>Feature sequence01 <1 1724 gene locus_tag LOCUS_00010 <1 1724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002338467.1:phospho-sugar mutase 3199 1943 gene locus_tag LOCUS_00020 3199 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3613 4050 gene locus_tag LOCUS_00030 gene argR 3613 4050 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633181.1 protein_id gnl|my_center|LOCUS_00030 6283 4175 gene locus_tag LOCUS_00040 6283 4175 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797673.1 protein_id gnl|my_center|LOCUS_00040 6424 7638 gene locus_tag LOCUS_00050 gene tyrS 6424 7638 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814877.1 protein_id gnl|my_center|LOCUS_00050 7654 10152 gene locus_tag LOCUS_00060 7654 10152 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020587.1 protein_id gnl|my_center|LOCUS_00060 10349 10588 gene locus_tag LOCUS_00070 10349 10588 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_00070 10601 11428 gene locus_tag LOCUS_00080 gene lgt 10601 11428 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942073.1 protein_id gnl|my_center|LOCUS_00080 11699 11394 gene locus_tag LOCUS_00090 11699 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12319 11837 gene locus_tag LOCUS_00100 12319 11837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12545 13345 gene locus_tag LOCUS_00110 12545 13345 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113651.1 protein_id gnl|my_center|LOCUS_00110 13539 14717 gene locus_tag LOCUS_00120 13539 14717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14811 15584 gene locus_tag LOCUS_00130 14811 15584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15584 15958 gene locus_tag LOCUS_00140 15584 15958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16000 16596 gene locus_tag LOCUS_00150 16000 16596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16599 17960 gene locus_tag LOCUS_00160 16599 17960 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461524.1 protein_id gnl|my_center|LOCUS_00160 17953 18705 gene locus_tag LOCUS_00170 17953 18705 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582439.1 protein_id gnl|my_center|LOCUS_00170 19410 18742 gene locus_tag LOCUS_00180 19410 18742 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817114.1 protein_id gnl|my_center|LOCUS_00180 19684 19415 gene locus_tag LOCUS_00190 19684 19415 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070523.1 protein_id gnl|my_center|LOCUS_00190 19811 20695 gene locus_tag LOCUS_00200 19811 20695 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_00200 20864 22618 gene locus_tag LOCUS_00210 20864 22618 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462083.1 protein_id gnl|my_center|LOCUS_00210 22633 24372 gene locus_tag LOCUS_00220 22633 24372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462084.1 protein_id gnl|my_center|LOCUS_00220 24435 25067 gene locus_tag LOCUS_00230 24435 25067 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305518.1 protein_id gnl|my_center|LOCUS_00230 25924 25160 gene locus_tag LOCUS_00240 gene gpmA 25924 25160 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670958.1 protein_id gnl|my_center|LOCUS_00240 26095 26301 gene locus_tag LOCUS_00250 26095 26301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 26463 27830 gene locus_tag LOCUS_00260 gene glnA 26463 27830 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545065.1 protein_id gnl|my_center|LOCUS_00260 28007 28681 gene locus_tag LOCUS_00270 28007 28681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 28933 30285 gene locus_tag LOCUS_00280 28933 30285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 30404 31777 gene locus_tag LOCUS_00290 30404 31777 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_00290 31876 32172 gene locus_tag LOCUS_00300 31876 32172 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043551648.1 protein_id gnl|my_center|LOCUS_00300 32212 34788 gene locus_tag LOCUS_00310 32212 34788 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_00310 35021 34821 gene locus_tag LOCUS_00320 35021 34821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 34954 35973 gene locus_tag LOCUS_00330 gene rbsR 34954 35973 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099392.1 protein_id gnl|my_center|LOCUS_00330 36060 37388 gene locus_tag LOCUS_00340 36060 37388 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_00340 37513 38415 gene locus_tag LOCUS_00350 37513 38415 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_00350 38415 39281 gene locus_tag LOCUS_00360 38415 39281 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_00360 39284 40792 gene locus_tag LOCUS_00370 gene malQ 39284 40792 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_00370 40780 41985 gene locus_tag LOCUS_00380 gene ugpC 40780 41985 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_00380 42267 43742 gene locus_tag LOCUS_00390 gene glgA 42267 43742 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_00390 43861 45852 gene locus_tag LOCUS_00400 gene htpG 43861 45852 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986521.1 protein_id gnl|my_center|LOCUS_00400 46010 48193 gene locus_tag LOCUS_00410 gene ligA 46010 48193 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_00410 49340 48405 gene locus_tag LOCUS_00420 49340 48405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 51573 49432 gene locus_tag LOCUS_00430 51573 49432 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873616.1 protein_id gnl|my_center|LOCUS_00430 53814 51724 gene locus_tag LOCUS_00440 53814 51724 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_00440 54006 56717 gene locus_tag LOCUS_00450 gene polA 54006 56717 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940283.1 protein_id gnl|my_center|LOCUS_00450 56767 59082 gene locus_tag LOCUS_00460 56767 59082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 59112 59891 gene locus_tag LOCUS_00470 59112 59891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 59997 60072 gene locus_tag LOCUS_t00010 59997 60072 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 60134 60207 gene locus_tag LOCUS_t00020 60134 60207 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 60320 61564 gene locus_tag LOCUS_00480 gene nifS 60320 61564 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_00480 61561 62658 gene locus_tag LOCUS_00490 gene mnmA 61561 62658 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813026.1 protein_id gnl|my_center|LOCUS_00490 65415 62689 gene locus_tag LOCUS_00500 gene mgtA 65415 62689 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861942.1 protein_id gnl|my_center|LOCUS_00500 66660 65725 gene locus_tag LOCUS_00510 66660 65725 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_00510 66842 69097 gene locus_tag LOCUS_00520 gene glgP 66842 69097 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950158.1 protein_id gnl|my_center|LOCUS_00520 70209 69202 gene locus_tag LOCUS_00530 gene asnA 70209 69202 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641196.1 protein_id gnl|my_center|LOCUS_00530 71142 71702 gene locus_tag LOCUS_00540 71142 71702 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461583.1 protein_id gnl|my_center|LOCUS_00540 72981 71725 gene locus_tag LOCUS_00550 gene metK 72981 71725 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_00550 73231 73037 gene locus_tag LOCUS_00560 73231 73037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 74207 73440 gene locus_tag LOCUS_00570 74207 73440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00570 74845 74444 gene locus_tag LOCUS_00580 74845 74444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 75119 77251 gene locus_tag LOCUS_00590 75119 77251 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986653.1 protein_id gnl|my_center|LOCUS_00590 77277 77573 gene locus_tag LOCUS_00600 77277 77573 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435756.1 protein_id gnl|my_center|LOCUS_00600 77592 78875 gene locus_tag LOCUS_00610 77592 78875 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435758.1 protein_id gnl|my_center|LOCUS_00610 78895 79713 gene locus_tag LOCUS_00620 78895 79713 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389978.1 protein_id gnl|my_center|LOCUS_00620 79713 80645 gene locus_tag LOCUS_00630 79713 80645 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545386.1 protein_id gnl|my_center|LOCUS_00630 80933 80676 gene locus_tag LOCUS_00640 80933 80676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 81076 81348 gene locus_tag LOCUS_00650 81076 81348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 81345 81554 gene locus_tag LOCUS_00660 81345 81554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 82466 81549 gene locus_tag LOCUS_00670 82466 81549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 82947 82459 gene locus_tag LOCUS_00680 82947 82459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 84806 82953 gene locus_tag LOCUS_00690 84806 82953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 85823 84810 gene locus_tag LOCUS_00700 85823 84810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 88128 86155 gene locus_tag LOCUS_00710 88128 86155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 90212 88824 gene locus_tag LOCUS_00720 90212 88824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 91338 90325 gene locus_tag LOCUS_00730 91338 90325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 91713 91639 gene locus_tag LOCUS_t00030 91713 91639 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 92027 93190 gene locus_tag LOCUS_00740 92027 93190 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966572.1 protein_id gnl|my_center|LOCUS_00740 93692 93602 gene locus_tag LOCUS_t00040 93692 93602 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 93884 95284 gene locus_tag LOCUS_00750 93884 95284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 95351 95614 gene locus_tag LOCUS_00760 95351 95614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 95634 96335 gene locus_tag LOCUS_00770 95634 96335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721621.1 protein_id gnl|my_center|LOCUS_00770 96338 99892 gene locus_tag LOCUS_00780 96338 99892 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721622.1 protein_id gnl|my_center|LOCUS_00780 99941 100783 gene locus_tag LOCUS_00790 99941 100783 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963843.1 protein_id gnl|my_center|LOCUS_00790 102308 100770 gene locus_tag LOCUS_00800 102308 100770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 103915 102305 gene locus_tag LOCUS_00810 103915 102305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 105122 104007 gene locus_tag LOCUS_00820 105122 104007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 105308 106324 gene locus_tag LOCUS_00830 105308 106324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 106328 108100 gene locus_tag LOCUS_00840 106328 108100 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107752.1 protein_id gnl|my_center|LOCUS_00840 108111 108932 gene locus_tag LOCUS_00850 108111 108932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 108933 109448 gene locus_tag LOCUS_00860 108933 109448 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_00860 109448 110644 gene locus_tag LOCUS_00870 109448 110644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 110710 111966 gene locus_tag LOCUS_00880 110710 111966 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_00880 111992 113314 gene locus_tag LOCUS_00890 111992 113314 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_00890 113373 113954 gene locus_tag LOCUS_00900 113373 113954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 113954 114346 gene locus_tag LOCUS_00910 113954 114346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 114336 115280 gene locus_tag LOCUS_00920 114336 115280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 115396 118035 gene locus_tag LOCUS_00930 gene alaS 115396 118035 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869780.1 protein_id gnl|my_center|LOCUS_00930 118097 118510 gene locus_tag LOCUS_00940 gene ruvX 118097 118510 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_00940 118523 119836 gene locus_tag LOCUS_00950 gene mltG 118523 119836 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_00950 119850 120362 gene locus_tag LOCUS_00960 119850 120362 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674579.1 protein_id gnl|my_center|LOCUS_00960 120359 120913 gene locus_tag LOCUS_00970 gene aroK 120359 120913 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381319.1 protein_id gnl|my_center|LOCUS_00970 120910 122133 gene locus_tag LOCUS_00980 gene aroB 120910 122133 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_00980 122136 123254 gene locus_tag LOCUS_00990 122136 123254 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 protein_id gnl|my_center|LOCUS_00990 123847 124836 gene locus_tag LOCUS_01000 123847 124836 CDS product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289456.1 protein_id gnl|my_center|LOCUS_01000 124849 125658 gene locus_tag LOCUS_01010 124849 125658 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294546.1 protein_id gnl|my_center|LOCUS_01010 125679 126656 gene locus_tag LOCUS_01020 125679 126656 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700025.1 protein_id gnl|my_center|LOCUS_01020 126856 127260 gene locus_tag LOCUS_01030 126856 127260 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546115.1 protein_id gnl|my_center|LOCUS_01030 127264 128130 gene locus_tag LOCUS_01040 127264 128130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 128275 128847 gene locus_tag LOCUS_01050 gene efp 128275 128847 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_01050 128977 129345 gene locus_tag LOCUS_01060 128977 129345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 129352 129960 gene locus_tag LOCUS_01070 129352 129960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 129960 130244 gene locus_tag LOCUS_01080 129960 130244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 130250 130984 gene locus_tag LOCUS_01090 130250 130984 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544951.1 protein_id gnl|my_center|LOCUS_01090 131158 132012 gene locus_tag LOCUS_01100 131158 132012 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869648.1 protein_id gnl|my_center|LOCUS_01100 132015 133646 gene locus_tag LOCUS_01110 gene recN 132015 133646 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_01110 134440 133643 gene locus_tag LOCUS_01120 134440 133643 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974283.1 protein_id gnl|my_center|LOCUS_01120 134650 135231 gene locus_tag LOCUS_01130 134650 135231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 135315 135602 gene locus_tag LOCUS_01140 135315 135602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 136550 135735 gene locus_tag LOCUS_01150 136550 135735 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_01150 136740 137720 gene locus_tag LOCUS_01160 gene xerD 136740 137720 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389683.1 protein_id gnl|my_center|LOCUS_01160 138109 138540 gene locus_tag LOCUS_01170 gene mraZ 138109 138540 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939783.1 protein_id gnl|my_center|LOCUS_01170 138580 139539 gene locus_tag LOCUS_01180 gene rsmH 138580 139539 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355891.1 protein_id gnl|my_center|LOCUS_01180 139719 140192 gene locus_tag LOCUS_01190 139719 140192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 140194 141981 gene locus_tag LOCUS_01200 140194 141981 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_01200 141996 143456 gene locus_tag LOCUS_01210 141996 143456 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_01210 143456 144487 gene locus_tag LOCUS_01220 gene mraY 143456 144487 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_01220 144563 145984 gene locus_tag LOCUS_01230 gene murD 144563 145984 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_01230 145977 147536 gene locus_tag LOCUS_01240 145977 147536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 147526 148650 gene locus_tag LOCUS_01250 gene murG 147526 148650 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392362.1 protein_id gnl|my_center|LOCUS_01250 150223 148736 gene locus_tag LOCUS_01260 150223 148736 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462215.1 protein_id gnl|my_center|LOCUS_01260 150947 150225 gene locus_tag LOCUS_01270 150947 150225 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815503.1 protein_id gnl|my_center|LOCUS_01270 151537 150947 gene locus_tag LOCUS_01280 151537 150947 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815501.1 protein_id gnl|my_center|LOCUS_01280 153287 151548 gene locus_tag LOCUS_01290 153287 151548 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462084.1 protein_id gnl|my_center|LOCUS_01290 155014 153284 gene locus_tag LOCUS_01300 155014 153284 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462213.1 protein_id gnl|my_center|LOCUS_01300 155699 155076 gene locus_tag LOCUS_01310 155699 155076 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460672.1 protein_id gnl|my_center|LOCUS_01310 155984 157414 gene locus_tag LOCUS_01320 gene murC 155984 157414 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392363.1 protein_id gnl|my_center|LOCUS_01320 157411 158325 gene locus_tag LOCUS_01330 gene murB 157411 158325 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437020.1 protein_id gnl|my_center|LOCUS_01330 158337 159626 gene locus_tag LOCUS_01340 158337 159626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 159993 161126 gene locus_tag LOCUS_01350 gene ftsZ 159993 161126 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_01350 161128 161934 gene locus_tag LOCUS_01360 gene pgeF 161128 161934 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_01360 161958 162710 gene locus_tag LOCUS_01370 161958 162710 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_01370 162797 163483 gene locus_tag LOCUS_01380 162797 163483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 163485 164291 gene locus_tag LOCUS_01390 gene proC 163485 164291 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_01390 164301 164564 