>Feature sequence01 283 753 gene locus_tag LOCUS_00010 283 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1314 1880 gene locus_tag LOCUS_00020 1314 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1877 2578 gene locus_tag LOCUS_00030 1877 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3301 3720 gene locus_tag LOCUS_00040 3301 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3780 4106 gene locus_tag LOCUS_00050 3780 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4272 4691 gene locus_tag LOCUS_00060 4272 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4751 5077 gene locus_tag LOCUS_00070 4751 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5243 5662 gene locus_tag LOCUS_00080 5243 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 5722 6048 gene locus_tag LOCUS_00090 5722 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6498 6971 gene locus_tag LOCUS_00100 6498 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 7283 7951 gene locus_tag LOCUS_00110 7283 7951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 8303 8512 gene locus_tag LOCUS_00120 8303 8512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 8611 9414 gene locus_tag LOCUS_00130 8611 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 9513 9704 gene locus_tag LOCUS_00140 9513 9704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 10766 9954 gene locus_tag LOCUS_00150 10766 9954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 11181 12362 gene locus_tag LOCUS_00160 11181 12362 CDS product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815556.1 protein_id gnl|my_center|LOCUS_00160 13232 12453 gene locus_tag LOCUS_00170 gene surE 13232 12453 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171844.1 protein_id gnl|my_center|LOCUS_00170 14108 13257 gene locus_tag LOCUS_00180 14108 13257 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098225.1 protein_id gnl|my_center|LOCUS_00180 14413 15897 gene locus_tag LOCUS_00190 gene proP 14413 15897 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298520.1 protein_id gnl|my_center|LOCUS_00190 16254 16664 gene locus_tag LOCUS_00200 16254 16664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 17026 17382 gene locus_tag LOCUS_00210 17026 17382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 17638 19350 gene locus_tag LOCUS_00220 gene dld 17638 19350 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691095.1 protein_id gnl|my_center|LOCUS_00220 21971 19413 gene locus_tag LOCUS_00230 gene mutS 21971 19413 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005807.1 protein_id gnl|my_center|LOCUS_00230 22413 23411 gene locus_tag LOCUS_00240 gene gapA 22413 23411 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097053.1 protein_id gnl|my_center|LOCUS_00240 23756 23547 gene locus_tag LOCUS_00250 23756 23547 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159934.1 protein_id gnl|my_center|LOCUS_00250 24676 24146 gene locus_tag LOCUS_00260 gene ppa 24676 24146 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368588.1 protein_id gnl|my_center|LOCUS_00260 25282 24746 gene locus_tag LOCUS_00270 gene yjgA 25282 24746 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174310.1 protein_id gnl|my_center|LOCUS_00270 25360 26712 gene locus_tag LOCUS_00280 gene pmbA 25360 26712 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817275.1 protein_id gnl|my_center|LOCUS_00280 26719 28455 gene locus_tag LOCUS_00290 26719 28455 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816413.1 protein_id gnl|my_center|LOCUS_00290 28493 29713 gene locus_tag LOCUS_00300 28493 29713 CDS product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921661.1 protein_id gnl|my_center|LOCUS_00300 29860 30150 gene locus_tag LOCUS_00310 gene rpoZ 29860 30150 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 protein_id gnl|my_center|LOCUS_00310 30170 32278 gene locus_tag LOCUS_00320 gene spoT 30170 32278 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369143.1 protein_id gnl|my_center|LOCUS_00320 32284 34377 gene locus_tag LOCUS_00330 gene recG 32284 34377 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176019.1 protein_id gnl|my_center|LOCUS_00330 35556 34489 gene locus_tag LOCUS_00340 gene ulaG 35556 34489 CDS product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049013.1 protein_id gnl|my_center|LOCUS_00340 36344 35583 gene locus_tag LOCUS_00350 gene ulaR 36344 35583 CDS product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006793.1 protein_id gnl|my_center|LOCUS_00350 36781 38544 gene locus_tag LOCUS_00360 36781 38544 CDS product PTS ascorbate-specific subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395341.1 protein_id gnl|my_center|LOCUS_00360 38570 39043 gene locus_tag LOCUS_00370 38570 39043 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523578.1 protein_id gnl|my_center|LOCUS_00370 39047 39745 gene locus_tag LOCUS_00380 39047 39745 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286765.1 protein_id gnl|my_center|LOCUS_00380 39760 40404 gene locus_tag LOCUS_00390 39760 40404 CDS product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165663.1 protein_id gnl|my_center|LOCUS_00390 40474 41361 gene locus_tag LOCUS_00400 40474 41361 CDS product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284299.1 protein_id gnl|my_center|LOCUS_00400 42372 43625 gene locus_tag LOCUS_00410 gene lysA 42372 43625 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384387.1 protein_id gnl|my_center|LOCUS_00410 43740 44564 gene locus_tag LOCUS_00420 gene dapF 43740 44564 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983200.1 protein_id gnl|my_center|LOCUS_00420 44626 45360 gene locus_tag LOCUS_00430 44626 45360 CDS product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099258.1 protein_id gnl|my_center|LOCUS_00430 45370 46293 gene locus_tag LOCUS_00440 gene xerC 45370 46293 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211473.1 protein_id gnl|my_center|LOCUS_00440 46293 47006 gene locus_tag LOCUS_00450 gene yigB 46293 47006 CDS product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368862.1 protein_id gnl|my_center|LOCUS_00450 47018 47197 gene locus_tag LOCUS_00460 47018 47197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 47187 49415 gene locus_tag LOCUS_00470 gene uvrD 47187 49415 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383393.1 protein_id gnl|my_center|LOCUS_00470 49785 49474 gene locus_tag LOCUS_00480 gene cyaY 49785 49474 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999936.1 protein_id gnl|my_center|LOCUS_00480 50413 49889 gene locus_tag LOCUS_00490 50413 49889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 51203 50439 gene locus_tag LOCUS_00500 51203 50439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 51906 51271 gene locus_tag LOCUS_00510 51906 51271 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830164.1 protein_id gnl|my_center|LOCUS_00510 52389 51928 gene locus_tag LOCUS_00520 gene rimI 52389 51928 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216075.1 protein_id gnl|my_center|LOCUS_00520 52765 52358 gene locus_tag LOCUS_00530 52765 52358 CDS product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209207.1 protein_id gnl|my_center|LOCUS_00530 52853 53893 gene locus_tag LOCUS_00540 gene rsmC 52853 53893 CDS product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272292.1 protein_id gnl|my_center|LOCUS_00540 55335 53935 gene locus_tag LOCUS_00550 gene hemN 55335 53935 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213155.1 protein_id gnl|my_center|LOCUS_00550 55477 55310 gene locus_tag LOCUS_00560 55477 55310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 56040 55546 gene locus_tag LOCUS_00570 gene yihI 56040 55546 CDS product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099380.1 protein_id gnl|my_center|LOCUS_00570 56208 57143 gene locus_tag LOCUS_00580 gene coaA 56208 57143 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165813.1 protein_id gnl|my_center|LOCUS_00580 57160 57615 gene locus_tag LOCUS_00590 57160 57615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 57883 58968 gene locus_tag LOCUS_00600 57883 58968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 58970 59392 gene locus_tag LOCUS_00610 58970 59392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 59382 61184 gene locus_tag LOCUS_00620 59382 61184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 61174 64098 gene locus_tag LOCUS_00630 61174 64098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 64294 64767 gene locus_tag LOCUS_00640 gene queF 64294 64767 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832596.1 protein_id gnl|my_center|LOCUS_00640 64818 65474 gene locus_tag LOCUS_00650 gene queC 64818 65474 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225597.1 protein_id gnl|my_center|LOCUS_00650 65519 66190 gene locus_tag LOCUS_00660 65519 66190 CDS product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703712.1 protein_id gnl|my_center|LOCUS_00660 66455 71587 gene locus_tag LOCUS_00670 66455 71587 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815782.1 protein_id gnl|my_center|LOCUS_00670 71742 73985 gene locus_tag LOCUS_00680 gene pbpC 71742 73985 CDS product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175631705.1 protein_id gnl|my_center|LOCUS_00680 74497 74631 gene locus_tag LOCUS_00690 74497 74631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 75473 74712 gene locus_tag LOCUS_00700 75473 74712 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679501.1 protein_id gnl|my_center|LOCUS_00700 76479 75496 gene locus_tag LOCUS_00710 76479 75496 CDS product D-threonate 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096616.1 protein_id gnl|my_center|LOCUS_00710 77753 76491 gene locus_tag LOCUS_00720 77753 76491 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410744.1 protein_id gnl|my_center|LOCUS_00720 77981 79117 gene locus_tag LOCUS_00730 77981 79117 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234754.1 protein_id gnl|my_center|LOCUS_00730 79144 80022 gene locus_tag LOCUS_00740 79144 80022 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126955.1 protein_id gnl|my_center|LOCUS_00740 80179 81465 gene locus_tag LOCUS_00750 80179 81465 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096620.1 protein_id gnl|my_center|LOCUS_00750 81481 82665 gene locus_tag LOCUS_00760 81481 82665 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705317.1 protein_id gnl|my_center|LOCUS_00760 82741 83205 gene locus_tag LOCUS_00770 82741 83205 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583482.1 protein_id gnl|my_center|LOCUS_00770 83482 84309 gene locus_tag LOCUS_00780 83482 84309 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215568.1 protein_id gnl|my_center|LOCUS_00780 84313 85032 gene locus_tag LOCUS_00790 84313 85032 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215571.1 protein_id gnl|my_center|LOCUS_00790 85039 85725 gene locus_tag LOCUS_00800 85039 85725 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817468.1 protein_id gnl|my_center|LOCUS_00800 85848 86384 gene locus_tag LOCUS_00810 gene ybjG 85848 86384 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704843.1 protein_id gnl|my_center|LOCUS_00810 86515 87177 gene locus_tag LOCUS_00820 gene pmrA 86515 87177 CDS product two-component system response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210183.1 protein_id gnl|my_center|LOCUS_00820 87208 88308 gene locus_tag LOCUS_00830 gene pmrB 87208 88308 CDS product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300761.1 protein_id gnl|my_center|LOCUS_00830 88900 88280 gene locus_tag LOCUS_00840 gene yrbL 88900 88280 CDS product PhoP regulatory network protein YrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012503037.1 protein_id gnl|my_center|LOCUS_00840 89178 89606 gene locus_tag LOCUS_00850 gene rplM 89178 89606 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004710905.1 protein_id gnl|my_center|LOCUS_00850 89618 90010 gene locus_tag LOCUS_00860 gene rpsI 89618 90010 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 protein_id gnl|my_center|LOCUS_00860 90313 90945 gene locus_tag LOCUS_00870 gene sspA 90313 90945 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162411.1 protein_id gnl|my_center|LOCUS_00870 90997 91401 gene locus_tag LOCUS_00880 90997 91401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 91704 93437 gene locus_tag LOCUS_00890 91704 93437 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461147.1 protein_id gnl|my_center|LOCUS_00890 93430 95163 gene locus_tag LOCUS_00900 93430 95163 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809002.1 protein_id gnl|my_center|LOCUS_00900 95228 96145 gene locus_tag LOCUS_00910 95228 96145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 97375 100212 gene locus_tag LOCUS_00920 gene glnE 97375 100212 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315860.1 protein_id gnl|my_center|LOCUS_00920 100288 102456 gene locus_tag LOCUS_00930 100288 102456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 103729 102509 gene locus_tag LOCUS_00940 103729 102509 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_00940 104570 103743 gene locus_tag LOCUS_00950 104570 103743 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369253.1 protein_id gnl|my_center|LOCUS_00950 105694 104798 gene locus_tag LOCUS_00960 gene ttcA 105694 104798 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157406.1 protein_id gnl|my_center|LOCUS_00960 106281 105709 gene locus_tag LOCUS_00970 gene yeiP 106281 105709 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815996.1 protein_id gnl|my_center|LOCUS_00970 106861 108303 gene locus_tag LOCUS_00980 gene lysP 106861 108303 CDS product lysine-specific permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534384.1 protein_id gnl|my_center|LOCUS_00980 108644 108426 gene locus_tag LOCUS_00990 gene infA 108644 108426 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211347.1 protein_id gnl|my_center|LOCUS_00990 109526 108870 gene locus_tag LOCUS_01000 gene nadD 109526 108870 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210330.1 protein_id gnl|my_center|LOCUS_01000 110524 109520 gene locus_tag LOCUS_01010 gene holA 110524 109520 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210331.1 protein_id gnl|my_center|LOCUS_01010 111028 110534 gene locus_tag LOCUS_01020 gene lptE 111028 110534 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704738.1 protein_id gnl|my_center|LOCUS_01020 113647 111065 gene locus_tag LOCUS_01030 gene leuS 113647 111065 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816835.1 protein_id gnl|my_center|LOCUS_01030 114136 114363 gene locus_tag LOCUS_01040 114136 114363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 115330 114536 gene locus_tag LOCUS_01050 gene bamD 115330 114536 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209469.1 protein_id gnl|my_center|LOCUS_01050 115423 116397 gene locus_tag LOCUS_01060 gene rluD 115423 116397 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370269.1 protein_id gnl|my_center|LOCUS_01060 116403 117179 gene locus_tag LOCUS_01070 gene pgeF 116403 117179 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694112.1 protein_id gnl|my_center|LOCUS_01070 118336 117233 gene locus_tag LOCUS_01080 118336 117233 CDS product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207540.1 protein_id gnl|my_center|LOCUS_01080 119069 118455 gene locus_tag LOCUS_01090 119069 118455 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686506.1 protein_id gnl|my_center|LOCUS_01090 119494 119066 gene locus_tag LOCUS_01100 gene queD 119494 119066 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663812.1 protein_id gnl|my_center|LOCUS_01100 119812 122382 gene locus_tag LOCUS_01110 gene clpB 119812 122382 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167451.1 protein_id gnl|my_center|LOCUS_01110 123343 122738 gene locus_tag LOCUS_01120 123343 122738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 123516 124325 gene locus_tag LOCUS_01130 123516 124325 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081584.1 protein_id gnl|my_center|LOCUS_01130 124545 124784 gene locus_tag LOCUS_01140 124545 124784 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958429.1 protein_id gnl|my_center|LOCUS_01140 124781 127099 gene locus_tag LOCUS_01150 gene feoB 124781 127099 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337005.1 protein_id gnl|my_center|LOCUS_01150 127118 127354 gene locus_tag LOCUS_01160 127118 127354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 127643 128098 gene locus_tag LOCUS_01170 gene rpiB 127643 128098 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209402.1 protein_id gnl|my_center|LOCUS_01170 128306 129256 gene locus_tag LOCUS_01180 gene tal 128306 129256 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003709.1 protein_id gnl|my_center|LOCUS_01180 129372 131378 gene locus_tag LOCUS_01190 gene tkt 129372 131378 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209965.1 protein_id gnl|my_center|LOCUS_01190 132966 131911 gene locus_tag LOCUS_01200 gene idnD 132966 131911 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197408.1 protein_id gnl|my_center|LOCUS_01200 133746 132979 gene locus_tag LOCUS_01210 133746 132979 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971598.1 protein_id gnl|my_center|LOCUS_01210 133994 134707 gene locus_tag LOCUS_01220 133994 134707 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814069.1 protein_id gnl|my_center|LOCUS_01220 134818 136065 gene locus_tag LOCUS_01230 134818 136065 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918420.1 protein_id gnl|my_center|LOCUS_01230 136196 137527 gene locus_tag LOCUS_01240 136196 137527 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047042816.1 protein_id gnl|my_center|LOCUS_01240 137736 138083 gene locus_tag LOCUS_01250 137736 138083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 138602 139549 gene locus_tag LOCUS_01260 138602 139549 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721341.1 protein_id gnl|my_center|LOCUS_01260 139767 141014 gene locus_tag LOCUS_01270 139767 141014 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989510.1 protein_id gnl|my_center|LOCUS_01270 141094 141477 gene locus_tag LOCUS_01280 141094 141477 CDS product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721339.1 protein_id gnl|my_center|LOCUS_01280 141522 142043 gene locus_tag LOCUS_01290 141522 142043 CDS product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721338.1 protein_id gnl|my_center|LOCUS_01290 142056 143084 gene locus_tag LOCUS_01300 142056 143084 CDS product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721337.1 protein_id gnl|my_center|LOCUS_01300 143103 143456 gene locus_tag LOCUS_01310 143103 143456 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721336.1 protein_id gnl|my_center|LOCUS_01310 145149 143578 gene locus_tag LOCUS_01320 145149 143578 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462493.1 protein_id gnl|my_center|LOCUS_01320 146687 145356 gene locus_tag LOCUS_01330 146687 145356 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210937.1 protein_id gnl|my_center|LOCUS_01330 148076 146754 gene locus_tag LOCUS_01340 gene rimO 148076 146754 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704839.1 protein_id gnl|my_center|LOCUS_01340 149220 148300 gene locus_tag LOCUS_01350 149220 148300 CDS product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287908.1 protein_id gnl|my_center|LOCUS_01350 149389 151362 gene locus_tag LOCUS_01360 149389 151362 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208782.1 protein_id gnl|my_center|LOCUS_01360 152485 152868 gene locus_tag LOCUS_01370 gene dhaM2 152485 152868 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723202.1 protein_id gnl|my_center|LOCUS_01370 152876 153361 gene locus_tag LOCUS_01380 152876 153361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723201.1 protein_id gnl|my_center|LOCUS_01380 153375 153728 gene locus_tag LOCUS_01390 153375 153728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723200.1 protein_id gnl|my_center|LOCUS_01390 153769 154767 gene locus_tag LOCUS_01400 gene dhaK2 153769 154767 CDS product dihydroxyacetone kinase subunit DhaK2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723199.1 protein_id gnl|my_center|LOCUS_01400 154785 155435 gene locus_tag LOCUS_01410 gene dhaL2 154785 155435 CDS product dihydroxyacetone kinase ADP-binding subunit DhaL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723198.1 protein_id gnl|my_center|LOCUS_01410 155506 156285 gene locus_tag LOCUS_01420 155506 156285 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533068.1 protein_id gnl|my_center|LOCUS_01420 156305 157288 gene locus_tag LOCUS_01430 156305 157288 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209407.1 protein_id gnl|my_center|LOCUS_01430 158708 157353 gene locus_tag LOCUS_01440 gene pssA 158708 157353 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208751.1 protein_id gnl|my_center|LOCUS_01440 159913 158861 gene locus_tag LOCUS_01450 gene ydiK 159913 158861 CDS product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169418.1 protein_id gnl|my_center|LOCUS_01450 160015 160509 gene locus_tag LOCUS_01460 gene eco 160015 160509 CDS product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420230.1 protein_id gnl|my_center|LOCUS_01460 160823 161932 gene locus_tag LOCUS_01470 gene potF 160823 161932 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208762.1 protein_id gnl|my_center|LOCUS_01470 162034 163170 gene locus_tag LOCUS_01480 gene potG 162034 163170 CDS product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208760.1 protein_id gnl|my_center|LOCUS_01480 163189 164367 gene locus_tag LOCUS_01490 163189 164367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 164368 165369 gene locus_tag LOCUS_01500 gene potI 164368 165369 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816016.1 protein_id gnl|my_center|LOCUS_01500 165765 166403 gene locus_tag LOCUS_01510 gene ribB 165765 166403 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817217.1 protein_id gnl|my_center|LOCUS_01510 166534 167463 gene locus_tag LOCUS_01520 166534 167463 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207214.1 protein_id gnl|my_center|LOCUS_01520 167579 169825 gene locus_tag LOCUS_01530 167579 169825 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019083965.1 protein_id gnl|my_center|LOCUS_01530 170972 169872 gene locus_tag LOCUS_01540 170972 169872 CDS product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704276.1 protein_id gnl|my_center|LOCUS_01540 171460 170987 gene locus_tag LOCUS_01550 171460 170987 CDS product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704275.1 protein_id gnl|my_center|LOCUS_01550 172109 171453 gene locus_tag LOCUS_01560 172109 171453 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704274.1 protein_id gnl|my_center|LOCUS_01560 172727 173050 gene locus_tag LOCUS_01570 172727 173050 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790630.1 protein_id gnl|my_center|LOCUS_01570 173074 173388 gene locus_tag LOCUS_01580 173074 173388 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539674.1 protein_id gnl|my_center|LOCUS_01580 173486 173561 gene locus_tag LOCUS_t00010 173486 173561 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 174188 174904 gene locus_tag LOCUS_01590 174188 174904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 175919 175650 gene locus_tag LOCUS_01600 175919 175650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 176537 176998 gene locus_tag LOCUS_01610 176537 176998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 177835 178167 gene locus_tag LOCUS_01620 gene abeS 177835 178167 CDS product multidrug efflux SMR transporter AbeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004700493.1 protein_id gnl|my_center|LOCUS_01620 178906 178304 gene locus_tag LOCUS_01630 178906 178304 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004707520.1 protein_id gnl|my_center|LOCUS_01630 180341 179031 gene locus_tag LOCUS_01640 gene srmB 180341 179031 CDS product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209669.1 protein_id gnl|my_center|LOCUS_01640 180592 181689 gene locus_tag LOCUS_01650 gene trmA 180592 181689 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693197.1 protein_id gnl|my_center|LOCUS_01650 182051 182737 gene locus_tag LOCUS_01660 gene cusR 182051 182737 CDS product copper response regulator transcription factor CusR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770953.1 protein_id gnl|my_center|LOCUS_01660 182715 184142 gene locus_tag LOCUS_01670 182715 184142 CDS product Cu(+)/Ag(+) sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704248.1 protein_id gnl|my_center|LOCUS_01670 184320 184120 gene locus_tag LOCUS_01680 184320 184120 CDS product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501889.1 protein_id gnl|my_center|LOCUS_01680 185318 184356 gene locus_tag LOCUS_01690 gene rfaC 185318 184356 CDS product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815273.1 protein_id gnl|my_center|LOCUS_01690 186367 185321 gene locus_tag LOCUS_01700 gene rfaF 186367 185321 CDS product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094907.1 protein_id gnl|my_center|LOCUS_01700 187305 186379 gene locus_tag LOCUS_01710 gene rfaD 187305 186379 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815275.1 protein_id gnl|my_center|LOCUS_01710 187963 187436 gene locus_tag LOCUS_01720 187963 187436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01720 188430 187954 gene locus_tag LOCUS_01730 188430 187954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01730 188563 189426 gene locus_tag LOCUS_01740 188563 189426 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678254.1 protein_id gnl|my_center|LOCUS_01740 189637 190935 gene locus_tag LOCUS_01750 189637 190935 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047749.1 protein_id gnl|my_center|LOCUS_01750 191011 192012 gene locus_tag LOCUS_01760 gene pdxA 191011 192012 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047748.1 protein_id gnl|my_center|LOCUS_01760 192086 193555 gene locus_tag LOCUS_01770 192086 193555 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047747.1 protein_id gnl|my_center|LOCUS_01770 194418 193639 gene locus_tag LOCUS_01780 gene cmoM 194418 193639 CDS product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301572.1 protein_id gnl|my_center|LOCUS_01780 195152 194424 gene locus_tag LOCUS_01790 gene plsC 195152 194424 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369660.1 protein_id gnl|my_center|LOCUS_01790 195239 195952 gene locus_tag LOCUS_01800 195239 195952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 199797 195994 gene locus_tag LOCUS_01810 199797 195994 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154295113.1 protein_id gnl|my_center|LOCUS_01810 201481 199799 gene locus_tag LOCUS_01820 gene tamA 201481 199799 CDS product autotransporter assembly complex protein TamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269316.1 protein_id gnl|my_center|LOCUS_01820 202102 201650 gene locus_tag LOCUS_01830 202102 201650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 202693 202154 gene locus_tag LOCUS_01840 gene hpt 202693 202154 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167149.1 protein_id gnl|my_center|LOCUS_01840 203324 202827 gene locus_tag LOCUS_01850 gene tadA 203324 202827 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370298.1 protein_id gnl|my_center|LOCUS_01850 204155 203334 gene locus_tag LOCUS_01860 gene dapB 204155 203334 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210504.1 protein_id gnl|my_center|LOCUS_01860 204284 205477 gene locus_tag LOCUS_01870 204284 205477 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207248.1 protein_id gnl|my_center|LOCUS_01870 206128 205517 gene locus_tag LOCUS_01880 gene fklB 206128 205517 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311330.1 protein_id gnl|my_center|LOCUS_01880 206337 206756 gene locus_tag LOCUS_01890 206337 206756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 207217 208590 gene locus_tag LOCUS_01900 207217 208590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 209114 208731 gene locus_tag LOCUS_01910 209114 208731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 209240 210166 gene locus_tag LOCUS_01920 gene dusA 209240 210166 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209092.1 protein_id gnl|my_center|LOCUS_01920 210264 212279 gene locus_tag LOCUS_01930 gene rep 210264 212279 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176228.1 protein_id gnl|my_center|LOCUS_01930 212527 212751 gene locus_tag LOCUS_01940 212527 212751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 212852 212928 gene locus_tag LOCUS_t00020 212852 212928 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 213747 214190 gene locus_tag LOCUS_01950 213747 214190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 215900 215628 gene locus_tag LOCUS_01960 215900 215628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 216068 215904 gene locus_tag LOCUS_01970 216068 215904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 216806 216531 gene locus_tag LOCUS_01980 216806 216531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 218090 217635 gene locus_tag LOCUS_01990 218090 217635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 218617 218297 gene locus_tag LOCUS_02000 218617 218297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 219459 218815 gene locus_tag LOCUS_02010 219459 218815 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299796.1 protein_id gnl|my_center|LOCUS_02010 219572 219775 gene locus_tag LOCUS_02020 219572 219775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 219998 220774 gene locus_tag LOCUS_02030 219998 220774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 220771 222177 gene locus_tag LOCUS_02040 220771 222177 CDS product DnaB-like helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131484.1 protein_id gnl|my_center|LOCUS_02040 222588 223196 gene locus_tag LOCUS_02050 222588 223196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 223722 223525 gene locus_tag LOCUS_02060 223722 223525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 224222 226252 gene locus_tag LOCUS_02070 224222 226252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 226723 228927 gene locus_tag LOCUS_02080 226723 228927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 229325 229053 gene locus_tag LOCUS_02090 229325 229053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 229847 230014 gene locus_tag LOCUS_02100 229847 230014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 230011 230184 gene locus_tag LOCUS_02110 230011 230184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 230499 232289 gene locus_tag LOCUS_02120 230499 232289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 233314 233126 gene locus_tag LOCUS_02130 233314 233126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 233365 233559 gene locus_tag LOCUS_02140 233365 233559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 234310 234999 gene locus_tag LOCUS_02150 234310 234999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 235270 235578 gene locus_tag LOCUS_02160 235270 235578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 235578 236018 gene locus_tag LOCUS_02170 235578 236018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 236018 236386 gene locus_tag LOCUS_02180 236018 236386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 236810 237280 gene locus_tag LOCUS_02190 236810 237280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 237301 237684 gene locus_tag LOCUS_02200 237301 237684 CDS product phage tail assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710952.1 protein_id gnl|my_center|LOCUS_02200 237979 241290 gene locus_tag LOCUS_02210 237979 241290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 241349 241903 gene locus_tag LOCUS_02220 241349 241903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 242471 243354 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccctgtatacacagggatagaccg 243559 243392 gene locus_tag LOCUS_02230 243559 243392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 243594 243959 gene locus_tag LOCUS_02240 243594 243959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 244117 244446 gene locus_tag LOCUS_02250 244117 244446 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447264.1 protein_id gnl|my_center|LOCUS_02250 244443 245147 gene locus_tag LOCUS_02260 244443 245147 CDS product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152626.1 protein_id gnl|my_center|LOCUS_02260 245210 245929 gene locus_tag LOCUS_02270 245210 245929 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194763.1 protein_id gnl|my_center|LOCUS_02270 245872 246429 gene locus_tag LOCUS_02280 245872 246429 CDS product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741571.1 protein_id gnl|my_center|LOCUS_02280 246422 249712 gene locus_tag LOCUS_02290 246422 249712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 249774 251345 gene locus_tag LOCUS_02300 249774 251345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 251363 251794 gene locus_tag LOCUS_02310 251363 251794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 253056 252700 gene locus_tag LOCUS_02320 253056 252700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 253244 253059 gene locus_tag LOCUS_02330 253244 253059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 254199 255140 gene locus_tag LOCUS_02340 254199 255140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 255204 256292 gene locus_tag LOCUS_02350 255204 256292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 256338 257909 gene locus_tag LOCUS_02360 256338 257909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 257987 258172 gene locus_tag LOCUS_02370 257987 258172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 259191 259514 gene locus_tag LOCUS_02380 259191 259514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 259643 259921 gene locus_tag LOCUS_02390 259643 259921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 260382 260801 gene locus_tag LOCUS_02400 260382 260801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 260926 261060 gene locus_tag LOCUS_02410 260926 261060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 261611 261787 gene locus_tag LOCUS_02420 261611 261787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 261778 262380 gene locus_tag LOCUS_02430 261778 262380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02430 262390 262623 gene locus_tag LOCUS_02440 262390 262623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 262949 263176 gene locus_tag LOCUS_02450 262949 263176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 263207 263878 gene locus_tag LOCUS_02460 263207 263878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 264000 264272 gene locus_tag LOCUS_02470 264000 264272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 264323 264448 gene locus_tag LOCUS_02480 264323 264448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 264457 264741 gene locus_tag LOCUS_02490 264457 264741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 265362 265550 gene locus_tag LOCUS_02500 265362 265550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 265833 266030 gene locus_tag LOCUS_02510 265833 266030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 266041 266262 gene locus_tag LOCUS_02520 266041 266262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 266876 267325 gene locus_tag LOCUS_02530 266876 267325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02530 267312 267440 gene locus_tag LOCUS_02540 267312 267440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 267418 267651 gene locus_tag LOCUS_02550 267418 267651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 268335 267727 gene locus_tag LOCUS_02560 268335 267727 CDS product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816236.1 protein_id gnl|my_center|LOCUS_02560 269443 268349 gene locus_tag LOCUS_02570 269443 268349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 270025 269444 gene locus_tag LOCUS_02580 270025 269444 CDS product YmfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005825880.1 protein_id gnl|my_center|LOCUS_02580 271074 270016 gene locus_tag LOCUS_02590 271074 270016 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693541.1 protein_id gnl|my_center|LOCUS_02590 271502 271086 gene locus_tag LOCUS_02600 271502 271086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 272057 271503 gene locus_tag LOCUS_02610 272057 271503 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693539.1 protein_id gnl|my_center|LOCUS_02610 273133 272060 gene locus_tag LOCUS_02620 273133 272060 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098807.1 protein_id gnl|my_center|LOCUS_02620 274475 273126 gene locus_tag LOCUS_02630 274475 273126 CDS product DNA circularization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869234.1 protein_id gnl|my_center|LOCUS_02630 276340 274475 gene locus_tag LOCUS_02640 276340 274475 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126609506.1 protein_id gnl|my_center|LOCUS_02640 276810 276469 gene locus_tag LOCUS_02650 276810 276469 CDS product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693534.1 protein_id gnl|my_center|LOCUS_02650 277169 276822 gene locus_tag LOCUS_02660 277169 276822 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015473.1 protein_id gnl|my_center|LOCUS_02660 278645 277179 gene locus_tag LOCUS_02670 278645 277179 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693532.1 protein_id gnl|my_center|LOCUS_02670 278819 278649 gene locus_tag LOCUS_02680 278819 278649 CDS product DUF2635 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262469.1 protein_id gnl|my_center|LOCUS_02680 279360 278812 gene locus_tag LOCUS_02690 279360 278812 CDS product DUF1834 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005825903.1 protein_id gnl|my_center|LOCUS_02690 279809 279360 gene locus_tag LOCUS_02700 279809 279360 CDS product gp436 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693528.1 protein_id gnl|my_center|LOCUS_02700 280315 279812 gene locus_tag LOCUS_02710 280315 279812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 281214 280333 gene locus_tag LOCUS_02720 281214 280333 CDS product Mu-like prophage major head subunit gpT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939979.1 protein_id gnl|my_center|LOCUS_02720 282406 281204 gene locus_tag LOCUS_02730 282406 281204 CDS product phage protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693524.1 protein_id gnl|my_center|LOCUS_02730 283039 282566 gene locus_tag LOCUS_02740 283039 282566 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070993.1 protein_id gnl|my_center|LOCUS_02740 284486 283179 gene locus_tag LOCUS_02750 284486 283179 CDS product phage head morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046893.1 protein_id gnl|my_center|LOCUS_02750 286020 284479 gene locus_tag LOCUS_02760 286020 284479 CDS product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869229.1 protein_id gnl|my_center|LOCUS_02760 287600 286020 gene locus_tag LOCUS_02770 287600 286020 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693520.1 protein_id gnl|my_center|LOCUS_02770 288169 287600 gene locus_tag LOCUS_02780 288169 287600 CDS product DUF3486 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072624.1 protein_id gnl|my_center|LOCUS_02780 288461 288162 gene locus_tag LOCUS_02790 288461 288162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072623.1 protein_id gnl|my_center|LOCUS_02790 288784 288458 gene locus_tag LOCUS_02800 288784 288458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 288999 288781 gene locus_tag LOCUS_02810 288999 288781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 289523 289158 gene locus_tag LOCUS_02820 289523 289158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 289761 289516 gene locus_tag LOCUS_02830 289761 289516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 290011 289745 gene locus_tag LOCUS_02840 290011 289745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 290373 290011 gene locus_tag LOCUS_02850 290373 290011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 290842 290459 gene locus_tag LOCUS_02860 290842 290459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 291285 290842 gene locus_tag LOCUS_02870 291285 290842 CDS product Mor transcription activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852377.1 protein_id gnl|my_center|LOCUS_02870 291787 291272 gene