center|LOCUS_5330 >Feature sequence107 18 1187 gene locus_tag LOCUS_5340 18 1187 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861089.1 protein_id gnl|my_center|LOCUS_5340 1205 1792 gene locus_tag LOCUS_5350 1205 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5350 3043 1874 gene locus_tag LOCUS_5360 3043 1874 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010680900.1 protein_id gnl|my_center|LOCUS_5360 3377 3904 gene locus_tag LOCUS_5370 3377 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5370 >Feature sequence108 23 1459 gene locus_tag LOCUS_5380 gene uxaB 23 1459 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854618.1 protein_id gnl|my_center|LOCUS_5380 1459 2949 gene locus_tag LOCUS_5390 gene uxaA 1459 2949 CDS product altronate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199352.1 protein_id gnl|my_center|LOCUS_5390 2971 3945 gene locus_tag LOCUS_5400 2971 3945 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_5400 >Feature sequence109 1517 363 gene locus_tag LOCUS_5410 gene metK 1517 363 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016332.1 protein_id gnl|my_center|LOCUS_5410 2424 1753 gene locus_tag LOCUS_5420 2424 1753 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070938.1 protein_id gnl|my_center|LOCUS_5420 3911 2538 gene locus_tag LOCUS_5430 gene citF 3911 2538 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272879.1 protein_id gnl|my_center|LOCUS_5430 >Feature sequence110 555 2057 gene locus_tag LOCUS_5440 gene yfcC 555 2057 CDS product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016083.1 protein_id gnl|my_center|LOCUS_5440 2197 3699 gene locus_tag LOCUS_5450 2197 3699 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902867.1 protein_id gnl|my_center|LOCUS_5450 >Feature sequence111 <1 989 gene locus_tag LOCUS_5460 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_124797038.1:putative glycoside hydrolase 1070 1927 gene locus_tag LOCUS_5470 gene truB 1070 1927 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016546.1 protein_id gnl|my_center|LOCUS_5470 1948 3765 gene locus_tag LOCUS_5480 gene typA 1948 3765 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016545.1 protein_id gnl|my_center|LOCUS_5480 >Feature sequence112 2321 240 gene locus_tag LOCUS_5490 gene fusA 2321 240 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015672.1 protein_id gnl|my_center|LOCUS_5490 2846 2376 gene locus_tag LOCUS_5500 gene rpsG 2846 2376 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005888149.1 protein_id gnl|my_center|LOCUS_5500 3239 2871 gene locus_tag LOCUS_5510 gene rpsL 3239 2871 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894529.1 protein_id gnl|my_center|LOCUS_5510 >Feature sequence113 <1 564 gene locus_tag LOCUS_5520 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015648.1:23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB 613 1209 gene locus_tag LOCUS_5530 613 1209 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015647.1 protein_id gnl|my_center|LOCUS_5530 >Feature sequence114 1152 838 gene locus_tag LOCUS_5540 1152 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5540 3842 1182 gene locus_tag LOCUS_5550 3842 1182 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015981.1 protein_id gnl|my_center|LOCUS_5550 >Feature sequence115 <1 860 gene locus_tag LOCUS_5560 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002163510.1:heme ABC transporter substrate-binding protein IsdE 844 1833 gene locus_tag LOCUS_5570 844 1833 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670726.1 protein_id gnl|my_center|LOCUS_5570 1835 2605 gene locus_tag LOCUS_5580 1835 2605 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626546.1 protein_id gnl|my_center|LOCUS_5580 2675 3358 gene locus_tag LOCUS_5590 2675 3358 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_5590 >Feature sequence116 489 115 gene locus_tag LOCUS_5600 489 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5600 842 549 gene locus_tag LOCUS_5610 842 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5610 1162 866 gene locus_tag LOCUS_5620 1162 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5620 1757 1515 gene locus_tag LOCUS_5630 1757 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5630 2478 1771 gene locus_tag LOCUS_5640 2478 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5640 3539 2490 gene locus_tag LOCUS_5650 3539 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5650 >Feature sequence117 827 603 gene locus_tag LOCUS_5660 gene secG 827 603 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904328.1 protein_id gnl|my_center|LOCUS_5660 1199 936 gene locus_tag LOCUS_5670 gene rpsO 1199 936 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890045.1 protein_id gnl|my_center|LOCUS_5670 3451 1295 gene locus_tag LOCUS_5680 gene ftsH 3451 1295 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015954.1 protein_id gnl|my_center|LOCUS_5680 >Feature sequence118 251 33 gene locus_tag LOCUS_5690 gene rpsR 251 33 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005891822.1 protein_id gnl|my_center|LOCUS_5690 574 290 gene locus_tag LOCUS_5700 gene rpsF 574 290 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023040534.1 protein_id gnl|my_center|LOCUS_5700 1742 675 gene locus_tag LOCUS_5710 gene ftsZ 1742 675 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902285.1 protein_id gnl|my_center|LOCUS_5710 3094 1763 gene locus_tag LOCUS_5720 gene ftsA 3094 1763 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902286.1 protein_id gnl|my_center|LOCUS_5720 <3766 3081 gene locus_tag LOCUS_5730 <3766 3081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898188.1:cell division protein FtsQ/DivIB >Feature sequence119 38 439 gene locus_tag LOCUS_5740 38 439 CDS product DUF2399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948374.1 protein_id gnl|my_center|LOCUS_5740 1422 487 gene locus_tag LOCUS_5750 1422 487 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_5750 3384 1435 gene locus_tag LOCUS_5760 3384 1435 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_5760 >Feature sequence120 1846 128 gene locus_tag LOCUS_5770 1846 128 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_5770 <3751 2113 gene locus_tag LOCUS_5780 <3751 2113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase >Feature sequence121 176 1525 gene locus_tag LOCUS_5790 176 1525 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389377.1 protein_id gnl|my_center|LOCUS_5790 1745 2707 gene locus_tag LOCUS_5800 1745 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5800 