gene locus_tag LOCUS_01400 164301 164564 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644609.1 protein_id gnl|my_center|LOCUS_01400 164724 165440 gene locus_tag LOCUS_01410 164724 165440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 166184 166738 gene locus_tag LOCUS_01420 166184 166738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 166748 167389 gene locus_tag LOCUS_01430 166748 167389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 >Feature sequence02 2369 891 gene locus_tag LOCUS_01440 2369 891 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993859.1 protein_id gnl|my_center|LOCUS_01440 3835 2459 gene locus_tag LOCUS_01450 3835 2459 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576225.1 protein_id gnl|my_center|LOCUS_01450 3992 5386 gene locus_tag LOCUS_01460 3992 5386 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_01460 5699 5623 gene locus_tag LOCUS_t00050 5699 5623 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5795 5722 gene locus_tag LOCUS_t00060 5795 5722 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6111 6347 gene locus_tag LOCUS_01470 6111 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 6705 8030 gene locus_tag LOCUS_01480 6705 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 8107 9378 gene locus_tag LOCUS_01490 8107 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 11073 9475 gene locus_tag LOCUS_01500 11073 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 12667 11144 gene locus_tag LOCUS_01510 gene gltX 12667 11144 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_01510 12986 13723 gene locus_tag LOCUS_01520 12986 13723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 13724 16201 gene locus_tag LOCUS_01530 13724 16201 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966852.1 protein_id gnl|my_center|LOCUS_01530 16296 17078 gene locus_tag LOCUS_01540 16296 17078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 17093 19426 gene locus_tag LOCUS_01550 gene priA 17093 19426 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_01550 19531 20082 gene locus_tag LOCUS_01560 gene def 19531 20082 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114101.1 protein_id gnl|my_center|LOCUS_01560 20084 21010 gene locus_tag LOCUS_01570 gene fmt 20084 21010 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697690.1 protein_id gnl|my_center|LOCUS_01570 21082 22446 gene locus_tag LOCUS_01580 gene rsmB 21082 22446 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460525.1 protein_id gnl|my_center|LOCUS_01580 23861 22503 gene locus_tag LOCUS_01590 23861 22503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 23995 24198 gene locus_tag LOCUS_01600 23995 24198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 24474 24662 gene locus_tag LOCUS_01610 gene rpmB 24474 24662 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813371.1 protein_id gnl|my_center|LOCUS_01610 24825 25169 gene locus_tag LOCUS_01620 24825 25169 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_01620 25257 26921 gene locus_tag LOCUS_01630 25257 26921 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992286.1 protein_id gnl|my_center|LOCUS_01630 26937 29108 gene locus_tag LOCUS_01640 gene recG 26937 29108 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392440.1 protein_id gnl|my_center|LOCUS_01640 29105 29740 gene locus_tag LOCUS_01650 29105 29740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 29721 30230 gene locus_tag LOCUS_01660 gene coaD 29721 30230 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393371.1 protein_id gnl|my_center|LOCUS_01660 30320 30811 gene locus_tag LOCUS_01670 30320 30811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 30805 31368 gene locus_tag LOCUS_01680 30805 31368 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227921.1 protein_id gnl|my_center|LOCUS_01680 31532 31711 gene locus_tag LOCUS_01690 gene rpmF 31532 31711 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419113.1 protein_id gnl|my_center|LOCUS_01690 31811 32809 gene locus_tag LOCUS_01700 gene plsX 31811 32809 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475845.1 protein_id gnl|my_center|LOCUS_01700 32877 33113 gene locus_tag LOCUS_01710 gene acpP 32877 33113 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928985.1 protein_id gnl|my_center|LOCUS_01710 33123 33890 gene locus_tag LOCUS_01720 gene rncS 33123 33890 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232030.1 protein_id gnl|my_center|LOCUS_01720 33890 37432 gene locus_tag LOCUS_01730 gene smc 33890 37432 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111689.1 protein_id gnl|my_center|LOCUS_01730 37432 38340 gene locus_tag LOCUS_01740 37432 38340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 38395 39813 gene locus_tag LOCUS_01750 gene ffh 38395 39813 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_01750 40640 39822 gene locus_tag LOCUS_01760 40640 39822 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_01760 40777 42318 gene locus_tag LOCUS_01770 40777 42318 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898068.1 protein_id gnl|my_center|LOCUS_01770 42396 44291 gene locus_tag LOCUS_01780 gene ftsH 42396 44291 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272613.1 protein_id gnl|my_center|LOCUS_01780 46204 44294 gene locus_tag LOCUS_01790 46204 44294 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794862.1 protein_id gnl|my_center|LOCUS_01790 46373 49192 gene locus_tag LOCUS_01800 gene ileS 46373 49192 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_01800 49196 49780 gene locus_tag LOCUS_01810 49196 49780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 49773 50816 gene locus_tag LOCUS_01820 49773 50816 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057378.1 protein_id gnl|my_center|LOCUS_01820 50863 52182 gene locus_tag LOCUS_01830 50863 52182 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814758.1 protein_id gnl|my_center|LOCUS_01830 52316 53836 gene locus_tag LOCUS_01840 52316 53836 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_01840 53954 56503 gene locus_tag LOCUS_01850 gene leuS 53954 56503 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_01850 56585 57988 gene locus_tag LOCUS_01860 56585 57988 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_01860 58124 58618 gene locus_tag LOCUS_01870 gene rimP 58124 58618 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456065.1 protein_id gnl|my_center|LOCUS_01870 58698 59957 gene locus_tag LOCUS_01880 gene nusA 58698 59957 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_01880 60007 62637 gene locus_tag LOCUS_01890 gene infB 60007 62637 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541506.1 protein_id gnl|my_center|LOCUS_01890 62702 63100 gene locus_tag LOCUS_01900 gene rbfA 62702 63100 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475824.1 protein_id gnl|my_center|LOCUS_01900 63109 64194 gene locus_tag LOCUS_01910 63109 64194 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_01910 64191 65162 gene locus_tag LOCUS_01920 gene truB 64191 65162 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091315604.1 protein_id gnl|my_center|LOCUS_01920 65159 66232 gene locus_tag LOCUS_01930 65159 66232 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937757.1 protein_id gnl|my_center|LOCUS_01930 66225 68087 gene locus_tag LOCUS_01940 66225 68087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 68141 69511 gene locus_tag LOCUS_01950 68141 69511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 69726 69652 gene locus_tag LOCUS_t00070 69726 69652 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 70277 69786 gene locus_tag LOCUS_01960 70277 69786 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_01960 70364 72742 gene locus_tag LOCUS_01970 70364 72742 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177619.1 protein_id gnl|my_center|LOCUS_01970 72835 73365 gene locus_tag LOCUS_01980 72835 73365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 73581 74174 gene locus_tag LOCUS_01990 gene pyrR 73581 74174 CDS product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232127.1 protein_id gnl|my_center|LOCUS_01990 74162 75085 gene locus_tag LOCUS_02000 74162 75085 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_02000 75085 76374 gene locus_tag LOCUS_02010 75085 76374 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_02010 76401 77183 gene locus_tag LOCUS_02020 76401 77183 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_02020 77177 78103 gene locus_tag LOCUS_02030 77177 78103 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_02030 78097 78831 gene locus_tag LOCUS_02040 gene pyrF 78097 78831 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_02040 78871 79524 gene locus_tag LOCUS_02050 gene pyrE 78871 79524 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711440.1 protein_id gnl|my_center|LOCUS_02050 79748 80056 gene locus_tag LOCUS_02060 gene mihF 79748 80056 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_02060 80056 80646 gene locus_tag LOCUS_02070 gene gmk 80056 80646 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869533.1 protein_id gnl|my_center|LOCUS_02070 80633 80929 gene locus_tag LOCUS_02080 80633 80929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 81027 82304 gene locus_tag LOCUS_02090 gene thiI 81027 82304 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_02090 82571 83269 gene locus_tag LOCUS_02100 gene comEA 82571 83269 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398514.1 protein_id gnl|my_center|LOCUS_02100 83262 85640 gene locus_tag LOCUS_02110 83262 85640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 85680 86657 gene locus_tag LOCUS_02120 85680 86657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 86698 87123 gene locus_tag LOCUS_02130 86698 87123 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261902.1 protein_id gnl|my_center|LOCUS_02130 87301 87771 gene locus_tag LOCUS_02140 87301 87771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 >Feature sequence03 404 643 gene locus_tag LOCUS_02150 404 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 918 655 gene locus_tag LOCUS_02160 gene rpsT 918 655 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775769.1 protein_id gnl|my_center|LOCUS_02160 1059 2873 gene locus_tag LOCUS_02170 gene lepA 1059 2873 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019133.1 protein_id gnl|my_center|LOCUS_02170 3876 2911 gene locus_tag LOCUS_02180 3876 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 4799 3897 gene locus_tag LOCUS_02190 4799 3897 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_02190 4883 5959 gene locus_tag LOCUS_02200 gene dusB 4883 5959 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391694.1 protein_id gnl|my_center|LOCUS_02200 5956 7179 gene locus_tag LOCUS_02210 gene hemW 5956 7179 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 protein_id gnl|my_center|LOCUS_02210 7176 8189 gene locus_tag LOCUS_02220 7176 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 8307 8708 gene locus_tag LOCUS_02230 8307 8708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 8754 10745 gene locus_tag LOCUS_02240 8754 10745 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_02240 10742 11437 gene locus_tag LOCUS_02250 10742 11437 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946654.1 protein_id gnl|my_center|LOCUS_02250 11437 12249 gene locus_tag LOCUS_02260 11437 12249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 12252 12989 gene locus_tag LOCUS_02270 12252 12989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 12982 13782 gene locus_tag LOCUS_02280 12982 13782 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_02280 13856 15400 gene locus_tag LOCUS_02290 13856 15400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 15449 16297 gene locus_tag LOCUS_02300 gene ispH 15449 16297 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_02300 16426 17745 gene locus_tag LOCUS_02310 gene der 16426 17745 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_02310 17748 18413 gene locus_tag LOCUS_02320 gene plsY 17748 18413 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_02320 18413 19417 gene locus_tag LOCUS_02330 18413 19417 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357312.1 protein_id gnl|my_center|LOCUS_02330 19452 20129 gene locus_tag LOCUS_02340 gene rpe 19452 20129 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964149.1 protein_id gnl|my_center|LOCUS_02340 20131 21309 gene locus_tag LOCUS_02350 gene nifS 20131 21309 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_02350 21342 22061 gene locus_tag LOCUS_02360 21342 22061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 22058 23509 gene locus_tag LOCUS_02370 gene coaBC 22058 23509 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260987.1 protein_id gnl|my_center|LOCUS_02370 23509 25314 gene locus_tag LOCUS_02380 23509 25314 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729311.1 protein_id gnl|my_center|LOCUS_02380 25520 25596 gene locus_tag LOCUS_t00080 25520 25596 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 25769 26131 gene locus_tag LOCUS_02390 gene crcB 25769 26131 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416045.1 protein_id gnl|my_center|LOCUS_02390 26498 26716 gene locus_tag LOCUS_02400 26498 26716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 27071 27481 gene locus_tag LOCUS_02410 27071 27481 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114300.1 protein_id gnl|my_center|LOCUS_02410 27498 27878 gene locus_tag LOCUS_02420 27498 27878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 27952 28026 gene locus_tag LOCUS_t00090 27952 28026 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 28083 29195 gene locus_tag LOCUS_02430 28083 29195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 29273 30382 gene locus_tag LOCUS_02440 gene dnaJ 29273 30382 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816474.1 protein_id gnl|my_center|LOCUS_02440 30395 31660 gene locus_tag LOCUS_02450 gene mtaB 30395 31660 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555988.1 protein_id gnl|my_center|LOCUS_02450 31783 32742 gene locus_tag LOCUS_02460 31783 32742 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_02460 32751 33251 gene locus_tag LOCUS_02470 gene ybeY 32751 33251 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230039.1 protein_id gnl|my_center|LOCUS_02470 33254 33628 gene locus_tag LOCUS_02480 33254 33628 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_02480 33640 34551 gene locus_tag LOCUS_02490 gene era 33640 34551 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134765.1 protein_id gnl|my_center|LOCUS_02490 34554 35303 gene locus_tag LOCUS_02500 34554 35303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 35470 35748 gene locus_tag LOCUS_02510 gene rpsO 35470 35748 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018328.1 protein_id gnl|my_center|LOCUS_02510 35896 38163 gene locus_tag LOCUS_02520 gene pnp 35896 38163 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722460.1 protein_id gnl|my_center|LOCUS_02520 38431 38913 gene locus_tag LOCUS_02530 38431 38913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 39680 41344 gene locus_tag LOCUS_02540 39680 41344 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_02540 41344 43971 gene locus_tag LOCUS_02550 41344 43971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 43975 45588 gene locus_tag LOCUS_02560 43975 45588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 45610 46980 gene locus_tag LOCUS_02570 gene rimO 45610 46980 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_02570 47004 47828 gene locus_tag LOCUS_02580 47004 47828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 47832 48344 gene locus_tag LOCUS_02590 47832 48344 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870383.1 protein_id gnl|my_center|LOCUS_02590 48602 49711 gene locus_tag LOCUS_02600 gene recA 48602 49711 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_02600 49719 50393 gene locus_tag LOCUS_02610 49719 50393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 50653 52212 gene locus_tag LOCUS_02620 gene rny 50653 52212 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986783.1 protein_id gnl|my_center|LOCUS_02620 52223 53302 gene locus_tag LOCUS_02630 52223 53302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 53419 53751 gene locus_tag LOCUS_02640 53419 53751 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362540.1 protein_id gnl|my_center|LOCUS_02640 53748 55118 gene locus_tag LOCUS_02650 gene miaB 53748 55118 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_02650 55115 56080 gene locus_tag LOCUS_02660 gene miaA 55115 56080 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224257.1 protein_id gnl|my_center|LOCUS_02660 56067 57383 gene locus_tag LOCUS_02670 gene hflX 56067 57383 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_02670 58807 58163 gene locus_tag LOCUS_02680 gene lexA 58807 58163 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_02680 58999 59451 gene locus_tag LOCUS_02690 58999 59451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 59586 60035 gene locus_tag LOCUS_02700 gene nrdR 59586 60035 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_02700 60032 60481 gene locus_tag LOCUS_02710 gene dut 60032 60481 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014744.1 protein_id gnl|my_center|LOCUS_02710 60573 61886 gene locus_tag LOCUS_02720 60573 61886 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047961.1 protein_id gnl|my_center|LOCUS_02720 61943 63205 gene locus_tag LOCUS_02730 gene uraA 61943 63205 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435928.1 protein_id gnl|my_center|LOCUS_02730 63459 64418 gene locus_tag LOCUS_02740 63459 64418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 66288 64666 gene locus_tag LOCUS_02750 66288 64666 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033562369.1 protein_id gnl|my_center|LOCUS_02750 67471 66290 gene locus_tag LOCUS_02760 67471 66290 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947929.1 protein_id gnl|my_center|LOCUS_02760 68084 67551 gene locus_tag LOCUS_02770 gene apt 68084 67551 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350746.1 protein_id gnl|my_center|LOCUS_02770 68872 