locus_tag LOCUS_02880 291787 291272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693508.1 protein_id gnl|my_center|LOCUS_02880 292368 291784 gene locus_tag LOCUS_02890 292368 291784 CDS product regulatory protein GemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070976.1 protein_id gnl|my_center|LOCUS_02890 293005 292370 gene locus_tag LOCUS_02900 293005 292370 CDS product DUF3164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072605.1 protein_id gnl|my_center|LOCUS_02900 293198 292992 gene locus_tag LOCUS_02910 293198 292992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 293514 293212 gene locus_tag LOCUS_02920 293514 293212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 294422 293517 gene locus_tag LOCUS_02930 294422 293517 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005708986.1 protein_id gnl|my_center|LOCUS_02930 296405 294426 gene locus_tag LOCUS_02940 296405 294426 CDS product transposase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072599.1 protein_id gnl|my_center|LOCUS_02940 296629 296417 gene locus_tag LOCUS_02950 296629 296417 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433427.1 protein_id gnl|my_center|LOCUS_02950 296879 297595 gene locus_tag LOCUS_02960 296879 297595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 >Feature sequence02 412 224 gene locus_tag LOCUS_02970 412 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 717 1067 gene locus_tag LOCUS_02980 717 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 1373 1140 gene locus_tag LOCUS_02990 1373 1140 CDS product SymE family type I addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213866.1 protein_id gnl|my_center|LOCUS_02990 1678 2028 gene locus_tag LOCUS_03000 1678 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 2270 2091 gene locus_tag LOCUS_03010 2270 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 2396 2533 gene locus_tag LOCUS_03020 2396 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 2682 2984 gene locus_tag LOCUS_03030 2682 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 3381 3533 gene locus_tag LOCUS_03040 3381 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 3535 3948 gene locus_tag LOCUS_03050 3535 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 4152 4373 gene locus_tag LOCUS_03060 4152 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 4952 5155 gene locus_tag LOCUS_03070 4952 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 6255 5668 gene locus_tag LOCUS_03080 6255 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 6584 7069 gene locus_tag LOCUS_03090 6584 7069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 7230 7682 gene locus_tag LOCUS_03100 7230 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 8806 8012 gene locus_tag LOCUS_03110 gene thiD 8806 8012 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172521.1 protein_id gnl|my_center|LOCUS_03110 9464 8811 gene locus_tag LOCUS_03120 gene thiE 9464 8811 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816649.1 protein_id gnl|my_center|LOCUS_03120 10262 9474 gene locus_tag LOCUS_03130 gene thiM 10262 9474 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694556.1 protein_id gnl|my_center|LOCUS_03130 11821 10460 gene locus_tag LOCUS_03140 gene trkA 11821 10460 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099016.1 protein_id gnl|my_center|LOCUS_03140 12984 11989 gene locus_tag LOCUS_03150 gene trpS 12984 11989 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165543.1 protein_id gnl|my_center|LOCUS_03150 13718 13023 gene locus_tag LOCUS_03160 13718 13023 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817344.1 protein_id gnl|my_center|LOCUS_03160 14388 13711 gene locus_tag LOCUS_03170 gene rpe 14388 13711 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174695.1 protein_id gnl|my_center|LOCUS_03170 15249 14428 gene locus_tag LOCUS_03180 gene dam 15249 14428 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099069.1 protein_id gnl|my_center|LOCUS_03180 16069 15302 gene locus_tag LOCUS_03190 16069 15302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 16658 16137 gene locus_tag LOCUS_03200 gene aroK 16658 16137 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818621.1 protein_id gnl|my_center|LOCUS_03200 17807 16845 gene locus_tag LOCUS_03210 gene gutQ 17807 16845 CDS product arabinose-5-phosphate isomerase GutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172515.1 protein_id gnl|my_center|LOCUS_03210 18626 18003 gene locus_tag LOCUS_03220 18626 18003 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166992.1 protein_id gnl|my_center|LOCUS_03220 20076 18634 gene locus_tag LOCUS_03230 20076 18634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 20327 20665 gene locus_tag LOCUS_03240 20327 20665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 20792 21091 gene locus_tag LOCUS_03250 20792 21091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 21215 21565 gene locus_tag LOCUS_03260 21215 21565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 21780 23036 gene locus_tag LOCUS_03270 21780 23036 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919178.1 protein_id gnl|my_center|LOCUS_03270 25325 23130 gene locus_tag LOCUS_03280 25325 23130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_03280 25551 27476 gene locus_tag LOCUS_03290 25551 27476 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211292.1 protein_id gnl|my_center|LOCUS_03290 28706 27543 gene locus_tag LOCUS_03300 28706 27543 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705313.1 protein_id gnl|my_center|LOCUS_03300 29362 28850 gene locus_tag LOCUS_03310 gene tpx 29362 28850 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223506.1 protein_id gnl|my_center|LOCUS_03310 29559 29948 gene locus_tag LOCUS_03320 29559 29948 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068360.1 protein_id gnl|my_center|LOCUS_03320 30273 31016 gene locus_tag LOCUS_03330 30273 31016 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705781.1 protein_id gnl|my_center|LOCUS_03330 32178 31111 gene locus_tag LOCUS_03340 gene apbC 32178 31111 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816717.1 protein_id gnl|my_center|LOCUS_03340 32434 34461 gene locus_tag LOCUS_03350 gene metG 32434 34461 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816718.1 protein_id gnl|my_center|LOCUS_03350 36547 35759 gene locus_tag LOCUS_03360 36547 35759 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890687.1 protein_id gnl|my_center|LOCUS_03360 37329 36664 gene locus_tag LOCUS_03370 37329 36664 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388219.1 protein_id gnl|my_center|LOCUS_03370 37432 38319 gene locus_tag LOCUS_03380 37432 38319 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388220.1 protein_id gnl|my_center|LOCUS_03380 39823 38468 gene locus_tag LOCUS_03390 gene tolC 39823 38468 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817216.1 protein_id gnl|my_center|LOCUS_03390 39961 40590 gene locus_tag LOCUS_03400 gene nudF 39961 40590 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369649.1 protein_id gnl|my_center|LOCUS_03400 40752 41582 gene locus_tag LOCUS_03410 gene cpdA 40752 41582 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444734.1 protein_id gnl|my_center|LOCUS_03410 43072 41609 gene locus_tag LOCUS_03420 gene cls 43072 41609 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816416.1 protein_id gnl|my_center|LOCUS_03420 43536 43078 gene locus_tag LOCUS_03430 gene yciA 43536 43078 CDS product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705756.1 protein_id gnl|my_center|LOCUS_03430 44099 43557 gene locus_tag LOCUS_03440 44099 43557 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096282.1 protein_id gnl|my_center|LOCUS_03440 44633 44175 gene locus_tag LOCUS_03450 gene fur 44633 44175 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163370.1 protein_id gnl|my_center|LOCUS_03450 45225 44713 gene locus_tag LOCUS_03460 gene fldA 45225 44713 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163372.1 protein_id gnl|my_center|LOCUS_03460 45406 46578 gene locus_tag LOCUS_03470 gene sucC 45406 46578 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048590.1 protein_id gnl|my_center|LOCUS_03470 46600 47472 gene locus_tag LOCUS_03480 gene sucD 46600 47472 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165487.1 protein_id gnl|my_center|LOCUS_03480 47582 49153 gene locus_tag LOCUS_03490 gene cydA 47582 49153 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168026.1 protein_id gnl|my_center|LOCUS_03490 49172 50308 gene locus_tag LOCUS_03500 gene cydB 49172 50308 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210731.1 protein_id gnl|my_center|LOCUS_03500 50611 51006 gene locus_tag LOCUS_03510 gene ybgC 50611 51006 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097533.1 protein_id gnl|my_center|LOCUS_03510 51007 51687 gene locus_tag LOCUS_03520 gene tolQ 51007 51687 CDS product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131310.1 protein_id gnl|my_center|LOCUS_03520 51690 52109 gene locus_tag LOCUS_03530 gene tolR 51690 52109 CDS product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124676.1 protein_id gnl|my_center|LOCUS_03530 52142 53269 gene locus_tag LOCUS_03540 52142 53269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 53431 53958 gene locus_tag LOCUS_03550 gene hslV 53431 53958 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208942.1 protein_id gnl|my_center|LOCUS_03550 53986 55314 gene locus_tag LOCUS_03560 gene hslU 53986 55314 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099313.1 protein_id gnl|my_center|LOCUS_03560 57288 55402 gene locus_tag LOCUS_03570 gene asmA 57288 55402 CDS product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211874.1 protein_id gnl|my_center|LOCUS_03570 57906 57325 gene locus_tag LOCUS_03580 gene dcd 57906 57325 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365790.1 protein_id gnl|my_center|LOCUS_03580 59065 57977 gene locus_tag LOCUS_03590 gene mltA 59065 57977 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228046.1 protein_id gnl|my_center|LOCUS_03590 59262 60632 gene locus_tag LOCUS_03600 gene cycA 59262 60632 CDS product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211170.1 protein_id gnl|my_center|LOCUS_03600 61702 60680 gene locus_tag LOCUS_03610 gene terC 61702 60680 CDS product tellurium resistance membrane protein TerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255079.1 protein_id gnl|my_center|LOCUS_03610 61886 63322 gene locus_tag LOCUS_03620 gene dacB 61886 63322 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420697.1 protein_id gnl|my_center|LOCUS_03620 65232 63397 gene locus_tag LOCUS_03630 65232 63397 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208115026.1 protein_id gnl|my_center|LOCUS_03630 66178 65486 gene locus_tag LOCUS_03640 66178 65486 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072597.1 protein_id gnl|my_center|LOCUS_03640 66822 66986 gene locus_tag LOCUS_03650 66822 66986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 66999 68183 gene locus_tag LOCUS_03660 gene ubiI 66999 68183 CDS product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817030.1 protein_id gnl|my_center|LOCUS_03660 69280 68240 gene locus_tag LOCUS_03670 69280 68240 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266942.1 protein_id gnl|my_center|LOCUS_03670 70774 69596 gene locus_tag LOCUS_03680 70774 69596 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208741.1 protein_id gnl|my_center|LOCUS_03680 71893 70847 gene locus_tag LOCUS_03690 gene mutY 71893 70847 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228057.1 protein_id gnl|my_center|LOCUS_03690 73044 71893 gene locus_tag LOCUS_03700 gene pheA 73044 71893 CDS product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370267.1 protein_id gnl|my_center|LOCUS_03700 73478 73146 gene locus_tag LOCUS_03710 gene raiA 73478 73146 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209468.1 protein_id gnl|my_center|LOCUS_03710 73739 74476 gene locus_tag LOCUS_03720 gene trmJ 73739 74476 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940032.1 protein_id gnl|my_center|LOCUS_03720 75950 74559 gene locus_tag LOCUS_03730 gene cysS 75950 74559 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222677.1 protein_id gnl|my_center|LOCUS_03730 76064 76354 gene locus_tag LOCUS_03740 76064 76354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 76711 76469 gene locus_tag LOCUS_03750 76711 76469 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512149.1 protein_id gnl|my_center|LOCUS_03750 78438 77077 gene locus_tag LOCUS_03760 gene lysC 78438 77077 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212084.1 protein_id gnl|my_center|LOCUS_03760 79271 78813 gene locus_tag LOCUS_03770 gene argR 79271 78813 CDS product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257847.1 protein_id gnl|my_center|LOCUS_03770 80046 79468 gene locus_tag LOCUS_03780 gene mog 80046 79468 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368355.1 protein_id gnl|my_center|LOCUS_03780 80288 81229 gene locus_tag LOCUS_03790 80288 81229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368204.1 protein_id gnl|my_center|LOCUS_03790 81222 81992 gene locus_tag LOCUS_03800 81222 81992 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156782.1 protein_id gnl|my_center|LOCUS_03800 82675 82037 gene locus_tag LOCUS_03810 82675 82037 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366001.1 protein_id gnl|my_center|LOCUS_03810 84080 82734 gene locus_tag LOCUS_03820 gene accC 84080 82734 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817284.1 protein_id gnl|my_center|LOCUS_03820 84581 84114 gene locus_tag LOCUS_03830 gene accB 84581 84114 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098992.1 protein_id gnl|my_center|LOCUS_03830 84949 85992 gene locus_tag LOCUS_03840 gene mreB 84949 85992 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228205.1 protein_id gnl|my_center|LOCUS_03840 86133 86975 gene locus_tag LOCUS_03850 gene mreC 86133 86975 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163136.1 protein_id gnl|my_center|LOCUS_03850 86962 87447 gene locus_tag LOCUS_03860 gene mreD 86962 87447 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369463.1 protein_id gnl|my_center|LOCUS_03860 87462 88937 gene locus_tag LOCUS_03870 gene rng 87462 88937 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210079.1 protein_id gnl|my_center|LOCUS_03870 89053 90510 gene locus_tag LOCUS_03880 gene tldD 89053 90510 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055936.1 protein_id gnl|my_center|LOCUS_03880 90541 91209 gene locus_tag LOCUS_03890 90541 91209 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174197.1 protein_id gnl|my_center|LOCUS_03890 92195 91833 gene locus_tag LOCUS_03900 92195 91833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 92656 92336 gene locus_tag LOCUS_03910 92656 92336 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210175.1 protein_id gnl|my_center|LOCUS_03910 92834 93190 gene locus_tag LOCUS_03920 92834 93190 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210176.1 protein_id gnl|my_center|LOCUS_03920 93260 93808 gene locus_tag LOCUS_03930 gene proQ 93260 93808 CDS product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432038.1 protein_id gnl|my_center|LOCUS_03930 93818 95893 gene locus_tag LOCUS_03940 gene prc 93818 95893 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170217.1 protein_id gnl|my_center|LOCUS_03940 96091 96178 gene locus_tag LOCUS_t00030 96091 96178 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 96330 97223 gene locus_tag LOCUS_03950 gene prmB 96330 97223 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005047007.1 protein_id gnl|my_center|LOCUS_03950 97252 98325 gene locus_tag LOCUS_03960 gene aroC 97252 98325 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209711.1 protein_id gnl|my_center|LOCUS_03960 98322 99074 gene locus_tag LOCUS_03970 98322 99074 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209713.1 protein_id gnl|my_center|LOCUS_03970 99377 99526 gene locus_tag LOCUS_03980 99377 99526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 100235 101206 gene locus_tag LOCUS_03990 100235 101206 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813143.1 protein_id gnl|my_center|LOCUS_03990 101356 101625 gene locus_tag LOCUS_04000 gene rpsO 101356 101625 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209257.1 protein_id gnl|my_center|LOCUS_04000 101900 104014 gene locus_tag LOCUS_04010 gene pnp 101900 104014 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098913.1 protein_id gnl|my_center|LOCUS_04010 104038 104898 gene locus_tag LOCUS_04020 gene nlpI 104038 104898 CDS product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098912.1 protein_id gnl|my_center|LOCUS_04020 105253 107022 gene locus_tag LOCUS_04030 gene deaD 105253 107022 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301504.1 protein_id gnl|my_center|LOCUS_04030 108475 107108 gene locus_tag LOCUS_04040 108475 107108 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298165.1 protein_id gnl|my_center|LOCUS_04040 108650 108946 gene locus_tag LOCUS_04050 108650 108946 CDS product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706185.1 protein_id gnl|my_center|LOCUS_04050 108957 109412 gene locus_tag LOCUS_04060 gene sixA 108957 109412 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365538.1 protein_id gnl|my_center|LOCUS_04060 109394 112864 gene locus_tag LOCUS_04070 gene recB 109394 112864 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816977.1 protein_id gnl|my_center|LOCUS_04070 116026 112940 gene locus_tag LOCUS_04080 116026 112940 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214048.1 protein_id gnl|my_center|LOCUS_04080 116419 118197 gene locus_tag LOCUS_04090 gene bglH 116419 118197 CDS product carbohydrate-specific porin BglH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489815.1 protein_id gnl|my_center|LOCUS_04090 119296 118292 gene locus_tag LOCUS_04100 gene galR 119296 118292 CDS product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098559.1 protein_id gnl|my_center|LOCUS_04100 121757 119640 gene locus_tag LOCUS_04110 121757 119640 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213113.1 protein_id gnl|my_center|LOCUS_04110 121944 122594 gene locus_tag LOCUS_04120 121944 122594 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369636.1 protein_id gnl|my_center|LOCUS_04120 122594 123691 gene locus_tag LOCUS_04130 122594 123691 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212197.1 protein_id gnl|my_center|LOCUS_04130 123809 123885 gene locus_tag LOCUS_t00040 123809 123885 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 123923 124007 gene locus_tag LOCUS_t00050 123923 124007 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 124034 124108 gene locus_tag LOCUS_t00060 124034 124108 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 124185 124267 gene locus_tag LOCUS_t00070 124185 124267 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 124293 124367 gene locus_tag LOCUS_t00080 124293 124367 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 124433 124517 gene locus_tag LOCUS_t00090 124433 124517 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 124533 124607 gene locus_tag LOCUS_t00100 124533 124607 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 125032 124856 gene locus_tag LOCUS_04140 125032 124856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 127000 125594 gene locus_tag LOCUS_04150 127000 125594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 128374 127004 gene locus_tag LOCUS_04160 128374 127004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 129525 128374 gene locus_tag LOCUS_04170 129525 128374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325761.1 protein_id gnl|my_center|LOCUS_04170 130923 130123 gene locus_tag LOCUS_04180 130923 130123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 131882 131274 gene locus_tag LOCUS_04190 131882 131274 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435254.1 protein_id gnl|my_center|LOCUS_04190 131987 134458 gene locus_tag LOCUS_04200 gene cyaA 131987 134458 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281726.1 protein_id gnl|my_center|LOCUS_04200 134670 135245 gene locus_tag LOCUS_04210 gene rpoE 134670 135245 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457274.1 protein_id gnl|my_center|LOCUS_04210 135287 135847 gene locus_tag LOCUS_04220 gene rseA 135287 135847 CDS product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172760.1 protein_id gnl|my_center|LOCUS_04220 135989 136837 gene locus_tag LOCUS_04230 gene rseB 135989 136837 CDS product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812053.1 protein_id gnl|my_center|LOCUS_04230 136991 138787 gene locus_tag LOCUS_04240 gene lepA 136991 138787 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172749.1 protein_id gnl|my_center|LOCUS_04240 138807 139811 gene locus_tag LOCUS_04250 gene lepB 138807 139811 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815754.1 protein_id gnl|my_center|LOCUS_04250 139823 140497 gene locus_tag LOCUS_04260 gene rnc 139823 140497 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420714.1 protein_id gnl|my_center|LOCUS_04260 140494 141399 gene locus_tag LOCUS_04270 gene era 140494 141399 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159414.1 protein_id gnl|my_center|LOCUS_04270 142304 141612 gene locus_tag LOCUS_04280 142304 141612 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286765.1 protein_id gnl|my_center|LOCUS_04280 143816 142395 gene locus_tag LOCUS_04290 gene araE 143816 142395 CDS product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256438.1 protein_id gnl|my_center|LOCUS_04290 145403 143895 gene locus_tag LOCUS_04300 gene araA 145403 143895 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210591.1 protein_id gnl|my_center|LOCUS_04300 147104 145443 gene locus_tag LOCUS_04310 147104 145443 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210590.1 protein_id gnl|my_center|LOCUS_04310 147307 148209 gene locus_tag LOCUS_04320 gene araC 147307 148209 CDS product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852388.1 protein_id gnl|my_center|LOCUS_04320 148751 150343 gene locus_tag LOCUS_04330 gene purH 148751 150343 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210692.1 protein_id gnl|my_center|LOCUS_04330 150424 151722 gene locus_tag LOCUS_04340 gene purD 150424 151722 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866776.1 protein_id gnl|my_center|LOCUS_04340 152297 151821 gene locus_tag LOCUS_04350 152297 151821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 152313 152543 gene locus_tag LOCUS_04360 152313 152543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 152882 152667 gene locus_tag LOCUS_04370 152882 152667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 152942 155419 gene locus_tag LOCUS_04380 gene rnr 152942 155419 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076332.1 protein_id gnl|my_center|LOCUS_04380 155420 156172 gene locus_tag LOCUS_04390 gene rlmB 155420 156172 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293265.1 protein_id gnl|my_center|LOCUS_04390 156187 156801 gene locus_tag LOCUS_04400 156187 156801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 156979 159081 gene locus_tag LOCUS_04410 156979 159081 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287536.1 protein_id gnl|my_center|LOCUS_04410 159108 159410 gene locus_tag LOCUS_04420 159108 159410 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292534.1 protein_id gnl|my_center|LOCUS_04420 159432 160721 gene locus_tag LOCUS_04430 159432 160721 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296769.1 protein_id gnl|my_center|LOCUS_04430 160736 161140 gene locus_tag LOCUS_04440 160736 161140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329646.1 protein_id gnl|my_center|LOCUS_04440 161153 162010 gene locus_tag LOCUS_04450 161153 162010 CDS product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294699.1 protein_id gnl|my_center|LOCUS_04450 162022 162630 gene locus_tag LOCUS_04460 162022 162630 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294697.1 protein_id gnl|my_center|LOCUS_04460 163350 162805 gene locus_tag LOCUS_04470 163350 162805 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173520.1 protein_id gnl|my_center|LOCUS_04470 163914 163630 gene locus_tag LOCUS_04480 gene zapA 163914 163630 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006811891.1 protein_id gnl|my_center|LOCUS_04480 165787 163922 gene locus_tag LOCUS_04490 gene dxs 165787 163922 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367989.1 protein_id gnl|my_center|LOCUS_04490 166669 165800 gene locus_tag LOCUS_04500 gene ispA 166669 165800 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816905.1 protein_id gnl|my_center|LOCUS_04500 166907 166662 gene locus_tag LOCUS_04510 gene xseB 166907 166662 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124935.1 protein_id gnl|my_center|LOCUS_04510 168446 167100 gene locus_tag LOCUS_04520 gene rmuC 168446 167100 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084315.1 protein_id gnl|my_center|LOCUS_04520 169423 168449 gene locus_tag LOCUS_04530 gene epmA 169423 168449 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095276.1 protein_id gnl|my_center|LOCUS_04530 171849 169492 gene locus_tag LOCUS_04540 gene mdoH 171849 169492 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298322.1 protein_id gnl|my_center|LOCUS_04540 173379 171868 gene locus_tag LOCUS_04550 173379 171868 CDS product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816064.1 protein_id gnl|my_center|LOCUS_04550 174113 173448 gene locus_tag LOCUS_04560 174113 173448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 174537 174265 gene locus_tag LOCUS_04570 174537 174265 CDS product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377227.1 protein_id gnl|my_center|LOCUS_04570 176619 174679 gene locus_tag LOCUS_04580 176619 174679 CDS product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000485046.1 protein_id gnl|my_center|LOCUS_04580 176757 177530 gene locus_tag LOCUS_04590 gene ybfF 176757 177530 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167956.1 protein_id gnl|my_center|LOCUS_04590 177885 177562 gene locus_tag LOCUS_04600 177885 177562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 178315 177878 gene locus_tag LOCUS_04610 178315 177878 CDS product YgdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211629.1 protein_id gnl|my_center|LOCUS_04610 178862 178284 gene locus_tag LOCUS_04620 178862 178284 CDS product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211630.1 protein_id gnl|my_center|LOCUS_04620 179332 178856 gene locus_tag LOCUS_04630 179332 178856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 179553 180377 gene locus_tag LOCUS_04640 gene dapD 179553 180377 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368172.1 protein_id gnl|my_center|LOCUS_04640 180482 180973 gene locus_tag LOCUS_04650 180482 180973 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208655.1 protein_id gnl|my_center|LOCUS_04650 181203 183479 gene locus_tag LOCUS_04660 gene bglX 181203 183479 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871556.1 protein_id gnl|my_center|LOCUS_04660 183532 185232 gene locus_tag LOCUS_04670 183532 185232 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272839.1 protein_id gnl|my_center|LOCUS_04670 185226 185945 gene locus_tag LOCUS_04680 gene btsR 185226 185945 CDS product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365746.1 protein_id gnl|my_center|LOCUS_04680 186267 188414 gene locus_tag LOCUS_04690 gene btsT 186267 188414 CDS product pyruvate/proton symporter BtsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001366791.1 protein_id gnl|my_center|LOCUS_04690 190066 188888 gene locus_tag LOCUS_04700 190066 188888 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020458.1 protein_id gnl|my_center|LOCUS_04700 190216 191109 gene locus_tag LOCUS_04710 190216 191109 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529480.1 protein_id gnl|my_center|LOCUS_04710 191919 191452 gene locus_tag LOCUS_04720 191919 191452 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208577.1 protein_id gnl|my_center|LOCUS_04720 192934 192026 gene locus_tag LOCUS_04730 192934 192026 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904497.1 protein_id gnl|my_center|LOCUS_04730 193239 195629 gene locus_tag LOCUS_04740 193239 195629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 >Feature sequence03 329 676 gene locus_tag LOCUS_04750 gene hinT 329 676 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097111.1 protein_id gnl|my_center|LOCUS_04750 682 1305 gene locus_tag LOCUS_04760 gene lpoB 682 1305 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213089.1 protein_id gnl|my_center|LOCUS_04760 1305 2351 gene locus_tag LOCUS_04770 gene nagZ 1305 2351 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529320.1 protein_id gnl|my_center|LOCUS_04770 2332 3573 gene locus_tag LOCUS_04780 gene tyrR 2332 3573 CDS product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210983.1 protein_id gnl|my_center|LOCUS_04780 3598 4596 gene locus_tag LOCUS_04790 gene rffG 3598 4596 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261022.1 protein_id gnl|my_center|LOCUS_04790 4649 5650 gene locus_tag LOCUS_04800 4649 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 5716 6465 gene locus_tag LOCUS_04810 5716 6465 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266512.1 protein_id gnl|my_center|LOCUS_04810 6462 7088 gene locus_tag LOCUS_04820 6462 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266513.1 protein_id gnl|my_center|LOCUS_04820 7078 7710 gene locus_tag LOCUS_04830 7078 7710 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266514.1 protein_id gnl|my_center|LOCUS_04830 7710 8444 gene locus_tag LOCUS_04840 7710 8444 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236089.1 protein_id gnl|my_center|LOCUS_04840 8444 8770 gene locus_tag LOCUS_04850 8444 8770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044391358.1 protein_id gnl|my_center|LOCUS_04850 8787 9827 gene locus_tag LOCUS_04860 8787 9827 CDS product WavE lipopolysaccharide synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769052.1 protein_id gnl|my_center|LOCUS_04860 9844 12060 gene locus_tag LOCUS_04870 9844 12060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 12095 13051 gene locus_tag LOCUS_04880 12095 13051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 13118 14173 gene locus_tag LOCUS_04890 13118 14173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 14315 16051 gene locus_tag LOCUS_04900 gene msbA 14315 16051 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551266.1 protein_id gnl|my_center|LOCUS_04900 16069 17850 gene locus_tag LOCUS_04910 gene msbA 16069 17850 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097303.1 protein_id gnl|my_center|LOCUS_04910 18958 17891 gene locus_tag LOCUS_04920 18958 17891 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128178822.1 protein_id gnl|my_center|LOCUS_04920 19954 18977 gene locus_tag LOCUS_04930 gene waaO 19954 18977 CDS product lipopolysaccharide 3-alpha-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188013.1 protein_id gnl|my_center|LOCUS_04930 20149 21123 gene locus_tag LOCUS_04940 gene waaO 20149 21123 CDS product lipopolysaccharide 3-alpha-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272750.1 protein_id gnl|my_center|LOCUS_04940 22292 21348 gene locus_tag LOCUS_04950 gene waaO 22292 21348 CDS product lipopolysaccharide 3-alpha-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188013.1 protein_id gnl|my_center|LOCUS_04950 22446 23426 gene locus_tag LOCUS_04960 gene rfaJ 22446 23426 CDS product lipopolysaccharide 1,2-glucosyltransferase RfaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376841.1 protein_id gnl|my_center|LOCUS_04960 23438 24412 gene locus_tag LOCUS_04970 gene waaO 23438 24412 CDS product lipopolysaccharide 3-alpha-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088491.1 protein_id gnl|my_center|LOCUS_04970 24702 26630 gene locus_tag LOCUS_04980 24702 26630 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849399.1 protein_id gnl|my_center|LOCUS_04980 26627 27307 gene locus_tag LOCUS_04990 gene tsaB 26627 27307 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211184.1 protein_id gnl|my_center|LOCUS_04990 27624 27358 gene locus_tag LOCUS_05000 27624 27358 CDS product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004873700.1 protein_id gnl|my_center|LOCUS_05000 27908 28600 gene locus_tag LOCUS_05010 27908 28600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 28670 29521 gene locus_tag LOCUS_05020 gene folD 28670 29521 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816853.1 protein_id gnl|my_center|LOCUS_05020 29589 30080 gene locus_tag LOCUS_05030 gene ppiB 29589 30080 CDS product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367878.1 protein_id gnl|my_center|LOCUS_05030 30073 30825 gene locus_tag LOCUS_05040 gene lpxH 30073 30825 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704629.1 protein_id gnl|my_center|LOCUS_05040 31484 30804 gene locus_tag LOCUS_05050 31484 30804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 32179 31484 gene locus_tag LOCUS_05060 gene modB 32179 31484 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158971.1 protein_id gnl|my_center|LOCUS_05060 32944 32192 gene locus_tag LOCUS_05070 gene modA 32944 32192 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816801.1 protein_id gnl|my_center|LOCUS_05070 33147 33923 gene locus_tag LOCUS_05080 gene modE 33147 33923 CDS product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168058.1 protein_id gnl|my_center|LOCUS_05080 33942 35402 gene locus_tag LOCUS_05090 gene modF 33942 35402 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096881.1 protein_id gnl|my_center|LOCUS_05090 35799 37802 gene locus_tag LOCUS_05100 gene uvrB 35799 37802 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210767.1 protein_id gnl|my_center|LOCUS_05100 37827 38177 gene locus_tag LOCUS_05110 37827 38177 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096138.1 protein_id gnl|my_center|LOCUS_05110 38331 38831 gene locus_tag LOCUS_05120 gene purE 38331 38831 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167785.1 protein_id gnl|my_center|LOCUS_05120 38833 39897 gene locus_tag LOCUS_05130 gene purK 38833 39897 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816855.1 protein_id gnl|my_center|LOCUS_05130 39922 41400 gene locus_tag LOCUS_05140 gene dgt 39922 41400 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209369.1 protein_id gnl|my_center|LOCUS_05140 41627 41965 gene locus_tag LOCUS_05150 gene glnK 41627 41965 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208627.1 protein_id gnl|my_center|LOCUS_05150 41986 43266 gene locus_tag LOCUS_05160 gene amtB 41986 43266 CDS product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167660.1 protein_id gnl|my_center|LOCUS_05160 43852 43376 gene locus_tag LOCUS_05170 43852 43376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 44940 45875 gene locus_tag LOCUS_05180 gene dsdC 44940 45875 CDS product DNA-binding transcriptional regulator DsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288116.1 protein_id gnl|my_center|LOCUS_05180 46899 45937 gene locus_tag LOCUS_05190 46899 45937 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947043.1 protein_id gnl|my_center|LOCUS_05190 48234 47008 gene locus_tag LOCUS_05200 48234 47008 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017569.1 protein_id gnl|my_center|LOCUS_05200 49108 48290 gene locus_tag LOCUS_05210 49108 48290 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_05210 50159 49350 gene locus_tag LOCUS_05220 gene fdhD 50159 49350 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703936.1 protein_id gnl|my_center|LOCUS_05220 50346 50876 gene locus_tag LOCUS_05230 50346 50876 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176305.1 protein_id gnl|my_center|LOCUS_05230 53491 50873 gene locus_tag LOCUS_05240 gene mscM 53491 50873 CDS product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228123.1 protein_id gnl|my_center|LOCUS_05240 54344 53496 gene locus_tag LOCUS_05250 gene asd 54344 53496 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368643.1 protein_id gnl|my_center|LOCUS_05250 54555 55961 gene locus_tag LOCUS_05260 gene rhaB 54555 55961 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209105.1 protein_id gnl|my_center|LOCUS_05260 56004 57257 gene locus_tag LOCUS_05270 gene rhaA 56004 57257 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703942.1 protein_id gnl|my_center|LOCUS_05270 57426 58460 gene locus_tag LOCUS_05280 gene rhaT 57426 58460 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209111.1 protein_id gnl|my_center|LOCUS_05280 58473 59624 gene locus_tag LOCUS_05290 gene fucO 58473 59624 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013588.1 protein_id gnl|my_center|LOCUS_05290 59694 60008 gene locus_tag LOCUS_05300 gene rhaM 59694 60008 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368949.1 protein_id gnl|my_center|LOCUS_05300 60925 60077 gene locus_tag LOCUS_05310 gene rhaR 60925 60077 CDS product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209110.1 protein_id gnl|my_center|LOCUS_05310 61767 60943 gene locus_tag LOCUS_05320 gene rhaS 61767 60943 CDS product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703945.1 protein_id gnl|my_center|LOCUS_05320 62523 63875 gene locus_tag LOCUS_05330 62523 63875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 65170 64364 gene locus_tag LOCUS_05340 gene rhaS 65170 64364 CDS product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217156.1 protein_id gnl|my_center|LOCUS_05340 65414 66982 gene locus_tag LOCUS_05350 65414 66982 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102178.1 protein_id gnl|my_center|LOCUS_05350 67008 68363 gene locus_tag LOCUS_05360 67008 68363 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966692.1 protein_id gnl|my_center|LOCUS_05360 68396 69577 gene locus_tag LOCUS_05370 68396 69577 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096165.1 protein_id gnl|my_center|LOCUS_05370 71027 69660 gene locus_tag LOCUS_05380 71027 69660 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222877.1 protein_id gnl|my_center|LOCUS_05380 71270 72232 gene locus_tag LOCUS_05390 gene rlmF 71270 72232 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172666006.1 protein_id gnl|my_center|LOCUS_05390 72420 73407 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttaatgccgtgtaggcagtttagaaa 74412 73552 gene locus_tag LOCUS_05400 74412 73552 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274601.1 protein_id gnl|my_center|LOCUS_05400 74597 74941 gene locus_tag LOCUS_05410 74597 74941 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209180.1 protein_id gnl|my_center|LOCUS_05410 77497 74993 gene locus_tag LOCUS_05420 gene ptsP 77497 74993 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185128.1 protein_id gnl|my_center|LOCUS_05420 77829 78914 gene locus_tag LOCUS_05430 77829 78914 CDS product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004469.1 protein_id gnl|my_center|LOCUS_05430 78942 79256 gene locus_tag LOCUS_05440 78942 79256 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209181.1 protein_id gnl|my_center|LOCUS_05440 79332 81629 gene locus_tag LOCUS_05450 79332 81629 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184833.1 protein_id gnl|my_center|LOCUS_05450 81595 82527 gene locus_tag LOCUS_05460 81595 82527 CDS product [formate-C-acetyltransferase]-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204151.1 protein_id gnl|my_center|LOCUS_05460 82594 83256 gene locus_tag LOCUS_05470 gene fsa 82594 83256 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420897.1 protein_id gnl|my_center|LOCUS_05470 83400 84176 gene locus_tag LOCUS_05480 83400 84176 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816565.1 protein_id gnl|my_center|LOCUS_05480 84193 84780 gene locus_tag LOCUS_05490 gene acpH 84193 84780 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095830.1 protein_id gnl|my_center|LOCUS_05490 86947 84860 gene locus_tag LOCUS_05500 86947 84860 CDS product D-(-)-3-hydroxybutyrate oligomer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532230.1 protein_id gnl|my_center|LOCUS_05500 87917 87018 gene locus_tag LOCUS_05510 gene ilvY 87917 87018 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176081.1 protein_id gnl|my_center|LOCUS_05510 88105 89697 gene locus_tag LOCUS_05520 gene