2718 3524 gene locus_tag LOCUS_5810 2718 3524 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099498.1 protein_id gnl|my_center|LOCUS_5810 >Feature sequence122 <1 825 gene locus_tag LOCUS_5820 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047697.1:dicarboxylate/amino acid:cation symporter 915 2105 gene locus_tag LOCUS_5830 915 2105 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_5830 2120 2872 gene locus_tag LOCUS_5840 2120 2872 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019252.1 protein_id gnl|my_center|LOCUS_5840 2882 3649 gene locus_tag LOCUS_5850 2882 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5850 >Feature sequence123 405 19 gene locus_tag LOCUS_5860 gene nifU 405 19 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796962.1 protein_id gnl|my_center|LOCUS_5860 1611 439 gene locus_tag LOCUS_5870 gene nifS 1611 439 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016111.1 protein_id gnl|my_center|LOCUS_5870 2326 1679 gene locus_tag LOCUS_5880 gene nth 2326 1679 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895383.1 protein_id gnl|my_center|LOCUS_5880 2789 2337 gene locus_tag LOCUS_5890 2789 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5890 <3743 2829 gene locus_tag LOCUS_5900 <3743 2829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_147367412.1:tyrosine--tRNA ligase >Feature sequence124 2020 1331 gene locus_tag LOCUS_5910 gene tsaB 2020 1331 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016759.1 protein_id gnl|my_center|LOCUS_5910 2465 2001 gene locus_tag LOCUS_5920 gene tsaE 2465 2001 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903737.1 protein_id gnl|my_center|LOCUS_5920 2958 2458 gene locus_tag LOCUS_5930 gene rfaE2 2958 2458 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896999.1 protein_id gnl|my_center|LOCUS_5930 3655 3038 gene locus_tag LOCUS_5940 3655 3038 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016761.1 protein_id gnl|my_center|LOCUS_5940 >Feature sequence125 575 57 gene locus_tag LOCUS_5950 575 57 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016072.1 protein_id gnl|my_center|LOCUS_5950 1451 597 gene locus_tag LOCUS_5960 gene nadC 1451 597 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016071.1 protein_id gnl|my_center|LOCUS_5960 2746 1448 gene locus_tag LOCUS_5970 2746 1448 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016070.1 protein_id gnl|my_center|LOCUS_5970 3474 2749 gene locus_tag LOCUS_5980 gene nadA 3474 2749 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016069.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_5980 3655 3527 gene locus_tag LOCUS_5990 3655 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5990 >Feature sequence126 2445 1567 gene locus_tag LOCUS_6000 2445 1567 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003517572.1 protein_id gnl|my_center|LOCUS_6000 3356 2457 gene locus_tag LOCUS_6010 3356 2457 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 protein_id gnl|my_center|LOCUS_6010 >Feature sequence127 20 694 gene locus_tag LOCUS_6020 20 694 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017182.1 protein_id gnl|my_center|LOCUS_6020 1167 1988 gene locus_tag LOCUS_6030 1167 1988 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814503.1 protein_id gnl|my_center|LOCUS_6030 2021 2788 gene locus_tag LOCUS_6040 2021 2788 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943967.1 protein_id gnl|my_center|LOCUS_6040 2801 3544 gene locus_tag LOCUS_6050 2801 3544 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459577.1 protein_id gnl|my_center|LOCUS_6050 >Feature sequence128 2220 1117 gene locus_tag LOCUS_6060 gene hydE 2220 1117 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964939.1 protein_id gnl|my_center|LOCUS_6060 2729 2232 gene locus_tag LOCUS_6070 2729 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6070 3250 2726 gene locus_tag LOCUS_6080 3250 2726 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903679.1 protein_id gnl|my_center|LOCUS_6080 >Feature sequence129 158 233 gene locus_tag LOCUS_t0100 158 233 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 360 710 gene locus_tag LOCUS_6090 gene rplS 360 710 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898626.1 protein_id gnl|my_center|LOCUS_6090 819 2162 gene locus_tag LOCUS_6100 819 2162 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861407.1 protein_id gnl|my_center|LOCUS_6100 >Feature sequence130 545 1873 gene locus_tag LOCUS_6110 gene dsdA 545 1873 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658347.1 protein_id gnl|my_center|LOCUS_6110 1987 3345 gene locus_tag LOCUS_6120 1987 3345 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_6120 >Feature sequence131 <1 756 gene locus_tag LOCUS_6130 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948803.1:iron ABC transporter permease 756 1673 gene locus_tag LOCUS_6140 756 1673 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948804.1 protein_id gnl|my_center|LOCUS_6140 1950 2690 gene locus_tag LOCUS_6150 1950 2690 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198479972.1 protein_id gnl|my_center|LOCUS_6150 2716 3486 gene locus_tag LOCUS_6160 2716 3486 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868883.1 protein_id gnl|my_center|LOCUS_6160 >Feature sequence132 94 384 gene locus_tag LOCUS_6170 gene gatC 94 384 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903491.1 protein_id gnl|my_center|LOCUS_6170 413 1870 gene locus_tag LOCUS_6180 gene gatA 413 1870 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903492.1 protein_id gnl|my_center|LOCUS_6180 1889 3331 gene locus_tag LOCUS_6190 gene gatB 1889 3331 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016630.1 protein_id gnl|my_center|LOCUS_6190 3433 3636 gene locus_tag LOCUS_6200 3433 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6200 >Feature sequence133 2040 607 gene locus_tag LOCUS_6210 2040 607 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987157.1 protein_id gnl|my_center|LOCUS_6210 3644 2109 gene locus_tag LOCUS_6220 3644 2109 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_6220 >Feature sequence134 638 1648 gene locus_tag LOCUS_6230 638 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6230 1664 2992 gene locus_tag LOCUS_6240 1664 2992 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_6240 >Feature sequence135 <1 684 gene locus_tag LOCUS_6250 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903983.1:ArsB/NhaD family transporter 1173 730 gene locus_tag LOCUS_6260 1173 730 