68120 gene locus_tag LOCUS_02780 68872 68120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 69306 68875 gene locus_tag LOCUS_02790 69306 68875 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856253.1 protein_id gnl|my_center|LOCUS_02790 70301 69444 gene locus_tag LOCUS_02800 70301 69444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 71082 70294 gene locus_tag LOCUS_02810 gene pgsA 71082 70294 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804671.1 protein_id gnl|my_center|LOCUS_02810 72362 71133 gene locus_tag LOCUS_02820 72362 71133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 72585 74066 gene locus_tag LOCUS_02830 72585 74066 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_02830 74100 75821 gene locus_tag LOCUS_02840 74100 75821 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364705.1 protein_id gnl|my_center|LOCUS_02840 75814 77556 gene locus_tag LOCUS_02850 75814 77556 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837093.1 protein_id gnl|my_center|LOCUS_02850 78470 77586 gene locus_tag LOCUS_02860 78470 77586 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097421.1 protein_id gnl|my_center|LOCUS_02860 79122 78490 gene locus_tag LOCUS_02870 gene pcp 79122 78490 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287081.1 protein_id gnl|my_center|LOCUS_02870 79550 79224 gene locus_tag LOCUS_02880 79550 79224 CDS product HIRAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002943204.1 protein_id gnl|my_center|LOCUS_02880 79660 80649 gene locus_tag LOCUS_02890 79660 80649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 80863 80938 gene locus_tag LOCUS_t00100 80863 80938 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 82096 83967 gene locus_tag LOCUS_02900 82096 83967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 83970 84173 gene locus_tag LOCUS_02910 83970 84173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 84234 84653 gene locus_tag LOCUS_02920 84234 84653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 84756 84983 gene locus_tag LOCUS_02930 84756 84983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 >Feature sequence04 358 1458 gene locus_tag LOCUS_02940 358 1458 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426912.1 protein_id gnl|my_center|LOCUS_02940 2336 1698 gene locus_tag LOCUS_02950 gene rdgB 2336 1698 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694045.1 protein_id gnl|my_center|LOCUS_02950 2548 2473 gene locus_tag LOCUS_t00110 2548 2473 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2596 4179 gene locus_tag LOCUS_02960 2596 4179 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285962.1 protein_id gnl|my_center|LOCUS_02960 4214 5146 gene locus_tag LOCUS_02970 4214 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 5336 6595 gene locus_tag LOCUS_02980 5336 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 7908 6718 gene locus_tag LOCUS_02990 7908 6718 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_02990 9358 8144 gene locus_tag LOCUS_03000 9358 8144 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_03000 9619 10764 gene locus_tag LOCUS_03010 9619 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 10761 11750 gene locus_tag LOCUS_03020 10761 11750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 12052 11801 gene locus_tag LOCUS_03030 12052 11801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 12207 12281 gene locus_tag LOCUS_t00120 12207 12281 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12422 12338 gene locus_tag LOCUS_t00130 12422 12338 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13524 12514 gene locus_tag LOCUS_03040 13524 12514 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_03040 14372 13524 gene locus_tag LOCUS_03050 14372 13524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 15480 14545 gene locus_tag LOCUS_03060 15480 14545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 19001 15516 gene locus_tag LOCUS_03070 gene mfd 19001 15516 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_03070 19063 20010 gene locus_tag LOCUS_03080 19063 20010 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364453.1 protein_id gnl|my_center|LOCUS_03080 20965 20123 gene locus_tag LOCUS_03090 20965 20123 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963831.1 protein_id gnl|my_center|LOCUS_03090 22197 21007 gene locus_tag LOCUS_03100 22197 21007 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108806343.1 protein_id gnl|my_center|LOCUS_03100 24484 22418 gene locus_tag LOCUS_03110 gene ftsH 24484 22418 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_03110 25097 24546 gene locus_tag LOCUS_03120 gene hpt 25097 24546 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_03120 26710 25130 gene locus_tag LOCUS_03130 gene tilS 26710 25130 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_03130 27266 26841 gene locus_tag LOCUS_03140 27266 26841 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966974.1 protein_id gnl|my_center|LOCUS_03140 27527 27979 gene locus_tag LOCUS_03150 27527 27979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 28293 28051 gene locus_tag LOCUS_03160 28293 28051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 29727 28306 gene locus_tag LOCUS_03170 29727 28306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 32441 29835 gene locus_tag LOCUS_03180 gene clpB 32441 29835 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_03180 32759 33733 gene locus_tag LOCUS_03190 32759 33733 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760658.1 protein_id gnl|my_center|LOCUS_03190 34377 33763 gene locus_tag LOCUS_03200 34377 33763 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547369.1 protein_id gnl|my_center|LOCUS_03200 34799 34377 gene locus_tag LOCUS_03210 34799 34377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 35742 34789 gene locus_tag LOCUS_03220 35742 34789 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940692.1 protein_id gnl|my_center|LOCUS_03220 36696 35848 gene locus_tag LOCUS_03230 36696 35848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 38607 36700 gene locus_tag LOCUS_03240 gene dnaK 38607 36700 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_03240 39067 39624 gene locus_tag LOCUS_03250 gene yfcE 39067 39624 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706165.1 protein_id gnl|my_center|LOCUS_03250 40352 40576 gene locus_tag LOCUS_03260 40352 40576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 40669 42153 gene locus_tag LOCUS_03270 gene sacA 40669 42153 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886636.1 protein_id gnl|my_center|LOCUS_03270 42177 43475 gene locus_tag LOCUS_03280 42177 43475 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445845.1 protein_id gnl|my_center|LOCUS_03280 43504 44919 gene locus_tag LOCUS_03290 gene gtfA 43504 44919 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775657.1 protein_id gnl|my_center|LOCUS_03290 44934 45833 gene locus_tag LOCUS_03300 44934 45833 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494826.1 protein_id gnl|my_center|LOCUS_03300 46715 45909 gene locus_tag LOCUS_03310 46715 45909 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251908.1 protein_id gnl|my_center|LOCUS_03310 48279 46756 gene locus_tag LOCUS_03320 gene sacA 48279 46756 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886636.1 protein_id gnl|my_center|LOCUS_03320 49287 48337 gene locus_tag LOCUS_03330 49287 48337 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083014.1 protein_id gnl|my_center|LOCUS_03330 51344 49380 gene locus_tag LOCUS_03340 51344 49380 CDS product PTS beta-glucoside transporter subunit IIBCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027722.1 protein_id gnl|my_center|LOCUS_03340 51768 52466 gene locus_tag LOCUS_03350 51768 52466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 52476 52907 gene locus_tag LOCUS_03360 52476 52907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 54034 53042 gene locus_tag LOCUS_03370 54034 53042 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896952.1 protein_id gnl|my_center|LOCUS_03370 55001 54045 gene locus_tag LOCUS_03380 gene metA 55001 54045 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054763.1 protein_id gnl|my_center|LOCUS_03380 56735 55122 gene locus_tag LOCUS_03390 56735 55122 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294573.1 protein_id gnl|my_center|LOCUS_03390 56996 56754 gene locus_tag LOCUS_03400 56996 56754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 57130 57041 gene locus_tag LOCUS_t00140 57130 57041 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 57269 57730 gene locus_tag LOCUS_03410 gene tadA 57269 57730 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940742.1 protein_id gnl|my_center|LOCUS_03410 58013 59848 gene locus_tag LOCUS_03420 58013 59848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 59852 61165 gene locus_tag LOCUS_03430 59852 61165 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_03430 62129 61251 gene locus_tag LOCUS_03440 62129 61251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 62701 62240 gene locus_tag LOCUS_03450 62701 62240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 63505 62789 gene locus_tag LOCUS_03460 63505 62789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 64921 63572 gene locus_tag LOCUS_03470 64921 63572 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803904.1 protein_id gnl|my_center|LOCUS_03470 65595 64933 gene locus_tag LOCUS_03480 65595 64933 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_03480 66947 65661 gene locus_tag LOCUS_03490 gene serS 66947 65661 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_03490 67189 67416 gene locus_tag LOCUS_03500 67189 67416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 67675 67589 gene locus_tag LOCUS_t00150 67675 67589 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 68607 67723 gene locus_tag LOCUS_03510 68607 67723 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813634.1 protein_id gnl|my_center|LOCUS_03510 69576 68704 gene locus_tag LOCUS_03520 69576 68704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 70373 69648 gene locus_tag LOCUS_03530 70373 69648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 71682 70387 gene locus_tag LOCUS_03540 gene purD 71682 70387 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327551.1 protein_id gnl|my_center|LOCUS_03540 72640 71720 gene locus_tag LOCUS_03550 72640 71720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 73927 72647 gene locus_tag LOCUS_03560 73927 72647 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_03560 75498 74071 gene locus_tag LOCUS_03570 gene dnaB 75498 74071 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546182.1 protein_id gnl|my_center|LOCUS_03570 76548 76018 gene locus_tag LOCUS_03580 gene rplI 76548 76018 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869406.1 protein_id gnl|my_center|LOCUS_03580 76867 76583 gene locus_tag LOCUS_03590 76867 76583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 77403 76888 gene locus_tag LOCUS_03600 77403 76888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 77748 77455 gene locus_tag LOCUS_03610 gene rpsF 77748 77455 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233779.1 protein_id gnl|my_center|LOCUS_03610 78951 78136 gene locus_tag LOCUS_03620 78951 78136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 79099 79012 gene locus_tag LOCUS_t00160 79099 79012 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 79231 79141 gene locus_tag LOCUS_t00170 79231 79141 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 79476 80243 gene locus_tag LOCUS_03630 79476 80243 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705587.1 protein_id gnl|my_center|LOCUS_03630 82161 80323 gene locus_tag LOCUS_03640 gene typA 82161 80323 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859745.1 protein_id gnl|my_center|LOCUS_03640 82697 82236 gene locus_tag LOCUS_03650 82697 82236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence05 1449 133 gene locus_tag LOCUS_03660 gene rlmD 1449 133 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143127.1 protein_id gnl|my_center|LOCUS_03660 3899 1458 gene locus_tag LOCUS_03670 3899 1458 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470194.1 protein_id gnl|my_center|LOCUS_03670 4494 5747 gene locus_tag LOCUS_03680 gene arcA 4494 5747 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870198.1 protein_id gnl|my_center|LOCUS_03680 5841 6833 gene locus_tag LOCUS_03690 gene argF 5841 6833 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_03690 7318 7043 gene locus_tag LOCUS_03700 7318 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 7230 8699 gene locus_tag LOCUS_03710 7230 8699 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356134.1 protein_id gnl|my_center|LOCUS_03710 8812 9297 gene locus_tag LOCUS_03720 8812 9297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 9405 10460 gene locus_tag LOCUS_03730 gene trpS 9405 10460 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003827911.1 protein_id gnl|my_center|LOCUS_03730 10715 11314 gene locus_tag LOCUS_03740 10715 11314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 12421 11411 gene locus_tag LOCUS_03750 12421 11411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 13840 12554 gene locus_tag LOCUS_03760 13840 12554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 14985 13840 gene locus_tag LOCUS_03770 gene pheA 14985 13840 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_03770 16169 15033 gene locus_tag LOCUS_03780 gene aroC 16169 15033 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_03780 17481 16159 gene locus_tag LOCUS_03790 gene aroA 17481 16159 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_03790 17681 18775 gene locus_tag LOCUS_03800 gene aroF 17681 18775 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_03800 18762 19658 gene locus_tag LOCUS_03810 18762 19658 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_03810 19671 20738 gene locus_tag LOCUS_03820 gene aroB 19671 20738 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_03820 20877 20801 gene locus_tag LOCUS_t00180 20877 20801 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20945 23380 gene locus_tag LOCUS_03830 20945 23380 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_03830 23316 26060 gene locus_tag LOCUS_03840 gene acnA 23316 26060 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_03840 26123 27151 gene locus_tag LOCUS_03850 26123 27151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 27286 27828 gene locus_tag LOCUS_03860 27286 27828 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_03860 27893 29380 gene locus_tag LOCUS_03870 27893 29380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 29400 30452 gene locus_tag LOCUS_03880 29400 30452 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_03880 30464 31480 gene locus_tag LOCUS_03890 30464 31480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 31487 32062 gene locus_tag LOCUS_03900 31487 32062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 32071 34101 gene locus_tag LOCUS_03910 gene mrdA 32071 34101 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545126.1 protein_id gnl|my_center|LOCUS_03910 34103 35311 gene locus_tag LOCUS_03920 gene rodA 34103 35311 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_03920 35401 36390 gene locus_tag LOCUS_03930 35401 36390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 36602 36910 gene locus_tag LOCUS_03940 gene rplU 36602 36910 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048023.1 protein_id gnl|my_center|LOCUS_03940 36957 37208 gene locus_tag LOCUS_03950 gene rpmA 36957 37208 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_03950 37574 38143 gene locus_tag LOCUS_03960 37574 38143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115564.1 protein_id gnl|my_center|LOCUS_03960 38185 40002 gene locus_tag LOCUS_03970 38185 40002 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574971.1 protein_id gnl|my_center|LOCUS_03970 40003 40749 gene locus_tag LOCUS_03980 40003 40749 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399515.1 protein_id gnl|my_center|LOCUS_03980 40846 42237 gene locus_tag LOCUS_03990 gene obgE 40846 42237 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_03990 42230 43351 gene locus_tag LOCUS_04000 gene proB 42230 43351 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888462.1 protein_id gnl|my_center|LOCUS_04000 43398 44204 gene locus_tag LOCUS_04010 43398 44204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 44201 44836 gene locus_tag LOCUS_04020 gene yqeK 44201 44836 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831144.1 protein_id gnl|my_center|LOCUS_04020 44863 45255 gene locus_tag LOCUS_04030 gene rsfS 44863 45255 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033582077.1 protein_id gnl|my_center|LOCUS_04030 46482 45265 gene locus_tag LOCUS_04040 gene dinB 46482 45265 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_04040 46751 47125 gene locus_tag LOCUS_04050 46751 47125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 47129 47446 gene locus_tag LOCUS_04060 47129 47446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 47624 47959 gene locus_tag LOCUS_04070 47624 47959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 47972 48679 gene locus_tag LOCUS_04080 gene trmD 47972 48679 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_04080 48681 49229 gene locus_tag LOCUS_04090 gene lepB 48681 49229 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460080.1 protein_id gnl|my_center|LOCUS_04090 49187 49366 gene locus_tag LOCUS_04100 49187 49366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 49320 50225 gene locus_tag LOCUS_04110 49320 50225 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390704.1 protein_id gnl|my_center|LOCUS_04110 50226 52322 gene locus_tag LOCUS_04120 gene glyS 50226 52322 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392141.1 protein_id gnl|my_center|LOCUS_04120 52391 52795 gene locus_tag LOCUS_04130 52391 52795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 52979 55708 gene locus_tag LOCUS_04140 gene ppdK 52979 55708 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392144.1 protein_id gnl|my_center|LOCUS_04140 55921 