prfC 88105 89697 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175968.1 protein_id gnl|my_center|LOCUS_05520 90037 92916 gene locus_tag LOCUS_05530 gene ptrA 90037 92916 CDS product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211626.1 protein_id gnl|my_center|LOCUS_05530 93017 93889 gene locus_tag LOCUS_05540 93017 93889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 93920 95200 gene locus_tag LOCUS_05550 gene aroA 93920 95200 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171024.1 protein_id gnl|my_center|LOCUS_05550 95202 95882 gene locus_tag LOCUS_05560 gene cmk 95202 95882 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367471.1 protein_id gnl|my_center|LOCUS_05560 96004 97686 gene locus_tag LOCUS_05570 gene rpsA 96004 97686 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367470.1 protein_id gnl|my_center|LOCUS_05570 97786 98076 gene locus_tag LOCUS_05580 gene ihfB 97786 98076 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705691.1 protein_id gnl|my_center|LOCUS_05580 98345 100591 gene locus_tag LOCUS_05590 98345 100591 CDS product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816036.1 protein_id gnl|my_center|LOCUS_05590 100655 101668 gene locus_tag LOCUS_05600 gene lpxK 100655 101668 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704887.1 protein_id gnl|my_center|LOCUS_05600 101665 101844 gene locus_tag LOCUS_05610 101665 101844 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072733.1 protein_id gnl|my_center|LOCUS_05610 101874 102638 gene locus_tag LOCUS_05620 gene kdsB 101874 102638 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211314.1 protein_id gnl|my_center|LOCUS_05620 102642 103334 gene locus_tag LOCUS_05630 102642 103334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 104072 103410 gene locus_tag LOCUS_05640 104072 103410 CDS product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366731.1 protein_id gnl|my_center|LOCUS_05640 105082 104186 gene locus_tag LOCUS_05650 105082 104186 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171845.1 protein_id gnl|my_center|LOCUS_05650 105209 105994 gene locus_tag LOCUS_05660 105209 105994 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171842.1 protein_id gnl|my_center|LOCUS_05660 106638 106111 gene locus_tag LOCUS_05670 gene ssb1 106638 106111 CDS product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209100.1 protein_id gnl|my_center|LOCUS_05670 106854 107795 gene locus_tag LOCUS_05680 gene corA 106854 107795 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947159.1 protein_id gnl|my_center|LOCUS_05680 108001 108960 gene locus_tag LOCUS_05690 gene glk 108001 108960 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815870.1 protein_id gnl|my_center|LOCUS_05690 108983 109231 gene locus_tag LOCUS_05700 108983 109231 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262257.1 protein_id gnl|my_center|LOCUS_05700 109228 109650 gene locus_tag LOCUS_05710 109228 109650 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807626.1 protein_id gnl|my_center|LOCUS_05710 110235 109678 gene locus_tag LOCUS_05720 110235 109678 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157142.1 protein_id gnl|my_center|LOCUS_05720 110973 110272 gene locus_tag LOCUS_05730 gene yggS 110973 110272 CDS product pyridoxal phosphate homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997800.1 protein_id gnl|my_center|LOCUS_05730 111010 111948 gene locus_tag LOCUS_05740 111010 111948 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461712.1 protein_id gnl|my_center|LOCUS_05740 112063 112872 gene locus_tag LOCUS_05750 gene proC 112063 112872 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095814.1 protein_id gnl|my_center|LOCUS_05750 113167 113376 gene locus_tag LOCUS_05760 gene cspE 113167 113376 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 protein_id gnl|my_center|LOCUS_05760 113558 113373 gene locus_tag LOCUS_05770 113558 113373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 113533 113811 gene locus_tag LOCUS_05780 113533 113811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 114354 113869 gene locus_tag LOCUS_05790 114354 113869 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173534.1 protein_id gnl|my_center|LOCUS_05790 114972 114448 gene locus_tag LOCUS_05800 gene fabA 114972 114448 CDS product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160035.1 protein_id gnl|my_center|LOCUS_05800 116886 115111 gene locus_tag LOCUS_05810 116886 115111 CDS product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224683.1 protein_id gnl|my_center|LOCUS_05810 117078 118850 gene locus_tag LOCUS_05820 gene yejM 117078 118850 CDS product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256203.1 protein_id gnl|my_center|LOCUS_05820 119837 118878 gene locus_tag LOCUS_05830 gene lipA 119837 118878 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367739.1 protein_id gnl|my_center|LOCUS_05830 120468 119848 gene locus_tag LOCUS_05840 gene lipB 120468 119848 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097593.1 protein_id gnl|my_center|LOCUS_05840 120845 123511 gene locus_tag LOCUS_05850 gene aceE 120845 123511 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209329.1 protein_id gnl|my_center|LOCUS_05850 123524 125155 gene locus_tag LOCUS_05860 gene aceF 123524 125155 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095598.1 protein_id gnl|my_center|LOCUS_05860 125170 126594 gene locus_tag LOCUS_05870 gene lpdA 125170 126594 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102483.1 protein_id gnl|my_center|LOCUS_05870 126932 126699 gene locus_tag LOCUS_05880 126932 126699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 127372 128673 gene locus_tag LOCUS_05890 127372 128673 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098563.1 protein_id gnl|my_center|LOCUS_05890 128702 130129 gene locus_tag LOCUS_05900 128702 130129 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098562.1 protein_id gnl|my_center|LOCUS_05900 130140 130460 gene locus_tag LOCUS_05910 130140 130460 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292778.1 protein_id gnl|my_center|LOCUS_05910 130522 131280 gene locus_tag LOCUS_05920 130522 131280 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098561.1 protein_id gnl|my_center|LOCUS_05920 132354 131530 gene locus_tag LOCUS_05930 132354 131530 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706181.1 protein_id gnl|my_center|LOCUS_05930 133199 132369 gene locus_tag LOCUS_05940 133199 132369 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706182.1 protein_id gnl|my_center|LOCUS_05940 133715 133224 gene locus_tag LOCUS_05950 133715 133224 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706183.1 protein_id gnl|my_center|LOCUS_05950 134158 133739 gene locus_tag LOCUS_05960 134158 133739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05960 134341 135051 gene locus_tag LOCUS_05970 gene deoC 134341 135051 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254138.1 protein_id gnl|my_center|LOCUS_05970 135825 135097 gene locus_tag LOCUS_05980 135825 135097 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254139.1 protein_id gnl|my_center|LOCUS_05980 137125 135938 gene locus_tag LOCUS_05990 gene manA 137125 135938 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263541.1 protein_id gnl|my_center|LOCUS_05990 138457 137273 gene locus_tag LOCUS_06000 138457 137273 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645128.1 protein_id gnl|my_center|LOCUS_06000 138802 139887 gene locus_tag LOCUS_06010 gene prfA 138802 139887 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096233.1 protein_id gnl|my_center|LOCUS_06010 139884 140720 gene locus_tag LOCUS_06020 gene prmC 139884 140720 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211235.1 protein_id gnl|my_center|LOCUS_06020 140735 141592 gene locus_tag LOCUS_06030 gene kdsA 140735 141592 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367105.1 protein_id gnl|my_center|LOCUS_06030 142040 143449 gene locus_tag LOCUS_06040 142040 143449 CDS product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167949.1 protein_id gnl|my_center|LOCUS_06040 143459 146125 gene locus_tag LOCUS_06050 143459 146125 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816825.1 protein_id gnl|my_center|LOCUS_06050 146585 146193 gene locus_tag LOCUS_06060 gene rraB 146585 146193 CDS product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002952.1 protein_id gnl|my_center|LOCUS_06060 146656 147486 gene locus_tag LOCUS_06070 146656 147486 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098057497.1 protein_id gnl|my_center|LOCUS_06070 147574 148194 gene locus_tag LOCUS_06080 147574 148194 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210628.1 protein_id gnl|my_center|LOCUS_06080 148239 148931 gene locus_tag LOCUS_06090 148239 148931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 148974 149855 gene locus_tag LOCUS_06100 gene rluB 148974 149855 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706718.1 protein_id gnl|my_center|LOCUS_06100 150150 151535 gene locus_tag LOCUS_06110 150150 151535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 151564 152727 gene locus_tag LOCUS_06120 151564 152727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 152756 154147 gene locus_tag LOCUS_06130 152756 154147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 154159 154869 gene locus_tag LOCUS_06140 154159 154869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 155032 155490 gene locus_tag LOCUS_06150 155032 155490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 156604 155588 gene locus_tag LOCUS_06160 156604 155588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 157022 157315 gene locus_tag LOCUS_06170 157022 157315 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104358.1 protein_id gnl|my_center|LOCUS_06170 159051 157360 gene locus_tag LOCUS_06180 gene argS 159051 157360 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096072.1 protein_id gnl|my_center|LOCUS_06180 159398 160396 gene locus_tag LOCUS_06190 gene thiB 159398 160396 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026017959.1 protein_id gnl|my_center|LOCUS_06190 160421 162001 gene locus_tag LOCUS_06200 gene thiP 160421 162001 CDS product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235671.1 protein_id gnl|my_center|LOCUS_06200 161979 162677 gene locus_tag LOCUS_06210 gene thiQ 161979 162677 CDS product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051608.1 protein_id gnl|my_center|LOCUS_06210 163375 164736 gene locus_tag LOCUS_06220 163375 164736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 165941 167122 gene locus_tag LOCUS_06230 165941 167122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 167195 168250 gene locus_tag LOCUS_06240 gene dinB 167195 168250 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167525.1 protein_id gnl|my_center|LOCUS_06240 169779 168343 gene locus_tag LOCUS_06250 gene bglA 169779 168343 CDS product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226994.1 protein_id gnl|my_center|LOCUS_06250 171664 169793 gene locus_tag LOCUS_06260 gene bglF 171664 169793 CDS product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277858.1 protein_id gnl|my_center|LOCUS_06260 171836 172540 gene locus_tag LOCUS_06270 171836 172540 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226988.1 protein_id gnl|my_center|LOCUS_06270 173725 172625 gene locus_tag LOCUS_06280 173725 172625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 174510 173863 gene locus_tag LOCUS_06290 gene pyrE 174510 173863 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844529.1 protein_id gnl|my_center|LOCUS_06290 175240 174524 gene locus_tag LOCUS_06300 gene rph 175240 174524 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247078.1 protein_id gnl|my_center|LOCUS_06300 175399 176265 gene locus_tag LOCUS_06310 175399 176265 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369148.1 protein_id gnl|my_center|LOCUS_06310 176270 177157 gene locus_tag LOCUS_06320 176270 177157 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208185.1 protein_id gnl|my_center|LOCUS_06320 177340 178254 gene locus_tag LOCUS_06330 177340 178254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 178747 178520 gene locus_tag LOCUS_06340 178747 178520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 178810 178986 gene locus_tag LOCUS_06350 178810 178986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 179296 180330 gene locus_tag LOCUS_06360 179296 180330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 181822 180437 gene locus_tag LOCUS_06370 181822 180437 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766607.1 protein_id gnl|my_center|LOCUS_06370 181994 182998 gene locus_tag LOCUS_06380 gene yejK 181994 182998 CDS product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365669.1 protein_id gnl|my_center|LOCUS_06380 183008 183850 gene locus_tag LOCUS_06390 gene nfo 183008 183850 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873880.1 protein_id gnl|my_center|LOCUS_06390 183855 184751 gene locus_tag LOCUS_06400 183855 184751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 184822 185745 gene locus_tag LOCUS_06410 184822 185745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 >Feature sequence04 78 154 gene locus_tag LOCUS_t00110 78 154 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 163 238 gene locus_tag LOCUS_t00120 163 238 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 371 709 gene locus_tag LOCUS_06420 371 709 CDS product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099290.1 protein_id gnl|my_center|LOCUS_06420 2238 715 gene locus_tag LOCUS_06430 2238 715 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815318.1 protein_id gnl|my_center|LOCUS_06430 3068 2358 gene locus_tag LOCUS_06440 gene znuB 3068 2358 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571480.1 protein_id gnl|my_center|LOCUS_06440 2998 3183 gene locus_tag LOCUS_06450 2998 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 3936 3190 gene locus_tag LOCUS_06460 gene znuC 3936 3190 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202986.1 protein_id gnl|my_center|LOCUS_06460 4030 4989 gene locus_tag LOCUS_06470 gene znuA 4030 4989 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227944.1 protein_id gnl|my_center|LOCUS_06470 5018 6379 gene locus_tag LOCUS_06480 gene mepM 5018 6379 CDS product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169193.1 protein_id gnl|my_center|LOCUS_06480 6515 8848 gene locus_tag LOCUS_06490 gene mrcB 6515 8848 CDS product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815593.1 protein_id gnl|my_center|LOCUS_06490 8859 9668 gene locus_tag LOCUS_06500 gene mutM 8859 9668 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175950.1 protein_id gnl|my_center|LOCUS_06500 10102 11400 gene locus_tag LOCUS_06510 gene tolB 10102 11400 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165502.1 protein_id gnl|my_center|LOCUS_06510 11644 11435 gene locus_tag LOCUS_06520 11644 11435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 11568 12053 gene locus_tag LOCUS_06530 gene pal 11568 12053 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005019976.1 protein_id gnl|my_center|LOCUS_06530 12076 12849 gene locus_tag LOCUS_06540 gene cpoB 12076 12849 CDS product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097583.1 protein_id gnl|my_center|LOCUS_06540 12981 13056 gene locus_tag LOCUS_t00130 12981 13056 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 13483 15600 gene locus_tag LOCUS_06550 13483 15600 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207935.1 protein_id gnl|my_center|LOCUS_06550 16956 15727 gene locus_tag LOCUS_06560 gene pepT 16956 15727 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211633.1 protein_id gnl|my_center|LOCUS_06560 18540 16981 gene locus_tag LOCUS_06570 18540 16981 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211634.1 protein_id gnl|my_center|LOCUS_06570 18918 21194 gene locus_tag LOCUS_06580 18918 21194 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108124.1 protein_id gnl|my_center|LOCUS_06580 21207 22469 gene locus_tag LOCUS_06590 gene icd 21207 22469 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203424.1 protein_id gnl|my_center|LOCUS_06590 22489 23844 gene locus_tag LOCUS_06600 22489 23844 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766471.1 protein_id gnl|my_center|LOCUS_06600 24056 23850 gene locus_tag LOCUS_06610 24056 23850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 24010 25512 gene locus_tag LOCUS_06620 gene murJ 24010 25512 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155214.1 protein_id gnl|my_center|LOCUS_06620 26875 25808 gene locus_tag LOCUS_06630 gene ulaG 26875 25808 CDS product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049013.1 protein_id gnl|my_center|LOCUS_06630 27663 26902 gene locus_tag LOCUS_06640 gene ulaR 27663 26902 CDS product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006793.1 protein_id gnl|my_center|LOCUS_06640 28109 29875 gene locus_tag LOCUS_06650 28109 29875 CDS product PTS ascorbate-specific subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395341.1 protein_id gnl|my_center|LOCUS_06650 29903 30376 gene locus_tag LOCUS_06660 29903 30376 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523578.1 protein_id gnl|my_center|LOCUS_06660 30381 31073 gene locus_tag LOCUS_06670 30381 31073 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286765.1 protein_id gnl|my_center|LOCUS_06670 31095 31739 gene locus_tag LOCUS_06680 31095 31739 CDS product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165663.1 protein_id gnl|my_center|LOCUS_06680 31807 32700 gene locus_tag LOCUS_06690 31807 32700 CDS product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284299.1 protein_id gnl|my_center|LOCUS_06690 33034 34008 gene locus_tag LOCUS_06700 33034 34008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 34956 33991 gene locus_tag LOCUS_06710 gene dusC 34956 33991 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168116.1 protein_id gnl|my_center|LOCUS_06710 35726 34962 gene locus_tag LOCUS_06720 gene moeB 35726 34962 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829211.1 protein_id gnl|my_center|LOCUS_06720 37125 35806 gene locus_tag LOCUS_06730 37125 35806 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_06730 37595 37146 gene locus_tag LOCUS_06740 37595 37146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492212.1 protein_id gnl|my_center|LOCUS_06740 38382 37606 gene locus_tag LOCUS_06750 38382 37606 CDS product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016874.1 protein_id gnl|my_center|LOCUS_06750 38957 38412 gene locus_tag LOCUS_06760 38957 38412 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286753.1 protein_id gnl|my_center|LOCUS_06760 39243 41000 gene locus_tag LOCUS_06770 gene aspS 39243 41000 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169176.1 protein_id gnl|my_center|LOCUS_06770 41011 41463 gene locus_tag LOCUS_06780 gene nudB 41011 41463 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050075476.1 protein_id gnl|my_center|LOCUS_06780 41474 41890 gene locus_tag LOCUS_06790 41474 41890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 41981 43447 gene locus_tag LOCUS_06800 gene ubiD 41981 43447 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339819.1 protein_id gnl|my_center|LOCUS_06800 43542 44639 gene locus_tag LOCUS_06810 43542 44639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 47323 44678 gene locus_tag LOCUS_06820 gene ppc 47323 44678 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815299.1 protein_id gnl|my_center|LOCUS_06820 47675 48166 gene locus_tag LOCUS_06830 47675 48166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 48168 48470 gene locus_tag LOCUS_06840 gene nuoK 48168 48470 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159229.1 protein_id gnl|my_center|LOCUS_06840 48557 50314 gene locus_tag LOCUS_06850 gene nuoL 48557 50314 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815943.1 protein_id gnl|my_center|LOCUS_06850 50332 51876 gene locus_tag LOCUS_06860 gene nuoM 50332 51876 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815944.1 protein_id gnl|my_center|LOCUS_06860 51883 53820 gene locus_tag LOCUS_06870 51883 53820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 54010 54342 gene locus_tag LOCUS_06880 gene yajC 54010 54342 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859109.1 protein_id gnl|my_center|LOCUS_06880 54436 56259 gene locus_tag LOCUS_06890 gene secD 54436 56259 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208670.1 protein_id gnl|my_center|LOCUS_06890 56269 57270 gene locus_tag LOCUS_06900 gene secF 56269 57270 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208669.1 protein_id gnl|my_center|LOCUS_06900 57396 57471 gene locus_tag LOCUS_t00140 57396 57471 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 57727 58905 gene locus_tag LOCUS_06910 57727 58905 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113815.1 protein_id gnl|my_center|LOCUS_06910 59888 61138 gene locus_tag LOCUS_06920 59888 61138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 61154 61462 gene locus_tag LOCUS_06930 61154 61462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 61652 61825 gene locus_tag LOCUS_06940 61652 61825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 61828 62325 gene locus_tag LOCUS_06950 61828 62325 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963896.1 protein_id gnl|my_center|LOCUS_06950 62938 63456 gene locus_tag LOCUS_06960 62938 63456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 64401 64610 gene locus_tag LOCUS_06970 64401 64610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 64773 65525 gene locus_tag LOCUS_06980 64773 65525 CDS product antA/AntB antirepressor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776709.1 protein_id gnl|my_center|LOCUS_06980 65979 65821 gene locus_tag LOCUS_06990 65979 65821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 66173 66523 gene locus_tag LOCUS_07000 66173 66523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 66570 66890 gene locus_tag LOCUS_07010 66570 66890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 66901 69246 gene locus_tag LOCUS_07020 66901 69246 CDS product primase-like DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209923.1 protein_id gnl|my_center|LOCUS_07020 69693 69520 gene locus_tag LOCUS_07030 69693 69520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 70228 70542 gene locus_tag LOCUS_07040 70228 70542 CDS product isochorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543138.1 protein_id gnl|my_center|LOCUS_07040 70556 71071 gene locus_tag LOCUS_07050 70556 71071 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675062.1 protein_id gnl|my_center|LOCUS_07050 71158 71394 gene locus_tag LOCUS_07060 71158 71394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170100.1 protein_id gnl|my_center|LOCUS_07060 71454 72530 gene locus_tag LOCUS_07070 71454 72530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 73401 74117 gene locus_tag LOCUS_07080 73401 74117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 76992 74278 gene locus_tag LOCUS_07090 76992 74278 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233978.1 protein_id gnl|my_center|LOCUS_07090 77581 79542 gene locus_tag LOCUS_07100 77581 79542 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208825.1 protein_id gnl|my_center|LOCUS_07100 79544 80632 gene locus_tag LOCUS_07110 79544 80632 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171436.1 protein_id gnl|my_center|LOCUS_07110 80632 81663 gene locus_tag LOCUS_07120 80632 81663 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097986.1 protein_id gnl|my_center|LOCUS_07120 81660 83393 gene locus_tag LOCUS_07130 gene yejF 81660 83393 CDS product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815989.1 protein_id gnl|my_center|LOCUS_07130 83472 84329 gene locus_tag LOCUS_07140 83472 84329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 84759 84403 gene locus_tag LOCUS_07150 gene frdD 84759 84403 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175559.1 protein_id gnl|my_center|LOCUS_07150 85205 84774 gene locus_tag LOCUS_07160 85205 84774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 85842 86012 gene locus_tag LOCUS_07170 85842 86012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 86082 87608 gene locus_tag LOCUS_07180 gene casA 86082 87608 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046083149.1 protein_id gnl|my_center|LOCUS_07180 87629 88258 gene locus_tag LOCUS_07190 gene casB 87629 88258 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935107.1 protein_id gnl|my_center|LOCUS_07190 88264 89328 gene locus_tag LOCUS_07200 gene cas7e 88264 89328 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044180303.1 protein_id gnl|my_center|LOCUS_07200 89342 90085 gene locus_tag LOCUS_07210 gene cas5e 89342 90085 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666425.1 protein_id gnl|my_center|LOCUS_07210 90086 90763 gene locus_tag LOCUS_07220 gene cas6e 90086 90763 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281411.1 protein_id gnl|my_center|LOCUS_07220 90775 91692 gene locus_tag LOCUS_07230 gene cas1e 90775 91692 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220066.1 protein_id gnl|my_center|LOCUS_07230 91695 91988 gene locus_tag LOCUS_07240 gene cas2e 91695 91988 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062282.1 protein_id gnl|my_center|LOCUS_07240 92073 92347 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccctgtatacacagggataaacc 92647 93288 gene locus_tag LOCUS_07250 gene tmk 92647 93288 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170710.1 protein_id gnl|my_center|LOCUS_07250 93285 94271 gene locus_tag LOCUS_07260 gene holB 93285 94271 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213083.1 protein_id gnl|my_center|LOCUS_07260 94332 95732 gene locus_tag LOCUS_07270 94332 95732 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706086.1 protein_id gnl|my_center|LOCUS_07270 95751 97232 gene locus_tag LOCUS_07280 95751 97232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 97225 98397 gene locus_tag LOCUS_07290 97225 98397 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225180.1 protein_id gnl|my_center|LOCUS_07290 98432 99136 gene locus_tag LOCUS_07300 gene pyrF 98432 99136 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705735.1 protein_id gnl|my_center|LOCUS_07300 99144 99464 gene locus_tag LOCUS_07310 gene yciH 99144 99464 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705734.1 protein_id gnl|my_center|LOCUS_07310 99843 99523 gene locus_tag LOCUS_07320 gene tmaR 99843 99523 CDS product PTS system regulator TmaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217522.1 protein_id gnl|my_center|LOCUS_07320 100164 101054 gene locus_tag LOCUS_07330 gene accD 100164 101054 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815925.1 protein_id gnl|my_center|LOCUS_07330 101061 102332 gene locus_tag LOCUS_07340 gene folC 101061 102332 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209730.1 protein_id gnl|my_center|LOCUS_07340 102345 102926 gene locus_tag LOCUS_07350 102345 102926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 103048 103533 gene locus_tag LOCUS_07360 gene cvpA 103048 103533 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262102.1 protein_id gnl|my_center|LOCUS_07360 103552 105069 gene locus_tag LOCUS_07370 gene purF 103552 105069 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209733.1 protein_id gnl|my_center|LOCUS_07370 105545 108244 gene locus_tag LOCUS_07380 105545 108244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 108402 109439 gene locus_tag LOCUS_07390 108402 109439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 109763 109969 gene locus_tag LOCUS_07400 109763 109969 CDS product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099053.1 protein_id gnl|my_center|LOCUS_07400 110059 110688 gene locus_tag LOCUS_07410 gene crp 110059 110688 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212297.1 protein_id gnl|my_center|LOCUS_07410 110750 111481 gene locus_tag LOCUS_07420 gene ispU 110750 111481 CDS product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173219.1 protein_id gnl|my_center|LOCUS_07420 111475 112314 gene locus_tag LOCUS_07430 gene cdsA 111475 112314 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095657.1 protein_id gnl|my_center|LOCUS_07430 112329 113648 gene locus_tag LOCUS_07440 gene rseP 112329 113648 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816967.1 protein_id gnl|my_center|LOCUS_07440 113674 116097 gene locus_tag LOCUS_07450 gene bamA 113674 116097 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240921.1 protein_id gnl|my_center|LOCUS_07450 116137 116625 gene locus_tag LOCUS_07460 116137 116625 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262427.1 protein_id gnl|my_center|LOCUS_07460 116625 117653 gene locus_tag LOCUS_07470 gene lpxD 116625 117653 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139265.1 protein_id gnl|my_center|LOCUS_07470 117761 119062 gene locus_tag LOCUS_07480 gene tig 117761 119062 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198388.1 protein_id gnl|my_center|LOCUS_07480 119156 119758 gene locus_tag LOCUS_07490 gene clpP 119156 119758 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167636.1 protein_id gnl|my_center|LOCUS_07490 119780 121045 gene locus_tag LOCUS_07500 gene clpX 119780 121045 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167638.1 protein_id gnl|my_center|LOCUS_07500 121233 123668 gene locus_tag LOCUS_07510 gene lon 121233 123668 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005053030.1 protein_id gnl|my_center|LOCUS_07510 123801 125660 gene locus_tag LOCUS_07520 gene ppiD 123801 125660 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167642.1 protein_id gnl|my_center|LOCUS_07520 125814 126134 gene locus_tag LOCUS_07530 125814 126134 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015701999.1 protein_id gnl|my_center|LOCUS_07530 128352 126184 gene locus_tag LOCUS_07540 gene priA 128352 126184 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703950.1 protein_id gnl|my_center|LOCUS_07540 128573 129064 gene locus_tag LOCUS_07550 gene moaC 128573 129064 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005642378.1 protein_id gnl|my_center|LOCUS_07550 129057 129302 gene locus_tag LOCUS_07560 gene moaD 129057 129302 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367604.1 protein_id gnl|my_center|LOCUS_07560 129307 129750 gene locus_tag LOCUS_07570 gene moaE 129307 129750 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694395.1 protein_id gnl|my_center|LOCUS_07570 129807 130505 gene locus_tag LOCUS_07580 129807 130505 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210775.1 protein_id gnl|my_center|LOCUS_07580 130657 132507 gene locus_tag LOCUS_07590 130657 132507 CDS product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060993346.1 protein_id gnl|my_center|LOCUS_07590 134416 132581 gene locus_tag LOCUS_07600 gene sppA 134416 132581 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816426.1 protein_id gnl|my_center|LOCUS_07600 135262 134444 gene locus_tag LOCUS_07610 gene apaH 135262 134444 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257186.1 protein_id gnl|my_center|LOCUS_07610 136064 135267 gene locus_tag LOCUS_07620 gene rsmA 136064 135267 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704372.1 protein_id gnl|my_center|LOCUS_07620 137376 136057 gene locus_tag LOCUS_07630 gene surA 137376 136057 CDS product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210488.1 protein_id gnl|my_center|LOCUS_07630 139807 137450 gene locus_tag LOCUS_07640 gene lptD 139807 137450 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815546.1 protein_id gnl|my_center|LOCUS_07640 141183 139882 gene locus_tag LOCUS_07650 gene pcnB 141183 139882 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174639.1 protein_id gnl|my_center|LOCUS_07650 141654 142580 gene locus_tag LOCUS_07660 gene oxyR 141654 142580 CDS product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209478.1 protein_id gnl|my_center|LOCUS_07660 142583 143227 gene locus_tag LOCUS_07670 gene fabR 142583 143227 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209476.1 protein_id gnl|my_center|LOCUS_07670 143422 144459 gene locus_tag LOCUS_07680 143422 144459 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215921.1 protein_id gnl|my_center|LOCUS_07680 145909 144521 gene locus_tag LOCUS_07690 gene pntB 145909 144521 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705257.1 protein_id gnl|my_center|LOCUS_07690 147457 145925 gene locus_tag LOCUS_07700 gene pntA 147457 145925 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816338.1 protein_id gnl|my_center|LOCUS_07700 148151 148393 gene locus_tag LOCUS_07710 148151 148393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07710 148740 149009 gene locus_tag LOCUS_07720 148740 149009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 149003 150391 gene locus_tag LOCUS_07730 149003 150391 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114561.1 protein_id gnl|my_center|LOCUS_07730 151242 150520 gene locus_tag LOCUS_07740 151242 150520 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267525.1 protein_id gnl|my_center|LOCUS_07740 151556 152878 gene locus_tag LOCUS_07750 gene mukF 151556 152878 CDS product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170970.1 protein_id gnl|my_center|LOCUS_07750 152859 153644 gene locus_tag LOCUS_07760 gene mukE 152859 153644 CDS product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211309.1 protein_id gnl|my_center|LOCUS_07760 153647 158065 gene locus_tag LOCUS_07770 gene mukB 153647 158065 CDS product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211308.1 protein_id gnl|my_center|LOCUS_07770 158443 158661 gene locus_tag LOCUS_07780 158443 158661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 159229 159450 gene locus_tag LOCUS_07790 159229 159450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 159848 161140 gene locus_tag LOCUS_07800 159848 161140 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208949.1 protein_id gnl|my_center|LOCUS_07800 161133 163244 gene locus_tag LOCUS_07810 161133 163244 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704147.1 protein_id gnl|my_center|LOCUS_07810 165702 163906 gene locus_tag LOCUS_07820 gene lepA 165702 163906 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392118.1 protein_id gnl|my_center|LOCUS_07820 165823 166266 gene locus_tag LOCUS_07830 165823 166266 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890791.1 protein_id gnl|my_center|LOCUS_07830 167036 166389 gene locus_tag LOCUS_07840 167036 166389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 167577 167416 gene locus_tag LOCUS_07850 167577 167416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence05 105 1091 gene locus_tag LOCUS_07860 105 1091 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175607.1 protein_id gnl|my_center|LOCUS_07860 1108 1881 gene locus_tag LOCUS_07870 1108 1881 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815405.1 protein_id gnl|my_center|LOCUS_07870 1968 2969 gene locus_tag LOCUS_07880 gene zntB 1968 2969 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169583.1 protein_id gnl|my_center|LOCUS_07880 3407 3751 gene locus_tag LOCUS_07890 3407 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 3795 5687 gene locus_tag LOCUS_07900 3795 5687 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461760.1 protein_id gnl|my_center|LOCUS_07900 7481 10189 gene locus_tag LOCUS_07910 gene mgtA 7481 10189 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050122726.1 protein_id gnl|my_center|LOCUS_07910 10772 10557 gene locus_tag LOCUS_07920 10772 10557 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810411.1 protein_id gnl|my_center|LOCUS_07920 10875 12392 gene locus_tag LOCUS_07930 10875 12392 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298776.1 protein_id gnl|my_center|LOCUS_07930 12439 13527 gene locus_tag LOCUS_07940 12439 13527 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462611.1 protein_id gnl|my_center|LOCUS_07940 14024 13551 gene locus_tag LOCUS_07950 gene bcp 14024 13551 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068682.1 protein_id gnl|my_center|LOCUS_07950 15386 14094 gene locus_tag LOCUS_07960 gene hemL 15386 14094 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209362.1 protein_id gnl|my_center|LOCUS_07960 15544 15882 gene locus_tag LOCUS_07970 gene erpA 15544 15882 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304404.1 protein_id gnl|my_center|LOCUS_07970 16083 16170 gene locus_tag LOCUS_t00150 16083 16170 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16188 16263 gene locus_tag LOCUS_t00160 16188 16263 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16754 17218 gene locus_tag LOCUS_07980 16754 17218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 17211 17501 gene locus_tag LOCUS_07990 17211 17501 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435756.1 protein_id gnl|my_center|LOCUS_07990 17519 18778 gene locus_tag LOCUS_08000 17519 18778 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435758.1 protein_id gnl|my_center|LOCUS_08000 18856 19452 gene locus_tag LOCUS_08010 18856 19452 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373863.1 protein_id gnl|my_center|LOCUS_08010 19446 20327 gene locus_tag LOCUS_08020 gene dapA 19446 20327 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435760.1 protein_id gnl|my_center|LOCUS_08020 20346 20984 gene locus_tag LOCUS_08030 20346 20984 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862015.1 protein_id gnl|my_center|LOCUS_08030 21036 23096 gene locus_tag LOCUS_08040 21036 23096 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862017.1 protein_id gnl|my_center|LOCUS_08040 23588 23208 gene locus_tag LOCUS_08050 23588 23208 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947880.1 protein_id gnl|my_center|LOCUS_08050 23754 24671 gene locus_tag LOCUS_08060 23754 24671 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948563.1 protein_id gnl|my_center|LOCUS_08060 24914 25816 gene locus_tag LOCUS_08070 24914 25816 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989491.1 protein_id gnl|my_center|LOCUS_08070 25967 26806 gene locus_tag LOCUS_08080 25967 26806 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706576.1 protein_id gnl|my_center|LOCUS_08080 27248 27712 gene locus_tag LOCUS_08090 gene aroL 27248 27712 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816919.1 protein_id gnl|my_center|LOCUS_08090 27935 29134 gene locus_tag LOCUS_08100 27935 29134 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296106.1 protein_id gnl|my_center|LOCUS_08100 30960 29740 gene locus_tag LOCUS_08110 30960 29740 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704390.1 protein_id gnl|my_center|LOCUS_08110 31316 32137 gene locus_tag LOCUS_08120 31316 32137 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084082.1 protein_id gnl|my_center|LOCUS_08120 32160 33032 gene locus_tag LOCUS_08130 32160 33032 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725703.1 protein_id gnl|my_center|LOCUS_08130 33140 33904 gene locus_tag LOCUS_08140 gene aroD 33140 33904 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721277.1 protein_id gnl|my_center|LOCUS_08140 34050 34889 gene locus_tag LOCUS_08150 34050 34889 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643078.1 protein_id gnl|my_center|LOCUS_08150 35337 37376 gene locus_tag LOCUS_08160 35337 37376 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989492.1 protein_id gnl|my_center|LOCUS_08160 37896 38345 gene locus_tag LOCUS_08170 37896 38345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 38658 39425 gene locus_tag LOCUS_08180 38658 39425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 39922 40380 gene locus_tag LOCUS_08190 39922 40380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 40529 41020 gene locus_tag LOCUS_08200 40529 41020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 41272 41730 gene locus_tag LOCUS_08210 41272 41730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 42534 41980 gene locus_tag LOCUS_08220 42534 41980 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208449.1 protein_id gnl|my_center|LOCUS_08220 42997 42833 gene locus_tag LOCUS_08230 42997 42833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 44641 43430 gene locus_tag LOCUS_08240 44641 43430 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537085.1 protein_id gnl|my_center|LOCUS_08240 