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435038.1 protein_id gnl|my_center|LOCUS_6260 1647 1297 gene locus_tag LOCUS_6270 gene rplQ 1647 1297 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903918.1 protein_id gnl|my_center|LOCUS_6270 2654 1677 gene locus_tag LOCUS_6280 2654 1677 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041516.1 protein_id gnl|my_center|LOCUS_6280 3269 2682 gene locus_tag LOCUS_6290 gene rpsD 3269 2682 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_6290 >Feature sequence136 <1 549 gene locus_tag LOCUS_6300 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903562.1:FtsW/RodA/SpoVE family cell cycle protein 1149 571 gene locus_tag LOCUS_6310 1149 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706253.1 protein_id gnl|my_center|LOCUS_6310 1310 2404 gene locus_tag LOCUS_6320 gene aroC 1310 2404 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_6320 2397 3218 gene locus_tag LOCUS_6330 2397 3218 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627323.1 protein_id gnl|my_center|LOCUS_6330 >Feature sequence137 24 1010 gene locus_tag LOCUS_6340 24 1010 CDS product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017179.1 protein_id gnl|my_center|LOCUS_6340 1039 2886 gene locus_tag LOCUS_6350 1039 2886 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902322.1 protein_id gnl|my_center|LOCUS_6350 >Feature sequence138 1741 125 gene locus_tag LOCUS_6360 gene groL 1741 125 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016573.1 protein_id gnl|my_center|LOCUS_6360 2030 1761 gene locus_tag LOCUS_6370 2030 1761 CDS product molecular chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902067.1 protein_id gnl|my_center|LOCUS_6370 2196 3557 gene locus_tag LOCUS_6380 2196 3557 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_6380 >Feature sequence139 3554 3186 gene locus_tag LOCUS_6390 gene rplL 3554 3186 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005889295.1 protein_id gnl|my_center|LOCUS_6390 >Feature sequence140 94 888 gene locus_tag LOCUS_6400 94 888 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903503.1 protein_id gnl|my_center|LOCUS_6400 924 1643 gene locus_tag LOCUS_6410 924 1643 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016272.1 protein_id gnl|my_center|LOCUS_6410 1646 2305 gene locus_tag LOCUS_6420 1646 2305 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903501.1 protein_id gnl|my_center|LOCUS_6420 3408 2377 gene locus_tag LOCUS_6430 3408 2377 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016813.1 protein_id gnl|my_center|LOCUS_6430 >Feature sequence141 39 1550 gene locus_tag LOCUS_6440 39 1550 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016819.1 protein_id gnl|my_center|LOCUS_6440 1567 2601 gene locus_tag LOCUS_6450 1567 2601 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032842698.1 protein_id gnl|my_center|LOCUS_6450 3363 2629 gene locus_tag LOCUS_6460 3363 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6460 3568 3386 gene locus_tag LOCUS_6470 3568 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6470 >Feature sequence142 1695 466 gene locus_tag LOCUS_6480 1695 466 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005914987.1 protein_id gnl|my_center|LOCUS_6480 2369 1692 gene locus_tag LOCUS_6490 2369 1692 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903416.1 protein_id gnl|my_center|LOCUS_6490 3459 2344 gene locus_tag LOCUS_6500 3459 2344 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898025.1 protein_id gnl|my_center|LOCUS_6500 >Feature sequence143 <1 705 gene locus_tag LOCUS_6510 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068666.1:alpha/beta hydrolase 1865 726 gene locus_tag LOCUS_6520 gene nagA 1865 726 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271133.1 protein_id gnl|my_center|LOCUS_6520 2758 1931 gene locus_tag LOCUS_6530 gene nagB 2758 1931 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016935.1 protein_id gnl|my_center|LOCUS_6530 <3560 2774 gene locus_tag LOCUS_6540 <3560 2774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704383.1:SIS domain-containing protein >Feature sequence144 294 902 gene locus_tag LOCUS_6550 294 902 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774866.1 protein_id gnl|my_center|LOCUS_6550 968 1507 gene locus_tag LOCUS_6560 968 1507 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392868.1 protein_id gnl|my_center|LOCUS_6560 1530 3197 gene locus_tag LOCUS_6570 gene dacB 1530 3197 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 protein_id gnl|my_center|LOCUS_6570 >Feature sequence145 <1 1412 gene locus_tag LOCUS_6580 <1 1412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016044.1:UDP-glucose--hexose-1-phosphate uridylyltransferase 1433 2422 gene locus_tag LOCUS_6590 gene galE 1433 2422 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016045.1 protein_id gnl|my_center|LOCUS_6590 3454 2513 gene locus_tag LOCUS_6600 3454 2513 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271954.1 protein_id gnl|my_center|LOCUS_6600 >Feature sequence146 1741 947 gene locus_tag LOCUS_6610 gene asrB 1741 947 CDS product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964822.1 protein_id gnl|my_center|LOCUS_6610 2753 1734 gene locus_tag LOCUS_6620 gene asrA 2753 1734 CDS product anaerobic sulfite reductase subunit AsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964821.1 protein_id gnl|my_center|LOCUS_6620 <3500 2831 gene locus_tag LOCUS_6630 <3500 2831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964819.1:Crp/Fnr family transcriptional regulator >Feature sequence147 <1 1684 gene locus_tag LOCUS_6640 <1 1684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_124795646.1:phospho-sugar mutase 1705 2781 gene locus_tag LOCUS_6650 gene hemW 1705 2781 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016482.1 protein_id gnl|my_center|LOCUS_6650 2797 3474 gene locus_tag LOCUS_6660 2797 3474 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016483.1 protein_id gnl|my_center|LOCUS_6660 >Feature sequence148 1828 515 gene locus_tag LOCUS_6670 gene trmFO 1828 515 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016878.1 protein_id gnl|my_center|LOCUS_6670 <3439 1839 gene locus_tag LOCUS_6680 <3439 1839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902939.1:type I DNA topoisomerase >Feature sequence149 19 837 gene locus_tag LOCUS_6690 19 837 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203489.1 protein_id gnl|my_center|LOCUS_6690 850 1791 gene locus_tag LOCUS_6700 850 1791 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 