56265 gene locus_tag LOCUS_04150 gene rplS 55921 56265 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965066.1 protein_id gnl|my_center|LOCUS_04150 56374 57153 gene locus_tag LOCUS_04160 56374 57153 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254306.1 protein_id gnl|my_center|LOCUS_04160 57328 57741 gene locus_tag LOCUS_04170 57328 57741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 57743 59236 gene locus_tag LOCUS_04180 57743 59236 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 protein_id gnl|my_center|LOCUS_04180 59249 60157 gene locus_tag LOCUS_04190 gene dprA 59249 60157 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_04190 60197 61582 gene locus_tag LOCUS_04200 gene trmFO 60197 61582 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056303.1 protein_id gnl|my_center|LOCUS_04200 61579 62529 gene locus_tag LOCUS_04210 gene xerD 61579 62529 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173453.1 protein_id gnl|my_center|LOCUS_04210 62743 63510 gene locus_tag LOCUS_04220 gene rpsB 62743 63510 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076880.1 protein_id gnl|my_center|LOCUS_04220 63551 64423 gene locus_tag LOCUS_04230 gene tsf 63551 64423 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384678.1 protein_id gnl|my_center|LOCUS_04230 64557 65285 gene locus_tag LOCUS_04240 gene pyrH 64557 65285 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904124.1 protein_id gnl|my_center|LOCUS_04240 65282 65836 gene locus_tag LOCUS_04250 gene frr 65282 65836 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430598.1 protein_id gnl|my_center|LOCUS_04250 65837 66622 gene locus_tag LOCUS_04260 65837 66622 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_04260 66619 67578 gene locus_tag LOCUS_04270 66619 67578 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460414.1 protein_id gnl|my_center|LOCUS_04270 67575 68774 gene locus_tag LOCUS_04280 67575 68774 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_04280 68774 70129 gene locus_tag LOCUS_04290 gene rseP 68774 70129 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906325.1 protein_id gnl|my_center|LOCUS_04290 70162 71238 gene locus_tag LOCUS_04300 gene ispG 70162 71238 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812233.1 protein_id gnl|my_center|LOCUS_04300 71282 73009 gene locus_tag LOCUS_04310 71282 73009 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460410.1 protein_id gnl|my_center|LOCUS_04310 >Feature sequence06 <1 627 gene locus_tag LOCUS_04320 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098856.1:Gfo/Idh/MocA family oxidoreductase 694 921 gene locus_tag LOCUS_04330 694 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 937 1575 gene locus_tag LOCUS_04340 937 1575 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390357.1 protein_id gnl|my_center|LOCUS_04340 2587 1793 gene locus_tag LOCUS_04350 2587 1793 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_04350 3504 2587 gene locus_tag LOCUS_04360 3504 2587 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_04360 4598 3615 gene locus_tag LOCUS_04370 4598 3615 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439336.1 protein_id gnl|my_center|LOCUS_04370 4948 5346 gene locus_tag LOCUS_04380 4948 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 5343 5606 gene locus_tag LOCUS_04390 5343 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 7411 5669 gene locus_tag LOCUS_04400 7411 5669 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289508.1 protein_id gnl|my_center|LOCUS_04400 9414 7426 gene locus_tag LOCUS_04410 9414 7426 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538222.1 protein_id gnl|my_center|LOCUS_04410 11059 9758 gene locus_tag LOCUS_04420 11059 9758 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945405.1 protein_id gnl|my_center|LOCUS_04420 11399 11199 gene locus_tag LOCUS_04430 11399 11199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 11525 11926 gene locus_tag LOCUS_04440 11525 11926 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_04440 13213 11933 gene locus_tag LOCUS_04450 13213 11933 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_04450 13326 14678 gene locus_tag LOCUS_04460 13326 14678 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864507.1 protein_id gnl|my_center|LOCUS_04460 14697 16130 gene locus_tag LOCUS_04470 14697 16130 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783579.1 protein_id gnl|my_center|LOCUS_04470 16198 17541 gene locus_tag LOCUS_04480 16198 17541 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051223.1 protein_id gnl|my_center|LOCUS_04480 18884 17622 gene locus_tag LOCUS_04490 18884 17622 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392227.1 protein_id gnl|my_center|LOCUS_04490 20225 18942 gene locus_tag LOCUS_04500 20225 18942 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_04500 20525 21496 gene locus_tag LOCUS_04510 20525 21496 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053658.1 protein_id gnl|my_center|LOCUS_04510 21624 22505 gene locus_tag LOCUS_04520 21624 22505 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053659.1 protein_id gnl|my_center|LOCUS_04520 22516 23310 gene locus_tag LOCUS_04530 22516 23310 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051227.1 protein_id gnl|my_center|LOCUS_04530 23433 25484 gene locus_tag LOCUS_04540 23433 25484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 26429 25590 gene locus_tag LOCUS_04550 26429 25590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 26966 26496 gene locus_tag LOCUS_04560 gene recR 26966 26496 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_04560 27422 27105 gene locus_tag LOCUS_04570 27422 27105 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391577.1 protein_id gnl|my_center|LOCUS_04570 27585 27661 gene locus_tag LOCUS_t00190 27585 27661 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 28174 29187 gene locus_tag LOCUS_04580 28174 29187 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_04580 29221 29766 gene locus_tag LOCUS_04590 29221 29766 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_04590 29883 30062 gene locus_tag LOCUS_04600 29883 30062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 30144 32792 gene locus_tag LOCUS_04610 30144 32792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 33679 32999 gene locus_tag LOCUS_04620 gene nth 33679 32999 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814299.1 protein_id gnl|my_center|LOCUS_04620 33870 36227 gene locus_tag LOCUS_04630 gene glgB 33870 36227 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272358.1 protein_id gnl|my_center|LOCUS_04630 36295 38748 gene locus_tag LOCUS_04640 36295 38748 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272357.1 protein_id gnl|my_center|LOCUS_04640 38868 40019 gene locus_tag LOCUS_04650 gene glgC 38868 40019 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_04650 40019 41116 gene locus_tag LOCUS_04660 gene glgD 40019 41116 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183792.1 protein_id gnl|my_center|LOCUS_04660 41126 42610 gene locus_tag LOCUS_04670 gene glgA 41126 42610 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_04670 42767 46027 gene locus_tag LOCUS_04680 42767 46027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 46974 46192 gene locus_tag LOCUS_04690 46974 46192 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989811.1 protein_id gnl|my_center|LOCUS_04690 47271 48017 gene locus_tag LOCUS_04700 47271 48017 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_04700 48064 49482 gene locus_tag LOCUS_04710 48064 49482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 50396 49572 gene locus_tag LOCUS_04720 50396 49572 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_04720 50535 50963 gene locus_tag LOCUS_04730 50535 50963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 52274 51102 gene locus_tag LOCUS_04740 52274 51102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 52781 54484 gene locus_tag LOCUS_04750 52781 54484 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680798.1 protein_id gnl|my_center|LOCUS_04750 54638 54504 gene locus_tag LOCUS_04760 54638 54504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 54613 55680 gene locus_tag LOCUS_04770 gene prfA 54613 55680 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_04770 55782 56729 gene locus_tag LOCUS_04780 55782 56729 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115465.1 protein_id gnl|my_center|LOCUS_04780 56726 57607 gene locus_tag LOCUS_04790 gene prmC 56726 57607 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_04790 57649 58299 gene locus_tag LOCUS_04800 57649 58299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 58345 59601 gene locus_tag LOCUS_04810 58345 59601 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732521.1 protein_id gnl|my_center|LOCUS_04810 59671 60129 gene locus_tag LOCUS_04820 gene rpiB 59671 60129 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_04820 60208 61371 gene locus_tag LOCUS_04830 60208 61371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 61702 62718 gene locus_tag LOCUS_04840 gene argF 61702 62718 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185363.1 protein_id gnl|my_center|LOCUS_04840 62827 64359 gene locus_tag LOCUS_04850 62827 64359 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290168.1 protein_id gnl|my_center|LOCUS_04850 64418 65275 gene locus_tag LOCUS_04860 64418 65275 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963698.1 protein_id gnl|my_center|LOCUS_04860 65341 66348 gene locus_tag LOCUS_04870 65341 66348 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083086.1 protein_id gnl|my_center|LOCUS_04870 66665 66534 gene locus_tag LOCUS_04880 66665 66534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 66628 67275 gene locus_tag LOCUS_04890 gene upp 66628 67275 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_04890 67596 67291 gene locus_tag LOCUS_04900 67596 67291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 >Feature sequence07 860 2200 gene locus_tag LOCUS_04910 860 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 2340 2415 gene locus_tag LOCUS_t00200 2340 2415 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4377 2434 gene locus_tag LOCUS_04920 4377 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 4704 5639 gene locus_tag LOCUS_04930 gene pfkB 4704 5639 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_04930 5744 7450 gene locus_tag LOCUS_04940 gene ptsP 5744 7450 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218638.1 protein_id gnl|my_center|LOCUS_04940 9146 7644 gene locus_tag LOCUS_04950 gene arcD 9146 7644 CDS product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344142.1 protein_id gnl|my_center|LOCUS_04950 10006 9230 gene locus_tag LOCUS_04960 10006 9230 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868883.1 protein_id gnl|my_center|LOCUS_04960 10223 10876 gene locus_tag LOCUS_04970 10223 10876 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943981.1 protein_id gnl|my_center|LOCUS_04970 11894 10902 gene locus_tag LOCUS_04980 11894 10902 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_04980 12157 12082 gene locus_tag LOCUS_t00210 12157 12082 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12338 12168 gene locus_tag LOCUS_04990 12338 12168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 12359 12435 gene locus_tag LOCUS_t00220 12359 12435 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12648 14009 gene locus_tag LOCUS_05000 gene gdhA 12648 14009 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815054.1 protein_id gnl|my_center|LOCUS_05000 14229 14313 gene locus_tag LOCUS_t00230 14229 14313 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14379 15722 gene locus_tag LOCUS_05010 gene tig 14379 15722 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_05010 15861 16469 gene locus_tag LOCUS_05020 gene clpP 15861 16469 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812508.1 protein_id gnl|my_center|LOCUS_05020 16490 17866 gene locus_tag LOCUS_05030 gene clpX 16490 17866 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640796.1 protein_id gnl|my_center|LOCUS_05030 17942 20653 gene locus_tag LOCUS_05040 17942 20653 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_05040 21623 20712 gene locus_tag LOCUS_05050 21623 20712 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775550.1 protein_id gnl|my_center|LOCUS_05050 21760 22968 gene locus_tag LOCUS_05060 21760 22968 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068831.1 protein_id gnl|my_center|LOCUS_05060 23114 24826 gene locus_tag LOCUS_05070 23114 24826 CDS product metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860923.1 protein_id gnl|my_center|LOCUS_05070 24828 25508 gene locus_tag LOCUS_05080 24828 25508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 25534 26154 gene locus_tag LOCUS_05090 25534 26154 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964405.1 protein_id gnl|my_center|LOCUS_05090 26366 26515 gene locus_tag LOCUS_05100 26366 26515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 26756 27106 gene locus_tag LOCUS_05110 26756 27106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 27408 29072 gene locus_tag LOCUS_05120 27408 29072 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_05120 29134 29760 gene locus_tag LOCUS_05130 29134 29760 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259121.1 protein_id gnl|my_center|LOCUS_05130 29763 30617 gene locus_tag LOCUS_05140 29763 30617 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948819.1 protein_id gnl|my_center|LOCUS_05140 30618 31235 gene locus_tag LOCUS_05150 gene folE 30618 31235 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014794265.1 protein_id gnl|my_center|LOCUS_05150 31245 32681 gene locus_tag LOCUS_05160 31245 32681 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804613.1 protein_id gnl|my_center|LOCUS_05160 32797 33228 gene locus_tag LOCUS_05170 32797 33228 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258099.1 protein_id gnl|my_center|LOCUS_05170 33649 35409 gene locus_tag LOCUS_05180 gene thrS 33649 35409 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_05180 35427 36257 gene locus_tag LOCUS_05190 35427 36257 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818363.1 protein_id gnl|my_center|LOCUS_05190 36292 37098 gene locus_tag LOCUS_05200 36292 37098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 37325 39949 gene locus_tag LOCUS_05210 gene adhE 37325 39949 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_05210 39986 40786 gene locus_tag LOCUS_05220 39986 40786 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242836.1 protein_id gnl|my_center|LOCUS_05220 40795 41463 gene locus_tag LOCUS_05230 40795 41463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 42076 41585 gene locus_tag LOCUS_05240 42076 41585 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966286.1 protein_id gnl|my_center|LOCUS_05240 42933 42085 gene locus_tag LOCUS_05250 42933 42085 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_05250 43378 42938 gene locus_tag LOCUS_05260 43378 42938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 44402 43389 gene locus_tag LOCUS_05270 44402 43389 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888004.1 protein_id gnl|my_center|LOCUS_05270 44561 45691 gene locus_tag LOCUS_05280 gene rnd 44561 45691 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086908.1 protein_id gnl|my_center|LOCUS_05280 45744 46418 gene locus_tag LOCUS_05290 45744 46418 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416253.1 protein_id gnl|my_center|LOCUS_05290 46420 47841 gene locus_tag LOCUS_05300 gene xseA 46420 47841 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_05300 47844 48107 gene locus_tag LOCUS_05310 47844 48107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 48144 48491 gene locus_tag LOCUS_05320 48144 48491 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430911.1 protein_id gnl|my_center|LOCUS_05320 48582 49751 gene locus_tag LOCUS_05330 gene ackA 48582 49751 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_05330 50294 49806 gene locus_tag LOCUS_05340 50294 49806 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696696.1 protein_id gnl|my_center|LOCUS_05340 50293 50475 gene locus_tag LOCUS_05350 50293 50475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 50510 52147 gene locus_tag LOCUS_05360 gene pckA 50510 52147 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626187.1 protein_id gnl|my_center|LOCUS_05360 52285 53307 gene locus_tag LOCUS_05370 52285 53307 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_05370 53378 54712 gene locus_tag LOCUS_05380 53378 54712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 55833 54856 gene locus_tag LOCUS_05390 gene pta 55833 54856 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_05390 56055 57257 gene locus_tag LOCUS_05400 gene glf 56055 57257 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875983.1 protein_id gnl|my_center|LOCUS_05400 57311 58345 gene locus_tag LOCUS_05410 57311 58345 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_05410 58493 58678 gene locus_tag LOCUS_05420 58493 58678 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430011.1 protein_id gnl|my_center|LOCUS_05420 58785 59012 gene locus_tag LOCUS_05430 58785 59012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 59062 59403 gene locus_tag LOCUS_05440 59062 59403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05440 59415 60422 gene locus_tag LOCUS_05450 59415 60422 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384240.1 protein_id gnl|my_center|LOCUS_05450 <61488 60489 gene locus_tag LOCUS_05460 <61488 60489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_120770826.1:LD-carboxypeptidase >Feature sequence08 <1 901 gene locus_tag LOCUS_05470 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012027398.1:dipeptidase PepV 1294 3738 gene locus_tag LOCUS_05480 1294 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 4561 3893 gene locus_tag LOCUS_05490 4561 3893 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_05490 4854 6269 gene locus_tag LOCUS_05500 gene pepV 4854 6269 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 protein_id gnl|my_center|LOCUS_05500 7482 6493 