46212 45376 gene locus_tag LOCUS_08250 46212 45376 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_08250 46587 46378 gene locus_tag LOCUS_08260 46587 46378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 47425 46574 gene locus_tag LOCUS_08270 47425 46574 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108052.1 protein_id gnl|my_center|LOCUS_08270 48198 47503 gene locus_tag LOCUS_08280 48198 47503 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814285.1 protein_id gnl|my_center|LOCUS_08280 48619 49158 gene locus_tag LOCUS_08290 48619 49158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 49929 49414 gene locus_tag LOCUS_08300 49929 49414 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888793.1 protein_id gnl|my_center|LOCUS_08300 50114 50776 gene locus_tag LOCUS_08310 50114 50776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 51111 50839 gene locus_tag LOCUS_08320 51111 50839 CDS product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146332.1 protein_id gnl|my_center|LOCUS_08320 51263 51811 gene locus_tag LOCUS_08330 gene msrA 51263 51811 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723414.1 protein_id gnl|my_center|LOCUS_08330 51815 52345 gene locus_tag LOCUS_08340 51815 52345 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113889.1 protein_id gnl|my_center|LOCUS_08340 52422 52862 gene locus_tag LOCUS_08350 gene msrB 52422 52862 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964858.1 protein_id gnl|my_center|LOCUS_08350 54177 53113 gene locus_tag LOCUS_08360 gene lptG 54177 53113 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175277.1 protein_id gnl|my_center|LOCUS_08360 55258 54188 gene locus_tag LOCUS_08370 gene lptF 55258 54188 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368544.1 protein_id gnl|my_center|LOCUS_08370 55430 56914 gene locus_tag LOCUS_08380 gene pepA 55430 56914 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397157.1 protein_id gnl|my_center|LOCUS_08380 56928 57380 gene locus_tag LOCUS_08390 gene holC 56928 57380 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786400.1 protein_id gnl|my_center|LOCUS_08390 58082 58474 gene locus_tag LOCUS_08400 58082 58474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 58687 58502 gene locus_tag LOCUS_08410 58687 58502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 59315 60679 gene locus_tag LOCUS_08420 59315 60679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 61036 61227 gene locus_tag LOCUS_08430 61036 61227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 61506 64364 gene locus_tag LOCUS_08440 61506 64364 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416348.1 protein_id gnl|my_center|LOCUS_08440 65970 64450 gene locus_tag LOCUS_08450 65970 64450 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055228983.1 protein_id gnl|my_center|LOCUS_08450 67400 66015 gene locus_tag LOCUS_08460 67400 66015 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 protein_id gnl|my_center|LOCUS_08460 68468 67797 gene locus_tag LOCUS_08470 68468 67797 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768999.1 protein_id gnl|my_center|LOCUS_08470 69933 68704 gene locus_tag LOCUS_08480 69933 68704 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816666.1 protein_id gnl|my_center|LOCUS_08480 71565 71032 gene locus_tag LOCUS_08490 71565 71032 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136345632.1 protein_id gnl|my_center|LOCUS_08490 72811 71645 gene locus_tag LOCUS_08500 72811 71645 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020458.1 protein_id gnl|my_center|LOCUS_08500 72955 73848 gene locus_tag LOCUS_08510 72955 73848 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529480.1 protein_id gnl|my_center|LOCUS_08510 74076 74444 gene locus_tag LOCUS_08520 74076 74444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 74724 75326 gene locus_tag LOCUS_08530 74724 75326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 75338 75907 gene locus_tag LOCUS_08540 75338 75907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 76117 76575 gene locus_tag LOCUS_08550 76117 76575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08550 76896 77168 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccctgtatgcacagggataaaccg 77324 77665 gene locus_tag LOCUS_08560 77324 77665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 77870 78877 gene locus_tag LOCUS_08570 77870 78877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 78874 80529 gene locus_tag LOCUS_08580 78874 80529 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160857111.1 protein_id gnl|my_center|LOCUS_08580 80684 81712 gene locus_tag LOCUS_08590 80684 81712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 82020 82736 gene locus_tag LOCUS_08600 82020 82736 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189145.1 protein_id gnl|my_center|LOCUS_08600 82923 87197 gene locus_tag LOCUS_08610 82923 87197 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107756.1 protein_id gnl|my_center|LOCUS_08610 87226 87843 gene locus_tag LOCUS_08620 87226 87843 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104477.1 protein_id gnl|my_center|LOCUS_08620 87866 89614 gene locus_tag LOCUS_08630 87866 89614 CDS product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105550.1 protein_id gnl|my_center|LOCUS_08630 89617 90933 gene locus_tag LOCUS_08640 89617 90933 CDS product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105551.1 protein_id gnl|my_center|LOCUS_08640 90927 91400 gene locus_tag LOCUS_08650 90927 91400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 91441 92376 gene locus_tag LOCUS_08660 91441 92376 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105554.1 protein_id gnl|my_center|LOCUS_08660 92523 92786 gene locus_tag LOCUS_08670 92523 92786 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621026.1 protein_id gnl|my_center|LOCUS_08670 94292 92913 gene locus_tag LOCUS_08680 94292 92913 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815881.1 protein_id gnl|my_center|LOCUS_08680 94625 95059 gene locus_tag LOCUS_08690 94625 95059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08690 95052 95759 gene locus_tag LOCUS_08700 95052 95759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08700 95803 96459 gene locus_tag LOCUS_08710 95803 96459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08710 98196 96514 gene locus_tag LOCUS_08720 98196 96514 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815882.1 protein_id gnl|my_center|LOCUS_08720 98301 98810 gene locus_tag LOCUS_08730 gene matP 98301 98810 CDS product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877153.1 protein_id gnl|my_center|LOCUS_08730 98840 101455 gene locus_tag LOCUS_08740 gene topA 98840 101455 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297122.1 protein_id gnl|my_center|LOCUS_08740 101625 102596 gene locus_tag LOCUS_08750 gene cysB 101625 102596 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210621.1 protein_id gnl|my_center|LOCUS_08750 103295 102669 gene locus_tag LOCUS_08760 gene hisIE 103295 102669 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706033.1 protein_id gnl|my_center|LOCUS_08760 104038 103289 gene locus_tag LOCUS_08770 gene hisF 104038 103289 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168354.1 protein_id gnl|my_center|LOCUS_08770 104799 104047 gene locus_tag LOCUS_08780 gene hisA 104799 104047 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097846.1 protein_id gnl|my_center|LOCUS_08780 105389 104802 gene locus_tag LOCUS_08790 gene hisH 105389 104802 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168362.1 protein_id gnl|my_center|LOCUS_08790 106457 105390 gene locus_tag LOCUS_08800 gene hisB 106457 105390 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080139.1 protein_id gnl|my_center|LOCUS_08800 107524 106466 gene locus_tag LOCUS_08810 gene hisC 107524 106466 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108921.1 protein_id gnl|my_center|LOCUS_08810 108835 107534 gene locus_tag LOCUS_08820 gene hisD 108835 107534 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816713.1 protein_id gnl|my_center|LOCUS_08820 109740 108841 gene locus_tag LOCUS_08830 gene hisG 109740 108841 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211896.1 protein_id gnl|my_center|LOCUS_08830 110494 110102 gene locus_tag LOCUS_08840 gene lrpA 110494 110102 CDS product transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246601.1 protein_id gnl|my_center|LOCUS_08840 110601 111152 gene locus_tag LOCUS_08850 110601 111152 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207917.1 protein_id gnl|my_center|LOCUS_08850 111282 112442 gene locus_tag LOCUS_08860 111282 112442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 112739 113329 gene locus_tag LOCUS_08870 112739 113329 CDS product DUF4291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 protein_id gnl|my_center|LOCUS_08870 113595 114536 gene locus_tag LOCUS_08880 113595 114536 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705616.1 protein_id gnl|my_center|LOCUS_08880 114803 115678 gene locus_tag LOCUS_08890 114803 115678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 116181 115765 gene locus_tag LOCUS_08900 116181 115765 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400759.1 protein_id gnl|my_center|LOCUS_08900 117268 116435 gene locus_tag LOCUS_08910 117268 116435 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815345.1 protein_id gnl|my_center|LOCUS_08910 118496 117285 gene locus_tag LOCUS_08920 118496 117285 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211477.1 protein_id gnl|my_center|LOCUS_08920 118676 119332 gene locus_tag LOCUS_08930 118676 119332 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080191.1 protein_id gnl|my_center|LOCUS_08930 119434 120273 gene locus_tag LOCUS_08940 119434 120273 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272620.1 protein_id gnl|my_center|LOCUS_08940 120330 121793 gene locus_tag LOCUS_08950 120330 121793 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272619.1 protein_id gnl|my_center|LOCUS_08950 122699 122301 gene locus_tag LOCUS_08960 122699 122301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 123183 122806 gene locus_tag LOCUS_08970 gene crcB 123183 122806 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 protein_id gnl|my_center|LOCUS_08970 123647 124780 gene locus_tag LOCUS_08980 123647 124780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 124892 125500 gene locus_tag LOCUS_08990 124892 125500 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483431.1 protein_id gnl|my_center|LOCUS_08990 125861 126337 gene locus_tag LOCUS_09000 125861 126337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 127040 127429 gene locus_tag LOCUS_09010 127040 127429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 127657 127875 gene locus_tag LOCUS_09020 127657 127875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 127901 128113 gene locus_tag LOCUS_09030 127901 128113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 128179 128409 gene locus_tag LOCUS_09040 128179 128409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 128437 128664 gene locus_tag LOCUS_09050 128437 128664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 129767 131743 gene locus_tag LOCUS_09060 gene manR 129767 131743 CDS product mannose transport/utilization transcriptional regulator ManR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245617.1 protein_id gnl|my_center|LOCUS_09060 131733 132188 gene locus_tag LOCUS_09070 131733 132188 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733191.1 protein_id gnl|my_center|LOCUS_09070 132218 133555 gene locus_tag LOCUS_09080 132218 133555 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674984.1 protein_id gnl|my_center|LOCUS_09080 133570 133854 gene locus_tag LOCUS_09090 133570 133854 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567994.1 protein_id gnl|my_center|LOCUS_09090 133951 134466 gene locus_tag LOCUS_09100 133951 134466 CDS product YjbQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576695.1 protein_id gnl|my_center|LOCUS_09100 134482 135132 gene locus_tag LOCUS_09110 gene rpe 134482 135132 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476680.1 protein_id gnl|my_center|LOCUS_09110 135143 135679 gene locus_tag LOCUS_09120 135143 135679 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116008.1 protein_id gnl|my_center|LOCUS_09120 138259 135935 gene locus_tag LOCUS_09130 138259 135935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 140226 138835 gene locus_tag LOCUS_09140 140226 138835 CDS product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216605.1 protein_id gnl|my_center|LOCUS_09140 141837 140314 gene locus_tag LOCUS_09150 141837 140314 CDS product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216605.1 protein_id gnl|my_center|LOCUS_09150 145330 141869 gene locus_tag LOCUS_09160 gene mfd 145330 141869 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816135.1 protein_id gnl|my_center|LOCUS_09160 145480 146691 gene locus_tag LOCUS_09170 gene lolC 145480 146691 CDS product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170663.1 protein_id gnl|my_center|LOCUS_09170 146684 147382 gene locus_tag LOCUS_09180 gene lolD 146684 147382 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210923.1 protein_id gnl|my_center|LOCUS_09180 147403 148641 gene locus_tag LOCUS_09190 gene lolE 147403 148641 CDS product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705054.1 protein_id gnl|my_center|LOCUS_09190 148677 148862 gene locus_tag LOCUS_09200 148677 148862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 148898 149080 gene locus_tag LOCUS_09210 148898 149080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 149859 149134 gene locus_tag LOCUS_09220 149859 149134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence06 629 435 gene locus_tag LOCUS_09230 629 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 2329 836 gene locus_tag LOCUS_09240 2329 836 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096787.1 protein_id gnl|my_center|LOCUS_09240 5509 2360 gene locus_tag LOCUS_09250 5509 2360 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 protein_id gnl|my_center|LOCUS_09250 6920 7390 gene locus_tag LOCUS_09260 6920 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 7717 7923 gene locus_tag LOCUS_09270 7717 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 9455 8061 gene locus_tag LOCUS_09280 gene clcA 9455 8061 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845433.1 protein_id gnl|my_center|LOCUS_09280 10911 9586 gene locus_tag LOCUS_09290 10911 9586 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108187.1 protein_id gnl|my_center|LOCUS_09290 11693 10914 gene locus_tag LOCUS_09300 11693 10914 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082282.1 protein_id gnl|my_center|LOCUS_09300 12541 11693 gene locus_tag LOCUS_09310 12541 11693 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173871.1 protein_id gnl|my_center|LOCUS_09310 13368 12538 gene locus_tag LOCUS_09320 13368 12538 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437750.1 protein_id gnl|my_center|LOCUS_09320 14309 13365 gene locus_tag LOCUS_09330 gene nikB 14309 13365 CDS product nickel ABC transporter permease subunit NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947076.1 protein_id gnl|my_center|LOCUS_09330 15898 14333 gene locus_tag LOCUS_09340 gene nikA 15898 14333 CDS product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493127.1 protein_id gnl|my_center|LOCUS_09340 16165 17466 gene locus_tag LOCUS_09350 gene rhlE 16165 17466 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097479.1 protein_id gnl|my_center|LOCUS_09350 17493 17834 gene locus_tag LOCUS_09360 17493 17834 CDS product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209990.1 protein_id gnl|my_center|LOCUS_09360 19490 17898 gene locus_tag LOCUS_09370 19490 17898 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097447.1 protein_id gnl|my_center|LOCUS_09370 19737 20423 gene locus_tag LOCUS_09380 19737 20423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 20509 21396 gene locus_tag LOCUS_09390 20509 21396 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176318.1 protein_id gnl|my_center|LOCUS_09390 22362 21403 gene locus_tag LOCUS_09400 22362 21403 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815364.1 protein_id gnl|my_center|LOCUS_09400 23143 22370 gene locus_tag LOCUS_09410 gene yaaA 23143 22370 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207208.1 protein_id gnl|my_center|LOCUS_09410 23220 23447 gene locus_tag LOCUS_09420 23220 23447 CDS product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367252.1 protein_id gnl|my_center|LOCUS_09420 23509 23949 gene locus_tag LOCUS_09430 23509 23949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 24152 25069 gene locus_tag LOCUS_09440 gene rnz 24152 25069 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098099.1 protein_id gnl|my_center|LOCUS_09440 26433 25276 gene locus_tag LOCUS_09450 gene argE 26433 25276 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099301.1 protein_id gnl|my_center|LOCUS_09450 26619 27242 gene locus_tag LOCUS_09460 26619 27242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 27607 28680 gene locus_tag LOCUS_09470 27607 28680 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099200.1 protein_id gnl|my_center|LOCUS_09470 28694 31489 gene locus_tag LOCUS_09480 gene rbbA 28694 31489 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149182.1 protein_id gnl|my_center|LOCUS_09480 31495 32625 gene locus_tag LOCUS_09490 31495 32625 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188525.1 protein_id gnl|my_center|LOCUS_09490 32697 33119 gene locus_tag LOCUS_09500 32697 33119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 33485 33859 gene locus_tag LOCUS_09510 33485 33859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 35153 33888 gene locus_tag LOCUS_09520 35153 33888 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946662.1 protein_id gnl|my_center|LOCUS_09520 35596 35153 gene locus_tag LOCUS_09530 gene umuD 35596 35153 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219995814.1 protein_id gnl|my_center|LOCUS_09530 36139 37227 gene locus_tag LOCUS_09540 36139 37227 CDS product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528865.1 protein_id gnl|my_center|LOCUS_09540 37227 37844 gene locus_tag LOCUS_09550 gene prfH 37227 37844 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602135.1 protein_id gnl|my_center|LOCUS_09550 38073 39602 gene locus_tag LOCUS_09560 38073 39602 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229234.1 protein_id gnl|my_center|LOCUS_09560 40042 39674 gene locus_tag LOCUS_09570 40042 39674 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316392.1 protein_id gnl|my_center|LOCUS_09570 40212 40682 gene locus_tag LOCUS_09580 40212 40682 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971989.1 protein_id gnl|my_center|LOCUS_09580 41195 41476 gene locus_tag LOCUS_09590 41195 41476 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361919.1 protein_id gnl|my_center|LOCUS_09590 41501 42871 gene locus_tag LOCUS_09600 41501 42871 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358211.1 protein_id gnl|my_center|LOCUS_09600 42990 43949 gene locus_tag LOCUS_09610 42990 43949 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520529.1 protein_id gnl|my_center|LOCUS_09610 43983 44843 gene locus_tag LOCUS_09620 43983 44843 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131850.1 protein_id gnl|my_center|LOCUS_09620 45335 46726 gene locus_tag LOCUS_09630 45335 46726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 46729 47754 gene locus_tag LOCUS_09640 46729 47754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 47769 48011 gene locus_tag LOCUS_09650 47769 48011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 49309 48101 gene locus_tag LOCUS_09660 49309 48101 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388621.1 protein_id gnl|my_center|LOCUS_09660 49444 50331 gene locus_tag LOCUS_09670 49444 50331 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388617.1 protein_id gnl|my_center|LOCUS_09670 52594 50381 gene locus_tag LOCUS_09680 52594 50381 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470621.1 protein_id gnl|my_center|LOCUS_09680 53414 53734 gene locus_tag LOCUS_09690 53414 53734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 54001 55083 gene locus_tag LOCUS_09700 54001 55083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 56477 58228 gene locus_tag LOCUS_09710 gene ybtP 56477 58228 CDS product yersiniabactin ABC transporter ATP-binding/permease protein YbtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640167.1 protein_id gnl|my_center|LOCUS_09710 58228 59985 gene locus_tag LOCUS_09720 gene ybtQ 58228 59985 CDS product yersiniabactin ABC transporter ATP-binding/permease protein YbtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654453.1 protein_id gnl|my_center|LOCUS_09720 60384 61562 gene locus_tag LOCUS_09730 60384 61562 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541054.1 protein_id gnl|my_center|LOCUS_09730 63089 62217 gene locus_tag LOCUS_09740 63089 62217 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614448.1 protein_id gnl|my_center|LOCUS_09740 64217 63534 gene locus_tag LOCUS_09750 64217 63534 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103807.1 protein_id gnl|my_center|LOCUS_09750 64528 65892 gene locus_tag LOCUS_09760 gene mdeA 64528 65892 CDS product multidrug efflux MFS transporter MdeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289367.1 protein_id gnl|my_center|LOCUS_09760 66507 66698 gene locus_tag LOCUS_09770 66507 66698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09770 66925 71595 gene locus_tag LOCUS_09780 66925 71595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 71759 71684 gene locus_tag LOCUS_t00170 71759 71684 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 71864 71777 gene locus_tag LOCUS_t00180 71864 71777 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 72638 72084 gene locus_tag LOCUS_09790 gene pgsA 72638 72084 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160187.1 protein_id gnl|my_center|LOCUS_09790 74581 72746 gene locus_tag LOCUS_09800 gene uvrC 74581 72746 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096027.1 protein_id gnl|my_center|LOCUS_09800 75260 74583 gene locus_tag LOCUS_09810 gene artM 75260 74583 CDS product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464490.1 protein_id gnl|my_center|LOCUS_09810 76034 75270 gene locus_tag LOCUS_09820 gene artQ 76034 75270 CDS product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001677.1 protein_id gnl|my_center|LOCUS_09820 76852 76118 gene locus_tag LOCUS_09830 gene artJ 76852 76118 CDS product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097361.1 protein_id gnl|my_center|LOCUS_09830 77667 76882 gene locus_tag LOCUS_09840 gene artP 77667 76882 CDS product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027186.1 protein_id gnl|my_center|LOCUS_09840 78580 77933 gene locus_tag LOCUS_09850 gene sanA 78580 77933 CDS product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211966.1 protein_id gnl|my_center|LOCUS_09850 79271 78582 gene locus_tag LOCUS_09860 79271 78582 CDS product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162334.1 protein_id gnl|my_center|LOCUS_09860 79711 79268 gene locus_tag LOCUS_09870 79711 79268 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211971.1 protein_id gnl|my_center|LOCUS_09870 81254 79818 gene locus_tag LOCUS_09880 gene sbcB 81254 79818 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211904.1 protein_id gnl|my_center|LOCUS_09880 81759 82238 gene locus_tag LOCUS_09890 81759 82238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 83453 82392 gene locus_tag LOCUS_09900 83453 82392 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089417.1 protein_id gnl|my_center|LOCUS_09900 84216 83710 gene locus_tag LOCUS_09910 84216 83710 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387097.1 protein_id gnl|my_center|LOCUS_09910 85845 84217 gene locus_tag LOCUS_09920 85845 84217 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215816.1 protein_id gnl|my_center|LOCUS_09920 85999 86691 gene locus_tag LOCUS_09930 gene recO 85999 86691 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209680.1 protein_id gnl|my_center|LOCUS_09930 87263 86763 gene locus_tag LOCUS_09940 87263 86763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 88675 87581 gene locus_tag LOCUS_09950 88675 87581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 88927 89871 gene locus_tag LOCUS_09960 88927 89871 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964762.1 protein_id gnl|my_center|LOCUS_09960 89923 91413 gene locus_tag LOCUS_09970 89923 91413 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582804.1 protein_id gnl|my_center|LOCUS_09970 91417 92433 gene locus_tag LOCUS_09980 91417 92433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978822.1 protein_id gnl|my_center|LOCUS_09980 92483 93889 gene locus_tag LOCUS_09990 92483 93889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058306008.1 protein_id gnl|my_center|LOCUS_09990 93882 94769 gene locus_tag LOCUS_10000 93882 94769 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789633.1 protein_id gnl|my_center|LOCUS_10000 95061 96986 gene locus_tag LOCUS_10010 gene thrS 95061 96986 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097005.1 protein_id gnl|my_center|LOCUS_10010 97083 97553 gene locus_tag LOCUS_10020 gene infC 97083 97553 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189469.1 protein_id gnl|my_center|LOCUS_10020 97637 97834 gene locus_tag LOCUS_10030 gene rpmI 97637 97834 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124225.1 protein_id gnl|my_center|LOCUS_10030 97866 98219 gene locus_tag LOCUS_10040 gene rplT 97866 98219 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211833.1 protein_id gnl|my_center|LOCUS_10040 98425 99408 gene locus_tag LOCUS_10050 gene pheS 98425 99408 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367044.1 protein_id gnl|my_center|LOCUS_10050 99425 101812 gene locus_tag LOCUS_10060 gene pheT 99425 101812 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672328.1 protein_id gnl|my_center|LOCUS_10060 101818 102111 gene locus_tag LOCUS_10070 gene ihfA 101818 102111 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097001.1 protein_id gnl|my_center|LOCUS_10070 102562 103431 gene locus_tag LOCUS_10080 gene htpX 102562 103431 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170215.1 protein_id gnl|my_center|LOCUS_10080 103530 105476 gene locus_tag LOCUS_10090 gene rlhA 103530 105476 CDS product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313806.1 protein_id gnl|my_center|LOCUS_10090 107511 107215 gene locus_tag LOCUS_10100 107511 107215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 108242 108955 gene locus_tag LOCUS_10110 108242 108955 CDS product FNR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211022.1 protein_id gnl|my_center|LOCUS_10110 109003 110061 gene locus_tag LOCUS_10120 gene ydgH 109003 110061 CDS product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769298.1 protein_id gnl|my_center|LOCUS_10120 113976 110107 gene locus_tag LOCUS_10130 gene hrpA 113976 110107 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420907.1 protein_id gnl|my_center|LOCUS_10130 114050 114469 gene locus_tag LOCUS_10140 gene hslJ 114050 114469 CDS product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296048.1 protein_id gnl|my_center|LOCUS_10140 114799 116211 gene locus_tag LOCUS_10150 gene pykF 114799 116211 CDS product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295403.1 protein_id gnl|my_center|LOCUS_10150 116325 118382 gene locus_tag LOCUS_10160 gene ppk1 116325 118382 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370393.1 protein_id gnl|my_center|LOCUS_10160 118394 119917 gene locus_tag LOCUS_10170 gene ppx 118394 119917 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072076535.1 protein_id gnl|my_center|LOCUS_10170 121446 119986 gene locus_tag LOCUS_10180 121446 119986 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818491.1 protein_id gnl|my_center|LOCUS_10180 122502 121525 gene locus_tag LOCUS_10190 122502 121525 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366796.1 protein_id gnl|my_center|LOCUS_10190 125289 122518 gene locus_tag LOCUS_10200 125289 122518 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097757.1 protein_id gnl|my_center|LOCUS_10200 125809 126858 gene locus_tag LOCUS_10210 125809 126858 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068709.1 protein_id gnl|my_center|LOCUS_10210 127300 126935 gene locus_tag LOCUS_10220 127300 126935 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355126.1 protein_id gnl|my_center|LOCUS_10220 127647 127931 gene locus_tag LOCUS_10230 127647 127931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 128304 128228 gene locus_tag LOCUS_t00190 128304 128228 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 129149 128418 gene locus_tag LOCUS_10240 gene dnaQ 129149 128418 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670675.1 protein_id gnl|my_center|LOCUS_10240 129324 129797 gene locus_tag LOCUS_10250 gene rnhA 129324 129797 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210699.1 protein_id gnl|my_center|LOCUS_10250 129870 130598 gene locus_tag LOCUS_10260 gene gloB 129870 130598 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210697.1 protein_id gnl|my_center|LOCUS_10260 130641 131900 gene locus_tag LOCUS_10270 gene mltD 130641 131900 CDS product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644685.1 protein_id gnl|my_center|LOCUS_10270 132660 131872 gene locus_tag LOCUS_10280 132660 131872 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230964.1 protein_id gnl|my_center|LOCUS_10280 134224 132653 gene locus_tag LOCUS_10290 gene gshA 134224 132653 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611791.1 protein_id gnl|my_center|LOCUS_10290 134962 134432 gene locus_tag LOCUS_10300 134962 134432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 137084 135942 gene locus_tag LOCUS_10310 gene rlmC 137084 135942 CDS product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149722.1 protein_id gnl|my_center|LOCUS_10310 137297 138085 gene locus_tag LOCUS_10320 gene map 137297 138085 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095652.1 protein_id gnl|my_center|LOCUS_10320 138279 138139 gene locus_tag LOCUS_10330 138279 138139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 139208 138339 gene locus_tag LOCUS_10340 gene cnoX 139208 138339 CDS product chaperedoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116065.1 protein_id gnl|my_center|LOCUS_10340 140006 139236 gene locus_tag LOCUS_10350 gene ybbO 140006 139236 CDS product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148920.1 protein_id gnl|my_center|LOCUS_10350 140108 140800 gene locus_tag LOCUS_10360 gene mtnN 140108 140800 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167232.1 protein_id gnl|my_center|LOCUS_10360 141953 140856 gene locus_tag LOCUS_10370 gene rnd 141953 140856 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169218.1 protein_id gnl|my_center|LOCUS_10370 142763 141978 gene locus_tag LOCUS_10380 142763 141978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10380 142873 143007 gene locus_tag LOCUS_10390 142873 143007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 143165 143935 gene locus_tag LOCUS_10400 gene cmoA 143165 143935 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211207.1 protein_id gnl|my_center|LOCUS_10400 143971 144939 gene locus_tag LOCUS_10410 gene cmoB 143971 144939 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569029.1 protein_id gnl|my_center|LOCUS_10410 146099 145194 gene locus_tag LOCUS_10420 146099 145194 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366366.1 protein_id gnl|my_center|LOCUS_10420 147179 146280 gene locus_tag LOCUS_10430 147179 146280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence07 4024 1889 gene locus_tag LOCUS_10440 4024 1889 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966626.1 protein_id gnl|my_center|LOCUS_10440 4241 5326 gene locus_tag LOCUS_10450 gene alr 4241 5326 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209096.1 protein_id gnl|my_center|LOCUS_10450 5329 6348 gene locus_tag LOCUS_10460 gene mltG 5329 6348 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693707.1 protein_id gnl|my_center|LOCUS_10460 7277 6411 gene locus_tag LOCUS_10470 7277 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 7462 7893 gene locus_tag LOCUS_10480 gene ppdD 7462 7893 CDS product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704409.1 protein_id gnl|my_center|LOCUS_10480 7921 9030 gene locus_tag LOCUS_10490 7921 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 9042 10211 gene locus_tag LOCUS_10500 gene hofC 9042 10211 CDS product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209321.1 protein_id gnl|my_center|LOCUS_10500 10211 10945 gene locus_tag LOCUS_10510 10211 10945 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490359.1 protein_id gnl|my_center|LOCUS_10510 11132 12298 gene locus_tag LOCUS_10520 11132 12298 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 protein_id gnl|my_center|LOCUS_10520 13253 12378 gene locus_tag LOCUS_10530 gene ygfZ 13253 12378 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886078.1 protein_id gnl|my_center|LOCUS_10530 13573 15291 gene locus_tag LOCUS_10540 gene ilvI 13573 15291 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425651.1 protein_id gnl|my_center|LOCUS_10540 15291 15785 gene locus_tag LOCUS_10550 gene ilvN 15291 15785 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210448.1 protein_id gnl|my_center|LOCUS_10550 15944 18112 gene locus_tag LOCUS_10560 15944 18112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 18188 20467 gene locus_tag LOCUS_10570 18188 20467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 20513 22807 gene locus_tag LOCUS_10580 20513 22807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 23009 24646 gene locus_tag LOCUS_10590 gene pyrG 23009 24646 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210863.1 protein_id gnl|my_center|LOCUS_10590 24693 25994 gene locus_tag LOCUS_10600 gene eno 24693 25994 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098515.1 protein_id gnl|my_center|LOCUS_10600 26237 27181 gene locus_tag LOCUS_10610 26237 27181 CDS product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097328.1 protein_id gnl|my_center|LOCUS_10610 27291 28199 gene locus_tag LOCUS_10620 27291 28199 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211358.1 protein_id gnl|my_center|LOCUS_10620 28673 30079 gene locus_tag LOCUS_10630 28673 30079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 30977 30459 gene locus_tag LOCUS_10640 30977 30459 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462102.1 protein_id gnl|my_center|LOCUS_10640 31853 31089 gene locus_tag LOCUS_10650 31853 31089 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797128.1 protein_id gnl|my_center|LOCUS_10650 33221 31866 gene locus_tag LOCUS_10660 33221 31866 CDS product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705374.1 protein_id gnl|my_center|LOCUS_10660 34219 33398 gene locus_tag LOCUS_10670 34219 33398 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705373.1 protein_id gnl|my_center|LOCUS_10670 35693 34302 gene locus_tag LOCUS_10680 gene ascB 35693 34302 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706100.1 protein_id gnl|my_center|LOCUS_10680 37592 35697 gene locus_tag LOCUS_10690 gene bglF 37592 35697 CDS product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137312.1 protein_id gnl|my_center|LOCUS_10690 38742 37771 gene locus_tag LOCUS_10700 gene licT 38742 37771 CDS product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 protein_id gnl|my_center|LOCUS_10700 40685 38811 gene locus_tag LOCUS_10710 gene htpG 40685 38811 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354670.1 protein_id gnl|my_center|LOCUS_10710 42295 40922 gene locus_tag LOCUS_10720 42295 40922 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 protein_id gnl|my_center|LOCUS_10720 42694 42901 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcactgccgtgtaggtagtttagaaa 42998 43285 gene locus_tag LOCUS_10730 42998 43285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 43423 44133 gene locus_tag LOCUS_10740 43423 44133 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815973.1 protein_id gnl|my_center|LOCUS_10740 44257 45720 gene locus_tag LOCUS_10750 gene guaB 44257 45720 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172545.1 protein_id gnl|my_center|LOCUS_10750 45958 46525 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcactgccgtgtaggtagtttagaaa 46743 48182 gene locus_tag LOCUS_10760 46743 48182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 49646 48717 gene locus_tag LOCUS_10770 49646 48717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 50054 51658 gene locus_tag LOCUS_10780 50054 51658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 53510 51873 gene locus_tag LOCUS_10790 gene pgm 53510 51873 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167960.1 protein_id gnl|my_center|LOCUS_10790 54092 53589 gene locus_tag LOCUS_10800 gene seqA 54092 53589 CDS product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097561.1 protein_id gnl|my_center|LOCUS_10800 54467 54946 gene locus_tag LOCUS_10810 gene slyB 54467 54946 CDS product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597196.1 protein_id gnl|my_center|LOCUS_10810 55176 55583 gene locus_tag LOCUS_10820 gene gloA 55176 55583 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210948.1 protein_id gnl|my_center|LOCUS_10820 56314 55634 gene locus_tag LOCUS_10830 gene gmk 56314 55634 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094883.1 protein_id gnl|my_center|LOCUS_10830 56496 57191 gene locus_tag LOCUS_10840 56496 57191 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732337.1 protein_id gnl|my_center|LOCUS_10840 57188 57511 gene locus_tag LOCUS_10850 57188 57511 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721948.1 protein_id gnl|my_center|LOCUS_10850 58467 57568 gene locus_tag LOCUS_10860 58467 57568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 59891 58479 gene locus_tag LOCUS_10870 gene hemX 59891 58479 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420796.1 protein_id gnl|my_center|LOCUS_10870 60641 59901 gene locus_tag LOCUS_10880 gene hemD 60641 59901 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211464.1 protein_id gnl|my_center|LOCUS_10880 61558 60638 gene locus_tag LOCUS_10890 gene hemC 61558 60638 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073972.1 protein_id gnl|my_center|LOCUS_10890 63147 61780 gene locus_tag LOCUS_10900 gene purB 63147 61780 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423729.1 protein_id gnl|my_center|LOCUS_10900 63827 63189 gene locus_tag LOCUS_10910 gene hflD 63827 63189 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170635.1 protein_id gnl|my_center|LOCUS_10910 64947 63829 gene locus_tag LOCUS_10920 gene mnmA 64947 63829 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210913.1 protein_id gnl|my_center|LOCUS_10920 65858 65172 gene locus_tag LOCUS_10930 65858 65172 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070966.1 protein_id gnl|my_center|LOCUS_10930 66013 66240 gene locus_tag LOCUS_10940 66013 66240 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193665.1 protein_id gnl|my_center|LOCUS_10940 67090 66326 gene locus_tag LOCUS_10950 gene tpiA 67090 66326 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175887.1 protein_id gnl|my_center|LOCUS_10950 67191 67436 gene locus_tag LOCUS_10960 67191 67436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 67513 68814 gene locus_tag LOCUS_10970 67513 68814 CDS product DUF2868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763651.1 protein_id gnl|my_center|LOCUS_10970 68816 70174 gene locus_tag LOCUS_10980 68816 70174 CDS product GTPase/DUF3482 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269201.1 protein_id gnl|my_center|LOCUS_10980 70122 70646 gene locus_tag LOCUS_10990 70122 70646 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367031.1 protein_id gnl|my_center|LOCUS_10990 74335 70793 gene locus_tag LOCUS_11000 gene nifJ 74335 70793 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816353.1 protein_id gnl|my_center|LOCUS_11000 75686 74649 gene locus_tag LOCUS_11010 gene purM 75686 74649 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295474.1 