protein_id gnl|my_center|LOCUS_6700 1810 2454 gene locus_tag LOCUS_6710 gene fsa 1810 2454 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722103.1 protein_id gnl|my_center|LOCUS_6710 2469 3134 gene locus_tag LOCUS_6720 gene deoC 2469 3134 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453154.1 protein_id gnl|my_center|LOCUS_6720 >Feature sequence150 123 1535 gene locus_tag LOCUS_6730 gene pykF 123 1535 CDS product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900019.1 protein_id gnl|my_center|LOCUS_6730 1609 2916 gene locus_tag LOCUS_6740 gene eno 1609 2916 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015819.1 protein_id gnl|my_center|LOCUS_6740 >Feature sequence151 1700 720 gene locus_tag LOCUS_6750 gene prfB 1700 720 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197551829.1 protein_id gnl|my_center|LOCUS_6750 2286 1831 gene locus_tag LOCUS_6760 2286 1831 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_6760 2657 2289 gene locus_tag LOCUS_6770 gene acpS 2657 2289 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017085.1 protein_id gnl|my_center|LOCUS_6770 <3411 2659 gene locus_tag LOCUS_6780 <3411 2659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207834.1:methyltransferase domain-containing protein >Feature sequence152 1330 122 gene locus_tag LOCUS_6790 1330 122 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_6790 3265 1346 gene locus_tag LOCUS_6800 3265 1346 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903247.1 protein_id gnl|my_center|LOCUS_6800 >Feature sequence153 2896 1202 gene locus_tag LOCUS_6810 2896 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6810 >Feature sequence154 2617 2162 gene locus_tag LOCUS_6820 2617 2162 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434060.1 protein_id gnl|my_center|LOCUS_6820 <3326 2618 gene locus_tag LOCUS_6830 <3326 2618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434058.1:FAD binding domain-containing protein >Feature sequence155 976 44 gene locus_tag LOCUS_6840 gene selD 976 44 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q9L4E1 protein_id gnl|my_center|LOCUS_6840 1357 1097 gene locus_tag LOCUS_6850 1357 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6850 <3315 1438 gene locus_tag LOCUS_6860 <3315 1438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016717.1:3-dehydroquinate synthase >Feature sequence156 271 423 gene locus_tag LOCUS_6870 gene rpmG 271 423 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940181.1 protein_id gnl|my_center|LOCUS_6870 446 521 gene locus_tag LOCUS_t0110 446 521 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 555 737 gene locus_tag LOCUS_6880 gene secE 555 737 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904075.1 protein_id gnl|my_center|LOCUS_6880 742 1344 gene locus_tag LOCUS_6890 gene nusG 742 1344 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904074.1 protein_id gnl|my_center|LOCUS_6890 1409 1834 gene locus_tag LOCUS_6900 gene rplK 1409 1834 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894933.1 protein_id gnl|my_center|LOCUS_6900 1923 2630 gene locus_tag LOCUS_6910 gene rplA 1923 2630 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015994.1 protein_id gnl|my_center|LOCUS_6910 >Feature sequence157 1599 961 gene locus_tag LOCUS_6920 1599 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902933.1 protein_id gnl|my_center|LOCUS_6920 2265 1639 gene locus_tag LOCUS_6930 gene udk 2265 1639 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986880.1 protein_id gnl|my_center|LOCUS_6930 >Feature sequence158 <1 2076 gene locus_tag LOCUS_6940 <1 2076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201627746.1:PolC-type DNA polymerase III 2177 2455 gene locus_tag LOCUS_6950 2177 2455 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901839.1 protein_id gnl|my_center|LOCUS_6950 >Feature sequence159 261 1445 gene locus_tag LOCUS_6960 261 1445 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_6960 1548 2324 gene locus_tag LOCUS_6970 1548 2324 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 protein_id gnl|my_center|LOCUS_6970 2373 3212 gene locus_tag LOCUS_6980 2373 3212 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 protein_id gnl|my_center|LOCUS_6980 >Feature sequence160 205 582 gene locus_tag LOCUS_6990 205 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_6990 683 1849 gene locus_tag LOCUS_7000 683 1849 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_7000 2868 1936 gene locus_tag LOCUS_7010 2868 1936 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_7010 >Feature sequence161 123 1295 gene locus_tag LOCUS_7020 123 1295 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627896.1 protein_id gnl|my_center|LOCUS_7020 1326 2087 gene locus_tag LOCUS_7030 1326 2087 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198479972.1 protein_id gnl|my_center|LOCUS_7030 2170 2364 gene locus_tag LOCUS_7040 2170 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7040 2440 3168 gene locus_tag LOCUS_7050 2440 3168 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016437.1 protein_id gnl|my_center|LOCUS_7050 >Feature sequence162 641 1609 gene locus_tag LOCUS_7060 641 1609 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439336.1 protein_id gnl|my_center|LOCUS_7060 1622 2512 gene locus_tag LOCUS_7070 1622 2512 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948810.1 protein_id gnl|my_center|LOCUS_7070 >Feature sequence163 135 263 gene locus_tag LOCUS_7080 135 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7080 312 1976 gene locus_tag LOCUS_7090 312 1976 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903107.1 protein_id gnl|my_center|LOCUS_7090 >Feature sequence164 <1 504 gene locus_tag LOCUS_7100 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162484762.1:class I SAM-dependent DNA methyltransferase 515 1582 gene locus_tag LOCUS_7110 gene corA 515 1582 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901598.1 protein_id gnl|my_center|LOCUS_7110 1604 3115 gene locus_tag LOCUS_7120 1604 3115 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016819.1 protein_id gnl|my_center|LOCUS_7120 >Feature sequence165 2601 811 gene locus_tag LOCUS_7130 gene hflX 2601 811 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016675.1 protein_id gnl|my_center|LOCUS_7130 2754 3038 gene locus_tag LOCUS_7140 2754 3038 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437519.1 protein_id gnl|my_center|LOCUS_7140 >Feature sequence166 179 652 gene locus_tag LOCUS_7150 179 652 