gene locus_tag LOCUS_05510 7482 6493 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963504.1 protein_id gnl|my_center|LOCUS_05510 8477 7482 gene locus_tag LOCUS_05520 8477 7482 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966002.1 protein_id gnl|my_center|LOCUS_05520 9387 8488 gene locus_tag LOCUS_05530 gene gsiD 9387 8488 CDS product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097433.1 protein_id gnl|my_center|LOCUS_05530 10317 9397 gene locus_tag LOCUS_05540 gene gsiC 10317 9397 CDS product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367554.1 protein_id gnl|my_center|LOCUS_05540 12138 10438 gene locus_tag LOCUS_05550 gene gsiB 12138 10438 CDS product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191432.1 protein_id gnl|my_center|LOCUS_05550 12486 12295 gene locus_tag LOCUS_05560 12486 12295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 12406 13755 gene locus_tag LOCUS_05570 12406 13755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 13759 16401 gene locus_tag LOCUS_05580 13759 16401 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_05580 17437 16493 gene locus_tag LOCUS_05590 17437 16493 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_05590 20126 17616 gene locus_tag LOCUS_05600 20126 17616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 21745 20510 gene locus_tag LOCUS_05610 21745 20510 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_05610 21909 22631 gene locus_tag LOCUS_05620 21909 22631 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263190.1 protein_id gnl|my_center|LOCUS_05620 22773 23198 gene locus_tag LOCUS_05630 22773 23198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 23228 24955 gene locus_tag LOCUS_05640 23228 24955 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143601.1 protein_id gnl|my_center|LOCUS_05640 27000 25021 gene locus_tag LOCUS_05650 27000 25021 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_05650 28846 26993 gene locus_tag LOCUS_05660 28846 26993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_05660 29313 28846 gene locus_tag LOCUS_05670 29313 28846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 29648 30400 gene locus_tag LOCUS_05680 29648 30400 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722576.1 protein_id gnl|my_center|LOCUS_05680 30397 31299 gene locus_tag LOCUS_05690 gene pfkB 30397 31299 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_05690 31347 33311 gene locus_tag LOCUS_05700 31347 33311 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 protein_id gnl|my_center|LOCUS_05700 34393 33506 gene locus_tag LOCUS_05710 34393 33506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 36450 34396 gene locus_tag LOCUS_05720 36450 34396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 36674 37594 gene locus_tag LOCUS_05730 36674 37594 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129543.1 protein_id gnl|my_center|LOCUS_05730 37756 38403 gene locus_tag LOCUS_05740 37756 38403 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_05740 38516 40114 gene locus_tag LOCUS_05750 gene amyS 38516 40114 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476408.1 protein_id gnl|my_center|LOCUS_05750 40168 41358 gene locus_tag LOCUS_05760 gene queA 40168 41358 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460358.1 protein_id gnl|my_center|LOCUS_05760 42692 41400 gene locus_tag LOCUS_05770 42692 41400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 42867 43139 gene locus_tag LOCUS_05780 42867 43139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 43243 44370 gene locus_tag LOCUS_05790 gene tgt 43243 44370 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_05790 44546 46039 gene locus_tag LOCUS_05800 44546 46039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 46032 47027 gene locus_tag LOCUS_05810 gene secF 46032 47027 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404566.1 protein_id gnl|my_center|LOCUS_05810 47100 50318 gene locus_tag LOCUS_05820 47100 50318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 50308 52683 gene locus_tag LOCUS_05830 50308 52683 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254292.1 protein_id gnl|my_center|LOCUS_05830 52686 53465 gene locus_tag LOCUS_05840 52686 53465 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_05840 53588 53674 gene locus_tag LOCUS_t00240 53588 53674 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 54257 54829 gene locus_tag LOCUS_05850 gene infC 54257 54829 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808206.1 protein_id gnl|my_center|LOCUS_05850 54834 55028 gene locus_tag LOCUS_05860 gene rpmI 54834 55028 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429729.1 protein_id gnl|my_center|LOCUS_05860 55085 55450 gene locus_tag LOCUS_05870 gene rplT 55085 55450 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132352.1 protein_id gnl|my_center|LOCUS_05870 56329 57540 gene locus_tag LOCUS_05880 56329 57540 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_05880 58557 57622 gene locus_tag LOCUS_05890 58557 57622 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_05890 60453 58639 gene locus_tag LOCUS_05900 gene glgB 60453 58639 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880434.1 protein_id gnl|my_center|LOCUS_05900 60658 60733 gene locus_tag LOCUS_t00250 60658 60733 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence09 3686 1290 gene locus_tag LOCUS_05910 3686 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 3916 3698 gene locus_tag LOCUS_05920 3916 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 4131 5198 gene locus_tag LOCUS_05930 gene galE 4131 5198 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861656.1 protein_id gnl|my_center|LOCUS_05930 5326 6384 gene locus_tag LOCUS_05940 gene idsA 5326 6384 CDS product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_05940 6385 7314 gene locus_tag LOCUS_05950 6385 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 9055 7652 gene locus_tag LOCUS_05960 gene gltA 9055 7652 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_05960 9885 9043 gene locus_tag LOCUS_05970 9885 9043 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869857.1 protein_id gnl|my_center|LOCUS_05970 11122 10094 gene locus_tag LOCUS_05980 gene rbsC 11122 10094 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211864.1 protein_id gnl|my_center|LOCUS_05980 12651 11122 gene locus_tag LOCUS_05990 gene rbsA 12651 11122 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217684.1 protein_id gnl|my_center|LOCUS_05990 13829 12720 gene locus_tag LOCUS_06000 13829 12720 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533130.1 protein_id gnl|my_center|LOCUS_06000 14840 13920 gene locus_tag LOCUS_06010 14840 13920 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_06010 15910 14879 gene locus_tag LOCUS_06020 15910 14879 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_06020 16151 17164 gene locus_tag LOCUS_06030 gene cytR 16151 17164 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216730.1 protein_id gnl|my_center|LOCUS_06030 17795 17211 gene locus_tag LOCUS_06040 gene pth 17795 17211 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_06040 18812 17805 gene locus_tag LOCUS_06050 18812 17805 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966497.1 protein_id gnl|my_center|LOCUS_06050 19935 18940 gene locus_tag LOCUS_06060 19935 18940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 20201 20128 gene locus_tag LOCUS_t00260 20201 20128 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 22831 20342 gene locus_tag LOCUS_06070 22831 20342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 23141 22950 gene locus_tag LOCUS_06080 23141 22950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 23744 23244 gene locus_tag LOCUS_06090 gene tsaE 23744 23244 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_06090 24406 23741 gene locus_tag LOCUS_06100 24406 23741 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_06100 25559 24399 gene locus_tag LOCUS_06110 gene alr 25559 24399 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_06110 27187 25571 gene locus_tag LOCUS_06120 27187 25571 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_06120 27692 27192 gene locus_tag LOCUS_06130 27692 27192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 29544 27697 gene locus_tag LOCUS_06140 gene glmS 29544 27697 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_06140 30824 29865 gene locus_tag LOCUS_06150 30824 29865 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 protein_id gnl|my_center|LOCUS_06150 31679 30825 gene locus_tag LOCUS_06160 31679 30825 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103260.1 protein_id gnl|my_center|LOCUS_06160 32042 31761 gene locus_tag LOCUS_06170 32042 31761 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098120.1 protein_id gnl|my_center|LOCUS_06170 33699 32236 gene locus_tag LOCUS_06180 33699 32236 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775482.1 protein_id gnl|my_center|LOCUS_06180 34237 33785 gene locus_tag LOCUS_06190 34237 33785 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463973.1 protein_id gnl|my_center|LOCUS_06190 34518 35405 gene locus_tag LOCUS_06200 34518 35405 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493645.1 protein_id gnl|my_center|LOCUS_06200 36491 36336 gene locus_tag LOCUS_06210 36491 36336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 36649 36936 gene locus_tag LOCUS_06220 36649 36936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 36981 37832 gene locus_tag LOCUS_06230 36981 37832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06230 39561 38074 gene locus_tag LOCUS_06240 39561 38074 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390163.1 protein_id gnl|my_center|LOCUS_06240 40898 39975 gene locus_tag LOCUS_06250 40898 39975 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133037023.1 protein_id gnl|my_center|LOCUS_06250 41743 40880 gene locus_tag LOCUS_06260 41743 40880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 43332 42367 gene locus_tag LOCUS_06270 43332 42367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 44437 43325 gene locus_tag LOCUS_06280 44437 43325 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659021.1 protein_id gnl|my_center|LOCUS_06280 44887 45309 gene locus_tag LOCUS_06290 44887 45309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 46937 45441 gene locus_tag LOCUS_06300 46937 45441 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949126.1 protein_id gnl|my_center|LOCUS_06300 47587 46925 gene locus_tag LOCUS_06310 gene cprR 47587 46925 CDS product two-component system response regulator CprR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437316.1 protein_id gnl|my_center|LOCUS_06310 48119 47697 gene locus_tag LOCUS_06320 48119 47697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 49019 48132 gene locus_tag LOCUS_06330 49019 48132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 49804 49016 gene locus_tag LOCUS_06340 49804 49016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 50514 49801 gene locus_tag LOCUS_06350 50514 49801 CDS product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261887.1 protein_id gnl|my_center|LOCUS_06350 51195 50764 gene locus_tag LOCUS_06360 51195 50764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 51961 51569 gene locus_tag LOCUS_06370 gene rpsI 51961 51569 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814701.1 protein_id gnl|my_center|LOCUS_06370 52404 51964 gene locus_tag LOCUS_06380 gene rplM 52404 51964 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016252.1 protein_id gnl|my_center|LOCUS_06380 53387 52659 gene locus_tag LOCUS_06390 gene nagB 53387 52659 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868991.1 protein_id gnl|my_center|LOCUS_06390 54165 53476 gene locus_tag LOCUS_06400 54165 53476 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113937.1 protein_id gnl|my_center|LOCUS_06400 55151 54177 gene locus_tag LOCUS_06410 55151 54177 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804460.1 protein_id gnl|my_center|LOCUS_06410 56084 55164 gene locus_tag LOCUS_06420 56084 55164 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993834.1 protein_id gnl|my_center|LOCUS_06420 >Feature sequence10 186 689 gene locus_tag LOCUS_06430 186 689 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082781.1 protein_id gnl|my_center|LOCUS_06430 3686 891 gene locus_tag LOCUS_06440 gene gyrA 3686 891 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815130.1 protein_id gnl|my_center|LOCUS_06440 5709 3748 gene locus_tag LOCUS_06450 gene gyrB 5709 3748 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_06450 6458 5919 gene locus_tag LOCUS_06460 6458 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 7554 6442 gene locus_tag LOCUS_06470 gene recF 7554 6442 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243515.1 protein_id gnl|my_center|LOCUS_06470 8661 7564 gene locus_tag LOCUS_06480 gene dnaN 8661 7564 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012615304.1 protein_id gnl|my_center|LOCUS_06480 10403 8910 gene locus_tag LOCUS_06490 10403 8910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 11350 10463 gene locus_tag LOCUS_06500 11350 10463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 11701 11835 gene locus_tag LOCUS_06510 11701 11835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 11878 12162 gene locus_tag LOCUS_06520 11878 12162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 12175 12384 gene locus_tag LOCUS_06530 12175 12384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 12403 13167 gene locus_tag LOCUS_06540 12403 13167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 13253 13816 gene locus_tag LOCUS_06550 13253 13816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 13872 14012 gene locus_tag LOCUS_06560 13872 14012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 13963 14697 gene locus_tag LOCUS_06570 gene rsmG 13963 14697 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462328.1 protein_id gnl|my_center|LOCUS_06570 14828 15628 gene locus_tag LOCUS_06580 14828 15628 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_06580 15621 16502 gene locus_tag LOCUS_06590 15621 16502 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_06590 16489 16731 gene locus_tag LOCUS_06600 16489 16731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 17826 16786 gene locus_tag LOCUS_06610 gene rlmN 17826 16786 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392423.1 protein_id gnl|my_center|LOCUS_06610 17973 18956 gene locus_tag LOCUS_06620 17973 18956 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583317.1 protein_id gnl|my_center|LOCUS_06620 18995 21937 gene locus_tag LOCUS_06630 18995 21937 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392668.1 protein_id gnl|my_center|LOCUS_06630 22869 21922 gene locus_tag LOCUS_06640 22869 21922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 23864 22869 gene locus_tag LOCUS_06650 23864 22869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 24065 27409 gene locus_tag LOCUS_06660 24065 27409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 27672 27445 gene locus_tag LOCUS_06670 27672 27445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 27887 27961 gene locus_tag LOCUS_t00270 27887 27961 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 28089 29372 gene locus_tag LOCUS_06680 28089 29372 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987074.1 protein_id gnl|my_center|LOCUS_06680 29401 30636 gene locus_tag LOCUS_06690 gene pepT 29401 30636 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948200.1 protein_id gnl|my_center|LOCUS_06690 30729 30804 gene locus_tag LOCUS_t00280 30729 30804 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 31540 32883 gene locus_tag LOCUS_06700 gene purB 31540 32883 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817240.1 protein_id gnl|my_center|LOCUS_06700 32908 34140 gene locus_tag LOCUS_06710 32908 34140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 34321 35043 gene locus_tag LOCUS_06720 34321 35043 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948714.1 protein_id gnl|my_center|LOCUS_06720 35047 36555 gene locus_tag LOCUS_06730 35047 36555 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461512.1 protein_id gnl|my_center|LOCUS_06730 36747 36672 gene locus_tag LOCUS_t00290 36747 36672 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 37488 36814 gene locus_tag LOCUS_06740 37488 36814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 38371 37475 gene locus_tag LOCUS_06750 38371 37475 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_06750 40413 38488 gene locus_tag LOCUS_06760 gene pknB 40413 38488 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733096.1 protein_id gnl|my_center|LOCUS_06760 43383 40510 gene locus_tag LOCUS_06770 43383 40510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 44705 43386 gene locus_tag LOCUS_06780 44705 43386 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222007.1 protein_id gnl|my_center|LOCUS_06780 45131 44718 gene locus_tag LOCUS_06790 45131 44718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 46378 45134 gene locus_tag LOCUS_06800 46378 45134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 48168 46375 gene locus_tag LOCUS_06810 48168 46375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 48274 48741 gene locus_tag LOCUS_06820 gene purE 48274 48741 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_06820 48818 49699 gene locus_tag LOCUS_06830 48818 49699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 49753 50847 gene locus_tag LOCUS_06840 gene purM 49753 50847 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461474.1 protein_id gnl|my_center|LOCUS_06840 50844 51461 gene locus_tag LOCUS_06850 gene purN 50844 51461 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938037.1 protein_id gnl|my_center|LOCUS_06850 52157 51579 gene locus_tag LOCUS_06860 52157 51579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 53339 52683 gene locus_tag LOCUS_06870 53339 52683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 53611 53895 gene locus_tag LOCUS_06880 53611 53895 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_06880 53902 54180 gene locus_tag LOCUS_06890 53902 54180 