protein_id gnl|my_center|LOCUS_11010 76197 75778 gene locus_tag LOCUS_11020 gene ruvX 76197 75778 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157116.1 protein_id gnl|my_center|LOCUS_11020 76758 76201 gene locus_tag LOCUS_11030 76758 76201 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817044.1 protein_id gnl|my_center|LOCUS_11030 77231 76779 gene locus_tag LOCUS_11040 77231 76779 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964777.1 protein_id gnl|my_center|LOCUS_11040 78190 77234 gene locus_tag LOCUS_11050 gene gshB 78190 77234 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703453.1 protein_id gnl|my_center|LOCUS_11050 79129 78404 gene locus_tag LOCUS_11060 gene rsmE 79129 78404 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461719.1 protein_id gnl|my_center|LOCUS_11060 79216 79596 gene locus_tag LOCUS_11070 gene folB 79216 79596 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295541.1 protein_id gnl|my_center|LOCUS_11070 79616 80635 gene locus_tag LOCUS_11080 79616 80635 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096126.1 protein_id gnl|my_center|LOCUS_11080 80686 80892 gene locus_tag LOCUS_11090 80686 80892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 80894 81322 gene locus_tag LOCUS_11100 80894 81322 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167964.1 protein_id gnl|my_center|LOCUS_11100 82540 81314 gene locus_tag LOCUS_11110 gene moeA 82540 81314 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397358.1 protein_id gnl|my_center|LOCUS_11110 83774 82683 gene locus_tag LOCUS_11120 gene ychF 83774 82683 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505866.1 protein_id gnl|my_center|LOCUS_11120 84773 83946 gene locus_tag LOCUS_11130 gene rsmI 84773 83946 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098896.1 protein_id gnl|my_center|LOCUS_11130 85129 86142 gene locus_tag LOCUS_11140 gene nlpD 85129 86142 CDS product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272592.1 protein_id gnl|my_center|LOCUS_11140 86265 87017 gene locus_tag LOCUS_11150 gene gpmA 86265 87017 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159006.1 protein_id gnl|my_center|LOCUS_11150 87106 87681 gene locus_tag LOCUS_11160 87106 87681 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334933.1 protein_id gnl|my_center|LOCUS_11160 87732 88940 gene locus_tag LOCUS_11170 87732 88940 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096422.1 protein_id gnl|my_center|LOCUS_11170 89103 89696 gene locus_tag LOCUS_11180 89103 89696 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225832.1 protein_id gnl|my_center|LOCUS_11180 89701 90141 gene locus_tag LOCUS_11190 89701 90141 CDS product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080672.1 protein_id gnl|my_center|LOCUS_11190 90614 90213 gene locus_tag LOCUS_11200 90614 90213 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208261.1 protein_id gnl|my_center|LOCUS_11200 91892 91311 gene locus_tag LOCUS_11210 gene pdxT 91892 91311 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932189.1 protein_id gnl|my_center|LOCUS_11210 92773 91892 gene locus_tag LOCUS_11220 gene pdxS 92773 91892 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247145.1 protein_id gnl|my_center|LOCUS_11220 92918 94318 gene locus_tag LOCUS_11230 92918 94318 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925710.1 protein_id gnl|my_center|LOCUS_11230 94354 95574 gene locus_tag LOCUS_11240 94354 95574 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521075.1 protein_id gnl|my_center|LOCUS_11240 96389 95637 gene locus_tag LOCUS_11250 96389 95637 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894191.1 protein_id gnl|my_center|LOCUS_11250 96605 97495 gene locus_tag LOCUS_11260 96605 97495 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117946.1 protein_id gnl|my_center|LOCUS_11260 97773 98042 gene locus_tag LOCUS_11270 97773 98042 CDS product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680497.1 protein_id gnl|my_center|LOCUS_11270 98538 98771 gene locus_tag LOCUS_11280 98538 98771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 98910 99491 gene locus_tag LOCUS_11290 98910 99491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 100710 99718 gene locus_tag LOCUS_11300 gene asnA 100710 99718 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845133.1 protein_id gnl|my_center|LOCUS_11300 101868 103166 gene locus_tag LOCUS_11310 101868 103166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 103541 103868 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcactgccgtgtaggcagtttagaaa 104960 103911 gene locus_tag LOCUS_11320 gene allD 104960 103911 CDS product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703940.1 protein_id gnl|my_center|LOCUS_11320 105911 105009 gene locus_tag LOCUS_11330 105911 105009 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855391.1 protein_id gnl|my_center|LOCUS_11330 106717 105938 gene locus_tag LOCUS_11340 gene allE 106717 105938 CDS product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540997.1 protein_id gnl|my_center|LOCUS_11340 108066 106834 gene locus_tag LOCUS_11350 108066 106834 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378762.1 protein_id gnl|my_center|LOCUS_11350 109305 108079 gene locus_tag LOCUS_11360 gene allC 109305 108079 CDS product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301887.1 protein_id gnl|my_center|LOCUS_11360 109706 111373 gene locus_tag LOCUS_11370 109706 111373 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580880.1 protein_id gnl|my_center|LOCUS_11370 111385 112644 gene locus_tag LOCUS_11380 111385 112644 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495367.1 protein_id gnl|my_center|LOCUS_11380 112648 113586 gene locus_tag LOCUS_11390 112648 113586 CDS product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152513.1 protein_id gnl|my_center|LOCUS_11390 113590 114513 gene locus_tag LOCUS_11400 gene allS 113590 114513 CDS product HTH-type transcriptional activator AllS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460148.1 protein_id gnl|my_center|LOCUS_11400 114564 115796 gene locus_tag LOCUS_11410 114564 115796 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419062.1 protein_id gnl|my_center|LOCUS_11410 116118 117395 gene locus_tag LOCUS_11420 116118 117395 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807816.1 protein_id gnl|my_center|LOCUS_11420 118431 118015 gene locus_tag LOCUS_11430 118431 118015 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705503.1 protein_id gnl|my_center|LOCUS_11430 119247 118483 gene locus_tag LOCUS_11440 119247 118483 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705502.1 protein_id gnl|my_center|LOCUS_11440 119618 120634 gene locus_tag LOCUS_11450 119618 120634 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176203.1 protein_id gnl|my_center|LOCUS_11450 120660 122525 gene locus_tag LOCUS_11460 120660 122525 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966460.1 protein_id gnl|my_center|LOCUS_11460 122722 123768 gene locus_tag LOCUS_11470 122722 123768 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047080945.1 protein_id gnl|my_center|LOCUS_11470 124024 124806 gene locus_tag LOCUS_11480 124024 124806 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705157.1 protein_id gnl|my_center|LOCUS_11480 124819 125580 gene locus_tag LOCUS_11490 124819 125580 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705158.1 protein_id gnl|my_center|LOCUS_11490 125567 126289 gene locus_tag LOCUS_11500 125567 126289 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705159.1 protein_id gnl|my_center|LOCUS_11500 127604 126393 gene locus_tag LOCUS_11510 gene fabB 127604 126393 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706178.1 protein_id gnl|my_center|LOCUS_11510 127913 129181 gene locus_tag LOCUS_11520 127913 129181 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764634.1 protein_id gnl|my_center|LOCUS_11520 129185 129976 gene locus_tag LOCUS_11530 129185 129976 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109278.1 protein_id gnl|my_center|LOCUS_11530 130775 130038 gene locus_tag LOCUS_11540 gene mlaA 130775 130038 CDS product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365533.1 protein_id gnl|my_center|LOCUS_11540 130923 130996 gene locus_tag LOCUS_t00200 130923 130996 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 132939 132196 gene locus_tag LOCUS_11550 132939 132196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 134585 134004 gene locus_tag LOCUS_11560 134585 134004 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954203.1 protein_id gnl|my_center|LOCUS_11560 135716 136381 gene locus_tag LOCUS_11570 135716 136381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 136383 136715 gene locus_tag LOCUS_11580 136383 136715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 136811 137002 gene locus_tag LOCUS_11590 136811 137002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 137294 137218 gene locus_tag LOCUS_t00210 137294 137218 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 137596 139425 gene locus_tag LOCUS_11600 gene recQ 137596 139425 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211484.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence08 84 1334 gene locus_tag LOCUS_11610 84 1334 CDS product oligosaccharide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197025.1 protein_id gnl|my_center|LOCUS_11610 1393 2511 gene locus_tag LOCUS_11620 1393 2511 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_11620 2527 3525 gene locus_tag LOCUS_11630 2527 3525 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096553.1 protein_id gnl|my_center|LOCUS_11630 4039 3557 gene locus_tag LOCUS_11640 gene smpB 4039 3557 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162574.1 protein_id gnl|my_center|LOCUS_11640 4105 4533 gene locus_tag LOCUS_11650 4105 4533 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815744.1 protein_id gnl|my_center|LOCUS_11650 4535 4804 gene locus_tag LOCUS_11660 4535 4804 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649214.1 protein_id gnl|my_center|LOCUS_11660 4828 5262 gene locus_tag LOCUS_11670 gene zur 4828 5262 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174547.1 protein_id gnl|my_center|LOCUS_11670 5250 5606 gene locus_tag LOCUS_11680 5250 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 5606 5989 gene locus_tag LOCUS_11690 5606 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 6374 6138 gene locus_tag LOCUS_11700 6374 6138 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002246537.1 protein_id gnl|my_center|LOCUS_11700 7144 6740 gene locus_tag LOCUS_11710 gene mutT 7144 6740 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210424.1 protein_id gnl|my_center|LOCUS_11710 9994 7262 gene locus_tag LOCUS_11720 gene secA 9994 7262 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905780.1 protein_id gnl|my_center|LOCUS_11720 10419 10075 gene locus_tag LOCUS_11730 10419 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 12355 10808 gene locus_tag LOCUS_11740 gene cueO 12355 10808 CDS product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858205.1 protein_id gnl|my_center|LOCUS_11740 12864 12490 gene locus_tag LOCUS_11750 12864 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 13582 14646 gene locus_tag LOCUS_11760 13582 14646 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704825.1 protein_id gnl|my_center|LOCUS_11760 14652 15152 gene locus_tag LOCUS_11770 gene folA 14652 15152 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080544.1 protein_id gnl|my_center|LOCUS_11770 17456 15198 gene locus_tag LOCUS_11780 17456 15198 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226815.1 protein_id gnl|my_center|LOCUS_11780 18795 17467 gene locus_tag LOCUS_11790 gene rlmD 18795 17467 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046827.1 protein_id gnl|my_center|LOCUS_11790 19301 18813 gene locus_tag LOCUS_11800 gene coaD 19301 18813 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171879.1 protein_id gnl|my_center|LOCUS_11800 19466 20530 gene locus_tag LOCUS_11810 19466 20530 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974938.1 protein_id gnl|my_center|LOCUS_11810 21669 20665 gene locus_tag LOCUS_11820 gene galM 21669 20665 CDS product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168049.1 protein_id gnl|my_center|LOCUS_11820 22817 21660 gene locus_tag LOCUS_11830 gene galK 22817 21660 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097521.1 protein_id gnl|my_center|LOCUS_11830 23867 22818 gene locus_tag LOCUS_11840 gene galT 23867 22818 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191517.1 protein_id gnl|my_center|LOCUS_11840 24934 23918 gene locus_tag LOCUS_11850 gene galE 24934 23918 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210750.1 protein_id gnl|my_center|LOCUS_11850 26252 24978 gene locus_tag LOCUS_11860 gene lacY 26252 24978 CDS product lactose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291553.1 protein_id gnl|my_center|LOCUS_11860 28268 27108 gene locus_tag LOCUS_11870 gene agp 28268 27108 CDS product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704989.1 protein_id gnl|my_center|LOCUS_11870 28990 28265 gene locus_tag LOCUS_11880 gene nfsA 28990 28265 CDS product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704853.1 protein_id gnl|my_center|LOCUS_11880 29709 29008 gene locus_tag LOCUS_11890 gene trmB 29709 29008 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927735.1 protein_id gnl|my_center|LOCUS_11890 29967 30914 gene locus_tag LOCUS_11900 gene prs 29967 30914 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211240.1 protein_id gnl|my_center|LOCUS_11900 30990 31574 gene locus_tag LOCUS_11910 gene pth 30990 31574 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096226.1 protein_id gnl|my_center|LOCUS_11910 32149 31673 gene locus_tag LOCUS_11920 32149 31673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 33916 32735 gene locus_tag LOCUS_11930 gene uxuA 33916 32735 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171409.1 protein_id gnl|my_center|LOCUS_11930 34755 33994 gene locus_tag LOCUS_11940 34755 33994 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477441.1 protein_id gnl|my_center|LOCUS_11940 35036 36505 gene locus_tag LOCUS_11950 35036 36505 CDS product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815994.1 protein_id gnl|my_center|LOCUS_11950 37346 37807 gene locus_tag LOCUS_11960 37346 37807 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004705424.1 protein_id gnl|my_center|LOCUS_11960 37868 38272 gene locus_tag LOCUS_11970 gene zapG 37868 38272 CDS product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162428.1 protein_id gnl|my_center|LOCUS_11970 38353 39729 gene locus_tag LOCUS_11980 gene degQ 38353 39729 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817258.1 protein_id gnl|my_center|LOCUS_11980 39847 40899 gene locus_tag LOCUS_11990 gene degS 39847 40899 CDS product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210128.1 protein_id gnl|my_center|LOCUS_11990 41043 41258 gene locus_tag LOCUS_12000 gene rpmE 41043 41258 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216737.1 protein_id gnl|my_center|LOCUS_12000 41680 41366 gene locus_tag LOCUS_12010 gene metJ 41680 41366 CDS product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004107547.1 protein_id gnl|my_center|LOCUS_12010 41860 43026 gene locus_tag LOCUS_12020 gene metB 41860 43026 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815294.1 protein_id gnl|my_center|LOCUS_12020 43655 43110 gene locus_tag LOCUS_12030 gene citX 43655 43110 CDS product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679050.1 protein_id gnl|my_center|LOCUS_12030 45263 43734 gene locus_tag LOCUS_12040 gene citF 45263 43734 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098680.1 protein_id gnl|my_center|LOCUS_12040 46163 45276 gene locus_tag LOCUS_12050 gene citE 46163 45276 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098681.1 protein_id gnl|my_center|LOCUS_12050 46450 46160 gene locus_tag LOCUS_12060 gene citD 46450 46160 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098682.1 protein_id gnl|my_center|LOCUS_12060 47506 46472 gene locus_tag LOCUS_12070 gene citC 47506 46472 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816655.1 protein_id gnl|my_center|LOCUS_12070 48356 47511 gene locus_tag LOCUS_12080 48356 47511 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098684.1 protein_id gnl|my_center|LOCUS_12080 49871 48450 gene locus_tag LOCUS_12090 49871 48450 CDS product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098685.1 protein_id gnl|my_center|LOCUS_12090 50056 51645 gene locus_tag LOCUS_12100 50056 51645 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098686.1 protein_id gnl|my_center|LOCUS_12100 51663 52373 gene locus_tag LOCUS_12110 51663 52373 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098687.1 protein_id gnl|my_center|LOCUS_12110 52534 53499 gene locus_tag LOCUS_12120 52534 53499 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079769.1 protein_id gnl|my_center|LOCUS_12120 53523 54263 gene locus_tag LOCUS_12130 53523 54263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 54260 55018 gene locus_tag LOCUS_12140 54260 55018 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893523.1 protein_id gnl|my_center|LOCUS_12140 55036 55461 gene locus_tag LOCUS_12150 55036 55461 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083908.1 protein_id gnl|my_center|LOCUS_12150 55516 56337 gene locus_tag LOCUS_12160 55516 56337 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255024.1 protein_id gnl|my_center|LOCUS_12160 56576 56355 gene locus_tag LOCUS_12170 56576 56355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12170 57125 57988 gene locus_tag LOCUS_12180 57125 57988 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964070.1 protein_id gnl|my_center|LOCUS_12180 57985 59124 gene locus_tag LOCUS_12190 57985 59124 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638288.1 protein_id gnl|my_center|LOCUS_12190 60586 59183 gene locus_tag LOCUS_12200 60586 59183 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379465.1 protein_id gnl|my_center|LOCUS_12200 62453 60597 gene locus_tag LOCUS_12210 62453 60597 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437576.1 protein_id gnl|my_center|LOCUS_12210 62719 63879 gene locus_tag LOCUS_12220 62719 63879 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860963.1 protein_id gnl|my_center|LOCUS_12220 64870 63983 gene locus_tag LOCUS_12230 gene citG 64870 63983 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103241.1 protein_id gnl|my_center|LOCUS_12230 67969 64982 gene locus_tag LOCUS_12240 67969 64982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 68597 68076 gene locus_tag LOCUS_12250 68597 68076 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948274.1 protein_id gnl|my_center|LOCUS_12250 69844 68600 gene locus_tag LOCUS_12260 69844 68600 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079955.1 protein_id gnl|my_center|LOCUS_12260 70685 69990 gene locus_tag LOCUS_12270 gene rsuA 70685 69990 CDS product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208832.1 protein_id gnl|my_center|LOCUS_12270 71437 70706 gene locus_tag LOCUS_12280 gene rsmJ 71437 70706 CDS product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165126.1 protein_id gnl|my_center|LOCUS_12280 73451 71424 gene locus_tag LOCUS_12290 gene prlC 73451 71424 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309824.1 protein_id gnl|my_center|LOCUS_12290 73801 73544 gene locus_tag LOCUS_12300 gene ibaG 73801 73544 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162441.1 protein_id gnl|my_center|LOCUS_12300 74167 73895 gene locus_tag LOCUS_12310 gene mlaB 74167 73895 CDS product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210125.1 protein_id gnl|my_center|LOCUS_12310 74815 74183 gene locus_tag LOCUS_12320 gene mlaC 74815 74183 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476484.1 protein_id gnl|my_center|LOCUS_12320 75405 74818 gene locus_tag LOCUS_12330 gene mlaD 75405 74818 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098934.1 protein_id gnl|my_center|LOCUS_12330 76196 75417 gene locus_tag LOCUS_12340 gene mlaE 76196 75417 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174247.1 protein_id gnl|my_center|LOCUS_12340 77011 76196 gene locus_tag LOCUS_12350 gene mlaF 77011 76196 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032898349.1 protein_id gnl|my_center|LOCUS_12350 78018 77311 gene locus_tag LOCUS_12360 78018 77311 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084191.1 protein_id gnl|my_center|LOCUS_12360 79062 78019 gene locus_tag LOCUS_12370 79062 78019 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817462.1 protein_id gnl|my_center|LOCUS_12370 80216 79062 gene locus_tag LOCUS_12380 80216 79062 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705543.1 protein_id gnl|my_center|LOCUS_12380 80401 81249 gene locus_tag LOCUS_12390 80401 81249 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225833.1 protein_id gnl|my_center|LOCUS_12390 81648 81313 gene locus_tag LOCUS_12400 81648 81313 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224094.1 protein_id gnl|my_center|LOCUS_12400 84421 81788 gene locus_tag LOCUS_12410 gene pepN 84421 81788 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193813.1 protein_id gnl|my_center|LOCUS_12410 84580 85773 gene locus_tag LOCUS_12420 gene pncB 84580 85773 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816044.1 protein_id gnl|my_center|LOCUS_12420 85924 87327 gene locus_tag LOCUS_12430 gene asnS 85924 87327 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117881.1 protein_id gnl|my_center|LOCUS_12430 87628 88779 gene locus_tag LOCUS_12440 gene ompF 87628 88779 CDS product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162928777.1 protein_id gnl|my_center|LOCUS_12440 89086 90225 gene locus_tag LOCUS_12450 gene ompN 89086 90225 CDS product porin OmpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837937.1 protein_id gnl|my_center|LOCUS_12450 90364 90822 gene locus_tag LOCUS_12460 gene mgsA 90364 90822 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386685.1 protein_id gnl|my_center|LOCUS_12460 90823 92034 gene locus_tag LOCUS_12470 gene mdtH 90823 92034 CDS product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816537.1 protein_id gnl|my_center|LOCUS_12470 92791 92012 gene locus_tag LOCUS_12480 92791 92012 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333380.1 protein_id gnl|my_center|LOCUS_12480 93371 92793 gene locus_tag LOCUS_12490 gene lpcA 93371 92793 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095727.1 protein_id gnl|my_center|LOCUS_12490 93752 94222 gene locus_tag LOCUS_12500 gene ribE 93752 94222 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208666.1 protein_id gnl|my_center|LOCUS_12500 94227 94646 gene locus_tag LOCUS_12510 gene nusB 94227 94646 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166503.1 protein_id gnl|my_center|LOCUS_12510 94668 95717 gene locus_tag LOCUS_12520 94668 95717 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167464.1 protein_id gnl|my_center|LOCUS_12520 95881 96816 gene locus_tag LOCUS_12530 95881 96816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 96879 97655 gene locus_tag LOCUS_12540 gene ubiE 96879 97655 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416847.1 protein_id gnl|my_center|LOCUS_12540 97670 99211 gene locus_tag LOCUS_12550 gene ubiB 97670 99211 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099239.1 protein_id gnl|my_center|LOCUS_12550 99280 99495 gene locus_tag LOCUS_12560 99280 99495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 99499 99840 gene locus_tag LOCUS_12570 99499 99840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 99837 100610 gene locus_tag LOCUS_12580 gene tatC 99837 100610 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694099.1 protein_id gnl|my_center|LOCUS_12580 100658 102082 gene locus_tag LOCUS_12590 gene hldE 100658 102082 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212193.1 protein_id gnl|my_center|LOCUS_12590 102371 103723 gene locus_tag LOCUS_12600 gene gorA 102371 103723 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703747.1 protein_id gnl|my_center|LOCUS_12600 105169 103820 gene locus_tag LOCUS_12610 105169 103820 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104851.1 protein_id gnl|my_center|LOCUS_12610 105360 105947 gene locus_tag LOCUS_12620 105360 105947 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694489.1 protein_id gnl|my_center|LOCUS_12620 105947 106546 gene locus_tag LOCUS_12630 105947 106546 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723344.1 protein_id gnl|my_center|LOCUS_12630 106672 108033 gene locus_tag LOCUS_12640 gene mnmE 106672 108033 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282357.1 protein_id gnl|my_center|LOCUS_12640 109884 108460 gene locus_tag LOCUS_12650 109884 108460 CDS product multidrug efflux MFS transporter NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722177.1 protein_id gnl|my_center|LOCUS_12650 111072 109900 gene locus_tag LOCUS_12660 111072 109900 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366269.1 protein_id gnl|my_center|LOCUS_12660 112043 111471 gene locus_tag LOCUS_12670 gene kptA 112043 111471 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151854.1 protein_id gnl|my_center|LOCUS_12670 112761 113006 gene locus_tag LOCUS_12680 112761 113006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 113410 113745 gene locus_tag LOCUS_12690 113410 113745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 113735 114025 gene locus_tag LOCUS_12700 113735 114025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 114258 114632 gene locus_tag LOCUS_12710 114258 114632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 114900 115085 gene locus_tag LOCUS_12720 114900 115085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 115087 115419 gene locus_tag LOCUS_12730 115087 115419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170022.1 protein_id gnl|my_center|LOCUS_12730 115490 115876 gene locus_tag LOCUS_12740 115490 115876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 115896 116051 gene locus_tag LOCUS_12750 115896 116051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 116041 116523 gene locus_tag LOCUS_12760 116041 116523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 116672 117061 gene locus_tag LOCUS_12770 116672 117061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 117325 117741 gene locus_tag LOCUS_12780 117325 117741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 117825 118400 gene locus_tag LOCUS_12790 117825 118400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 118428 118610 gene locus_tag LOCUS_12800 118428 118610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 118740 119222 gene locus_tag LOCUS_12810 118740 119222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 119502 119266 gene locus_tag LOCUS_12820 119502 119266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 119594 119755 gene locus_tag LOCUS_12830 119594 119755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence09 314 862 gene locus_tag LOCUS_12840 314 862 CDS product NADAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_12840 1720 926 gene locus_tag LOCUS_12850 1720 926 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039425.1 protein_id gnl|my_center|LOCUS_12850 2666 1713 gene locus_tag LOCUS_12860 2666 1713 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092881.1 protein_id gnl|my_center|LOCUS_12860 3702 2725 gene locus_tag LOCUS_12870 3702 2725 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092876.1 protein_id gnl|my_center|LOCUS_12870 4883 3927 gene locus_tag LOCUS_12880 4883 3927 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092876.1 protein_id gnl|my_center|LOCUS_12880 5975 5067 gene locus_tag LOCUS_12890 gene fdhE 5975 5067 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368963.1 protein_id gnl|my_center|LOCUS_12890 6773 6078 gene locus_tag LOCUS_12900 gene fdnI 6773 6078 CDS product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705520.1 protein_id gnl|my_center|LOCUS_12900 7740 6766 gene locus_tag LOCUS_12910 gene fdnH 7740 6766 CDS product formate dehydrogenase N subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240581.1 protein_id gnl|my_center|LOCUS_12910 10828 7760 gene locus_tag LOCUS_12920 gene fdnG 10828 7760 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830448.1 protein_id gnl|my_center|LOCUS_12920 13570 11141 gene locus_tag LOCUS_12930 gene plsB 13570 11141 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108900543.1 protein_id gnl|my_center|LOCUS_12930 14755 13991 gene locus_tag LOCUS_12940 gene aroD 14755 13991 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860178.1 protein_id gnl|my_center|LOCUS_12940 15735 14863 gene locus_tag LOCUS_12950 15735 14863 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704391.1 protein_id gnl|my_center|LOCUS_12950 16629 17912 gene locus_tag LOCUS_12960 16629 17912 CDS product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113382.1 protein_id gnl|my_center|LOCUS_12960 17948 19240 gene locus_tag LOCUS_12970 gene rsmB 17948 19240 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817317.1 protein_id gnl|my_center|LOCUS_12970 19836 19294 gene locus_tag LOCUS_12980 19836 19294 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206335.1 protein_id gnl|my_center|LOCUS_12980 19959 20300 gene locus_tag LOCUS_12990 19959 20300 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206336.1 protein_id gnl|my_center|LOCUS_12990 21551 20826 gene locus_tag LOCUS_13000 21551 20826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 22444 21863 gene locus_tag LOCUS_13010 22444 21863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 22692 22501 gene locus_tag LOCUS_13020 22692 22501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 23281 22700 gene locus_tag LOCUS_13030 23281 22700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 24046 23465 gene locus_tag LOCUS_13040 24046 23465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 25052 24327 gene locus_tag LOCUS_13050 25052 24327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 25177 25055 gene locus_tag LOCUS_13060 25177 25055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 26000 25233 gene locus_tag LOCUS_13070 26000 25233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 29293 26009 gene locus_tag LOCUS_13080 29293 26009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 30053 31027 gene locus_tag LOCUS_13090 gene serB 30053 31027 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166929.1 protein_id gnl|my_center|LOCUS_13090 31037 32413 gene locus_tag LOCUS_13100 gene radA 31037 32413 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005053736.1 protein_id gnl|my_center|LOCUS_13100 33865 32489 gene locus_tag LOCUS_13110 gene ppnN 33865 32489 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369952.1 protein_id gnl|my_center|LOCUS_13110 34130 34543 gene locus_tag LOCUS_13120 34130 34543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 34697 35713 gene locus_tag LOCUS_13130 gene moaA 34697 35713 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168084.1 protein_id gnl|my_center|LOCUS_13130 36583 35693 gene locus_tag LOCUS_13140 gene gluQRS 36583 35693 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937424.1 protein_id gnl|my_center|LOCUS_13140 37073 36618 gene locus_tag LOCUS_13150 gene dksA 37073 36618 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209354.1 protein_id gnl|my_center|LOCUS_13150 37749 37210 gene locus_tag LOCUS_13160 gene folK 37749 37210 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209351.1 protein_id gnl|my_center|LOCUS_13160 37905 39260 gene locus_tag LOCUS_13170 37905 39260 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243743.1 protein_id gnl|my_center|LOCUS_13170 40056 39304 gene locus_tag LOCUS_13180 40056 39304 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243284.1 protein_id gnl|my_center|LOCUS_13180 40739 40068 gene locus_tag LOCUS_13190 40739 40068 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243465.1 protein_id gnl|my_center|LOCUS_13190 41518 40736 gene locus_tag LOCUS_13200 41518 40736 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227109.1 protein_id gnl|my_center|LOCUS_13200 42039 41515 gene locus_tag LOCUS_13210 gene snaB 42039 41515 CDS product sulfur-containing aminoacid acetyltransferase SnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242734.1 protein_id gnl|my_center|LOCUS_13210 43397 42036 gene locus_tag LOCUS_13220 gene purB 43397 42036 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857989.1 protein_id gnl|my_center|LOCUS_13220 44876 43701 gene locus_tag LOCUS_13230 gene aspC 44876 43701 CDS product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462668.1 protein_id gnl|my_center|LOCUS_13230 45548 45015 gene locus_tag LOCUS_13240 gene syd 45548 45015 CDS product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342432.1 protein_id gnl|my_center|LOCUS_13240 46296 49001 gene locus_tag LOCUS_13250 gene rne 46296 49001 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868984.1 protein_id gnl|my_center|LOCUS_13250 49080 50015 gene locus_tag LOCUS_13260 gene sapB 49080 50015 CDS product putrescine ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169521.1 protein_id gnl|my_center|LOCUS_13260 50008 50868 gene locus_tag LOCUS_13270 gene sapC 50008 50868 CDS product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947601.1 protein_id gnl|my_center|LOCUS_13270 50871 51860 gene locus_tag LOCUS_13280 gene sapD 50871 51860 CDS product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169513.1 protein_id gnl|my_center|LOCUS_13280 51880 52692 gene locus_tag LOCUS_13290 gene sapF 51880 52692 CDS product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210969.1 protein_id gnl|my_center|LOCUS_13290 52910 53842 gene locus_tag LOCUS_13300 gene metA 52910 53842 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368802.1 protein_id gnl|my_center|LOCUS_13300 54267 54419 gene locus_tag LOCUS_13310 54267 54419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 55376 57025 gene locus_tag LOCUS_13320 gene pgi 55376 57025 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789986.1 protein_id gnl|my_center|LOCUS_13320 57618 57115 gene locus_tag LOCUS_13330 gene crr 57618 57115 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522248.1 protein_id gnl|my_center|LOCUS_13330 59355 57628 gene locus_tag LOCUS_13340 gene ptsI 59355 57628 CDS product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208490.1 protein_id gnl|my_center|LOCUS_13340 59664 59407 gene locus_tag LOCUS_13350 gene ptsH 59664 59407 CDS product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164859.1 protein_id gnl|my_center|LOCUS_13350 60157 59804 gene locus_tag LOCUS_13360 60157 59804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 60281 60823 gene locus_tag LOCUS_13370 60281 60823 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027229.1 protein_id gnl|my_center|LOCUS_13370 60861 62174 gene locus_tag LOCUS_13380 gene pepP 60861 62174 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290127.1 protein_id gnl|my_center|LOCUS_13380 63058 62255 gene locus_tag LOCUS_13390 63058 62255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 63201 64187 gene locus_tag LOCUS_13400 gene ispB 63201 64187 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175409.1 protein_id gnl|my_center|LOCUS_13400 64314 65186 gene locus_tag LOCUS_13410 gene rhtA 64314 65186 CDS product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268284.1 protein_id gnl|my_center|LOCUS_13410 66644 65277 gene locus_tag LOCUS_13420 gene ffh 66644 65277 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167432.1 protein_id gnl|my_center|LOCUS_13420 66835 67218 gene locus_tag LOCUS_13430 gene ridA 66835 67218 CDS product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047539.1 protein_id gnl|my_center|LOCUS_13430 67485 68678 gene locus_tag LOCUS_13440 gene tyrB 67485 68678 CDS product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486946.1 protein_id gnl|my_center|LOCUS_13440 68704 68853 gene locus_tag LOCUS_13450 68704 68853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 68893 69393 gene locus_tag LOCUS_13460 68893 69393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 69775 70689 gene locus_tag LOCUS_13470 gene galU 69775 70689 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419830.1 protein_id gnl|my_center|LOCUS_13470 72178 70757 gene locus_tag LOCUS_13480 72178 70757 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861591.1 protein_id gnl|my_center|LOCUS_13480 73652 72321 gene locus_tag LOCUS_13490 73652 72321 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665679.1 protein_id gnl|my_center|LOCUS_13490 74809 73838 gene locus_tag LOCUS_13500 gene hemH 74809 73838 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816874.1 protein_id gnl|my_center|LOCUS_13500 76090 74819 gene locus_tag LOCUS_13510 gene waaA 76090 74819 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094897.1 protein_id gnl|my_center|LOCUS_13510 76659 76096 gene locus_tag LOCUS_13520 gene orn 76659 76096 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295188.1 protein_id gnl|my_center|LOCUS_13520 76733 77767 gene locus_tag LOCUS_13530 gene rsgA 76733 77767 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041964.1 protein_id gnl|my_center|LOCUS_13530 78434 77892 gene locus_tag LOCUS_13540 78434 77892 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532362.1 protein_id gnl|my_center|LOCUS_13540 80300 78627 gene locus_tag LOCUS_13550 gene dauA 80300 78627 CDS product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816539.1 protein_id gnl|my_center|LOCUS_13550 80543 81904 gene locus_tag LOCUS_13560 80543 81904 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_13560 82401 81967 gene locus_tag LOCUS_13570 gene dtd 82401 81967 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368967.1 protein_id gnl|my_center|LOCUS_13570 83248 82409 gene locus_tag LOCUS_13580 83248 82409 CDS product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099364.1 protein_id gnl|my_center|LOCUS_13580 83873 83259 gene locus_tag LOCUS_13590 83873 83259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 84247 83984 gene locus_tag LOCUS_13600 gene rpsT 84247 83984 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157027.1 protein_id gnl|my_center|LOCUS_13600 84476 85639 gene locus_tag LOCUS_13610 gene pgk 84476 85639 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369762.1 protein_id gnl|my_center|LOCUS_13610 85718 86797 gene locus_tag LOCUS_13620 gene fbaA 85718 86797 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 protein_id gnl|my_center|LOCUS_13620 86980 87408 gene locus_tag LOCUS_13630 gene rplK 86980 87408 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393384.1 protein_id gnl|my_center|LOCUS_13630 87412 88113 gene locus_tag LOCUS_13640 gene rplA 87412 88113 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096684.1 protein_id gnl|my_center|LOCUS_13640 88344 88841 gene locus_tag LOCUS_13650 gene rplJ 88344 88841 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210674.1 protein_id gnl|my_center|LOCUS_13650 88900 89268 gene locus_tag LOCUS_13660 gene rplL 88900 89268 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028878.1 protein_id gnl|my_center|LOCUS_13660 89517 93545 gene locus_tag LOCUS_13670 gene rpoB 89517 93545 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005015893.1 protein_id gnl|my_center|LOCUS_13670 93636 97853 gene locus_tag LOCUS_13680 gene rpoC 93636 97853 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368824.1 protein_id gnl|my_center|LOCUS_13680 97937 98248 gene locus_tag LOCUS_13690 97937 98248 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721013.1 protein_id gnl|my_center|LOCUS_13690 98669 99265 gene locus_tag LOCUS_13700 98669 99265 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036019.1 protein_id gnl|my_center|LOCUS_13700 99274 100188 gene locus_tag LOCUS_13710 99274 100188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 100530 101039 gene locus_tag LOCUS_13720 gene yceD 100530 101039 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097124.1 protein_id gnl|my_center|LOCUS_13720 101044 101211 gene locus_tag LOCUS_13730 gene rpmF 101044 101211 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544470.1 protein_id gnl|my_center|LOCUS_13730 101245 102291 gene locus_tag LOCUS_13740 gene plsX 101245 102291 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197585.1 protein_id gnl|my_center|LOCUS_13740 102296 103249 gene locus_tag LOCUS_13750 102296 103249 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170737.1 protein_id gnl|my_center|LOCUS_13750 103285 104220 gene locus_tag LOCUS_13760 gene fabD 103285 104220 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816075.1 protein_id gnl|my_center|LOCUS_13760 104240 104974 gene locus_tag LOCUS_13770 gene fabG 104240 104974 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097120.1 protein_id gnl|my_center|LOCUS_13770 105125 105358 gene locus_tag LOCUS_13780 gene acpP 105125 105358 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220787.1 protein_id gnl|my_center|LOCUS_13780 105517 106761 gene locus_tag LOCUS_13790 gene fabF 105517 106761 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213079.1 protein_id gnl|my_center|LOCUS_13790 107241 110723 gene locus_tag LOCUS_13800 gene dnaE 107241 110723 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704450.1 protein_id gnl|my_center|LOCUS_13800 110973 111932 gene locus_tag LOCUS_13810 gene accA 110973 111932 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212147.1 protein_id gnl|my_center|LOCUS_13810 111953 112321 gene locus_tag LOCUS_13820 111953 112321 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095052.1 protein_id gnl|my_center|LOCUS_13820 113275 112433 gene locus_tag LOCUS_13830 113275 112433 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954235.1 protein_id gnl|my_center|LOCUS_13830 113886 113269 gene locus_tag LOCUS_13840 113886 113269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762776.1 protein_id gnl|my_center|LOCUS_13840 114213 113902 gene locus_tag LOCUS_13850 114213 113902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 115540 114389 gene locus_tag LOCUS_13860 gene metK 115540 114389 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062128.1 protein_id gnl|my_center|LOCUS_13860 115754 116578 gene locus_tag LOCUS_13870 gene murI 115754 116578 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703959.