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005919085.1 protein_id gnl|my_center|LOCUS_7150 662 1123 gene locus_tag LOCUS_7160 gene nrdR 662 1123 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902339.1 protein_id gnl|my_center|LOCUS_7160 1139 2056 gene locus_tag LOCUS_7170 gene fmt 1139 2056 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373209.1 protein_id gnl|my_center|LOCUS_7170 2082 2933 gene locus_tag LOCUS_7180 gene folD 2082 2933 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864845.1 protein_id gnl|my_center|LOCUS_7180 >Feature sequence167 <1 1035 gene locus_tag LOCUS_7190 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015702.1:tRNA (guanosine(46)-N7)-methyltransferase TrmB note possible pseudo, frameshifted 1046 1741 gene locus_tag LOCUS_7200 1046 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_7200 1759 3036 gene locus_tag LOCUS_7210 1759 3036 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015701.1 protein_id gnl|my_center|LOCUS_7210 >Feature sequence168 817 185 gene locus_tag LOCUS_7220 gene thiE 817 185 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939368.1 protein_id gnl|my_center|LOCUS_7220 1343 807 gene locus_tag LOCUS_7230 gene thiF 1343 807 CDS product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897548.1 protein_id gnl|my_center|LOCUS_7230 2446 1340 gene locus_tag LOCUS_7240 gene thiH 2446 1340 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896847.1 protein_id gnl|my_center|LOCUS_7240 <3152 2448 gene locus_tag LOCUS_7250 <3152 2448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009889636.1:thiazole synthase >Feature sequence169 54 428 gene locus_tag LOCUS_7260 54 428 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272757.1 protein_id gnl|my_center|LOCUS_7260 524 1537 gene locus_tag LOCUS_7270 524 1537 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462034.1 protein_id gnl|my_center|LOCUS_7270 >Feature sequence170 910 230 gene locus_tag LOCUS_7280 910 230 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704854.1 protein_id gnl|my_center|LOCUS_7280 1925 891 gene locus_tag LOCUS_7290 1925 891 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356948.1 protein_id gnl|my_center|LOCUS_7290 <3117 2146 gene locus_tag LOCUS_7300 <3117 2146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861942.1:magnesium-translocating P-type ATPase >Feature sequence171 412 990 gene locus_tag LOCUS_7310 412 990 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015911.1 protein_id gnl|my_center|LOCUS_7310 2071 1085 gene locus_tag LOCUS_7320 2071 1085 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321171.1 protein_id gnl|my_center|LOCUS_7320 <3090 2088 gene locus_tag LOCUS_7330 <3090 2088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289801.1:AEC family transporter >Feature sequence172 1131 163 gene locus_tag LOCUS_7340 gene pfkA 1131 163 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041561.1 protein_id gnl|my_center|LOCUS_7340 2098 1151 gene locus_tag LOCUS_7350 2098 1151 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016368.1 protein_id gnl|my_center|LOCUS_7350 3010 2114 gene locus_tag LOCUS_7360 gene accD 3010 2114 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902759.1 protein_id gnl|my_center|LOCUS_7360 >Feature sequence173 <1 908 gene locus_tag LOCUS_7370 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005897665.1:ABC transporter ATP-binding protein 1048 1359 gene locus_tag LOCUS_7380 1048 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903280.1 protein_id gnl|my_center|LOCUS_7380 1372 2721 gene locus_tag LOCUS_7390 gene ffh 1372 2721 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903281.1 protein_id gnl|my_center|LOCUS_7390 2779 3042 gene locus_tag LOCUS_7400 gene rpsP 2779 3042 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903282.1 protein_id gnl|my_center|LOCUS_7400 >Feature sequence174 1031 360 gene locus_tag LOCUS_7410 1031 360 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017188.1 protein_id gnl|my_center|LOCUS_7410 2265 1024 gene locus_tag LOCUS_7420 2265 1024 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017189.1 protein_id gnl|my_center|LOCUS_7420 2838 2386 gene locus_tag LOCUS_7430 gene accB 2838 2386 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009516.1 protein_id gnl|my_center|LOCUS_7430 >Feature sequence175 294 37 gene locus_tag LOCUS_7440 294 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7440 2441 309 gene locus_tag LOCUS_7450 gene rnr 2441 309 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016521.1 protein_id gnl|my_center|LOCUS_7450 3011 2445 gene locus_tag LOCUS_7460 gene yqeK 3011 2445 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016520.1 protein_id gnl|my_center|LOCUS_7460 >Feature sequence176 348 1586 gene locus_tag LOCUS_7470 348 1586 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081014.1 protein_id gnl|my_center|LOCUS_7470 1990 1640 gene locus_tag LOCUS_7480 gene rplT 1990 1640 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901611.1 protein_id gnl|my_center|LOCUS_7480 2247 2041 gene locus_tag LOCUS_7490 gene rpmI 2247 2041 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005893833.1 protein_id gnl|my_center|LOCUS_7490 2810 2292 gene locus_tag LOCUS_7500 gene infC 2810 2292 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901608.1 protein_id gnl|my_center|LOCUS_7500 >Feature sequence177 1839 196 gene locus_tag LOCUS_7510 1839 196 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_7510 2865 1990 gene locus_tag LOCUS_7520 2865 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7520 >Feature sequence178 1139 324 gene locus_tag LOCUS_7530 1139 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7530 2568 1210 gene locus_tag LOCUS_7540 2568 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7540 >Feature sequence179 98 850 gene locus_tag LOCUS_7550 gene rpsB 98 850 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904120.1 protein_id gnl|my_center|LOCUS_7550 913 1806 gene locus_tag LOCUS_7560 gene tsf 913 1806 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015713.1 protein_id gnl|my_center|LOCUS_7560 1874 2593 gene locus_tag LOCUS_7570 gene pyrH 1874 2593 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904124.1 protein_id gnl|my_center|LOCUS_7570 >Feature sequence180 2 199 gene locus_tag LOCUS_7580 2 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7580 210 704 gene locus_tag LOCUS_7590 gene coaD 210 704 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016187.1 protein_id gnl|my_center|LOCUS_7590 712 2100 gene locus_tag LOCUS_7600 gene