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_06890 >Feature sequence11 1065 646 gene locus_tag LOCUS_06900 gene mscL 1065 646 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571482.1 protein_id gnl|my_center|LOCUS_06900 1538 1113 gene locus_tag LOCUS_06910 gene dtd 1538 1113 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565699.1 protein_id gnl|my_center|LOCUS_06910 3352 1589 gene locus_tag LOCUS_06920 gene ypwA 3352 1589 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215104.1 protein_id gnl|my_center|LOCUS_06920 3615 4556 gene locus_tag LOCUS_06930 3615 4556 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_06930 4696 5151 gene locus_tag LOCUS_06940 4696 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 5327 6649 gene locus_tag LOCUS_06950 gene brnQ 5327 6649 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389948.1 protein_id gnl|my_center|LOCUS_06950 6692 7504 gene locus_tag LOCUS_06960 6692 7504 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764352.1 protein_id gnl|my_center|LOCUS_06960 7844 8911 gene locus_tag LOCUS_06970 gene pheS 7844 8911 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436795.1 protein_id gnl|my_center|LOCUS_06970 8943 11402 gene locus_tag LOCUS_06980 gene pheT 8943 11402 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398979.1 protein_id gnl|my_center|LOCUS_06980 11462 12139 gene locus_tag LOCUS_06990 11462 12139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 13684 12263 gene locus_tag LOCUS_07000 13684 12263 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_07000 13891 14646 gene locus_tag LOCUS_07010 13891 14646 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105289345.1 protein_id gnl|my_center|LOCUS_07010 14687 16063 gene locus_tag LOCUS_07020 14687 16063 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_07020 17892 16453 gene locus_tag LOCUS_07030 gene pyk 17892 16453 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_07030 19059 18055 gene locus_tag LOCUS_07040 19059 18055 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707803.1 protein_id gnl|my_center|LOCUS_07040 19298 19780 gene locus_tag LOCUS_07050 19298 19780 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576062.1 protein_id gnl|my_center|LOCUS_07050 19923 22604 gene locus_tag LOCUS_07060 19923 22604 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643866.1 protein_id gnl|my_center|LOCUS_07060 22606 23823 gene locus_tag LOCUS_07070 22606 23823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 24927 25709 gene locus_tag LOCUS_07080 24927 25709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 25702 27093 gene locus_tag LOCUS_07090 25702 27093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 27090 28433 gene locus_tag LOCUS_07100 27090 28433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 28412 29365 gene locus_tag LOCUS_07110 28412 29365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 29367 30011 gene locus_tag LOCUS_07120 29367 30011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 30060 30263 gene locus_tag LOCUS_07130 30060 30263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 30292 30828 gene locus_tag LOCUS_07140 30292 30828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 30806 31051 gene locus_tag LOCUS_07150 30806 31051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 31113 31538 gene locus_tag LOCUS_07160 31113 31538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 31510 33660 gene locus_tag LOCUS_07170 31510 33660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 33663 34193 gene locus_tag LOCUS_07180 33663 34193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 34194 34577 gene locus_tag LOCUS_07190 34194 34577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 34570 35160 gene locus_tag LOCUS_07200 34570 35160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 35254 35329 gene locus_tag LOCUS_t00300 35254 35329 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 35479 35910 gene locus_tag LOCUS_07210 35479 35910 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381519.1 protein_id gnl|my_center|LOCUS_07210 36121 36333 gene locus_tag LOCUS_07220 36121 36333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 36516 36695 gene locus_tag LOCUS_07230 36516 36695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 36699 37478 gene locus_tag LOCUS_07240 36699 37478 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837604.1 protein_id gnl|my_center|LOCUS_07240 37498 37710 gene locus_tag LOCUS_07250 37498 37710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 38081 38275 gene locus_tag LOCUS_07260 38081 38275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 39094 38180 gene locus_tag LOCUS_07270 39094 38180 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581611.1 protein_id gnl|my_center|LOCUS_07270 39266 40039 gene locus_tag LOCUS_07280 39266 40039 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295798.1 protein_id gnl|my_center|LOCUS_07280 40483 40076 gene locus_tag LOCUS_07290 40483 40076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 40624 42540 gene locus_tag LOCUS_07300 40624 42540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 42661 43161 gene locus_tag LOCUS_07310 42661 43161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 44515 43325 gene locus_tag LOCUS_07320 44515 43325 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_07320 44709 45005 gene locus_tag LOCUS_07330 44709 45005 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871082.1 protein_id gnl|my_center|LOCUS_07330 45020 46630 gene locus_tag LOCUS_07340 45020 46630 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_07340 49170 46831 gene locus_tag LOCUS_07350 49170 46831 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387003.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence12 981 385 gene locus_tag LOCUS_07360 gene ysxC 981 385 CDS product ribosome biogenesis GTP-binding protein YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869116.1 protein_id gnl|my_center|LOCUS_07360 1299 2897 gene locus_tag LOCUS_07370 1299 2897 CDS product TerB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546145.1 protein_id gnl|my_center|LOCUS_07370 2890 4260 gene locus_tag LOCUS_07380 2890 4260 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546148.1 protein_id gnl|my_center|LOCUS_07380 4345 4731 gene locus_tag LOCUS_07390 4345 4731 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_07390 4724 5635 gene locus_tag LOCUS_07400 4724 5635 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_07400 5610 7613 gene locus_tag LOCUS_07410 5610 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 7729 10086 gene locus_tag LOCUS_07420 7729 10086 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546149.1 protein_id gnl|my_center|LOCUS_07420 10155 10532 gene locus_tag LOCUS_07430 10155 10532 CDS product HsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453603.1 protein_id gnl|my_center|LOCUS_07430 10641 10820 gene locus_tag LOCUS_07440 10641 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 12223 10853 gene locus_tag LOCUS_07450 gene lpdA 12223 10853 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809814.1 protein_id gnl|my_center|LOCUS_07450 13221 12232 gene locus_tag LOCUS_07460 13221 12232 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812232.1 protein_id gnl|my_center|LOCUS_07460 14697 13258 gene locus_tag LOCUS_07470 gene gcvPB 14697 13258 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679310.1 protein_id gnl|my_center|LOCUS_07470 16010 14694 gene locus_tag LOCUS_07480 gene gcvPA 16010 14694 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_07480 16397 16014 gene locus_tag LOCUS_07490 gene gcvH 16397 16014 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026899.1 protein_id gnl|my_center|LOCUS_07490 17550 16468 gene locus_tag LOCUS_07500 gene gcvT 17550 16468 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_07500 18006 19685 gene locus_tag LOCUS_07510 gene ettA 18006 19685 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814786.1 protein_id gnl|my_center|LOCUS_07510 20294 20947 gene locus_tag LOCUS_07520 20294 20947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 21171 22376 gene locus_tag LOCUS_07530 21171 22376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 22385 23056 gene locus_tag LOCUS_07540 22385 23056 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815055.1 protein_id gnl|my_center|LOCUS_07540 23049 23906 gene locus_tag LOCUS_07550 23049 23906 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815052.1 protein_id gnl|my_center|LOCUS_07550 24043 24252 gene locus_tag LOCUS_07560 24043 24252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 24249 26225 gene locus_tag LOCUS_07570 24249 26225 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379416.1 protein_id gnl|my_center|LOCUS_07570 28048 26714 gene locus_tag LOCUS_07580 gene glmM 28048 26714 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521474.1 protein_id gnl|my_center|LOCUS_07580 28170 28802 gene locus_tag LOCUS_07590 28170 28802 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_07590 29722 28916 gene locus_tag LOCUS_07600 29722 28916 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_07600 29882 31285 gene locus_tag LOCUS_07610 gene asnS 29882 31285 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_07610 31329 31682 gene locus_tag LOCUS_07620 31329 31682 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948308.1 protein_id gnl|my_center|LOCUS_07620 31779 33173 gene locus_tag LOCUS_07630 gene fumC 31779 33173 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228523.1 protein_id gnl|my_center|LOCUS_07630 33359 34501 gene locus_tag LOCUS_07640 33359 34501 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694419.1 protein_id gnl|my_center|LOCUS_07640 34595 36322 gene locus_tag LOCUS_07650 34595 36322 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626058.1 protein_id gnl|my_center|LOCUS_07650 36325 37401 gene locus_tag LOCUS_07660 36325 37401 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804129.1 protein_id gnl|my_center|LOCUS_07660 38587 37373 gene locus_tag LOCUS_07670 38587 37373 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295845.1 protein_id gnl|my_center|LOCUS_07670 38847 39722 gene locus_tag LOCUS_07680 38847 39722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 41257 39779 gene locus_tag LOCUS_07690 41257 39779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 43372 41450 gene locus_tag LOCUS_07700 43372 41450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 43572 44255 gene locus_tag LOCUS_07710 43572 44255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 45825 44425 gene locus_tag LOCUS_07720 45825 44425 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016800.1 protein_id gnl|my_center|LOCUS_07720 46020 46976 gene locus_tag LOCUS_07730 46020 46976 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068301.1 protein_id gnl|my_center|LOCUS_07730 46985 47893 gene locus_tag LOCUS_07740 46985 47893 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140077.1 protein_id gnl|my_center|LOCUS_07740 47941 49512 gene locus_tag LOCUS_07750 47941 49512 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888725.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence13 1392 262 gene locus_tag LOCUS_07760 1392 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 2064 1393 gene locus_tag LOCUS_07770 2064 1393 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_07770 2156 2302 gene locus_tag LOCUS_07780 2156 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 2367 3218 gene locus_tag LOCUS_07790 2367 3218 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_07790 3243 4214 gene locus_tag LOCUS_07800 3243 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 5089 4331 gene locus_tag LOCUS_07810 5089 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 5574 5086 gene locus_tag LOCUS_07820 5574 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 6717 5815 gene locus_tag LOCUS_07830 6717 5815 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896022.1 protein_id gnl|my_center|LOCUS_07830 6919 12135 gene locus_tag LOCUS_07840 6919 12135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 12512 13423 gene locus_tag LOCUS_07850 12512 13423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 13685 14191 gene locus_tag LOCUS_07860 13685 14191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 14201 14428 gene locus_tag LOCUS_07870 14201 14428 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721916.1 protein_id gnl|my_center|LOCUS_07870 14425 14952 gene locus_tag LOCUS_07880 gene vanZ1 14425 14952 CDS product glycopeptide resistance protein VanZ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889012.1 protein_id gnl|my_center|LOCUS_07880 15405 15719 gene locus_tag LOCUS_07890 15405 15719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 15722 17833 gene locus_tag LOCUS_07900 15722 17833 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_07900 18534 17905 gene locus_tag LOCUS_07910 18534 17905 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809641.1 protein_id gnl|my_center|LOCUS_07910 18790 19092 gene locus_tag LOCUS_07920 18790 19092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 20144 19155 gene locus_tag LOCUS_07930 gene manA 20144 19155 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905553.1 protein_id gnl|my_center|LOCUS_07930 20739 20176 gene locus_tag LOCUS_07940 gene hxlB 20739 20176 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246343.1 protein_id gnl|my_center|LOCUS_07940 21423 20797 gene locus_tag LOCUS_07950 gene hxlA 21423 20797 CDS product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246452.1 protein_id gnl|my_center|LOCUS_07950 22470 21556 gene locus_tag LOCUS_07960 22470 21556 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101944.1 protein_id gnl|my_center|LOCUS_07960 22756 23004 gene locus_tag LOCUS_07970 22756 23004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07970 23015 23224 gene locus_tag LOCUS_07980 23015 23224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 24128 23334 gene locus_tag LOCUS_07990 gene ucpA 24128 23334 CDS product SDR family oxidoreductase UcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517446.1 protein_id gnl|my_center|LOCUS_07990 24365 25417 gene locus_tag LOCUS_08000 24365 25417 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459857.1 protein_id gnl|my_center|LOCUS_08000 25514 25834 gene locus_tag LOCUS_08010 25514 25834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 25837 27525 gene locus_tag LOCUS_08020 25837 27525 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817202.1 protein_id gnl|my_center|LOCUS_08020 27701 28432 gene locus_tag LOCUS_08030 27701 28432 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274793.1 protein_id gnl|my_center|LOCUS_08030 29369 28482 gene locus_tag LOCUS_08040 29369 28482 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458966.1 protein_id gnl|my_center|LOCUS_08040 30430 29699 gene locus_tag LOCUS_08050 30430 29699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 30751 32208 gene locus_tag LOCUS_08060 30751 32208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 32274 33221 gene locus_tag LOCUS_08070 32274 33221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 33214 33837 gene locus_tag LOCUS_08080 33214 33837 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174178.1 protein_id gnl|my_center|LOCUS_08080 36369 34099 gene locus_tag LOCUS_08090 gene pflB 36369 34099 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_08090 37134 36382 gene locus_tag LOCUS_08100 gene pflA 37134 36382 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_08100 38143 37385 gene locus_tag LOCUS_08110 38143 37385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 38766 38161 gene locus_tag LOCUS_08120 38766 38161 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_08120 39899 38823 gene locus_tag LOCUS_08130 39899 38823 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549434.1 protein_id gnl|my_center|LOCUS_08130 40608 40117 gene locus_tag LOCUS_08140 40608 40117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 41092 40643 gene locus_tag LOCUS_08150 41092 40643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 41886 42032 gene locus_tag LOCUS_08160 41886 42032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 42374 43312 gene locus_tag LOCUS_08170 42374 43312 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153115.1 protein_id gnl|my_center|LOCUS_08170 43429 43887 gene locus_tag LOCUS_08180 gene bcp 43429 43887 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_08180 43903 44661 gene locus_tag LOCUS_08190 gene yaaA 43903 44661 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674749.