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence10 314 239 gene locus_tag LOCUS_t00220 314 239 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 392 318 gene locus_tag LOCUS_t00230 392 318 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 532 448 gene locus_tag LOCUS_t00240 532 448 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 640 565 gene locus_tag LOCUS_t00250 640 565 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3490 794 gene locus_tag LOCUS_13880 gene adhE 3490 794 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816419.1 protein_id gnl|my_center|LOCUS_13880 4608 3805 gene locus_tag LOCUS_13890 gene tcdA 4608 3805 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173260.1 protein_id gnl|my_center|LOCUS_13890 5460 4897 gene locus_tag LOCUS_13900 5460 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 6179 6012 gene locus_tag LOCUS_13910 6179 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 6364 6215 gene locus_tag LOCUS_13920 6364 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 6625 7629 gene locus_tag LOCUS_13930 6625 7629 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389115.1 protein_id gnl|my_center|LOCUS_13930 7631 8260 gene locus_tag LOCUS_13940 gene dhaL 7631 8260 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389114.1 protein_id gnl|my_center|LOCUS_13940 9127 8465 gene locus_tag LOCUS_13950 9127 8465 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861507.1 protein_id gnl|my_center|LOCUS_13950 11219 9156 gene locus_tag LOCUS_13960 11219 9156 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722025.1 protein_id gnl|my_center|LOCUS_13960 12695 11313 gene locus_tag LOCUS_13970 12695 11313 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731941.1 protein_id gnl|my_center|LOCUS_13970 12983 12705 gene locus_tag LOCUS_13980 12983 12705 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722354.1 protein_id gnl|my_center|LOCUS_13980 13469 12993 gene locus_tag LOCUS_13990 13469 12993 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722024.1 protein_id gnl|my_center|LOCUS_13990 15135 13780 gene locus_tag LOCUS_14000 15135 13780 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_14000 15442 15173 gene locus_tag LOCUS_14010 15442 15173 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721327.1 protein_id gnl|my_center|LOCUS_14010 15588 16802 gene locus_tag LOCUS_14020 gene alaA 15588 16802 CDS product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098109.1 protein_id gnl|my_center|LOCUS_14020 17925 17170 gene locus_tag LOCUS_14030 17925 17170 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792300.1 protein_id gnl|my_center|LOCUS_14030 18112 19149 gene locus_tag LOCUS_14040 gene queA 18112 19149 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208673.1 protein_id gnl|my_center|LOCUS_14040 19928 19245 gene locus_tag LOCUS_14050 19928 19245 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817038.1 protein_id gnl|my_center|LOCUS_14050 20067 21215 gene locus_tag LOCUS_14060 gene tgt 20067 21215 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005645731.1 protein_id gnl|my_center|LOCUS_14060 21276 21352 gene locus_tag LOCUS_t00260 21276 21352 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 23694 21928 gene locus_tag LOCUS_14070 23694 21928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762826.1 protein_id gnl|my_center|LOCUS_14070 25309 23684 gene locus_tag LOCUS_14080 25309 23684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762824.1 protein_id gnl|my_center|LOCUS_14080 27468 25468 gene locus_tag LOCUS_14090 gene fyuA 27468 25468 CDS product siderophore yersiniabactin receptor FyuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784550.1 protein_id gnl|my_center|LOCUS_14090 27618 28547 gene locus_tag LOCUS_14100 27618 28547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 29644 28556 gene locus_tag LOCUS_14110 29644 28556 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388595.1 protein_id gnl|my_center|LOCUS_14110 31597 30566 gene locus_tag LOCUS_14120 31597 30566 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026954.1 protein_id gnl|my_center|LOCUS_14120 31926 32369 gene locus_tag LOCUS_14130 31926 32369 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916805.1 protein_id gnl|my_center|LOCUS_14130 32401 32673 gene locus_tag LOCUS_14140 32401 32673 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699818.1 protein_id gnl|my_center|LOCUS_14140 32694 34061 gene locus_tag LOCUS_14150 32694 34061 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681684.1 protein_id gnl|my_center|LOCUS_14150 34234 34785 gene locus_tag LOCUS_14160 gene rimL 34234 34785 CDS product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366387.1 protein_id gnl|my_center|LOCUS_14160 36456 35008 gene locus_tag LOCUS_14170 36456 35008 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546313.1 protein_id gnl|my_center|LOCUS_14170 37686 36652 gene locus_tag LOCUS_14180 gene adhP 37686 36652 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649161.1 protein_id gnl|my_center|LOCUS_14180 39502 38183 gene locus_tag LOCUS_14190 39502 38183 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815535.1 protein_id gnl|my_center|LOCUS_14190 39742 40782 gene locus_tag LOCUS_14200 39742 40782 CDS product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721333.1 protein_id gnl|my_center|LOCUS_14200 41587 40937 gene locus_tag LOCUS_14210 gene grxB 41587 40937 CDS product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780912.1 protein_id gnl|my_center|LOCUS_14210 41769 41590 gene locus_tag LOCUS_14220 41769 41590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 41912 42076 gene locus_tag LOCUS_14230 41912 42076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 43053 45860 gene locus_tag LOCUS_14240 43053 45860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 45860 46375 gene locus_tag LOCUS_14250 45860 46375 CDS product DUF4123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535778.1 protein_id gnl|my_center|LOCUS_14250 46375 46716 gene locus_tag LOCUS_14260 46375 46716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 46726 47841 gene locus_tag LOCUS_14270 46726 47841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 47859 48608 gene locus_tag LOCUS_14280 47859 48608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 49255 49449 gene locus_tag LOCUS_14290 49255 49449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 49663 50301 gene locus_tag LOCUS_14300 49663 50301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 50365 50964 gene locus_tag LOCUS_14310 50365 50964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 51539 52531 gene locus_tag LOCUS_14320 51539 52531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 52658 53731 gene locus_tag LOCUS_14330 52658 53731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 53854 54939 gene locus_tag LOCUS_14340 53854 54939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 55203 55802 gene locus_tag LOCUS_14350 55203 55802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 55942 56076 gene locus_tag LOCUS_14360 55942 56076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 56073 56621 gene locus_tag LOCUS_14370 56073 56621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 56719 58182 gene locus_tag LOCUS_14380 56719 58182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 58257 58925 gene locus_tag LOCUS_14390 58257 58925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 59438 60355 gene locus_tag LOCUS_14400 gene xerD 59438 60355 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173453.1 protein_id gnl|my_center|LOCUS_14400 60381 61085 gene locus_tag LOCUS_14410 gene dsbC 60381 61085 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209932.1 protein_id gnl|my_center|LOCUS_14410 61166 62902 gene locus_tag LOCUS_14420 gene recJ 61166 62902 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813396.1 protein_id gnl|my_center|LOCUS_14420 63028 64422 gene locus_tag LOCUS_14430 gene mpl 63028 64422 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368582.1 protein_id gnl|my_center|LOCUS_14430 64493 65977 gene locus_tag LOCUS_14440 64493 65977 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_14440 66024 66383 gene locus_tag LOCUS_14450 66024 66383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 67844 66477 gene locus_tag LOCUS_14460 gene sdaA 67844 66477 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419892.1 protein_id gnl|my_center|LOCUS_14460 69342 68041 gene locus_tag LOCUS_14470 69342 68041 CDS product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215443.1 protein_id gnl|my_center|LOCUS_14470 69765 71486 gene locus_tag LOCUS_14480 gene proS 69765 71486 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163997.1 protein_id gnl|my_center|LOCUS_14480 71624 72094 gene locus_tag LOCUS_14490 71624 72094 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766229.1 protein_id gnl|my_center|LOCUS_14490 72220 73674 gene locus_tag LOCUS_14500 gene bepA 72220 73674 CDS product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489651.1 protein_id gnl|my_center|LOCUS_14500 74423 73761 gene locus_tag LOCUS_14510 74423 73761 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732846.1 protein_id gnl|my_center|LOCUS_14510 75430 74441 gene locus_tag LOCUS_14520 gene rluC 75430 74441 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705035.1 protein_id gnl|my_center|LOCUS_14520 75579 76097 gene locus_tag LOCUS_14530 gene dsbB 75579 76097 CDS product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705844.1 protein_id gnl|my_center|LOCUS_14530 76190 76846 gene locus_tag LOCUS_14540 gene rluA 76190 76846 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654471.1 protein_id gnl|my_center|LOCUS_14540 76932 77528 gene locus_tag LOCUS_14550 76932 77528 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482459.1 protein_id gnl|my_center|LOCUS_14550 77612 78460 gene locus_tag LOCUS_14560 gene rapZ 77612 78460 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210113.1 protein_id gnl|my_center|LOCUS_14560 79279 78461 gene locus_tag LOCUS_14570 79279 78461 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135520.1 protein_id gnl|my_center|LOCUS_14570 80490 79279 gene locus_tag LOCUS_14580 gene envC 80490 79279 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815277.1 protein_id gnl|my_center|LOCUS_14580 80700 81632 gene locus_tag LOCUS_14590 gene glyQ 80700 81632 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005339464.1 protein_id gnl|my_center|LOCUS_14590 81646 83712 gene locus_tag LOCUS_14600 gene glyS 81646 83712 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291772.1 protein_id gnl|my_center|LOCUS_14600 83778 84581 gene locus_tag LOCUS_14610 83778 84581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 84680 85165 gene locus_tag LOCUS_14620 gene ybaK 84680 85165 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428207.1 protein_id gnl|my_center|LOCUS_14620 85579 85307 gene locus_tag LOCUS_14630 gene hupA 85579 85307 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210689.1 protein_id gnl|my_center|LOCUS_14630 86347 85754 gene locus_tag LOCUS_14640 86347 85754 CDS product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704016.1 protein_id gnl|my_center|LOCUS_14640 87413 86340 gene locus_tag LOCUS_14650 gene hemE 87413 86340 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137619.1 protein_id gnl|my_center|LOCUS_14650 88407 87502 gene locus_tag LOCUS_14660 88407 87502 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163344.1 protein_id gnl|my_center|LOCUS_14660 88615 89280 gene locus_tag LOCUS_14670 gene rpiA 88615 89280 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163342.1 protein_id gnl|my_center|LOCUS_14670 89336 90577 gene locus_tag LOCUS_14680 gene serA 89336 90577 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151609.1 protein_id gnl|my_center|LOCUS_14680 91570 90791 gene locus_tag LOCUS_14690 91570 90791 CDS product DNA-binding transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172511.1 protein_id gnl|my_center|LOCUS_14690 92038 91673 gene locus_tag LOCUS_14700 gene gutM 92038 91673 CDS product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172508.1 protein_id gnl|my_center|LOCUS_14700 92891 92112 gene locus_tag LOCUS_14710 gene srlD 92891 92112 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162204.1 protein_id gnl|my_center|LOCUS_14710 93272 92904 gene locus_tag LOCUS_14720 gene srlB 93272 92904 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216206.1 protein_id gnl|my_center|LOCUS_14720 94355 93363 gene locus_tag LOCUS_14730 94355 93363 CDS product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703246.1 protein_id gnl|my_center|LOCUS_14730 94923 94375 gene locus_tag LOCUS_14740 94923 94375 CDS product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391259.1 protein_id gnl|my_center|LOCUS_14740 95200 95760 gene locus_tag LOCUS_14750 95200 95760 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966677.1 protein_id gnl|my_center|LOCUS_14750 95843 96391 gene locus_tag LOCUS_14760 95843 96391 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404446.1 protein_id gnl|my_center|LOCUS_14760 96461 97147 gene locus_tag LOCUS_14770 gene mutH 96461 97147 CDS product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082197.1 protein_id gnl|my_center|LOCUS_14770 97360 97779 gene locus_tag LOCUS_14780 97360 97779 CDS product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815636.1 protein_id gnl|my_center|LOCUS_14780 97780 98271 gene locus_tag LOCUS_14790 97780 98271 CDS product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167379.1 protein_id gnl|my_center|LOCUS_14790 98306 99124 gene locus_tag LOCUS_14800 98306 99124 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165149.1 protein_id gnl|my_center|LOCUS_14800 99143 99973 gene locus_tag LOCUS_14810 99143 99973 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815634.1 protein_id gnl|my_center|LOCUS_14810 100134 101378 gene locus_tag LOCUS_14820 100134 101378 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815633.1 protein_id gnl|my_center|LOCUS_14820 101487 102458 gene locus_tag LOCUS_14830 101487 102458 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815637.1 protein_id gnl|my_center|LOCUS_14830 102635 104050 gene locus_tag LOCUS_14840 102635 104050 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286021.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence11 599 1303 gene locus_tag LOCUS_14850 599 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 1476 2084 gene locus_tag LOCUS_14860 1476 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 4379 2418 gene locus_tag LOCUS_14870 4379 2418 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 protein_id gnl|my_center|LOCUS_14870 5413 4787 gene locus_tag LOCUS_14880 5413 4787 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943404.1 protein_id gnl|my_center|LOCUS_14880 6851 5502 gene locus_tag LOCUS_14890 6851 5502 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973921.1 protein_id gnl|my_center|LOCUS_14890 7382 6963 gene locus_tag LOCUS_14900 7382 6963 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549988.1 protein_id gnl|my_center|LOCUS_14900 7679 8485 gene locus_tag LOCUS_14910 7679 8485 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071542.1 protein_id gnl|my_center|LOCUS_14910 8990 8619 gene locus_tag LOCUS_14920 8990 8619 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866321.1 protein_id gnl|my_center|LOCUS_14920 10038 8968 gene locus_tag LOCUS_14930 10038 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380253.1 protein_id gnl|my_center|LOCUS_14930 11617 10616 gene locus_tag LOCUS_14940 gene mltB 11617 10616 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387762.1 protein_id gnl|my_center|LOCUS_14940 12753 11746 gene locus_tag LOCUS_14950 12753 11746 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816352.1 protein_id gnl|my_center|LOCUS_14950 13017 14279 gene locus_tag LOCUS_14960 13017 14279 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243984.1 protein_id gnl|my_center|LOCUS_14960 14288 14944 gene locus_tag LOCUS_14970 14288 14944 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243096.1 protein_id gnl|my_center|LOCUS_14970 15413 16366 gene locus_tag LOCUS_14980 gene trxB 15413 16366 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073137.1 protein_id gnl|my_center|LOCUS_14980 16381 18096 gene locus_tag LOCUS_14990 gene cydD 16381 18096 CDS product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816031.1 protein_id gnl|my_center|LOCUS_14990 18090 19733 gene locus_tag LOCUS_15000 gene cydC 18090 19733 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704874.1 protein_id gnl|my_center|LOCUS_15000 19873 20187 gene locus_tag LOCUS_15010 gene rsfS 19873 20187 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161664.1 protein_id gnl|my_center|LOCUS_15010 20192 20662 gene locus_tag LOCUS_15020 gene rlmH 20192 20662 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649848.1 protein_id gnl|my_center|LOCUS_15020 20686 21153 gene locus_tag LOCUS_15030 gene ybeY 20686 21153 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158419.1 protein_id gnl|my_center|LOCUS_15030 21236 22099 gene locus_tag LOCUS_15040 gene corC 21236 22099 CDS product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158416.1 protein_id gnl|my_center|LOCUS_15040 22101 23642 gene locus_tag LOCUS_15050 gene lnt 22101 23642 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210341.1 protein_id gnl|my_center|LOCUS_15050 23870 24778 gene locus_tag LOCUS_15060 23870 24778 CDS product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531996.1 protein_id gnl|my_center|LOCUS_15060 24859 25593 gene locus_tag LOCUS_15070 24859 25593 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167917.1 protein_id gnl|my_center|LOCUS_15070 25595 26296 gene locus_tag LOCUS_15080 gene gltK 25595 26296 CDS product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167916.1 protein_id gnl|my_center|LOCUS_15080 26293 27018 gene locus_tag LOCUS_15090 26293 27018 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367722.1 protein_id gnl|my_center|LOCUS_15090 28975 27125 gene locus_tag LOCUS_15100 gene recD 28975 27125 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703320.1 protein_id gnl|my_center|LOCUS_15100 30574 28985 gene locus_tag LOCUS_15110 30574 28985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 30817 32052 gene locus_tag LOCUS_15120 gene nadR 30817 32052 CDS product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815523.1 protein_id gnl|my_center|LOCUS_15120 32055 32744 gene locus_tag LOCUS_15130 gene pnuC 32055 32744 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345378.1 protein_id gnl|my_center|LOCUS_15130 33736 33107 gene locus_tag LOCUS_15140 33736 33107 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167299.1 protein_id gnl|my_center|LOCUS_15140 34764 33742 gene locus_tag LOCUS_15150 gene truD 34764 33742 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209393.1 protein_id gnl|my_center|LOCUS_15150 35271 34786 gene locus_tag LOCUS_15160 gene ispF 35271 34786 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219244.1 protein_id gnl|my_center|LOCUS_15160 35979 35290 gene locus_tag LOCUS_15170 gene ispD 35979 35290 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246155.1 protein_id gnl|my_center|LOCUS_15170 36284 35988 gene locus_tag LOCUS_15180 gene ftsB 36284 35988 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517472.1 protein_id gnl|my_center|LOCUS_15180 36623 36306 gene locus_tag LOCUS_15190 36623 36306 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419649.1 protein_id gnl|my_center|LOCUS_15190 36816 36903 gene locus_tag LOCUS_t00270 36816 36903 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 37070 37357 gene locus_tag LOCUS_15200 37070 37357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 38854 37787 gene locus_tag LOCUS_15210 38854 37787 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653868.1 protein_id gnl|my_center|LOCUS_15210 39267 40442 gene locus_tag LOCUS_15220 gene emrA 39267 40442 CDS product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208745.1 protein_id gnl|my_center|LOCUS_15220 40439 41980 gene locus_tag LOCUS_15230 gene emrB 40439 41980 CDS product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098429.1 protein_id gnl|my_center|LOCUS_15230 42819 43637 gene locus_tag LOCUS_15240 42819 43637 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207937.1 protein_id gnl|my_center|LOCUS_15240 44059 43841 gene locus_tag LOCUS_15250 44059 43841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15250 45859 44510 gene locus_tag LOCUS_15260 45859 44510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114398.1 protein_id gnl|my_center|LOCUS_15260 52110 45856 gene locus_tag LOCUS_15270 52110 45856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 52768 52121 gene locus_tag LOCUS_15280 52768 52121 CDS product 4Fe-4S cluster-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114396.1 protein_id gnl|my_center|LOCUS_15280 54589 52769 gene locus_tag LOCUS_15290 54589 52769 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895630.1 protein_id gnl|my_center|LOCUS_15290 54956 55174 gene locus_tag LOCUS_15300 54956 55174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 55903 55445 gene locus_tag LOCUS_15310 55903 55445 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209946.1 protein_id gnl|my_center|LOCUS_15310 57976 55952 gene locus_tag LOCUS_15320 57976 55952 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989494.1 protein_id gnl|my_center|LOCUS_15320 58080 58988 gene locus_tag LOCUS_15330 58080 58988 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423226.1 protein_id gnl|my_center|LOCUS_15330 60678 60397 gene locus_tag LOCUS_15340 60678 60397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 61451 60708 gene locus_tag LOCUS_15350 61451 60708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 62239 61463 gene locus_tag LOCUS_15360 62239 61463 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653653.1 protein_id gnl|my_center|LOCUS_15360 63399 62245 gene locus_tag LOCUS_15370 63399 62245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 64564 63419 gene locus_tag LOCUS_15380 64564 63419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 65604 64987 gene locus_tag LOCUS_15390 65604 64987 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048538105.1 protein_id gnl|my_center|LOCUS_15390 67123 66368 gene locus_tag LOCUS_15400 67123 66368 CDS product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088623.1 protein_id gnl|my_center|LOCUS_15400 67543 67349 gene locus_tag LOCUS_15410 67543 67349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 67589 68464 gene locus_tag LOCUS_15420 67589 68464 CDS product aspartyl protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038632280.1 protein_id gnl|my_center|LOCUS_15420 70986 68554 gene locus_tag LOCUS_15430 70986 68554 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209354.1 protein_id gnl|my_center|LOCUS_15430 71900 71001 gene locus_tag LOCUS_15440 71900 71001 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576948.1 protein_id gnl|my_center|LOCUS_15440 72334 72504 gene locus_tag LOCUS_15450 72334 72504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 72577 72747 gene locus_tag LOCUS_15460 72577 72747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 73948 73127 gene locus_tag LOCUS_15470 73948 73127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 74580 74368 gene locus_tag LOCUS_15480 74580 74368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 74851 74504 gene locus_tag LOCUS_15490 74851 74504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 75309 74872 gene locus_tag LOCUS_15500 75309 74872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 75851 75543 gene locus_tag LOCUS_15510 75851 75543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 77224 76880 gene locus_tag LOCUS_15520 77224 76880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 77541 78236 gene locus_tag LOCUS_15530 77541 78236 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133087235.1 protein_id gnl|my_center|LOCUS_15530 80003 78789 gene locus_tag LOCUS_15540 80003 78789 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390089.1 protein_id gnl|my_center|LOCUS_15540 82163 80190 gene locus_tag LOCUS_15550 82163 80190 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279435.1 protein_id gnl|my_center|LOCUS_15550 84028 82427 gene locus_tag LOCUS_15560 84028 82427 CDS product bifunctional aspartate transaminase/aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073522.1 protein_id gnl|my_center|LOCUS_15560 85757 84057 gene locus_tag LOCUS_15570 gene aspT 85757 84057 CDS product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068377.1 protein_id gnl|my_center|LOCUS_15570 87208 86192 gene locus_tag LOCUS_15580 87208 86192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 88494 87439 gene locus_tag LOCUS_15590 gene sohB 88494 87439 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422045.1 protein_id gnl|my_center|LOCUS_15590 88648 90348 gene locus_tag LOCUS_15600 88648 90348 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661416.1 protein_id gnl|my_center|LOCUS_15600 90348 90767 gene locus_tag LOCUS_15610 90348 90767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 92655 90829 gene locus_tag LOCUS_15620 gene typA 92655 90829 CDS product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099375.1 protein_id gnl|my_center|LOCUS_15620 93344 92811 gene locus_tag LOCUS_15630 gene hemG 93344 92811 CDS product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176268.1 protein_id gnl|my_center|LOCUS_15630 93949 95334 gene locus_tag LOCUS_15640 gene glmU 93949 95334 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933743.1 protein_id gnl|my_center|LOCUS_15640 95338 97170 gene locus_tag LOCUS_15650 gene glmS 95338 97170 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099409.1 protein_id gnl|my_center|LOCUS_15650 97459 99333 gene locus_tag LOCUS_15660 gene mtlA 97459 99333 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093287.1 protein_id gnl|my_center|LOCUS_15660 99417 100577 gene locus_tag LOCUS_15670 99417 100577 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817444.1 protein_id gnl|my_center|LOCUS_15670 100585 101136 gene locus_tag LOCUS_15680 gene mtlR 100585 101136 CDS product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703790.1 protein_id gnl|my_center|LOCUS_15680 102594 101674 gene locus_tag LOCUS_15690 102594 101674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 104098 102605 gene locus_tag LOCUS_15700 104098 102605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence12 1738 260 gene locus_tag LOCUS_15710 gene ilvC 1738 260 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212007.1 protein_id gnl|my_center|LOCUS_15710 2157 3608 gene locus_tag LOCUS_15720 gene panF 2157 3608 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817285.1 protein_id gnl|my_center|LOCUS_15720 3583 4449 gene locus_tag LOCUS_15730 gene prmA 3583 4449 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145812.1 protein_id gnl|my_center|LOCUS_15730 4486 5493 gene locus_tag LOCUS_15740 gene dusB 4486 5493 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219664.1 protein_id gnl|my_center|LOCUS_15740 5501 5797 gene locus_tag LOCUS_15750 gene fis 5501 5797 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210061.1 protein_id gnl|my_center|LOCUS_15750 6894 5902 gene locus_tag LOCUS_15760 gene rbsR 6894 5902 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224470.1 protein_id gnl|my_center|LOCUS_15760 7875 6910 gene locus_tag LOCUS_15770 gene rbsK 7875 6910 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212251.1 protein_id gnl|my_center|LOCUS_15770 8781 7894 gene locus_tag LOCUS_15780 gene rbsB 8781 7894 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175185.1 protein_id gnl|my_center|LOCUS_15780 9754 8804 gene locus_tag LOCUS_15790 gene rbsC 9754 8804 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368991.1 protein_id gnl|my_center|LOCUS_15790 11255 9741 gene locus_tag LOCUS_15800 gene rbsA 11255 9741 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175183.1 protein_id gnl|my_center|LOCUS_15800 11720 11301 gene locus_tag LOCUS_15810 gene rbsD 11720 11301 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161210.1 protein_id gnl|my_center|LOCUS_15810 12075 12818 gene locus_tag LOCUS_15820 12075 12818 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211202.1 protein_id gnl|my_center|LOCUS_15820 12818 13306 gene locus_tag LOCUS_15830 gene ruvC 12818 13306 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365988.1 protein_id gnl|my_center|LOCUS_15830 16712 13500 gene locus_tag LOCUS_15840 gene acrB 16712 13500 CDS product efflux RND transporter permease AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208616.1 protein_id gnl|my_center|LOCUS_15840 17928 16732 gene locus_tag LOCUS_15850 gene acrA 17928 16732 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005019446.1 protein_id gnl|my_center|LOCUS_15850 18324 19238 gene locus_tag LOCUS_15860 gene zipA 18324 19238 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227089.1 protein_id gnl|my_center|LOCUS_15860 19412 21490 gene locus_tag LOCUS_15870 gene ligA 19412 21490 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443689.1 protein_id gnl|my_center|LOCUS_15870 21555 22070 gene locus_tag LOCUS_15880 gene luxS 21555 22070 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261308.1 protein_id gnl|my_center|LOCUS_15880 22080 22274 gene locus_tag LOCUS_15890 22080 22274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 22992 22375 gene locus_tag LOCUS_15900 gene ribA 22992 22375 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176295.1 protein_id gnl|my_center|LOCUS_15900 23089 23808 gene locus_tag LOCUS_15910 gene pgpB 23089 23808 CDS product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210617.1 protein_id gnl|my_center|LOCUS_15910 23891 24202 gene locus_tag LOCUS_15920 23891 24202 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165840.1 protein_id gnl|my_center|LOCUS_15920 24208 25380 gene locus_tag LOCUS_15930 gene lapB 24208 25380 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210615.1 protein_id gnl|my_center|LOCUS_15930 25399 26181 gene locus_tag LOCUS_15940 25399 26181 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816079.1 protein_id gnl|my_center|LOCUS_15940 26174 27289 gene locus_tag LOCUS_15950 26174 27289 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704249.1 protein_id gnl|my_center|LOCUS_15950 27476 28711 gene locus_tag LOCUS_15960 27476 28711 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693428.1 protein_id gnl|my_center|LOCUS_15960 29213 28791 gene locus_tag LOCUS_15970 29213 28791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 30223 29696 gene locus_tag LOCUS_15980 30223 29696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 31247 30360 gene locus_tag LOCUS_15990 31247 30360 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245421.1 protein_id gnl|my_center|LOCUS_15990 32184 33860 gene locus_tag LOCUS_16000 gene ilvG 32184 33860 CDS product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012560.1 protein_id gnl|my_center|LOCUS_16000 33864 34094 gene locus_tag LOCUS_16010 gene ilvM 33864 34094 CDS product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368897.1 protein_id gnl|my_center|LOCUS_16010 34265 35194 gene locus_tag LOCUS_16020 gene ilvE 34265 35194 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099287.1 protein_id gnl|my_center|LOCUS_16020 35327 37177 gene locus_tag LOCUS_16030 gene ilvD 35327 37177 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176087.1 protein_id gnl|my_center|LOCUS_16030 37180 38721 gene locus_tag LOCUS_16040 gene ilvA 37180 38721 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212013.1 protein_id gnl|my_center|LOCUS_16040 38939 39919 gene locus_tag LOCUS_16050 38939 39919 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817240.1 protein_id gnl|my_center|LOCUS_16050 41362 40436 gene locus_tag LOCUS_16060 41362 40436 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732587.1 protein_id gnl|my_center|LOCUS_16060 42455 42030 gene locus_tag LOCUS_16070 gene tssE 42455 42030 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705635.1 protein_id gnl|my_center|LOCUS_16070 42970 42455 gene locus_tag LOCUS_16080 gene tssJ 42970 42455 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096443.1 protein_id gnl|my_center|LOCUS_16080 43993 42986 gene locus_tag LOCUS_16090 gene tssG 43993 42986 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211941.1 protein_id gnl|my_center|LOCUS_16090 45756 43993 gene locus_tag LOCUS_16100 gene tssF 45756 43993 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342476.1 protein_id gnl|my_center|LOCUS_16100 47413 45809 gene locus_tag LOCUS_16110 gene tssA 47413 45809 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169039904.1 protein_id gnl|my_center|LOCUS_16110 50782 47441 gene locus_tag LOCUS_16120 50782 47441 CDS product type VI secretion system membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211936.1 protein_id gnl|my_center|LOCUS_16120 51917 50772 gene locus_tag LOCUS_16130 51917 50772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 52188 51922 gene locus_tag LOCUS_16140 52188 51922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 55233 52453 gene locus_tag LOCUS_16150 gene tssH 55233 52453 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210013.1 protein_id gnl|my_center|LOCUS_16150 55810 55322 gene locus_tag LOCUS_16160 55810 55322 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997068.1 protein_id gnl|my_center|LOCUS_16160 57586 55844 gene locus_tag LOCUS_16170 57586 55844 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243153.1 protein_id gnl|my_center|LOCUS_16170 58263 57598 gene locus_tag LOCUS_16180 58263 57598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 59626 58274 gene locus_tag LOCUS_16190 gene tssK 59626 58274 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213011.1 protein_id gnl|my_center|LOCUS_16190 61195 59663 gene locus_tag LOCUS_16200 gene tssC 61195 59663 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640195.1 protein_id gnl|my_center|LOCUS_16200 61771 61271 gene locus_tag LOCUS_16210 gene tssB 61771 61271 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211662.1 protein_id gnl|my_center|LOCUS_16210 62757 63674 gene locus_tag LOCUS_16220 62757 63674 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662662.1 protein_id gnl|my_center|LOCUS_16220 63674 64564 gene locus_tag LOCUS_16230 gene yfeB 63674 64564 CDS product iron/manganese ABC transporter ATP-binding protein YfeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170112.1 protein_id gnl|my_center|LOCUS_16230 64570 65436 gene locus_tag LOCUS_16240 gene yfeC 64570 65436 CDS product iron/manganese ABC transporter permease subunit YfeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816221.1 protein_id gnl|my_center|LOCUS_16240 65433 66269 gene locus_tag LOCUS_16250 gene yfeD 65433 66269 CDS product iron/manganese ABC transporter permease subunit YfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170116.1 protein_id gnl|my_center|LOCUS_16250 67762 66338 gene locus_tag LOCUS_16260 gene dnaB 67762 66338 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165232.1 protein_id gnl|my_center|LOCUS_16260 68599 67808 gene locus_tag LOCUS_16270 gene truA 68599 67808 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072966.1 protein_id gnl|my_center|LOCUS_16270 69635 68586 gene locus_tag LOCUS_16280 69635 68586 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815923.1 protein_id gnl|my_center|LOCUS_16280 69930 70976 gene locus_tag LOCUS_16290 69930 70976 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_16290 71948 71046 gene locus_tag LOCUS_16300 gene truB 71948 71046 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089690.1 protein_id gnl|my_center|LOCUS_16300 72393 72016 gene locus_tag LOCUS_16310 gene rbfA 72393 72016 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175393.1 protein_id gnl|my_center|LOCUS_16310 75164 72459 gene locus_tag LOCUS_16320 gene infB 75164 72459 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133055.1 protein_id gnl|my_center|LOCUS_16320 76657 75182 gene locus_tag LOCUS_16330 gene nusA 76657 75182 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156278.1 protein_id gnl|my_center|LOCUS_16330 77135 76674 gene locus_tag LOCUS_16340 gene rimP 77135 76674 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300397.1 protein_id gnl|my_center|LOCUS_16340 77402 77326 gene locus_tag LOCUS_t00280 77402 77326 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 78416 77610 gene locus_tag LOCUS_16350 gene trpA 78416 77610 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169334.1 protein_id gnl|my_center|LOCUS_16350 79606 78413 gene locus_tag LOCUS_16360 gene trpB 79606 78413 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076940213.1 protein_id gnl|my_center|LOCUS_16360 81014 79632 gene locus_tag LOCUS_16370 gene trpCF 81014 79632 CDS product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210632.1 protein_id gnl|my_center|LOCUS_16370 82664 81030 gene locus_tag LOCUS_16380 gene trpD 82664 81030 CDS product bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366209.1 protein_id gnl|my_center|LOCUS_16380 84226 82664 gene locus_tag LOCUS_16390 84226 82664 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228454.