radA 712 2100 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016188.1 protein_id gnl|my_center|LOCUS_7600 >Feature sequence181 171 686 gene locus_tag LOCUS_7610 171 686 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902602.1 protein_id gnl|my_center|LOCUS_7610 683 2038 gene locus_tag LOCUS_7620 gene glmM 683 2038 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902604.1 protein_id gnl|my_center|LOCUS_7620 2053 2760 gene locus_tag LOCUS_7630 2053 2760 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229973.1 protein_id gnl|my_center|LOCUS_7630 >Feature sequence182 35 1342 gene locus_tag LOCUS_7640 gene licC 35 1342 CDS product PTS lichenan transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243273.1 protein_id gnl|my_center|LOCUS_7640 1362 2765 gene locus_tag LOCUS_7650 1362 2765 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093650197.1 protein_id gnl|my_center|LOCUS_7650 >Feature sequence183 338 1066 gene locus_tag LOCUS_7660 gene pyrF 338 1066 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435818.1 protein_id gnl|my_center|LOCUS_7660 1060 2274 gene locus_tag LOCUS_7670 1060 2274 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056513.1 protein_id gnl|my_center|LOCUS_7670 2267 2890 gene locus_tag LOCUS_7680 gene pyrE 2267 2890 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357418.1 protein_id gnl|my_center|LOCUS_7680 >Feature sequence184 2285 360 gene locus_tag LOCUS_7690 gene metG 2285 360 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017027.1 protein_id gnl|my_center|LOCUS_7690 2950 2309 gene locus_tag LOCUS_7700 2950 2309 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367246.1 protein_id gnl|my_center|LOCUS_7700 >Feature sequence185 1102 338 gene locus_tag LOCUS_7710 gene pstB 1102 338 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962535.1 protein_id gnl|my_center|LOCUS_7710 1981 1133 gene locus_tag LOCUS_7720 gene pstA 1981 1133 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788578.1 protein_id gnl|my_center|LOCUS_7720 2871 1999 gene locus_tag LOCUS_7730 gene pstC 2871 1999 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_7730 >Feature sequence186 308 1501 gene locus_tag LOCUS_7740 gene megL 308 1501 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 protein_id gnl|my_center|LOCUS_7740 2167 1544 gene locus_tag LOCUS_7750 2167 1544 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259234.1 protein_id gnl|my_center|LOCUS_7750 2886 2266 gene locus_tag LOCUS_7760 gene pncA 2886 2266 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211676.1 protein_id gnl|my_center|LOCUS_7760 >Feature sequence187 1320 73 gene locus_tag LOCUS_7770 1320 73 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680089.1 protein_id gnl|my_center|LOCUS_7770 2917 1460 gene locus_tag LOCUS_7780 2917 1460 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680091.1 protein_id gnl|my_center|LOCUS_7780 >Feature sequence188 <1 739 gene locus_tag LOCUS_7790 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016454.1:23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN 749 2935 gene locus_tag LOCUS_7800 749 2935 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898410.1 protein_id gnl|my_center|LOCUS_7800 >Feature sequence189 1387 35 gene locus_tag LOCUS_7810 1387 35 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899369.1 protein_id gnl|my_center|LOCUS_7810 2094 1798 gene locus_tag LOCUS_7820 2094 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7820 2190 2114 gene locus_tag LOCUS_t0120 2190 2114 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <2939 2244 gene locus_tag LOCUS_7830 <2939 2244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258853.1:CehA/McbA family metallohydrolase >Feature sequence190 118 1302 gene locus_tag LOCUS_7840 118 1302 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895828.1 protein_id gnl|my_center|LOCUS_7840 1315 2223 gene locus_tag LOCUS_7850 1315 2223 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860958.1 protein_id gnl|my_center|LOCUS_7850 >Feature sequence191 339 43 gene locus_tag LOCUS_7860 339 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903162.1 protein_id gnl|my_center|LOCUS_7860 1109 354 gene locus_tag LOCUS_7870 1109 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918333.1 protein_id gnl|my_center|LOCUS_7870 <2906 1120 gene locus_tag LOCUS_7880 <2906 1120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016976.1:heavy metal translocating P-type ATPase >Feature sequence192 <1 1950 gene locus_tag LOCUS_7890 <1 1950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015682.1:endonuclease MutS2 1926 2603 gene locus_tag LOCUS_7900 gene ispD 1926 2603 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015681.1 protein_id gnl|my_center|LOCUS_7900 >Feature sequence193 1593 64 gene locus_tag LOCUS_7910 1593 64 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665727.1 protein_id gnl|my_center|LOCUS_7910 >Feature sequence194 2792 1128 gene locus_tag LOCUS_7920 gene ilvD 2792 1128 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_7920 >Feature sequence195 80 682 gene locus_tag LOCUS_7930 80 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902761.1 protein_id gnl|my_center|LOCUS_7930 696 1730 gene locus_tag LOCUS_7940 gene citC 696 1730 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016310.1 protein_id gnl|my_center|LOCUS_7940 >Feature sequence196 <1 1562 gene locus_tag LOCUS_7950 <1 1562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032842746.1:alpha-2-macroglobulin >Feature sequence197 <1 1277 gene locus_tag LOCUS_7960 <1 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005896128.1:sigma-54 dependent transcriptional regulator >Feature sequence198 118 1572 gene locus_tag LOCUS_7970 gene guaB 118 1572 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017001.1 protein_id gnl|my_center|LOCUS_7970 1999 1715 gene locus_tag LOCUS_7980 gene rpmA 1999 1715 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902873.1 protein_id gnl|my_center|LOCUS_7980 2335 2000 gene locus_tag LOCUS_7990 2335 2000 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016913.1 protein_id gnl|my_center|LOCUS_7990 2667 2356 gene locus_tag LOCUS_8000 gene rplU 2667 2356 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896540.1 protein_id gnl|my_center|LOCUS_8000 >Feature sequence199 219 2786 gene locus_tag LOCUS_8010 gene ppdK 219 2786 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016653.1 protein_id gnl|my_center|LOCUS_8010 >Feature sequence200 1253 81 gene locus_tag LOCUS_8020 1253 81 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_8020 <2821 1293 gene locus_tag LOCUS_8030 <2821 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016739.