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence14 568 299 gene locus_tag LOCUS_08200 568 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 614 1282 gene locus_tag LOCUS_08210 614 1282 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_08210 1279 2331 gene locus_tag LOCUS_08220 1279 2331 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_08220 2500 3363 gene locus_tag LOCUS_08230 2500 3363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_08230 3353 5443 gene locus_tag LOCUS_08240 3353 5443 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986650.1 protein_id gnl|my_center|LOCUS_08240 5521 5808 gene locus_tag LOCUS_08250 5521 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 7153 5888 gene locus_tag LOCUS_08260 7153 5888 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272456.1 protein_id gnl|my_center|LOCUS_08260 7740 7153 gene locus_tag LOCUS_08270 7740 7153 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460542.1 protein_id gnl|my_center|LOCUS_08270 7699 7887 gene locus_tag LOCUS_08280 7699 7887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 8100 8999 gene locus_tag LOCUS_08290 8100 8999 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460543.1 protein_id gnl|my_center|LOCUS_08290 8999 9745 gene locus_tag LOCUS_08300 8999 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 9747 10481 gene locus_tag LOCUS_08310 9747 10481 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460545.1 protein_id gnl|my_center|LOCUS_08310 11483 10584 gene locus_tag LOCUS_08320 11483 10584 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814610.1 protein_id gnl|my_center|LOCUS_08320 11784 13604 gene locus_tag LOCUS_08330 11784 13604 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460630.1 protein_id gnl|my_center|LOCUS_08330 13608 15347 gene locus_tag LOCUS_08340 13608 15347 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065725.1 protein_id gnl|my_center|LOCUS_08340 16481 15504 gene locus_tag LOCUS_08350 16481 15504 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016646.1 protein_id gnl|my_center|LOCUS_08350 17636 16578 gene locus_tag LOCUS_08360 17636 16578 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874921.1 protein_id gnl|my_center|LOCUS_08360 18318 19328 gene locus_tag LOCUS_08370 18318 19328 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903661.1 protein_id gnl|my_center|LOCUS_08370 19341 19529 gene locus_tag LOCUS_08380 19341 19529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015423.1 protein_id gnl|my_center|LOCUS_08380 19790 19635 gene locus_tag LOCUS_08390 19790 19635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 19809 20531 gene locus_tag LOCUS_08400 19809 20531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 21756 20635 gene locus_tag LOCUS_08410 21756 20635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 21876 23678 gene locus_tag LOCUS_08420 21876 23678 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390093.1 protein_id gnl|my_center|LOCUS_08420 23671 25425 gene locus_tag LOCUS_08430 23671 25425 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390092.1 protein_id gnl|my_center|LOCUS_08430 25536 26057 gene locus_tag LOCUS_08440 25536 26057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08440 26141 26461 gene locus_tag LOCUS_08450 26141 26461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 27327 26488 gene locus_tag LOCUS_08460 27327 26488 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674428.1 protein_id gnl|my_center|LOCUS_08460 27845 30364 gene locus_tag LOCUS_08470 27845 30364 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788368.1 protein_id gnl|my_center|LOCUS_08470 30425 31483 gene locus_tag LOCUS_08480 30425 31483 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202979.1 protein_id gnl|my_center|LOCUS_08480 31669 32610 gene locus_tag LOCUS_08490 31669 32610 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384427.1 protein_id gnl|my_center|LOCUS_08490 33779 32745 gene locus_tag LOCUS_08500 33779 32745 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016459.1 protein_id gnl|my_center|LOCUS_08500 34191 34054 gene locus_tag LOCUS_08510 34191 34054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 35774 34188 gene locus_tag LOCUS_08520 35774 34188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 36572 35787 gene locus_tag LOCUS_08530 36572 35787 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815052.1 protein_id gnl|my_center|LOCUS_08530 37242 36565 gene locus_tag LOCUS_08540 37242 36565 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815055.1 protein_id gnl|my_center|LOCUS_08540 38279 37251 gene locus_tag LOCUS_08550 38279 37251 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458890.1 protein_id gnl|my_center|LOCUS_08550 38598 38413 gene locus_tag LOCUS_08560 38598 38413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 39410 38739 gene locus_tag LOCUS_08570 gene fsa 39410 38739 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430626.1 protein_id gnl|my_center|LOCUS_08570 41879 39465 gene locus_tag LOCUS_08580 41879 39465 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922724.1 protein_id gnl|my_center|LOCUS_08580 41987 42895 gene locus_tag LOCUS_08590 41987 42895 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939546.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence15 224 42 gene locus_tag LOCUS_08600 224 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 634 3618 gene locus_tag LOCUS_08610 gene cas3 634 3618 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440412.1 protein_id gnl|my_center|LOCUS_08610 3602 5296 gene locus_tag LOCUS_08620 3602 5296 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994024.1 protein_id gnl|my_center|LOCUS_08620 5315 5968 gene locus_tag LOCUS_08630 5315 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 5961 7097 gene locus_tag LOCUS_08640 gene cas7e 5961 7097 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 protein_id gnl|my_center|LOCUS_08640 7100 7861 gene locus_tag LOCUS_08650 gene cas5e 7100 7861 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674073.1 protein_id gnl|my_center|LOCUS_08650 7861 8625 gene locus_tag LOCUS_08660 7861 8625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 8589 9632 gene locus_tag LOCUS_08670 gene cas1e 8589 9632 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440418.1 protein_id gnl|my_center|LOCUS_08670 9685 10512 gene locus_tag LOCUS_08680 gene cas2e 9685 10512 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674076.1 protein_id gnl|my_center|LOCUS_08680 10556 11925 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctgctccccgcacacgcgggggtgatcc 12015 12833 gene locus_tag LOCUS_08690 12015 12833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 12808 13014 gene locus_tag LOCUS_08700 12808 13014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 13101 13520 gene locus_tag LOCUS_08710 13101 13520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 13742 13951 gene locus_tag LOCUS_08720 13742 13951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 15609 14482 gene locus_tag LOCUS_08730 15609 14482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 15719 17470 gene locus_tag LOCUS_08740 gene murJ 15719 17470 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108806275.1 protein_id gnl|my_center|LOCUS_08740 17611 18828 gene locus_tag LOCUS_08750 17611 18828 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029869.1 protein_id gnl|my_center|LOCUS_08750 18907 20196 gene locus_tag LOCUS_08760 18907 20196 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804838.1 protein_id gnl|my_center|LOCUS_08760 20208 22223 gene locus_tag LOCUS_08770 gene uvrC 20208 22223 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_08770 23228 22287 gene locus_tag LOCUS_08780 gene whiA 23228 22287 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462177.1 protein_id gnl|my_center|LOCUS_08780 24189 23248 gene locus_tag LOCUS_08790 gene rapZ 24189 23248 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462179.1 protein_id gnl|my_center|LOCUS_08790 24472 25497 gene locus_tag LOCUS_08800 gene gap 24472 25497 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_08800 25635 26828 gene locus_tag LOCUS_08810 25635 26828 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243051.1 protein_id gnl|my_center|LOCUS_08810 26821 27585 gene locus_tag LOCUS_08820 gene tpiA 26821 27585 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990539.1 protein_id gnl|my_center|LOCUS_08820 27954 29372 gene locus_tag LOCUS_08830 27954 29372 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243035.1 protein_id gnl|my_center|LOCUS_08830 29369 30307 gene locus_tag LOCUS_08840 29369 30307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 30304 32127 gene locus_tag LOCUS_08850 30304 32127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 32136 33428 gene locus_tag LOCUS_08860 32136 33428 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244568.1 protein_id gnl|my_center|LOCUS_08860 33600 35396 gene locus_tag LOCUS_08870 gene aspS 33600 35396 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_08870 35428 36195 gene locus_tag LOCUS_08880 35428 36195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 36379 37716 gene locus_tag LOCUS_08890 36379 37716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 39402 37924 gene locus_tag LOCUS_08900 39402 37924 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994262.1 protein_id gnl|my_center|LOCUS_08900 39605 39808 gene locus_tag LOCUS_08910 39605 39808 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905424.1 protein_id gnl|my_center|LOCUS_08910 40142 41290 gene locus_tag LOCUS_08920 40142 41290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence16 1428 538 gene locus_tag LOCUS_08930 1428 538 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086424.1 protein_id gnl|my_center|LOCUS_08930 2176 1523 gene locus_tag LOCUS_08940 2176 1523 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549992.1 protein_id gnl|my_center|LOCUS_08940 3167 2289 gene locus_tag LOCUS_08950 3167 2289 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_08950 3533 3457 gene locus_tag LOCUS_t00310 3533 3457 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3615 3539 gene locus_tag LOCUS_t00320 3615 3539 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4009 5646 gene locus_tag LOCUS_08960 4009 5646 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812931.1 protein_id gnl|my_center|LOCUS_08960 6897 5725 gene locus_tag LOCUS_08970 6897 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 8212 6908 gene locus_tag LOCUS_08980 8212 6908 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054367.1 protein_id gnl|my_center|LOCUS_08980 9499 8312 gene locus_tag LOCUS_08990 9499 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 10262 9714 gene locus_tag LOCUS_09000 10262 9714 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_09000 10464 11444 gene locus_tag LOCUS_09010 10464 11444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 12000 12173 gene locus_tag LOCUS_09020 12000 12173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 12175 12555 gene locus_tag LOCUS_09030 12175 12555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 12549 12737 gene locus_tag LOCUS_09040 12549 12737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 12712 13329 gene locus_tag LOCUS_09050 12712 13329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 13313 13438 gene locus_tag LOCUS_09060 13313 13438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 13548 13423 gene locus_tag LOCUS_09070 13548 13423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 15295 13553 gene locus_tag LOCUS_09080 15295 13553 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679276.1 protein_id gnl|my_center|LOCUS_09080 17110 15296 gene locus_tag LOCUS_09090 17110 15296 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679279.1 protein_id gnl|my_center|LOCUS_09090 18654 17107 gene locus_tag LOCUS_09100 18654 17107 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068102.1 protein_id gnl|my_center|LOCUS_09100 19349 18651 gene locus_tag LOCUS_09110 19349 18651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 19975 19352 gene locus_tag LOCUS_09120 19975 19352 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681184.1 protein_id gnl|my_center|LOCUS_09120 20142 21101 gene locus_tag LOCUS_09130 20142 21101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 22005 21148 gene locus_tag LOCUS_09140 22005 21148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 22042 22428 gene locus_tag LOCUS_09150 22042 22428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 23444 23118 gene locus_tag LOCUS_09160 23444 23118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 23489 24415 gene locus_tag LOCUS_09170 23489 24415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 24598 24942 gene locus_tag LOCUS_09180 24598 24942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 26814 24871 gene locus_tag LOCUS_09190 26814 24871 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230933.1 protein_id gnl|my_center|LOCUS_09190 28012 26801 gene locus_tag LOCUS_09200 28012 26801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 29312 27999 gene locus_tag LOCUS_09210 29312 27999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 32700 29317 gene locus_tag LOCUS_09220 32700 29317 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143843.1 protein_id gnl|my_center|LOCUS_09220 34796 32703 gene locus_tag LOCUS_09230 34796 32703 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963214.1 protein_id gnl|my_center|LOCUS_09230 35013 34801 gene locus_tag LOCUS_09240 35013 34801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 35256 41243 gene locus_tag LOCUS_09250 35256 41243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 >Feature sequence17 254 21 gene locus_tag LOCUS_09260 254 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1220 309 gene locus_tag LOCUS_09270 gene map 1220 309 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_09270 1843 1217 gene locus_tag LOCUS_09280 1843 1217 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_09280 3384 2101 gene locus_tag LOCUS_09290 gene secY 3384 2101 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892870.1 protein_id gnl|my_center|LOCUS_09290 3827 3378 gene locus_tag LOCUS_09300 gene rplO 3827 3378 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810128.1 protein_id gnl|my_center|LOCUS_09300 4026 3838 gene locus_tag LOCUS_09310 gene rpmD 4026 3838 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_09310 4551 4030 gene locus_tag LOCUS_09320 gene rpsE 4551 4030 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854347.1 protein_id gnl|my_center|LOCUS_09320 4930 4562 gene locus_tag LOCUS_09330 gene rplR 4930 4562 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_09330 5546 4992 gene locus_tag LOCUS_09340 gene rplF 5546 4992 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_09340 5971 5573 gene locus_tag LOCUS_09350 gene rpsH 5971 5573 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854344.1 protein_id gnl|my_center|LOCUS_09350 6245 6060 gene locus_tag LOCUS_09360 gene rpsN 6245 6060 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085700.1 protein_id gnl|my_center|LOCUS_09360 6900 6313 gene locus_tag LOCUS_09370 gene rplE 6900 6313 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625881.1 protein_id gnl|my_center|LOCUS_09370 11952 7231 gene locus_tag LOCUS_09380 11952 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 12648 12331 gene locus_tag LOCUS_09390 gene rplX 12648 12331 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 protein_id gnl|my_center|LOCUS_09390 13032 12664 gene locus_tag LOCUS_09400 gene rplN 13032 12664 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938608.1 protein_id gnl|my_center|LOCUS_09400 13361 13095 gene locus_tag LOCUS_09410 gene rpsQ 13361 13095 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762040.1 protein_id gnl|my_center|LOCUS_09410 13587 13375 gene locus_tag LOCUS_09420 gene rpmC 13587 13375 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258239.1 protein_id gnl|my_center|LOCUS_09420 14018 13593 gene locus_tag LOCUS_09430 gene rplP 14018 13593 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 protein_id gnl|my_center|LOCUS_09430 14728 14018 gene locus_tag LOCUS_09440 gene rpsC 14728 14018 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_09440 15097 14732 gene locus_tag LOCUS_09450 gene rplV 15097 14732 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727697.1 protein_id gnl|my_center|LOCUS_09450 15375 15115 gene locus_tag LOCUS_09460 gene rpsS 15375 15115 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421166.1 protein_id gnl|my_center|LOCUS_09460 16233 15397 gene locus_tag LOCUS_09470 gene rplB 16233 15397 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459099.1 protein_id gnl|my_center|LOCUS_09470 16724 16419 gene locus_tag LOCUS_09480 gene rplW 16724 16419 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_09480 17347 16724 gene locus_tag LOCUS_09490 gene rplD 17347 16724 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 protein_id gnl|my_center|LOCUS_09490 17978 17358 gene locus_tag LOCUS_09500 gene rplC 17978 17358 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579663.1 protein_id gnl|my_center|LOCUS_09500 19193 18333 gene locus_tag LOCUS_09510 19193 18333 CDS product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244034.1 protein_id gnl|my_center|LOCUS_09510 19920 19222 gene locus_tag LOCUS_09520 19920 19222 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 protein_id gnl|my_center|LOCUS_09520 21051 19933 gene locus_tag LOCUS_09530 gene ulaG 21051 19933 CDS product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368618.1 protein_id gnl|my_center|LOCUS_09530 22152 21091 gene locus_tag LOCUS_09540 22152 21091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700534.1 protein_id gnl|my_center|LOCUS_09540 22586 22278 gene locus_tag LOCUS_09550 22586 22278 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288830.1 protein_id gnl|my_center|LOCUS_09550 24159 22648 gene locus_tag LOCUS_09560 24159 22648 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288827.1 protein_id gnl|my_center|LOCUS_09560 24692 24219 gene locus_tag LOCUS_09570 24692 24219 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358021.1 protein_id gnl|my_center|LOCUS_09570 24947 25705 gene locus_tag LOCUS_09580 24947 25705 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321321.1 protein_id gnl|my_center|LOCUS_09580 25825 26826 gene locus_tag LOCUS_09590 gene msrB 25825 26826 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203359.1 protein_id gnl|my_center|LOCUS_09590 27136 27456 gene locus_tag LOCUS_09600 27136 27456 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359266.1 protein_id gnl|my_center|LOCUS_09600 29031 27532 gene locus_tag LOCUS_09610 gene glpK 29031 27532 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964631.1 protein_id gnl|my_center|LOCUS_09610 29453 29109 gene locus_tag LOCUS_09620 29453 29109 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964634.1 protein_id gnl|my_center|LOCUS_09620 30787 29456 gene locus_tag LOCUS_09630 30787 29456 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_09630 32238 30793 gene locus_tag LOCUS_09640 32238 30793 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895612.1 protein_id gnl|my_center|LOCUS_09640 32422 32856 gene locus_tag LOCUS_09650 32422 32856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 33343 33035 gene locus_tag LOCUS_09660 gene rpsJ 33343 33035 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_09660 35486 33387 gene locus_tag LOCUS_09670 gene fusA 35486 33387 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_09670 35991 35521 gene locus_tag LOCUS_09680 gene rpsG 35991 35521 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892787.1 