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence13 2298 1024 gene locus_tag LOCUS_16400 2298 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16400 2597 2355 gene locus_tag LOCUS_16410 2597 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16410 3175 2624 gene locus_tag LOCUS_16420 3175 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16420 3567 3268 gene locus_tag LOCUS_16430 3567 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 4303 4734 gene locus_tag LOCUS_16440 4303 4734 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070053.1 protein_id gnl|my_center|LOCUS_16440 5090 6367 gene locus_tag LOCUS_16450 5090 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 7110 10628 gene locus_tag LOCUS_16460 7110 10628 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344102.1 protein_id gnl|my_center|LOCUS_16460 12627 11890 gene locus_tag LOCUS_16470 12627 11890 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094853.1 protein_id gnl|my_center|LOCUS_16470 13750 13022 gene locus_tag LOCUS_16480 gene pagN 13750 13022 CDS product adhesin/invasin protein PagN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787614.1 protein_id gnl|my_center|LOCUS_16480 14100 14025 gene locus_tag LOCUS_t00290 14100 14025 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 14247 14822 gene locus_tag LOCUS_16490 14247 14822 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067248.1 protein_id gnl|my_center|LOCUS_16490 16575 14878 gene locus_tag LOCUS_16500 gene fruA 16575 14878 CDS product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208797.1 protein_id gnl|my_center|LOCUS_16500 17519 16584 gene locus_tag LOCUS_16510 gene fruK 17519 16584 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171387.1 protein_id gnl|my_center|LOCUS_16510 18718 17519 gene locus_tag LOCUS_16520 gene fruB 18718 17519 CDS product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706118.1 protein_id gnl|my_center|LOCUS_16520 19957 18926 gene locus_tag LOCUS_16530 gene cra 19957 18926 CDS product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815563.1 protein_id gnl|my_center|LOCUS_16530 20835 20080 gene locus_tag LOCUS_16540 20835 20080 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209584.1 protein_id gnl|my_center|LOCUS_16540 21803 20832 gene locus_tag LOCUS_16550 21803 20832 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209583.1 protein_id gnl|my_center|LOCUS_16550 22752 21793 gene locus_tag LOCUS_16560 22752 21793 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209582.1 protein_id gnl|my_center|LOCUS_16560 23716 22760 gene locus_tag LOCUS_16570 23716 22760 CDS product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209581.1 protein_id gnl|my_center|LOCUS_16570 25369 23930 gene locus_tag LOCUS_16580 gene glnG 25369 23930 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368973.1 protein_id gnl|my_center|LOCUS_16580 26430 25381 gene locus_tag LOCUS_16590 gene glnL 26430 25381 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213151.1 protein_id gnl|my_center|LOCUS_16590 27910 26501 gene locus_tag LOCUS_16600 gene glnA 27910 26501 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392048.1 protein_id gnl|my_center|LOCUS_16600 28484 28924 gene locus_tag LOCUS_16610 28484 28924 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156179.1 protein_id gnl|my_center|LOCUS_16610 28950 29423 gene locus_tag LOCUS_16620 gene secB 28950 29423 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164715.1 protein_id gnl|my_center|LOCUS_16620 29461 30474 gene locus_tag LOCUS_16630 gene gpsA 29461 30474 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076194.1 protein_id gnl|my_center|LOCUS_16630 31510 30536 gene locus_tag LOCUS_16640 31510 30536 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563822.1 protein_id gnl|my_center|LOCUS_16640 31708 33849 gene locus_tag LOCUS_16650 gene aas 31708 33849 CDS product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816988.1 protein_id gnl|my_center|LOCUS_16650 33864 35051 gene locus_tag LOCUS_16660 gene lplT 33864 35051 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620430.1 protein_id gnl|my_center|LOCUS_16660 35038 35949 gene locus_tag LOCUS_16670 gene murQ 35038 35949 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477459.1 protein_id gnl|my_center|LOCUS_16670 36145 37896 gene locus_tag LOCUS_16680 36145 37896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 38399 39373 gene locus_tag LOCUS_16690 38399 39373 CDS product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289456.1 protein_id gnl|my_center|LOCUS_16690 39397 40197 gene locus_tag LOCUS_16700 39397 40197 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356031.1 protein_id gnl|my_center|LOCUS_16700 40214 41125 gene locus_tag LOCUS_16710 40214 41125 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356032.1 protein_id gnl|my_center|LOCUS_16710 41292 41666 gene locus_tag LOCUS_16720 41292 41666 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356033.1 protein_id gnl|my_center|LOCUS_16720 41888 42136 gene locus_tag LOCUS_16730 gene rpsP 41888 42136 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166006.1 protein_id gnl|my_center|LOCUS_16730 42160 42690 gene locus_tag LOCUS_16740 gene rimM 42160 42690 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043335.1 protein_id gnl|my_center|LOCUS_16740 42707 43459 gene locus_tag LOCUS_16750 gene trmD 42707 43459 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264777.1 protein_id gnl|my_center|LOCUS_16750 43491 43841 gene locus_tag LOCUS_16760 gene rplS 43491 43841 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065253.1 protein_id gnl|my_center|LOCUS_16760 43998 44600 gene locus_tag LOCUS_16770 43998 44600 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939073.1 protein_id gnl|my_center|LOCUS_16770 46114 44720 gene locus_tag LOCUS_16780 46114 44720 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380357.1 protein_id gnl|my_center|LOCUS_16780 47277 46171 gene locus_tag LOCUS_16790 47277 46171 CDS product alanine/ornithine racemase family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281913.1 protein_id gnl|my_center|LOCUS_16790 48708 47296 gene locus_tag LOCUS_16800 48708 47296 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072509.1 protein_id gnl|my_center|LOCUS_16800 50159 48762 gene locus_tag LOCUS_16810 50159 48762 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132306.1 protein_id gnl|my_center|LOCUS_16810 50425 51861 gene locus_tag LOCUS_16820 50425 51861 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168932.1 protein_id gnl|my_center|LOCUS_16820 53049 51868 gene locus_tag LOCUS_16830 53049 51868 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439188.1 protein_id gnl|my_center|LOCUS_16830 53449 57906 gene locus_tag LOCUS_16840 gene gltB 53449 57906 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229651.1 protein_id gnl|my_center|LOCUS_16840 57919 59331 gene locus_tag LOCUS_16850 gene gltD 57919 59331 CDS product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369485.1 protein_id gnl|my_center|LOCUS_16850 59969 59439 gene locus_tag LOCUS_16860 59969 59439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688872.1 protein_id gnl|my_center|LOCUS_16860 60673 59981 gene locus_tag LOCUS_16870 60673 59981 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925693.1 protein_id gnl|my_center|LOCUS_16870 61208 60768 gene locus_tag LOCUS_16880 61208 60768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 62003 61215 gene locus_tag LOCUS_16890 gene mazG 62003 61215 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071648.1 protein_id gnl|my_center|LOCUS_16890 62235 64238 gene locus_tag LOCUS_16900 62235 64238 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224746.1 protein_id gnl|my_center|LOCUS_16900 65434 64286 gene locus_tag LOCUS_16910 65434 64286 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815413.1 protein_id gnl|my_center|LOCUS_16910 66378 65497 gene locus_tag LOCUS_16920 gene garR 66378 65497 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350452.1 protein_id gnl|my_center|LOCUS_16920 67184 66414 gene locus_tag LOCUS_16930 gene garL 67184 66414 CDS product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098883.1 protein_id gnl|my_center|LOCUS_16930 68567 67233 gene locus_tag LOCUS_16940 gene gudD 68567 67233 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098237.1 protein_id gnl|my_center|LOCUS_16940 69944 68607 gene locus_tag LOCUS_16950 69944 68607 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235392.1 protein_id gnl|my_center|LOCUS_16950 71314 69989 gene locus_tag LOCUS_16960 71314 69989 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703312.1 protein_id gnl|my_center|LOCUS_16960 71755 73305 gene locus_tag LOCUS_16970 gene garD 71755 73305 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273719.1 protein_id gnl|my_center|LOCUS_16970 74559 73393 gene locus_tag LOCUS_16980 gene cdaR 74559 73393 CDS product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929450.1 protein_id gnl|my_center|LOCUS_16980 74644 76578 gene locus_tag LOCUS_16990 74644 76578 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703646.1 protein_id gnl|my_center|LOCUS_16990 77253 76708 gene locus_tag LOCUS_17000 gene nusG 77253 76708 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287516.1 protein_id gnl|my_center|LOCUS_17000 77656 77255 gene locus_tag LOCUS_17010 gene secE 77656 77255 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555502.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence14 45 2720 gene locus_tag LOCUS_17020 45 2720 CDS product putative virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267840.1 protein_id gnl|my_center|LOCUS_17020 2852 3898 gene locus_tag LOCUS_17030 2852 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104249.1 protein_id gnl|my_center|LOCUS_17030 3911 5875 gene locus_tag LOCUS_17040 3911 5875 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104250.1 protein_id gnl|my_center|LOCUS_17040 5881 6597 gene locus_tag LOCUS_17050 5881 6597 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267837.1 protein_id gnl|my_center|LOCUS_17050 6600 7823 gene locus_tag LOCUS_17060 6600 7823 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771463.1 protein_id gnl|my_center|LOCUS_17060 7780 9402 gene locus_tag LOCUS_17070 7780 9402 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267835.1 protein_id gnl|my_center|LOCUS_17070 9402 10094 gene locus_tag LOCUS_17080 9402 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 10097 10579 gene locus_tag LOCUS_17090 10097 10579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 10640 11980 gene locus_tag LOCUS_17100 10640 11980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267832.1 protein_id gnl|my_center|LOCUS_17100 12099 13571 gene locus_tag LOCUS_17110 12099 13571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 16101 13690 gene locus_tag LOCUS_17120 gene gyrB 16101 13690 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072072.1 protein_id gnl|my_center|LOCUS_17120 17217 16144 gene locus_tag LOCUS_17130 gene recF 17217 16144 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060112.1 protein_id gnl|my_center|LOCUS_17130 18370 17267 gene locus_tag LOCUS_17140 gene dnaN 18370 17267 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673464.1 protein_id gnl|my_center|LOCUS_17140 19745 18387 gene locus_tag LOCUS_17150 gene dnaA 19745 18387 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161100.1 protein_id gnl|my_center|LOCUS_17150 21008 19902 gene locus_tag LOCUS_17160 gene ompA 21008 19902 CDS product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309394.1 protein_id gnl|my_center|LOCUS_17160 22108 21200 gene locus_tag LOCUS_17170 gene rdgC 22108 21200 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208691.1 protein_id gnl|my_center|LOCUS_17170 23037 22234 gene locus_tag LOCUS_17180 23037 22234 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163762.1 protein_id gnl|my_center|LOCUS_17180 23150 24559 gene locus_tag LOCUS_17190 23150 24559 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868396.1 protein_id gnl|my_center|LOCUS_17190 24795 25844 gene locus_tag LOCUS_17200 24795 25844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 25841 26713 gene locus_tag LOCUS_17210 25841 26713 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393248.1 protein_id gnl|my_center|LOCUS_17210 27195 26794 gene locus_tag LOCUS_17220 27195 26794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 27553 27197 gene locus_tag LOCUS_17230 27553 27197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 28386 27553 gene locus_tag LOCUS_17240 28386 27553 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527983.1 protein_id gnl|my_center|LOCUS_17240 29130 28423 gene locus_tag LOCUS_17250 29130 28423 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 protein_id gnl|my_center|LOCUS_17250 29289 30017 gene locus_tag LOCUS_17260 gene bfmR 29289 30017 CDS product response regulator transcription factor BfmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_17260 30014 31357 gene locus_tag LOCUS_17270 gene rstB 30014 31357 CDS product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011192505.1 protein_id gnl|my_center|LOCUS_17270 31480 32691 gene locus_tag LOCUS_17280 31480 32691 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355251.1 protein_id gnl|my_center|LOCUS_17280 32930 34606 gene locus_tag LOCUS_17290 gene glnS 32930 34606 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097566.1 protein_id gnl|my_center|LOCUS_17290 35183 34665 gene locus_tag LOCUS_17300 35183 34665 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888793.1 protein_id gnl|my_center|LOCUS_17300 36684 35290 gene locus_tag LOCUS_17310 36684 35290 CDS product DUF3999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765555.1 protein_id gnl|my_center|LOCUS_17310 39857 36834 gene locus_tag LOCUS_17320 39857 36834 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105345.1 protein_id gnl|my_center|LOCUS_17320 40570 44472 gene locus_tag LOCUS_17330 gene purL 40570 44472 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970035.1 protein_id gnl|my_center|LOCUS_17330 45619 44534 gene locus_tag LOCUS_17340 gene aroF 45619 44534 CDS product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370264.1 protein_id gnl|my_center|LOCUS_17340 45946 46869 gene locus_tag LOCUS_17350 45946 46869 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262252.1 protein_id gnl|my_center|LOCUS_17350 47838 46894 gene locus_tag LOCUS_17360 47838 46894 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643099.1 protein_id gnl|my_center|LOCUS_17360 48084 48707 gene locus_tag LOCUS_17370 48084 48707 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643097.1 protein_id gnl|my_center|LOCUS_17370 48707 51172 gene locus_tag LOCUS_17380 48707 51172 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262027.1 protein_id gnl|my_center|LOCUS_17380 51147 52367 gene locus_tag LOCUS_17390 51147 52367 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989913.1 protein_id gnl|my_center|LOCUS_17390 53541 52462 gene locus_tag LOCUS_17400 gene aroB 53541 52462 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208898.1 protein_id gnl|my_center|LOCUS_17400 53662 55266 gene locus_tag LOCUS_17410 53662 55266 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 protein_id gnl|my_center|LOCUS_17410 55291 55629 gene locus_tag LOCUS_17420 gene glnB 55291 55629 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860685.1 protein_id gnl|my_center|LOCUS_17420 56289 55636 gene locus_tag LOCUS_17430 56289 55636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 56598 57212 gene locus_tag LOCUS_17440 56598 57212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 58551 57322 gene locus_tag LOCUS_17450 gene rhlB 58551 57322 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228177.1 protein_id gnl|my_center|LOCUS_17450 58707 59033 gene locus_tag LOCUS_17460 gene trxA 58707 59033 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280776.1 protein_id gnl|my_center|LOCUS_17460 59382 60644 gene locus_tag LOCUS_17470 gene rho 59382 60644 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054532.1 protein_id gnl|my_center|LOCUS_17470 60819 62234 gene locus_tag LOCUS_17480 gene gndA 60819 62234 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043484.1 protein_id gnl|my_center|LOCUS_17480 62620 64755 gene locus_tag LOCUS_17490 gene nrdD 62620 64755 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187778.1 protein_id gnl|my_center|LOCUS_17490 64773 65237 gene locus_tag LOCUS_17500 gene nrdG 64773 65237 CDS product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106222.1 protein_id gnl|my_center|LOCUS_17500 65910 65248 gene locus_tag LOCUS_17510 gene can 65910 65248 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651604.1 protein_id gnl|my_center|LOCUS_17510 67039 65981 gene locus_tag LOCUS_17520 gene cbrA 67039 65981 CDS product colicin M resistance lipid reductase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602615.1 protein_id gnl|my_center|LOCUS_17520 68285 67245 gene locus_tag LOCUS_17530 gene yjiA 68285 67245 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268931.1 protein_id gnl|my_center|LOCUS_17530 68499 68302 gene locus_tag LOCUS_17540 68499 68302 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893903.1 protein_id gnl|my_center|LOCUS_17540 68792 70045 gene locus_tag LOCUS_17550 gene murA 68792 70045 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357265.1 protein_id gnl|my_center|LOCUS_17550 70102 70677 gene locus_tag LOCUS_17560 gene yajL 70102 70677 CDS product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208657.1 protein_id gnl|my_center|LOCUS_17560 70689 71585 gene locus_tag LOCUS_17570 gene fieF 70689 71585 CDS product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368935.1 protein_id gnl|my_center|LOCUS_17570 71678 72640 gene locus_tag LOCUS_17580 gene pfkA 71678 72640 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368934.1 protein_id gnl|my_center|LOCUS_17580 72903 73160 gene locus_tag LOCUS_17590 72903 73160 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098585.1 protein_id gnl|my_center|LOCUS_17590 73792 74379 gene locus_tag LOCUS_17600 73792 74379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence15 1126 4431 gene locus_tag LOCUS_17610 gene yapE 1126 4431 CDS product autotransporter adhesin YapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817383.1 protein_id gnl|my_center|LOCUS_17610 4731 6314 gene locus_tag LOCUS_17620 gene guaA 4731 6314 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138293.1 protein_id gnl|my_center|LOCUS_17620 7637 6402 gene locus_tag LOCUS_17630 7637 6402 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268088.1 protein_id gnl|my_center|LOCUS_17630 7960 7661 gene locus_tag LOCUS_17640 7960 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 10364 8775 gene locus_tag LOCUS_17650 10364 8775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 10833 10348 gene locus_tag LOCUS_17660 10833 10348 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188927153.1 protein_id gnl|my_center|LOCUS_17660 12533 10830 gene locus_tag LOCUS_17670 12533 10830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 13557 12523 gene locus_tag LOCUS_17680 13557 12523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 14336 13965 gene locus_tag LOCUS_17690 14336 13965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 14409 14753 gene locus_tag LOCUS_17700 14409 14753 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969729.1 protein_id gnl|my_center|LOCUS_17700 15097 15621 gene locus_tag LOCUS_17710 gene prpB 15097 15621 CDS product protein arginine phosphatase PrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227664.1 protein_id gnl|my_center|LOCUS_17710 16436 16224 gene locus_tag LOCUS_17720 16436 16224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 16616 17086 gene locus_tag LOCUS_17730 16616 17086 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209301.1 protein_id gnl|my_center|LOCUS_17730 17114 18052 gene locus_tag LOCUS_17740 17114 18052 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817387.1 protein_id gnl|my_center|LOCUS_17740 18868 18131 gene locus_tag LOCUS_17750 18868 18131 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485222.1 protein_id gnl|my_center|LOCUS_17750 19179 22019 gene locus_tag LOCUS_17760 gene uvrA 19179 22019 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368747.1 protein_id gnl|my_center|LOCUS_17760 22065 22664 gene locus_tag LOCUS_17770 gene plsY 22065 22664 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160822.1 protein_id gnl|my_center|LOCUS_17770 22875 23480 gene locus_tag LOCUS_17780 gene recR 22875 23480 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367906.1 protein_id gnl|my_center|LOCUS_17780 23561 24382 gene locus_tag LOCUS_17790 23561 24382 CDS product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816800.1 protein_id gnl|my_center|LOCUS_17790 24398 25105 gene locus_tag LOCUS_17800 gene truC 24398 25105 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889996.1 protein_id gnl|my_center|LOCUS_17800 25350 25763 gene locus_tag LOCUS_17810 25350 25763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 25888 26298 gene locus_tag LOCUS_17820 25888 26298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 26374 26994 gene locus_tag LOCUS_17830 26374 26994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 28168 27110 gene locus_tag LOCUS_17840 28168 27110 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437792.1 protein_id gnl|my_center|LOCUS_17840 28998 28183 gene locus_tag LOCUS_17850 28998 28183 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981721.1 protein_id gnl|my_center|LOCUS_17850 29786 28995 gene locus_tag LOCUS_17860 29786 28995 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071854933.1 protein_id gnl|my_center|LOCUS_17860 30297 29824 gene locus_tag LOCUS_17870 30297 29824 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020988.1 protein_id gnl|my_center|LOCUS_17870 30740 30309 gene locus_tag LOCUS_17880 30740 30309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 31794 30949 gene locus_tag LOCUS_17890 31794 30949 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027818.1 protein_id gnl|my_center|LOCUS_17890 32313 32017 gene locus_tag LOCUS_17900 32313 32017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 32704 32777 gene locus_tag LOCUS_t00300 32704 32777 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 33737 33937 gene locus_tag LOCUS_17910 33737 33937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 35102 33954 gene locus_tag LOCUS_17920 gene cdaR 35102 33954 CDS product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929450.1 protein_id gnl|my_center|LOCUS_17920 36461 35316 gene locus_tag LOCUS_17930 36461 35316 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966119.1 protein_id gnl|my_center|LOCUS_17930 37783 36479 gene locus_tag LOCUS_17940 37783 36479 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379729.1 protein_id gnl|my_center|LOCUS_17940 38194 39537 gene locus_tag LOCUS_17950 gene yegQ 38194 39537 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475997.1 protein_id gnl|my_center|LOCUS_17950 40842 39589 gene locus_tag LOCUS_17960 gene proA 40842 39589 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032901182.1 protein_id gnl|my_center|LOCUS_17960 41383 40853 gene locus_tag LOCUS_17970 41383 40853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 41834 41409 gene locus_tag LOCUS_17980 41834 41409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 42477 42055 gene locus_tag LOCUS_17990 42477 42055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 42801 42511 gene locus_tag LOCUS_18000 42801 42511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 43934 42825 gene locus_tag LOCUS_18010 gene proB 43934 42825 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285288.1 protein_id gnl|my_center|LOCUS_18010 45220 43961 gene locus_tag LOCUS_18020 gene frsA 45220 43961 CDS product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816927.1 protein_id gnl|my_center|LOCUS_18020 45777 45247 gene locus_tag LOCUS_18030 gene gpt 45777 45247 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291990.1 protein_id gnl|my_center|LOCUS_18030 45927 47390 gene locus_tag LOCUS_18040 gene pepD 45927 47390 CDS product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292984.1 protein_id gnl|my_center|LOCUS_18040 47589 48599 gene locus_tag LOCUS_18050 gene argC 47589 48599 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209489.1 protein_id gnl|my_center|LOCUS_18050 48651 49430 gene locus_tag LOCUS_18060 gene argB 48651 49430 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295507.1 protein_id gnl|my_center|LOCUS_18060 49538 50830 gene locus_tag LOCUS_18070 49538 50830 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874007.1 protein_id gnl|my_center|LOCUS_18070 50982 50755 gene locus_tag LOCUS_18080 50982 50755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 50994 52370 gene locus_tag LOCUS_18090 gene argH 50994 52370 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099298.1 protein_id gnl|my_center|LOCUS_18090 52528 53613 gene locus_tag LOCUS_18100 gene serC 52528 53613 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211326.1 protein_id gnl|my_center|LOCUS_18100 54083 53673 gene locus_tag LOCUS_18110 54083 53673 CDS product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175566.1 protein_id gnl|my_center|LOCUS_18110 54253 54329 gene locus_tag LOCUS_t00310 54253 54329 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 56313 55189 gene locus_tag LOCUS_18120 56313 55189 CDS product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816081.1 protein_id gnl|my_center|LOCUS_18120 56758 56321 gene locus_tag LOCUS_18130 56758 56321 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140365.1 protein_id gnl|my_center|LOCUS_18130 59090 56760 gene locus_tag LOCUS_18140 59090 56760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 59659 59360 gene locus_tag LOCUS_18150 59659 59360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 60241 59729 gene locus_tag LOCUS_18160 60241 59729 CDS product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816083.1 protein_id gnl|my_center|LOCUS_18160 <61063 60255 gene locus_tag LOCUS_18170 <61063 60255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004531063.1:phage tail sheath protein >Feature sequence16 581 234 gene locus_tag LOCUS_18180 581 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18180 962 717 gene locus_tag LOCUS_18190 962 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 977 1249 gene locus_tag LOCUS_18200 977 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1866 2318 gene locus_tag LOCUS_18210 gene nrdR 1866 2318 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543535.1 protein_id gnl|my_center|LOCUS_18210 2328 3437 gene locus_tag LOCUS_18220 gene ribD 2328 3437 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150440.1 protein_id gnl|my_center|LOCUS_18220 3501 3938 gene locus_tag LOCUS_18230 3501 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 4402 4055 gene locus_tag LOCUS_18240 4402 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18240 5965 4550 gene locus_tag LOCUS_18250 5965 4550 CDS product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719918.1 protein_id gnl|my_center|LOCUS_18250 6898 5978 gene locus_tag LOCUS_18260 gene pfkB 6898 5978 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986527.1 protein_id gnl|my_center|LOCUS_18260 7764 6910 gene locus_tag LOCUS_18270 7764 6910 CDS product tagatose bisphosphate family class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469985.1 protein_id gnl|my_center|LOCUS_18270 8107 8934 gene locus_tag LOCUS_18280 8107 8934 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118366.1 protein_id gnl|my_center|LOCUS_18280 8936 9901 gene locus_tag LOCUS_18290 8936 9901 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027808.1 protein_id gnl|my_center|LOCUS_18290 11285 10152 gene locus_tag LOCUS_18300 gene hemW 11285 10152 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817047.1 protein_id gnl|my_center|LOCUS_18300 11483 12355 gene locus_tag LOCUS_18310 11483 12355 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211679.1 protein_id gnl|my_center|LOCUS_18310 12537 12821 gene locus_tag LOCUS_18320 gene rplY 12537 12821 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494192.1 protein_id gnl|my_center|LOCUS_18320 13004 14464 gene locus_tag LOCUS_18330 gene zwf 13004 14464 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211191.1 protein_id gnl|my_center|LOCUS_18330 14478 15176 gene locus_tag LOCUS_18340 gene pgl 14478 15176 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_18340 15588 16034 gene locus_tag LOCUS_18350 gene mraZ 15588 16034 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210443.1 protein_id gnl|my_center|LOCUS_18350 16053 16991 gene locus_tag LOCUS_18360 gene rsmH 16053 16991 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970479.1 protein_id gnl|my_center|LOCUS_18360 16981 17358 gene locus_tag LOCUS_18370 gene ftsL 16981 17358 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156880.1 protein_id gnl|my_center|LOCUS_18370 17358 19136 gene locus_tag LOCUS_18380 17358 19136 CDS product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368251.1 protein_id gnl|my_center|LOCUS_18380 19150 20700 gene locus_tag LOCUS_18390 gene murE 19150 20700 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785149.1 protein_id gnl|my_center|LOCUS_18390 20697 22052 gene locus_tag LOCUS_18400 gene murF 20697 22052 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095571.1 protein_id gnl|my_center|LOCUS_18400 22071 23153 gene locus_tag LOCUS_18410 gene mraY 22071 23153 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210437.1 protein_id gnl|my_center|LOCUS_18410 23175 24509 gene locus_tag LOCUS_18420 gene murD 23175 24509 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796468.1 protein_id gnl|my_center|LOCUS_18420 24506 25657 gene locus_tag LOCUS_18430 gene ftsW 24506 25657 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295532.1 protein_id gnl|my_center|LOCUS_18430 25657 26709 gene locus_tag LOCUS_18440 gene murG 25657 26709 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016582.1 protein_id gnl|my_center|LOCUS_18440 26858 28306 gene locus_tag LOCUS_18450 gene murC 26858 28306 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815569.1 protein_id gnl|my_center|LOCUS_18450 28307 29215 gene locus_tag LOCUS_18460 28307 29215 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210432.1 protein_id gnl|my_center|LOCUS_18460 29228 30058 gene locus_tag LOCUS_18470 gene ftsQ 29228 30058 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075728.1 protein_id gnl|my_center|LOCUS_18470 30080 31333 gene locus_tag LOCUS_18480 gene ftsA 30080 31333 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006173845.1 protein_id gnl|my_center|LOCUS_18480 31415 32554 gene locus_tag LOCUS_18490 gene ftsZ 31415 32554 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462798.1 protein_id gnl|my_center|LOCUS_18490 32622 33536 gene locus_tag LOCUS_18500 gene lpxC 32622 33536 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389005.1 protein_id gnl|my_center|LOCUS_18500 33620 34213 gene locus_tag LOCUS_18510 gene yfbR 33620 34213 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171739.1 protein_id gnl|my_center|LOCUS_18510 36749 34302 gene locus_tag LOCUS_18520 36749 34302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 37544 36873 gene locus_tag LOCUS_18530 37544 36873 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598666.1 protein_id gnl|my_center|LOCUS_18530 39165 37522 gene locus_tag LOCUS_18540 39165 37522 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746428.1 protein_id gnl|my_center|LOCUS_18540 40435 39278 gene locus_tag LOCUS_18550 40435 39278 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360544.1 protein_id gnl|my_center|LOCUS_18550 41852 40557 gene locus_tag LOCUS_18560 41852 40557 CDS product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363749.1 protein_id gnl|my_center|LOCUS_18560 42263 42012 gene locus_tag LOCUS_18570 42263 42012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 43014 42349 gene locus_tag LOCUS_18580 43014 42349 CDS product DUF799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211607.1 protein_id gnl|my_center|LOCUS_18580 43377 43018 gene locus_tag LOCUS_18590 43377 43018 CDS product DUF4810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815875.1 protein_id gnl|my_center|LOCUS_18590 44083 43412 gene locus_tag LOCUS_18600 44083 43412 CDS product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215847.1 protein_id gnl|my_center|LOCUS_18600 45158 44571 gene locus_tag LOCUS_18610 45158 44571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 46047 45343 gene locus_tag LOCUS_18620 46047 45343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 46579 46875 gene locus_tag LOCUS_18630 46579 46875 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156248.1 protein_id gnl|my_center|LOCUS_18630 47946 46957 gene locus_tag LOCUS_18640 47946 46957 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175762.1 protein_id gnl|my_center|LOCUS_18640 48574 47963 gene locus_tag LOCUS_18650 gene yihA 48574 47963 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183344.1 protein_id gnl|my_center|LOCUS_18650 49853 48642 gene locus_tag LOCUS_18660 49853 48642 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369401.1 protein_id gnl|my_center|LOCUS_18660 50070 50339 gene locus_tag LOCUS_18670 50070 50339 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648477.1 protein_id gnl|my_center|LOCUS_18670 50348 51418 gene locus_tag LOCUS_18680 gene mltC 50348 51418 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209995.1 protein_id gnl|my_center|LOCUS_18680 51617 52465 gene locus_tag LOCUS_18690 gene focA 51617 52465 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367477.1 protein_id gnl|my_center|LOCUS_18690 >Feature sequence17 492 4220 gene locus_tag LOCUS_18700 492 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 4611 8363 gene locus_tag LOCUS_18710 4611 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 8995 12810 gene locus_tag LOCUS_18720 8995 12810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 12804 13901 gene locus_tag LOCUS_18730 12804 13901 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208437.1 protein_id gnl|my_center|LOCUS_18730 13911 16466 gene locus_tag LOCUS_18740 13911 16466 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084336.1 protein_id gnl|my_center|LOCUS_18740 16475 17650 gene locus_tag LOCUS_18750 16475 17650 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786824.1 protein_id gnl|my_center|LOCUS_18750 17647 19779 gene locus_tag LOCUS_18760 17647 19779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 24628 19997 gene locus_tag LOCUS_18770 24628 19997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 24858 25313 gene locus_tag LOCUS_18780 24858 25313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 27420 25324 gene locus_tag LOCUS_18790 gene yccS 27420 25324 CDS product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816054.1 protein_id gnl|my_center|LOCUS_18790 28269 27892 gene locus_tag LOCUS_18800 28269 27892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 28947 28321 gene locus_tag LOCUS_18810 gene lexA 28947 28321 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 protein_id gnl|my_center|LOCUS_18810 29263 29877 gene locus_tag LOCUS_18820 gene coaE 29263 29877 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209319.1 protein_id gnl|my_center|LOCUS_18820 29870 30607 gene locus_tag LOCUS_18830 gene zapD 29870 30607 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167091.1 protein_id gnl|my_center|LOCUS_18830 30633 30851 gene locus_tag LOCUS_18840 gene yacG 30633 30851 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209317.1 protein_id gnl|my_center|LOCUS_18840 30851 31861 gene locus_tag LOCUS_18850 gene tsaD 30851 31861 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369630.1 protein_id gnl|my_center|LOCUS_18850 32289 31960 gene locus_tag LOCUS_18860 32289 31960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 32417 34177 gene locus_tag LOCUS_18870 32417 34177 CDS product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367476.1 protein_id gnl|my_center|LOCUS_18870 34647 35606 gene locus_tag LOCUS_18880 34647 35606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 36919 36089 gene locus_tag LOCUS_18890 36919 36089 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215853.1 protein_id gnl|my_center|LOCUS_18890 38896 37538 gene locus_tag LOCUS_18900 38896 37538 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965834.1 protein_id gnl|my_center|LOCUS_18900 39581 38910 gene locus_tag LOCUS_18910 39581 38910 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342247.1 protein_id gnl|my_center|LOCUS_18910 40600 39581 gene locus_tag LOCUS_18920 gene sfbB 40600 39581 CDS product virulence-associated ABC transporter ATP-binding protein SfbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569655.1 protein_id gnl|my_center|LOCUS_18920 41421 40603 gene locus_tag LOCUS_18930 41421 40603 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524312.1 protein_id gnl|my_center|LOCUS_18930 42581 41406 gene locus_tag LOCUS_18940 42581 41406 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_18940 43747 44853 gene locus_tag LOCUS_18950 43747 44853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 46014 47129 gene locus_tag LOCUS_18960 46014 47129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence18 1909 587 gene locus_tag LOCUS_18970 1909 587 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286021.1 protein_id gnl|my_center|LOCUS_18970 3517 2018 gene locus_tag LOCUS_18980 3517 2018 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174191.1 protein_id gnl|my_center|LOCUS_18980 4994 3531 gene locus_tag LOCUS_18990 4994 3531 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174192.1 protein_id gnl|my_center|LOCUS_18990 6425 5013 gene locus_tag LOCUS_19000 gene uxaC 6425 5013 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174193.1 protein_id gnl|my_center|LOCUS_19000 7762 6494 gene locus_tag LOCUS_19010 7762 6494 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002353699.1 protein_id gnl|my_center|LOCUS_19010 7933 8787 gene locus_tag LOCUS_19020 gene exuR 7933 8787 CDS product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174195.1 protein_id gnl|my_center|LOCUS_19020 9941 9348 gene locus_tag LOCUS_19030 gene lolA 9941 9348 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211338.1 protein_id gnl|my_center|LOCUS_19030 10117 11457 gene locus_tag LOCUS_19040 10117 11457 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171047.1 protein_id gnl|my_center|LOCUS_19040 12131 13537 gene locus_tag LOCUS_19050 12131 13537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 14223 15617 gene locus_tag LOCUS_19060 14223 15617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 15959 18244 gene locus_tag LOCUS_19070 gene nrdA 15959 18244 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815972.1 protein_id gnl|my_center|LOCUS_19070 18378 19514 gene locus_tag LOCUS_19080 gene nrdB 18378 19514 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299501.1 protein_id gnl|my_center|LOCUS_19080 19835 22498 gene locus_tag LOCUS_19090 gene glnD 19835 22498 CDS product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173232.1 protein_id gnl|my_center|LOCUS_19090 22523 23446 gene locus_tag LOCUS_19100 22523 23446 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721396.1 protein_id gnl|my_center|LOCUS_19100 24289 23609 gene locus_tag LOCUS_19110 24289 23609 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289185.1 protein_id gnl|my_center|LOCUS_19110 24663 27263 gene locus_tag LOCUS_19120 gene mprF 24663 27263 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112595.1 protein_id gnl|my_center|LOCUS_19120 27268 28548 gene locus_tag LOCUS_19130 27268 28548 CDS product virulence factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112596.1 protein_id gnl|my_center|LOCUS_19130 29473 28607 gene locus_tag LOCUS_19140 29473 28607 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234873.1 protein_id gnl|my_center|LOCUS_19140 31118 30126 gene locus_tag LOCUS_19150 31118 30126 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296809.1 protein_id gnl|my_center|LOCUS_19150 31404 32807 gene locus_tag LOCUS_19160 31404 32807 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296810.1 protein_id gnl|my_center|LOCUS_19160 32951 34342 gene locus_tag LOCUS_19170 32951 34342 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_19170 34636 35000 gene locus_tag LOCUS_tm00010 34636 35000 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 35184 36434 gene locus_tag LOCUS_19180 35184 36434 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101723.1 protein_id gnl|my_center|LOCUS_19180 37629 38843 gene locus_tag LOCUS_19190 37629 38843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 39506 40186 gene locus_tag LOCUS_19200 39506 40186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 40332 40532 gene locus_tag LOCUS_19210 40332 40532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 41359 41192 gene locus_tag LOCUS_19220 41359 41192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170387.1 protein_id gnl|my_center|LOCUS_19220 41463 41855 gene locus_tag LOCUS_19230 41463 41855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 41848 42222 gene locus_tag LOCUS_19240 41848 42222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence19 772 236 gene locus_tag LOCUS_19250 gene gmhB 772 236 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220062.1 protein_id gnl|my_center|LOCUS_19250 889 1920 gene locus_tag LOCUS_19260 gene metN 889 1920 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095679.1 protein_id gnl|my_center|LOCUS_19260 1913 2674 gene locus_tag LOCUS_19270 1913 2674 CDS product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212160.1 protein_id gnl|my_center|LOCUS_19270 2689 3588 gene locus_tag LOCUS_19280 gene metQ 2689 3588 CDS product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874226.1 protein_id gnl|my_center|LOCUS_19280 3711 4424 gene locus_tag LOCUS_19290 gene tsaA 3711 4424 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212157.1 protein_id gnl|my_center|LOCUS_19290 5605 4742 gene locus_tag LOCUS_19300 gene hslO 5605 4742 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208911.1 protein_id gnl|my_center|LOCUS_19300 6005 5607 gene locus_tag LOCUS_19310 gene hslR 6005 5607 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159667.1 protein_id gnl|my_center|LOCUS_19310 7731 6109 gene locus_tag LOCUS_19320 7731 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 7942 8418 gene locus_tag LOCUS_19330 gene greA 7942 8418 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148008.1 protein_id gnl|my_center|LOCUS_19330 8749 8456 gene locus_tag LOCUS_19340 gene yhbY 8749 8456 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650404.1 protein_id gnl|my_center|LOCUS_19340 8848 9474 gene locus_tag LOCUS_19350 gene rlmE 8848 9474 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145971.1 protein_id gnl|my_center|LOCUS_19350 9598 11430 gene locus_tag LOCUS_19360 gene ftsH 9598 11430 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107466.1 protein_id gnl|my_center|LOCUS_19360 11545 12381 gene locus_tag LOCUS_19370 gene folP 11545 12381 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703603.1 protein_id gnl|my_center|LOCUS_19370 13641 12811 gene locus_tag LOCUS_19380 gene ubiA 13641 12811 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095050.1 protein_id gnl|my_center|LOCUS_19380 14343 13759 gene locus_tag LOCUS_19390 14343 13759 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228419.1 protein_id gnl|my_center|LOCUS_19390 15236 14397 gene locus_tag LOCUS_19400 15236 14397 CDS product dimethyl sulfoxide reductase anchor subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211604.1 protein_id gnl|my_center|LOCUS_19400 15852 15238 gene locus_tag LOCUS_19410 gene dmsB 15852 15238 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211603.1 protein_id gnl|my_center|LOCUS_19410 18325 15872 gene locus_tag LOCUS_19420 18325 15872 CDS product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211602.1 protein_id gnl|my_center|LOCUS_19420 18564 20453 gene locus_tag LOCUS_19430 gene parE 18564 20453 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212181.1 protein_id gnl|my_center|LOCUS_19430 20481 22706 gene locus_tag LOCUS_19440 gene parC 20481 22706 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212178.1 protein_id gnl|my_center|LOCUS_19440 22711 23556 gene locus_tag LOCUS_19450 gene djlA 22711 23556 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095544.1 protein_id gnl|my_center|LOCUS_19450 23568 25016 gene locus_tag LOCUS_19460 gene trkH 23568 25016 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176271.1 protein_id gnl|my_center|LOCUS_19460 25172 26734 gene locus_tag LOCUS_19470 25172 26734 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211875.1 protein_id gnl|my_center|LOCUS_19470 26934 28244 gene locus_tag LOCUS_19480 gene adeP 26934 28244 CDS product adenine permease AdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214973.1 protein_id gnl|my_center|LOCUS_19480 28614 29933 gene locus_tag LOCUS_19490 gene xylA 28614 29933 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817425.1 protein_id gnl|my_center|LOCUS_19490 30028 31485 gene locus_tag LOCUS_19500 gene xylB 30028 31485 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275365.1 protein_id gnl|my_center|LOCUS_19500 32113 31550 gene locus_tag LOCUS_19510 32113 31550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19510 32739 32110 gene locus_tag LOCUS_19520 32739 32110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19520 33181 33555 gene locus_tag LOCUS_19530 gene rpsL 33181 33555 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212323.1 protein_id gnl|my_center|LOCUS_19530 33656 34126 gene locus_tag LOCUS_19540 gene rpsG 33656 34126 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212324.