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence201 1623 40 gene locus_tag LOCUS_8040 1623 40 CDS product alpha-glucoside-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704145.1 protein_id gnl|my_center|LOCUS_8040 2101 1781 gene locus_tag LOCUS_8050 2101 1781 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388928.1 protein_id gnl|my_center|LOCUS_8050 2221 2712 gene locus_tag LOCUS_8060 2221 2712 CDS product lactoylglutathione lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119583.1 protein_id gnl|my_center|LOCUS_8060 >Feature sequence202 188 1546 gene locus_tag LOCUS_8070 gene melB 188 1546 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028111.1 protein_id gnl|my_center|LOCUS_8070 >Feature sequence203 1679 57 gene locus_tag LOCUS_8080 1679 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_8080 2548 1679 gene locus_tag LOCUS_8090 2548 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_8090 >Feature sequence204 537 31 gene locus_tag LOCUS_8100 gene nrdG 537 31 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_8100 2737 548 gene locus_tag LOCUS_8110 gene nrdD 2737 548 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016303.1 protein_id gnl|my_center|LOCUS_8110 >Feature sequence205 1938 571 gene locus_tag LOCUS_8120 1938 571 CDS product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005970668.1 protein_id gnl|my_center|LOCUS_8120 2678 1959 gene locus_tag LOCUS_8130 2678 1959 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682266.1 protein_id gnl|my_center|LOCUS_8130 >Feature sequence206 1677 2705 gene locus_tag LOCUS_8140 1677 2705 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070687.1 protein_id gnl|my_center|LOCUS_8140 >Feature sequence207 231 1025 gene locus_tag LOCUS_8150 231 1025 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904102.1 protein_id gnl|my_center|LOCUS_8150 1036 1965 gene locus_tag LOCUS_8160 gene prmA 1036 1965 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029493681.1 protein_id gnl|my_center|LOCUS_8160 1978 2640 gene locus_tag LOCUS_8170 gene cmk 1978 2640 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015703.1 protein_id gnl|my_center|LOCUS_8170 >Feature sequence208 <2776 888 gene locus_tag LOCUS_8180 <2776 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016141.1:ribonucleoside-diphosphate reductase subunit alpha >Feature sequence209 1300 29 gene locus_tag LOCUS_8190 gene serS 1300 29 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016148.1 protein_id gnl|my_center|LOCUS_8190 1920 1327 gene locus_tag LOCUS_8200 1920 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8200 <2773 1992 gene locus_tag LOCUS_8210 <2773 1992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903952.1:UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase >Feature sequence210 611 27 gene locus_tag LOCUS_8220 611 27 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986510.1 protein_id gnl|my_center|LOCUS_8220 1224 616 gene locus_tag LOCUS_8230 gene thiU 1224 616 CDS product HMP/thiamine ABC transporter substrate-binding protein ThiU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244962.1 protein_id gnl|my_center|LOCUS_8230 <2766 1420 gene locus_tag LOCUS_8240 <2766 1420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015910.1:leucyl aminopeptidase >Feature sequence211 <1 1246 gene locus_tag LOCUS_8250 <1 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903253.1:PLP-dependent aminotransferase family protein 1496 1957 gene locus_tag LOCUS_8260 gene ribE 1496 1957 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902111.1 protein_id gnl|my_center|LOCUS_8260 >Feature sequence212 829 41 gene locus_tag LOCUS_8270 829 41 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016638.1 protein_id gnl|my_center|LOCUS_8270 1800 829 gene locus_tag LOCUS_8280 1800 829 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903477.1 protein_id gnl|my_center|LOCUS_8280 <2752 1832 gene locus_tag LOCUS_8290 <2752 1832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023036708.1:TonB-dependent receptor >Feature sequence213 58 1584 gene locus_tag LOCUS_8300 58 1584 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_8300 1600 2670 gene locus_tag LOCUS_8310 1600 2670 CDS product M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546357.1 protein_id gnl|my_center|LOCUS_8310 >Feature sequence214 1640 321 gene locus_tag LOCUS_8320 1640 321 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_8320 <2731 1658 gene locus_tag LOCUS_8330 <2731 1658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861987.1:M20/M25/M40 family metallo-hydrolase >Feature sequence215 1960 464 gene locus_tag LOCUS_8340 1960 464 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016014.1 protein_id gnl|my_center|LOCUS_8340 2633 1971 gene locus_tag LOCUS_8350 2633 1971 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902228.1 protein_id gnl|my_center|LOCUS_8350 >Feature sequence216 <1 1208 gene locus_tag LOCUS_8360 <1 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047950.1:diaminopropionate ammonia-lyase 1266 2450 gene locus_tag LOCUS_8370 1266 2450 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421980.1 protein_id gnl|my_center|LOCUS_8370 >Feature sequence217 110 1468 gene locus_tag LOCUS_8380 110 1468 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_8380 2427 1552 gene locus_tag LOCUS_8390 2427 1552 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748811.1 protein_id gnl|my_center|LOCUS_8390 >Feature sequence218 99 389 gene locus_tag LOCUS_8400 99 389 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942058.1 protein_id gnl|my_center|LOCUS_8400 389 769 gene locus_tag LOCUS_8410 389 769 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813896.1 protein_id gnl|my_center|LOCUS_8410 821 1189 gene locus_tag LOCUS_8420 821 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8420 1199 2029 gene locus_tag LOCUS_8430 1199 2029 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986700.1 protein_id gnl|my_center|LOCUS_8430 >Feature sequence219 439 1737 gene locus_tag LOCUS_8440 gene mtaB 439 1737 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016990.1 protein_id gnl|my_center|LOCUS_8440 >Feature sequence220 2624 1314 gene locus_tag LOCUS_8450 gene xylA 2624 1314 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898127.1 protein_id gnl|my_center|LOCUS_8450 >Feature sequence221 1887 901 gene locus_tag LOCUS_8460 1887 901 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948802.1 protein_id gnl|my_center|LOCUS_8460 2540 1917 gene locus_tag LOCUS_8470 2540 1917 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048417.1 protein_id gnl|my_center|LOCUS_8470 >Feature sequence222 35 274 gene locus_tag LOCUS_8480 35 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903836.1 protein_id gnl|my_center|LOCUS_8480 291 1490 gene locus_tag LOCUS_8490 291 1490 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694560.1 protein_id gnl|my_center|LOCUS_8490 1501 2085 gene locus_tag LOCUS_8500 1501 2085 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203642.1 protein_id gnl|my_center|LOCUS_8500 2132 2587 gene locus_tag LOCUS_8510 2132 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8510 >Feature sequence223 275 1009 gene locus_tag LOCUS_8520 gene trmD 275 1009 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016280.1 protein_id gnl|my_center|LOCUS_8520 984 1517 gene locus_tag LOCUS_8530 984 1517 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_8530 1542 2105 gene locus_tag LOCUS_8540 1542 2105 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904383.1 protein_id gnl|my_center|LOCUS_8540 >Feature sequence224 <1 1013 gene locus_tag LOCUS_8550 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005901847.1:LptF/LptG family permease 1013 2095 gene locus_tag LOCUS_8560 1013 2095 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016847.1 protein_id gnl|my_center|LOCUS_8560 >Feature sequence225 2584 5 gene locus_tag LOCUS_8570 gene clpB 2584 5 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627102.1 protein_id gnl|my_center|LOCUS_8570 >Feature sequence226 <1 577 gene locus_tag LOCUS_8580 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016874.1:DUF3100 domain-containing protein 570 1064 gene locus_tag LOCUS_8590 570 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8590 2486 1098 gene locus_tag LOCUS_8600 2486 1098 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657823.1 protein_id gnl|my_center|LOCUS_8600 >Feature sequence227 60 1400 gene locus_tag LOCUS_8610 gene dnaB 60 1400 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903028.1 protein_id gnl|my_center|LOCUS_8610 >Feature sequence228 2172 676 gene locus_tag LOCUS_8620 2172 676 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986561.1 protein_id gnl|my_center|LOCUS_8620 >Feature sequence229 >Feature sequence230 1943 624 gene locus_tag LOCUS_8630 1943 624 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934974.1 protein_id gnl|my_center|LOCUS_8630 >Feature sequence231 519 1334 gene locus_tag LOCUS_8640 gene yqeB 519 1334 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437839.1 protein_id gnl|my_center|LOCUS_8640 1344 2111 gene locus_tag LOCUS_8650 1344 2111 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386049.1 protein_id gnl|my_center|LOCUS_8650 2128 2427 gene locus_tag LOCUS_8660 2128 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8660 >Feature sequence232 <1 878 gene locus_tag LOCUS_8670 <1 878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029492060.1:murein hydrolase activator EnvC 891 1688 gene locus_tag LOCUS_8680 891 1688 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016268.1 protein_id gnl|my_center|LOCUS_8680 >Feature sequence233 116 1291 gene locus_tag LOCUS_8690 116 1291 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902445.1 protein_id gnl|my_center|LOCUS_8690 >Feature sequence234 <1 550 gene locus_tag LOCUS_8700 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861576.1:6-phospho-alpha-glucosidase 561 1577 gene locus_tag LOCUS_8710 561 1577 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041466227.1 protein_id gnl|my_center|LOCUS_8710 2051 1593 gene locus_tag LOCUS_8720 2051 1593 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016462.1 protein_id gnl|my_center|LOCUS_8720 >Feature sequence235 144 1484 gene locus_tag LOCUS_8730 144 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8730 >Feature sequence236 1418 18 gene locus_tag LOCUS_8740 gene uxaC 1418 18 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_8740 <2545 1483 gene locus_tag LOCUS_8750 <2545 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082566.1:mannonate dehydratase >Feature sequence237 >Feature sequence238 22 1290 gene locus_tag LOCUS_8760 22 1290 CDS product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016639.1 protein_id gnl|my_center|LOCUS_8760 >Feature sequence239 361 1605 gene locus_tag LOCUS_8770 gene rhaA 361 1605 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244294.1 protein_id gnl|my_center|LOCUS_8770 1626 2450 gene locus_tag LOCUS_8780 gene rhaD 1626 2450 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099339.1 protein_id gnl|my_center|LOCUS_8780 >Feature sequence240 16 525 gene locus_tag LOCUS_8790 gene def 16 525 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016949.1 protein_id gnl|my_center|LOCUS_8790 632 817 gene locus_tag LOCUS_8800 632 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8800 827 1879 gene locus_tag LOCUS_8810 gene glpX 827 1879 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016951.1 protein_id gnl|my_center|LOCUS_8810 1953 2435 gene locus_tag LOCUS_8820 1953 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8820 >Feature sequence241 10 987 gene locus_tag LOCUS_8830 gene galE 10 987 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902584.1 protein_id gnl|my_center|LOCUS_8830 1590 1015 gene locus_tag LOCUS_8840 gene gmhA 1590 1015 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016435.1 protein_id gnl|my_center|LOCUS_8840 2472 1600 gene locus_tag LOCUS_8850 2472 1600 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903649.1 protein_id gnl|my_center|LOCUS_8850 >Feature sequence242 1151 345 gene locus_tag LOCUS_8860 1151 345 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167627999.1 protein_id gnl|my_center|LOCUS_8860 1923 1141 gene locus_tag LOCUS_8870 gene agaW 1923 1141 CDS product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406209.1 protein_id gnl|my_center|LOCUS_8870 2420 1944 gene locus_tag LOCUS_8880 gene agaV 2420 1944 CDS product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387360.1 protein_id gnl|my_center|LOCUS_8880 >Feature sequence243 <1 2463 gene locus_tag LOCUS_8890 <1 2463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016672.1:tetratricopeptide repeat protein >Feature sequence244 291 1553 gene locus_tag LOCUS_8900 291 1553 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210884.1 protein_id gnl|my_center|LOCUS_8900