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence20 778 2898 gene locus_tag LOCUS_19550 gene rlmKL 778 2898 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211293.1 protein_id gnl|my_center|LOCUS_19550 3589 3206 gene locus_tag LOCUS_19560 3589 3206 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703163.1 protein_id gnl|my_center|LOCUS_19560 4584 4156 gene locus_tag LOCUS_19570 gene uspF 4584 4156 CDS product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082296.1 protein_id gnl|my_center|LOCUS_19570 4800 5210 gene locus_tag LOCUS_19580 4800 5210 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 protein_id gnl|my_center|LOCUS_19580 5207 5788 gene locus_tag LOCUS_19590 5207 5788 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367195.1 protein_id gnl|my_center|LOCUS_19590 6517 5852 gene locus_tag LOCUS_19600 6517 5852 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085164002.1 protein_id gnl|my_center|LOCUS_19600 7728 6517 gene locus_tag LOCUS_19610 7728 6517 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679166.1 protein_id gnl|my_center|LOCUS_19610 8232 7765 gene locus_tag LOCUS_19620 8232 7765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 8910 8251 gene locus_tag LOCUS_19630 8910 8251 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669030.1 protein_id gnl|my_center|LOCUS_19630 10063 8921 gene locus_tag LOCUS_19640 10063 8921 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017093.1 protein_id gnl|my_center|LOCUS_19640 11367 10081 gene locus_tag LOCUS_19650 11367 10081 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494592.1 protein_id gnl|my_center|LOCUS_19650 12690 11389 gene locus_tag LOCUS_19660 12690 11389 CDS product Fe-S-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671216.1 protein_id gnl|my_center|LOCUS_19660 13302 12739 gene locus_tag LOCUS_19670 13302 12739 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669021.1 protein_id gnl|my_center|LOCUS_19670 14719 13520 gene locus_tag LOCUS_19680 14719 13520 CDS product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669020.1 protein_id gnl|my_center|LOCUS_19680 15373 14735 gene locus_tag LOCUS_19690 15373 14735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 16018 16229 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atgttccctgtacacacagggataaaccg 16551 17828 gene locus_tag LOCUS_19700 16551 17828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 17828 18136 gene locus_tag LOCUS_19710 17828 18136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 18143 18442 gene locus_tag LOCUS_19720 18143 18442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 18565 18876 gene locus_tag LOCUS_19730 18565 18876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 18898 19209 gene locus_tag LOCUS_19740 18898 19209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 19786 20217 gene locus_tag LOCUS_19750 19786 20217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 20559 20969 gene locus_tag LOCUS_19760 20559 20969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 21020 21353 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atgttccctgtatacacagggataaaccg 21449 21994 gene locus_tag LOCUS_19770 21449 21994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 22245 22063 gene locus_tag LOCUS_19780 22245 22063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 22878 23804 gene locus_tag LOCUS_19790 22878 23804 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210140.1 protein_id gnl|my_center|LOCUS_19790 24444 24289 gene locus_tag LOCUS_19800 24444 24289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 24841 25962 gene locus_tag LOCUS_19810 gene rfaG 24841 25962 CDS product lipopolysaccharide glucosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634283.1 protein_id gnl|my_center|LOCUS_19810 25955 26758 gene locus_tag LOCUS_19820 gene rfaP 25955 26758 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298957.1 protein_id gnl|my_center|LOCUS_19820 26773 28401 gene locus_tag LOCUS_19830 26773 28401 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816028.1 protein_id gnl|my_center|LOCUS_19830 30235 28568 gene locus_tag LOCUS_19840 gene ettA 30235 28568 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704886.1 protein_id gnl|my_center|LOCUS_19840 31138 30494 gene locus_tag LOCUS_19850 gene nfsB 31138 30494 CDS product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207095.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence21 146 430 gene locus_tag LOCUS_19860 146 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 1182 427 gene locus_tag LOCUS_19870 1182 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2111 1179 gene locus_tag LOCUS_19880 2111 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 2630 2115 gene locus_tag LOCUS_19890 2630 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 3607 2642 gene locus_tag LOCUS_19900 3607 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 4956 5840 gene locus_tag LOCUS_19910 4956 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 5982 7886 gene locus_tag LOCUS_19920 5982 7886 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047326435.1 protein_id gnl|my_center|LOCUS_19920 7883 9562 gene locus_tag LOCUS_19930 7883 9562 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775114.1 protein_id gnl|my_center|LOCUS_19930 10099 11124 gene locus_tag LOCUS_19940 10099 11124 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084243.1 protein_id gnl|my_center|LOCUS_19940 11216 12049 gene locus_tag LOCUS_19950 gene cysT 11216 12049 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401602.1 protein_id gnl|my_center|LOCUS_19950 12064 12918 gene locus_tag LOCUS_19960 gene cysW 12064 12918 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380253.1 protein_id gnl|my_center|LOCUS_19960 12928 14007 gene locus_tag LOCUS_19970 12928 14007 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027092.1 protein_id gnl|my_center|LOCUS_19970 14985 14032 gene locus_tag LOCUS_19980 gene cbl 14985 14032 CDS product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816563.1 protein_id gnl|my_center|LOCUS_19980 17115 15349 gene locus_tag LOCUS_19990 gene cysI 17115 15349 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209382.1 protein_id gnl|my_center|LOCUS_19990 18953 17154 gene locus_tag LOCUS_20000 gene cysJ 18953 17154 CDS product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815604.1 protein_id gnl|my_center|LOCUS_20000 19728 19093 gene locus_tag LOCUS_20010 19728 19093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 20938 19778 gene locus_tag LOCUS_20020 gene sat 20938 19778 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_20020 21207 22079 gene locus_tag LOCUS_20030 21207 22079 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095399.1 protein_id gnl|my_center|LOCUS_20030 22100 23059 gene locus_tag LOCUS_20040 22100 23059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266855.1 protein_id gnl|my_center|LOCUS_20040 25057 23453 gene locus_tag LOCUS_20050 25057 23453 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705005.1 protein_id gnl|my_center|LOCUS_20050 25328 26791 gene locus_tag LOCUS_20060 25328 26791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 27054 27779 gene locus_tag LOCUS_20070 27054 27779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 28147 30018 gene locus_tag LOCUS_20080 28147 30018 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092480236.1 protein_id gnl|my_center|LOCUS_20080 30022 31488 gene locus_tag LOCUS_20090 30022 31488 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092480235.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence22 377 177 gene locus_tag LOCUS_20100 gene csrA 377 177 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213314.1 protein_id gnl|my_center|LOCUS_20100 3163 530 gene locus_tag LOCUS_20110 gene alaS 3163 530 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047198.1 protein_id gnl|my_center|LOCUS_20110 3876 3376 gene locus_tag LOCUS_20120 gene recX 3876 3376 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167422.1 protein_id gnl|my_center|LOCUS_20120 4922 3876 gene locus_tag LOCUS_20130 gene recA 4922 3876 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707431.1 protein_id gnl|my_center|LOCUS_20130 5472 6725 gene locus_tag LOCUS_20140 gene pqiA 5472 6725 CDS product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026017889.1 protein_id gnl|my_center|LOCUS_20140 6733 8370 gene locus_tag LOCUS_20150 gene pqiB 6733 8370 CDS product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445533.1 protein_id gnl|my_center|LOCUS_20150 8370 8954 gene locus_tag LOCUS_20160 gene pqiC 8370 8954 CDS product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759136.1 protein_id gnl|my_center|LOCUS_20160 10746 9007 gene locus_tag LOCUS_20170 gene pabB 10746 9007 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722110.1 protein_id gnl|my_center|LOCUS_20170 11323 10754 gene locus_tag LOCUS_20180 gene pabA 11323 10754 CDS product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369400.1 protein_id gnl|my_center|LOCUS_20180 11819 12832 gene locus_tag LOCUS_20190 gene yiaK 11819 12832 CDS product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869006.1 protein_id gnl|my_center|LOCUS_20190 12919 14427 gene locus_tag LOCUS_20200 12919 14427 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096787.1 protein_id gnl|my_center|LOCUS_20200 14806 16020 gene locus_tag LOCUS_20210 gene rspA 14806 16020 CDS product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295394.1 protein_id gnl|my_center|LOCUS_20210 16036 17052 gene locus_tag LOCUS_20220 16036 17052 CDS product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096790.1 protein_id gnl|my_center|LOCUS_20220 17096 18445 gene locus_tag LOCUS_20230 17096 18445 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419305.1 protein_id gnl|my_center|LOCUS_20230 18462 19943 gene locus_tag LOCUS_20240 18462 19943 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705299.1 protein_id gnl|my_center|LOCUS_20240 20128 20811 gene locus_tag LOCUS_20250 20128 20811 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215563.1 protein_id gnl|my_center|LOCUS_20250 20792 20977 gene locus_tag LOCUS_20260 20792 20977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 20974 21252 gene locus_tag LOCUS_20270 gene yccX 20974 21252 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072884.1 protein_id gnl|my_center|LOCUS_20270 21951 21358 gene locus_tag LOCUS_20280 21951 21358 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074062.1 protein_id gnl|my_center|LOCUS_20280 22234 22797 gene locus_tag LOCUS_20290 22234 22797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 22802 23353 gene locus_tag LOCUS_20300 gene lptA 22802 23353 CDS product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669770.1 protein_id gnl|my_center|LOCUS_20300 23355 24080 gene locus_tag LOCUS_20310 gene lptB 23355 24080 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210116.1 protein_id gnl|my_center|LOCUS_20310 24077 25495 gene locus_tag LOCUS_20320 gene rpoN 24077 25495 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098942.1 protein_id gnl|my_center|LOCUS_20320 26308 25544 gene locus_tag LOCUS_20330 26308 25544 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211713.1 protein_id gnl|my_center|LOCUS_20330 26954 26352 gene locus_tag LOCUS_20340 gene leuD 26954 26352 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704393.1 protein_id gnl|my_center|LOCUS_20340 28366 26966 gene locus_tag LOCUS_20350 gene leuC 28366 26966 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140652.1 protein_id gnl|my_center|LOCUS_20350 29605 28526 gene locus_tag LOCUS_20360 gene leuB 29605 28526 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095561.1 protein_id gnl|my_center|LOCUS_20360 <30378 29668 gene locus_tag LOCUS_20370 <30378 29668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210453.1:2-isopropylmalate synthase >Feature sequence23 739 287 gene locus_tag LOCUS_20380 739 287 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836391.1 protein_id gnl|my_center|LOCUS_20380 1173 742 gene locus_tag LOCUS_20390 1173 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 1447 1362 gene locus_tag LOCUS_t00320 1447 1362 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1829 1455 gene locus_tag LOCUS_20400 gene secG 1829 1455 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861803.1 protein_id gnl|my_center|LOCUS_20400 2254 3705 gene locus_tag LOCUS_20410 gene thiI 2254 3705 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668687.1 protein_id gnl|my_center|LOCUS_20410 3837 4550 gene locus_tag LOCUS_20420 gene cpxR 3837 4550 CDS product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033727.1 protein_id gnl|my_center|LOCUS_20420 4586 5971 gene locus_tag LOCUS_20430 gene cpxA 4586 5971 CDS product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208971.1 protein_id gnl|my_center|LOCUS_20430 5985 6479 gene locus_tag LOCUS_20440 gene trmL 5985 6479 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932342.1 protein_id gnl|my_center|LOCUS_20440 7203 6637 gene locus_tag LOCUS_20450 gene efp 7203 6637 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855940.1 protein_id gnl|my_center|LOCUS_20450 7236 8264 gene locus_tag LOCUS_20460 gene epmB 7236 8264 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940549.1 protein_id gnl|my_center|LOCUS_20460 8596 8736 gene locus_tag LOCUS_20470 gene rpmH 8596 8736 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831330.1 protein_id gnl|my_center|LOCUS_20470 8781 9104 gene locus_tag LOCUS_20480 gene rnpA 8781 9104 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099420.1 protein_id gnl|my_center|LOCUS_20480 9071 9397 gene locus_tag LOCUS_20490 9071 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 9397 11013 gene locus_tag LOCUS_20500 gene yidC 9397 11013 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220739.1 protein_id gnl|my_center|LOCUS_20500 11072 11875 gene locus_tag LOCUS_20510 gene nudC 11072 11875 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166081.1 protein_id gnl|my_center|LOCUS_20510 12749 11934 gene locus_tag LOCUS_20520 12749 11934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 13592 12822 gene locus_tag LOCUS_20530 13592 12822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 14988 13975 gene locus_tag LOCUS_20540 gene hemB 14988 13975 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211541.1 protein_id gnl|my_center|LOCUS_20540 15173 15388 gene locus_tag LOCUS_20550 gene rpsU 15173 15388 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 protein_id gnl|my_center|LOCUS_20550 15519 17300 gene locus_tag LOCUS_20560 gene dnaG 15519 17300 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210358.1 protein_id gnl|my_center|LOCUS_20560 17385 19226 gene locus_tag LOCUS_20570 gene rpoD 17385 19226 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437371.1 protein_id gnl|my_center|LOCUS_20570 19294 20265 gene locus_tag LOCUS_20580 19294 20265 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169841.1 protein_id gnl|my_center|LOCUS_20580 20335 21849 gene locus_tag LOCUS_20590 gene pitA 20335 21849 CDS product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209526.1 protein_id gnl|my_center|LOCUS_20590 21915 22367 gene locus_tag LOCUS_20600 gene uspA 21915 22367 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323571.1 protein_id gnl|my_center|LOCUS_20600 22558 23310 gene locus_tag LOCUS_20610 22558 23310 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222631.1 protein_id gnl|my_center|LOCUS_20610 23450 23779 gene locus_tag LOCUS_20620 23450 23779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206662.1 protein_id gnl|my_center|LOCUS_20620 24139 26595 gene locus_tag LOCUS_20630 gene thrA 24139 26595 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209237.1 protein_id gnl|my_center|LOCUS_20630 26596 27534 gene locus_tag LOCUS_20640 gene thrB 26596 27534 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241685.1 protein_id gnl|my_center|LOCUS_20640 27644 28933 gene locus_tag LOCUS_20650 gene thrC 27644 28933 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781061.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence24 765 229 gene locus_tag LOCUS_20660 765 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 795 1061 gene locus_tag LOCUS_20670 795 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 1730 2284 gene locus_tag LOCUS_20680 1730 2284 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356834.1 protein_id gnl|my_center|LOCUS_20680 2585 3670 gene locus_tag LOCUS_20690 2585 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 3680 5251 gene locus_tag LOCUS_20700 3680 5251 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922193.1 protein_id gnl|my_center|LOCUS_20700 5436 5792 gene locus_tag LOCUS_20710 5436 5792 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703145.1 protein_id gnl|my_center|LOCUS_20710 5806 6939 gene locus_tag LOCUS_20720 gene dapE 5806 6939 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277801.1 protein_id gnl|my_center|LOCUS_20720 7026 7211 gene locus_tag LOCUS_20730 7026 7211 CDS product YpfN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172354.1 protein_id gnl|my_center|LOCUS_20730 8041 7220 gene locus_tag LOCUS_20740 gene cysZ 8041 7220 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878167.1 protein_id gnl|my_center|LOCUS_20740 10088 8154 gene locus_tag LOCUS_20750 10088 8154 CDS product tRNA cytosine(34) acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208552.1 protein_id gnl|my_center|LOCUS_20750 10547 10092 gene locus_tag LOCUS_20760 10547 10092 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460707.1 protein_id gnl|my_center|LOCUS_20760 11257 10547 gene locus_tag LOCUS_20770 11257 10547 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208555.1 protein_id gnl|my_center|LOCUS_20770 12208 11513 gene locus_tag LOCUS_20780 12208 11513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 13122 12244 gene locus_tag LOCUS_20790 gene dapA 13122 12244 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365464.1 protein_id gnl|my_center|LOCUS_20790 13976 13218 gene locus_tag LOCUS_20800 13976 13218 CDS product type 2 GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168004.1 protein_id gnl|my_center|LOCUS_20800 14578 15342 gene locus_tag LOCUS_20810 14578 15342 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558842.1 protein_id gnl|my_center|LOCUS_20810 15383 16096 gene locus_tag LOCUS_20820 gene rnt 15383 16096 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169454.1 protein_id gnl|my_center|LOCUS_20820 16497 16159 gene locus_tag LOCUS_20830 16497 16159 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010673955.1 protein_id gnl|my_center|LOCUS_20830 17929 16799 gene locus_tag LOCUS_20840 17929 16799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 19902 18559 gene locus_tag LOCUS_20850 19902 18559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 21837 20305 gene locus_tag LOCUS_20860 21837 20305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 23795 22332 gene locus_tag LOCUS_20870 23795 22332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 25622 24627 gene locus_tag LOCUS_20880 25622 24627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 25932 25600 gene locus_tag LOCUS_20890 25932 25600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 27896 26790 gene locus_tag LOCUS_20900 27896 26790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence25 1619 708 gene locus_tag LOCUS_20910 1619 708 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532966.1 protein_id gnl|my_center|LOCUS_20910 3846 1831 gene locus_tag LOCUS_20920 3846 1831 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972911.1 protein_id gnl|my_center|LOCUS_20920 4892 4017 gene locus_tag LOCUS_20930 gene yihT 4892 4017 CDS product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067413.1 protein_id gnl|my_center|LOCUS_20930 5796 4912 gene locus_tag LOCUS_20940 gene yihU 5796 4912 CDS product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718883.1 protein_id gnl|my_center|LOCUS_20940 5947 6846 gene locus_tag LOCUS_20950 5947 6846 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520529.1 protein_id gnl|my_center|LOCUS_20950 6871 7650 gene locus_tag LOCUS_20960 6871 7650 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059678.1 protein_id gnl|my_center|LOCUS_20960 7991 9130 gene locus_tag LOCUS_20970 7991 9130 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948659.1 protein_id gnl|my_center|LOCUS_20970 9145 10134 gene locus_tag LOCUS_20980 gene dhaK 9145 10134 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701020.1 protein_id gnl|my_center|LOCUS_20980 10147 10725 gene locus_tag LOCUS_20990 gene dhaL 10147 10725 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641764.1 protein_id gnl|my_center|LOCUS_20990 10741 11127 gene locus_tag LOCUS_21000 gene dhaM 10741 11127 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386689.1 protein_id gnl|my_center|LOCUS_21000 11171 12421 gene locus_tag LOCUS_21010 gene yihS 11171 12421 CDS product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099370.1 protein_id gnl|my_center|LOCUS_21010 12574 14031 gene locus_tag LOCUS_21020 12574 14031 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078438.1 protein_id gnl|my_center|LOCUS_21020 14115 15512 gene locus_tag LOCUS_21030 14115 15512 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279690.1 protein_id gnl|my_center|LOCUS_21030 16580 15687 gene locus_tag LOCUS_21040 16580 15687 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097654.1 protein_id gnl|my_center|LOCUS_21040 16803 17996 gene locus_tag LOCUS_21050 gene emrD 16803 17996 CDS product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420858.1 protein_id gnl|my_center|LOCUS_21050 18096 18824 gene locus_tag LOCUS_21060 18096 18824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 19038 19673 gene locus_tag LOCUS_21070 19038 19673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 20160 21152 gene locus_tag LOCUS_21080 20160 21152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 21618 22628 gene locus_tag LOCUS_21090 21618 22628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 22942 23154 gene locus_tag LOCUS_21100 22942 23154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 23815 23234 gene locus_tag LOCUS_21110 23815 23234 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245544.1 protein_id gnl|my_center|LOCUS_21110 23870 24541 gene locus_tag LOCUS_21120 gene nfi 23870 24541 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217884.1 protein_id gnl|my_center|LOCUS_21120 24531 25277 gene locus_tag LOCUS_21130 24531 25277 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227868.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence26 1128 628 gene locus_tag LOCUS_21140 gene hutX 1128 628 CDS product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209065.1 protein_id gnl|my_center|LOCUS_21140 2567 1140 gene locus_tag LOCUS_21150 gene hutW 2567 1140 CDS product heme anaerobic degradation radical SAM methyltransferase ChuW/HutW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175593.1 protein_id gnl|my_center|LOCUS_21150 2700 3665 gene locus_tag LOCUS_21160 gene shuT 2700 3665 CDS product heme ABC transporter substrate-binding protein ShuT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302516.1 protein_id gnl|my_center|LOCUS_21160 4357 4602 gene locus_tag LOCUS_21170 4357 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21170 4728 4952 gene locus_tag LOCUS_21180 4728 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 5662 6510 gene locus_tag LOCUS_21190 gene shuT 5662 6510 CDS product heme ABC transporter substrate-binding protein ShuT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302516.1 protein_id gnl|my_center|LOCUS_21190 6605 8905 gene locus_tag LOCUS_21200 6605 8905 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703276.1 protein_id gnl|my_center|LOCUS_21200 9126 9767 gene locus_tag LOCUS_21210 9126 9767 CDS product YjfI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092612.1 protein_id gnl|my_center|LOCUS_21210 9798 10490 gene locus_tag LOCUS_21220 9798 10490 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092609.1 protein_id gnl|my_center|LOCUS_21220 10588 11238 gene locus_tag LOCUS_21230 10588 11238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100672.1 protein_id gnl|my_center|LOCUS_21230 11264 13432 gene locus_tag LOCUS_21240 11264 13432 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113833.1 protein_id gnl|my_center|LOCUS_21240 13537 18471 gene locus_tag LOCUS_21250 13537 18471 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 protein_id gnl|my_center|LOCUS_21250 19176 18799 gene locus_tag LOCUS_21260 19176 18799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 20691 20179 gene locus_tag LOCUS_21270 20691 20179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 21222 20728 gene locus_tag LOCUS_21280 21222 20728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 22363 22097 gene locus_tag LOCUS_21290 22363 22097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 24141 22669 gene locus_tag LOCUS_21300 gene lidL 24141 22669 CDS product Dot/Icm type IV secretion system effector LidL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946906.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence27 <1 719 gene locus_tag LOCUS_21310 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002208505.1:HAMP domain-containing sensor histidine kinase 700 1383 gene locus_tag LOCUS_21320 700 1383 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074040.1 protein_id gnl|my_center|LOCUS_21320 2632 1574 gene locus_tag LOCUS_21330 2632 1574 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098369.1 protein_id gnl|my_center|LOCUS_21330 2983 3633 gene locus_tag LOCUS_21340 2983 3633 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899814.1 protein_id gnl|my_center|LOCUS_21340 4557 3715 gene locus_tag LOCUS_21350 gene ispE 4557 3715 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133845424.1 protein_id gnl|my_center|LOCUS_21350 5147 4569 gene locus_tag LOCUS_21360 5147 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 5347 6618 gene locus_tag LOCUS_21370 gene hemA 5347 6618 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169107.1 protein_id gnl|my_center|LOCUS_21370 6653 6946 gene locus_tag LOCUS_21380 6653 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 7065 7307 gene locus_tag LOCUS_21390 7065 7307 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965765.1 protein_id gnl|my_center|LOCUS_21390 8374 7439 gene locus_tag LOCUS_21400 8374 7439 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_21400 8749 8835 gene locus_tag LOCUS_t00330 8749 8835 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9604 8891 gene locus_tag LOCUS_21410 9604 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426728.1 protein_id gnl|my_center|LOCUS_21410 10323 9619 gene locus_tag LOCUS_21420 10323 9619 CDS product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426729.1 protein_id gnl|my_center|LOCUS_21420 10835 10320 gene locus_tag LOCUS_21430 10835 10320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 12114 10882 gene locus_tag LOCUS_21440 12114 10882 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732668.1 protein_id gnl|my_center|LOCUS_21440 13401 12136 gene locus_tag LOCUS_21450 13401 12136 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_21450 14511 13717 gene locus_tag LOCUS_21460 14511 13717 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943998.1 protein_id gnl|my_center|LOCUS_21460 14671 16107 gene locus_tag LOCUS_21470 14671 16107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 16825 17661 gene locus_tag LOCUS_21480 16825 17661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 19417 17819 gene locus_tag LOCUS_21490 gene malP 19417 17819 CDS product PTS maltose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233606.1 protein_id gnl|my_center|LOCUS_21490 20859 19531 gene locus_tag LOCUS_21500 20859 19531 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038001995.1 protein_id gnl|my_center|LOCUS_21500 21117 21833 gene locus_tag LOCUS_21510 gene mngR 21117 21833 CDS product mannosyl-D-glycerate transport/metabolism system transcriptional repressor MngR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509906.1 protein_id gnl|my_center|LOCUS_21510 22133 22921 gene locus_tag LOCUS_21520 22133 22921 CDS product non-specific acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001785756.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence28 <1 1051 gene locus_tag LOCUS_21530 <1 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092038.1:T6SS immunity protein Tli4 family protein 2805 1585 gene locus_tag LOCUS_21540 2805 1585 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388621.1 protein_id gnl|my_center|LOCUS_21540 2952 3869 gene locus_tag LOCUS_21550 2952 3869 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388617.1 protein_id gnl|my_center|LOCUS_21550 5772 3871 gene locus_tag LOCUS_21560 5772 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 6893 5772 gene locus_tag LOCUS_21570 6893 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 9163 6950 gene locus_tag LOCUS_21580 9163 6950 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470621.1 protein_id gnl|my_center|LOCUS_21580 10023 9211 gene locus_tag LOCUS_21590 10023 9211 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031832.1 protein_id gnl|my_center|LOCUS_21590 14591 10020 gene locus_tag LOCUS_21600 14591 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 18037 14588 gene locus_tag LOCUS_21610 18037 14588 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460625.1 protein_id gnl|my_center|LOCUS_21610 19419 18037 gene locus_tag LOCUS_21620 19419 18037 CDS product salicylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143153455.1 protein_id gnl|my_center|LOCUS_21620 21020 19431 gene locus_tag LOCUS_21630 gene ybtE 21020 19431 CDS product yersiniabactin biosynthesis salycil-AMP ligase YbtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104104.1 protein_id gnl|my_center|LOCUS_21630 21866 21675 gene locus_tag LOCUS_21640 21866 21675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 >Feature sequence29 3221 2016 gene locus_tag LOCUS_21650 gene ackA 3221 2016 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098115.1 protein_id gnl|my_center|LOCUS_21650 3414 3860 gene locus_tag LOCUS_21660 gene yfbV 3414 3860 CDS product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106627.1 protein_id gnl|my_center|LOCUS_21660 3874 4380 gene locus_tag LOCUS_21670 3874 4380 CDS product primosomal replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881612.1 protein_id gnl|my_center|LOCUS_21670 5149 4913 gene locus_tag LOCUS_21680 5149 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 5789 5130 gene locus_tag LOCUS_21690 5789 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 6090 5806 gene locus_tag LOCUS_21700 6090 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 6739 6455 gene locus_tag LOCUS_21710 6739 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 7220 7594 gene locus_tag LOCUS_21720 7220 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 8928 8365 gene locus_tag LOCUS_21730 8928 8365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 9381 9163 gene locus_tag LOCUS_21740 9381 9163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 9797 10762 gene locus_tag LOCUS_21750 gene cysK 9797 10762 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034402.1 protein_id gnl|my_center|LOCUS_21750 11867 10863 gene locus_tag LOCUS_21760 gene ruvB 11867 10863 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211198.1 protein_id gnl|my_center|LOCUS_21760 12494 11886 gene locus_tag LOCUS_21770 gene ruvA 12494 11886 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211199.1 protein_id gnl|my_center|LOCUS_21770 13089 12751 gene locus_tag LOCUS_21780 13089 12751 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158176.1 protein_id gnl|my_center|LOCUS_21780 >Feature sequence30 738 1709 gene locus_tag LOCUS_21790 738 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 1986 2888 gene locus_tag LOCUS_21800 1986 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 5280 3277 gene locus_tag LOCUS_21810 gene pbpC 5280 3277 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070480.1 protein_id gnl|my_center|LOCUS_21810 5411 5677 gene locus_tag LOCUS_21820 5411 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 11775 5743 gene locus_tag LOCUS_21830 11775 5743 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210294.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence31 1784 939 gene locus_tag LOCUS_21840 1784 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 2890 2066 gene locus_tag LOCUS_21850 2890 2066 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225833.1 protein_id gnl|my_center|LOCUS_21850 4027 3077 gene locus_tag LOCUS_21860 gene dsdC 4027 3077 CDS product DNA-binding transcriptional regulator DsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001331803.1 protein_id gnl|my_center|LOCUS_21860 4233 5570 gene locus_tag LOCUS_21870 gene dsdX 4233 5570 CDS product D-serine transporter DsdX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032644228.1 protein_id gnl|my_center|LOCUS_21870 5591 6922 gene locus_tag LOCUS_21880 5591 6922 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167354.1 protein_id gnl|my_center|LOCUS_21880 7951 6989 gene locus_tag LOCUS_21890 7951 6989 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803888.1 protein_id gnl|my_center|LOCUS_21890 8105 8986 gene locus_tag LOCUS_21900 8105 8986 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705545.1 protein_id gnl|my_center|LOCUS_21900 9672 9499 gene locus_tag LOCUS_21910 9672 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence32 182 742 gene locus_tag LOCUS_21920 182 742 CDS product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477487.1 protein_id gnl|my_center|LOCUS_21920 839 1411 gene locus_tag LOCUS_21930 gene rppH 839 1411 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211381.1 protein_id gnl|my_center|LOCUS_21930 1408 2277 gene locus_tag LOCUS_21940 gene lgt 1408 2277 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211383.1 protein_id gnl|my_center|LOCUS_21940 2274 3068 gene locus_tag LOCUS_21950 gene thyA 2274 3068 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369929.1 protein_id gnl|my_center|LOCUS_21950 3293 4243 gene locus_tag LOCUS_21960 3293 4243 CDS product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816068.1 protein_id gnl|my_center|LOCUS_21960 4290 5372 gene locus_tag LOCUS_21970 gene rlmM 4290 5372 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816972.1 protein_id gnl|my_center|LOCUS_21970 5395 7230 gene locus_tag LOCUS_21980 5395 7230 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228200.1 protein_id gnl|my_center|LOCUS_21980 7199 7567 gene locus_tag LOCUS_21990 7199 7567 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001893625.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence33 1501 92 gene locus_tag LOCUS_22000 1501 92 CDS product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112459.1 protein_id gnl|my_center|LOCUS_22000 2314 1544 gene locus_tag LOCUS_22010 2314 1544 CDS product dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086612.1 protein_id gnl|my_center|LOCUS_22010 3107 2562 gene locus_tag LOCUS_22020 gene apt 3107 2562 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167709.1 protein_id gnl|my_center|LOCUS_22020 3370 4707 gene locus_tag LOCUS_22030 3370 4707 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208502.1 protein_id gnl|my_center|LOCUS_22030 >Feature sequence34 318 1094 gene locus_tag LOCUS_22040 gene pflA 318 1094 CDS product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067928.1 protein_id gnl|my_center|LOCUS_22040 2039 1143 gene locus_tag LOCUS_22050 gene rarD 2039 1143 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268385.1 protein_id gnl|my_center|LOCUS_22050 3411 2119 gene locus_tag LOCUS_22060 gene serS 3411 2119 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886697.1 protein_id gnl|my_center|LOCUS_22060