protein_id gnl|my_center|LOCUS_09680 36439 36068 gene locus_tag LOCUS_09690 gene rpsL 36439 36068 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_09690 36718 37074 gene locus_tag LOCUS_09700 36718 37074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 <41052 37007 gene locus_tag LOCUS_09710 <41052 37007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222587.1:DNA-directed RNA polymerase subunit beta' >Feature sequence18 909 226 gene locus_tag LOCUS_09720 909 226 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_09720 2978 927 gene locus_tag LOCUS_09730 2978 927 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283300.1 protein_id gnl|my_center|LOCUS_09730 3738 2968 gene locus_tag LOCUS_09740 3738 2968 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106419.1 protein_id gnl|my_center|LOCUS_09740 5014 4133 gene locus_tag LOCUS_09750 5014 4133 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_09750 6079 5150 gene locus_tag LOCUS_09760 gene nudC 6079 5150 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102051.1 protein_id gnl|my_center|LOCUS_09760 6808 6089 gene locus_tag LOCUS_09770 6808 6089 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435276.1 protein_id gnl|my_center|LOCUS_09770 7848 6805 gene locus_tag LOCUS_09780 7848 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 11180 7887 gene locus_tag LOCUS_09790 11180 7887 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058870.1 protein_id gnl|my_center|LOCUS_09790 12138 11368 gene locus_tag LOCUS_09800 gene murI 12138 11368 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475984.1 protein_id gnl|my_center|LOCUS_09800 12303 12731 gene locus_tag LOCUS_09810 12303 12731 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933554.1 protein_id gnl|my_center|LOCUS_09810 12731 13192 gene locus_tag LOCUS_09820 gene pth2 12731 13192 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320039.1 protein_id gnl|my_center|LOCUS_09820 14826 13312 gene locus_tag LOCUS_09830 14826 13312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 15980 14805 gene locus_tag LOCUS_09840 15980 14805 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013555.1 protein_id gnl|my_center|LOCUS_09840 16614 15973 gene locus_tag LOCUS_09850 gene tmk 16614 15973 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_09850 19199 16626 gene locus_tag LOCUS_09860 19199 16626 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902213.1 protein_id gnl|my_center|LOCUS_09860 20096 19242 gene locus_tag LOCUS_09870 gene tatC 20096 19242 CDS product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815373.1 protein_id gnl|my_center|LOCUS_09870 20654 20112 gene locus_tag LOCUS_09880 20654 20112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 21011 20694 gene locus_tag LOCUS_09890 21011 20694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 21923 21063 gene locus_tag LOCUS_09900 21923 21063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 23405 22122 gene locus_tag LOCUS_09910 23405 22122 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_09910 23544 23825 gene locus_tag LOCUS_09920 23544 23825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 25250 23835 gene locus_tag LOCUS_09930 gene nhaA 25250 23835 CDS product sodium/proton antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049644.1 protein_id gnl|my_center|LOCUS_09930 25403 26260 gene locus_tag LOCUS_09940 25403 26260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 26463 27899 gene locus_tag LOCUS_09950 26463 27899 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_09950 28057 29304 gene locus_tag LOCUS_09960 28057 29304 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_09960 29657 30250 gene locus_tag LOCUS_09970 29657 30250 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389733.1 protein_id gnl|my_center|LOCUS_09970 30260 32098 gene locus_tag LOCUS_09980 30260 32098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 32082 32876 gene locus_tag LOCUS_09990 32082 32876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 37873 33143 gene locus_tag LOCUS_10000 37873 33143 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484061.1 protein_id gnl|my_center|LOCUS_10000 38605 37883 gene locus_tag LOCUS_10010 38605 37883 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023665.1 protein_id gnl|my_center|LOCUS_10010 39978 38812 gene locus_tag LOCUS_10020 39978 38812 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887601.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence19 246 3302 gene locus_tag LOCUS_10030 246 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 3477 6266 gene locus_tag LOCUS_10040 gene secA 3477 6266 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_10040 6362 7471 gene locus_tag LOCUS_10050 gene prfB 6362 7471 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_10050 7468 8361 gene locus_tag LOCUS_10060 7468 8361 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_10060 8508 9191 gene locus_tag LOCUS_10070 gene fsa 8508 9191 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228415.1 protein_id gnl|my_center|LOCUS_10070 9181 10062 gene locus_tag LOCUS_10080 9181 10062 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904393.1 protein_id gnl|my_center|LOCUS_10080 10059 11000 gene locus_tag LOCUS_10090 10059 11000 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_10090 11552 12655 gene locus_tag LOCUS_10100 11552 12655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 12648 13580 gene locus_tag LOCUS_10110 gene ftsX 12648 13580 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_10110 13632 15659 gene locus_tag LOCUS_10120 gene rnr 13632 15659 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 protein_id gnl|my_center|LOCUS_10120 15712 16557 gene locus_tag LOCUS_10130 15712 16557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 16562 17044 gene locus_tag LOCUS_10140 gene smpB 16562 17044 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583706.1 protein_id gnl|my_center|LOCUS_10140 17288 18037 gene locus_tag LOCUS_10150 gene nagR 17288 18037 CDS product transcriptional regulator NagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228089.1 protein_id gnl|my_center|LOCUS_10150 18117 19322 gene locus_tag LOCUS_10160 18117 19322 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028212.1 protein_id gnl|my_center|LOCUS_10160 19428 20999 gene locus_tag LOCUS_10170 19428 20999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583514.1 protein_id gnl|my_center|LOCUS_10170 20980 22104 gene locus_tag LOCUS_10180 20980 22104 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723915.1 protein_id gnl|my_center|LOCUS_10180 22106 23020 gene locus_tag LOCUS_10190 22106 23020 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969293.1 protein_id gnl|my_center|LOCUS_10190 23013 23621 gene locus_tag LOCUS_10200 23013 23621 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762168.1 protein_id gnl|my_center|LOCUS_10200 23621 24613 gene locus_tag LOCUS_10210 23621 24613 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258875.1 protein_id gnl|my_center|LOCUS_10210 24627 25382 gene locus_tag LOCUS_10220 24627 25382 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922794.1 protein_id gnl|my_center|LOCUS_10220 25398 26183 gene locus_tag LOCUS_10230 25398 26183 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903881.1 protein_id gnl|my_center|LOCUS_10230 26239 27387 gene locus_tag LOCUS_10240 26239 27387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 27380 28117 gene locus_tag LOCUS_10250 gene trpA 27380 28117 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881005.1 protein_id gnl|my_center|LOCUS_10250 28280 28420 gene locus_tag LOCUS_10260 28280 28420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 28508 29101 gene locus_tag LOCUS_10270 28508 29101 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_10270 29575 29814 gene locus_tag LOCUS_10280 29575 29814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 30450 29938 gene locus_tag LOCUS_10290 30450 29938 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897047.1 protein_id gnl|my_center|LOCUS_10290 32351 30774 gene locus_tag LOCUS_10300 32351 30774 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389524.1 protein_id gnl|my_center|LOCUS_10300 32760 32419 gene locus_tag LOCUS_10310 32760 32419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 33407 32841 gene locus_tag LOCUS_10320 33407 32841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 33895 33371 gene locus_tag LOCUS_10330 33895 33371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 35615 33888 gene locus_tag LOCUS_10340 35615 33888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 35866 35690 gene locus_tag LOCUS_10350 35866 35690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 36001 36276 gene locus_tag LOCUS_10360 36001 36276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 36659 36348 gene locus_tag LOCUS_10370 36659 36348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 38224 36680 gene locus_tag LOCUS_10380 38224 36680 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389521.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence20 912 268 gene locus_tag LOCUS_10390 912 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1586 918 gene locus_tag LOCUS_10400 1586 918 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243153.1 protein_id gnl|my_center|LOCUS_10400 3287 2430 gene locus_tag LOCUS_10410 3287 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 3976 3284 gene locus_tag LOCUS_10420 3976 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 4566 4045 gene locus_tag LOCUS_10430 4566 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 5435 4743 gene locus_tag LOCUS_10440 5435 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 6319 5627 gene locus_tag LOCUS_10450 6319 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 6954 6427 gene locus_tag LOCUS_10460 6954 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 9799 7064 gene locus_tag LOCUS_10470 9799 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 11779 10085 gene locus_tag LOCUS_10480 gene derK 11779 10085 CDS product D-erythrulose 4-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728941.1 protein_id gnl|my_center|LOCUS_10480 12498 11854 gene locus_tag LOCUS_10490 12498 11854 CDS product dihydroxyacetone kinase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680280.1 protein_id gnl|my_center|LOCUS_10490 13548 12559 gene locus_tag LOCUS_10500 13548 12559 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674237.1 protein_id gnl|my_center|LOCUS_10500 14400 13579 gene locus_tag LOCUS_10510 14400 13579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 15227 14556 gene locus_tag LOCUS_10520 15227 14556 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861507.1 protein_id gnl|my_center|LOCUS_10520 16738 15356 gene locus_tag LOCUS_10530 16738 15356 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731941.1 protein_id gnl|my_center|LOCUS_10530 17174 16872 gene locus_tag LOCUS_10540 17174 16872 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722354.1 protein_id gnl|my_center|LOCUS_10540 17696 17220 gene locus_tag LOCUS_10550 17696 17220 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642910.1 protein_id gnl|my_center|LOCUS_10550 18842 18078 gene locus_tag LOCUS_10560 18842 18078 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919197.1 protein_id gnl|my_center|LOCUS_10560 19685 18846 gene locus_tag LOCUS_10570 19685 18846 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245153.1 protein_id gnl|my_center|LOCUS_10570 20143 19682 gene locus_tag LOCUS_10580 20143 19682 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102894.1 protein_id gnl|my_center|LOCUS_10580 20911 20165 gene locus_tag LOCUS_10590 20911 20165 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_10590 22525 21083 gene locus_tag LOCUS_10600 22525 21083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 23817 22522 gene locus_tag LOCUS_10610 23817 22522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 25175 23934 gene locus_tag LOCUS_10620 25175 23934 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068433.1 protein_id gnl|my_center|LOCUS_10620 28956 25423 gene locus_tag LOCUS_10630 gene nifJ 28956 25423 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_10630 29922 29314 gene locus_tag LOCUS_10640 29922 29314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 30141 29932 gene locus_tag LOCUS_10650 30141 29932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 31681 30062 gene locus_tag LOCUS_10660 gene purH 31681 30062 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745444.1 protein_id gnl|my_center|LOCUS_10660 31900 32547 gene locus_tag LOCUS_10670 31900 32547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 33604 32639 gene locus_tag LOCUS_10680 gene arcC 33604 32639 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363186.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence21 2114 1503 gene locus_tag LOCUS_10690 2114 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 3300 2101 gene locus_tag LOCUS_10700 3300 2101 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399716.1 protein_id gnl|my_center|LOCUS_10700 4383 3301 gene locus_tag LOCUS_10710 4383 3301 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861971.1 protein_id gnl|my_center|LOCUS_10710 5805 4462 gene locus_tag LOCUS_10720 5805 4462 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861972.1 protein_id gnl|my_center|LOCUS_10720 6150 5809 gene locus_tag LOCUS_10730 6150 5809 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421322.1 protein_id gnl|my_center|LOCUS_10730 6485 6153 gene locus_tag LOCUS_10740 6485 6153 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421329.1 protein_id gnl|my_center|LOCUS_10740 7616 6561 gene locus_tag LOCUS_10750 gene ypdE 7616 6561 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891992.1 protein_id gnl|my_center|LOCUS_10750 9534 7606 gene locus_tag LOCUS_10760 9534 7606 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169820.1 protein_id gnl|my_center|LOCUS_10760 11315 9963 gene locus_tag LOCUS_10770 11315 9963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 12719 12318 gene locus_tag LOCUS_10780 12719 12318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 12747 13664 gene locus_tag LOCUS_10790 12747 13664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 13825 15219 gene locus_tag LOCUS_10800 13825 15219 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016217.1 protein_id gnl|my_center|LOCUS_10800 15459 15307 gene locus_tag LOCUS_10810 15459 15307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 15806 15630 gene locus_tag LOCUS_10820 15806 15630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 17629 15791 gene locus_tag LOCUS_10830 17629 15791 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006301633.1 protein_id gnl|my_center|LOCUS_10830 20886 17623 gene locus_tag LOCUS_10840 20886 17623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 21629 20883 gene locus_tag LOCUS_10850 21629 20883 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681221.1 protein_id gnl|my_center|LOCUS_10850 22322 21705 gene locus_tag LOCUS_10860 22322 21705 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368971.1 protein_id gnl|my_center|LOCUS_10860 23000 22386 gene locus_tag LOCUS_10870 23000 22386 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679286.1 protein_id gnl|my_center|LOCUS_10870 23235 23053 gene locus_tag LOCUS_10880 23235 23053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 23816 23232 gene locus_tag LOCUS_10890 23816 23232 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775601.1 protein_id gnl|my_center|LOCUS_10890 25048 24338 gene locus_tag LOCUS_10900 25048 24338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 25502 25426 gene locus_tag LOCUS_t00330 25502 25426 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 25712 26335 gene locus_tag LOCUS_10910 gene plsY 25712 26335 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531796.1 protein_id gnl|my_center|LOCUS_10910 26569 27117 gene locus_tag LOCUS_10920 26569 27117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 27187 30918 gene locus_tag LOCUS_10930 27187 30918 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_10930 31413 31063 gene locus_tag LOCUS_10940 31413 31063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 >Feature sequence22 1932 712 gene locus_tag LOCUS_10950 1932 712 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204864755.1 protein_id gnl|my_center|LOCUS_10950 3251 1971 gene locus_tag LOCUS_10960 3251 1971 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775569.1 protein_id gnl|my_center|LOCUS_10960 3385 4467 gene locus_tag LOCUS_10970 3385 4467 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_10970 4897 4484 gene locus_tag LOCUS_10980 4897 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 5828 4890 gene locus_tag LOCUS_10990 5828 4890 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 protein_id gnl|my_center|LOCUS_10990 6030 6752 gene locus_tag LOCUS_11000 6030 6752 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899987.1 protein_id gnl|my_center|LOCUS_11000 6761 7129 gene locus_tag LOCUS_11010 6761 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 7163 8221 gene locus_tag LOCUS_11020 7163 8221 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475870.1 protein_id gnl|my_center|LOCUS_11020 10181 8238 gene locus_tag LOCUS_11030 10181 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 10278 12782 gene locus_tag LOCUS_11040 10278 12782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 12814 13929 gene locus_tag LOCUS_11050 12814 13929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 15083 13953 gene locus_tag LOCUS_11060 gene rffA 15083 13953 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612044.1 protein_id gnl|my_center|LOCUS_11060 15227 16171 gene locus_tag LOCUS_11070 15227 16171 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_11070 16168 17364 gene locus_tag LOCUS_11080 16168 17364 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108800.1 protein_id gnl|my_center|LOCUS_11080 18278 17361 gene locus_tag LOCUS_11090 18278 17361 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419670.1 protein_id gnl|my_center|LOCUS_11090 19398 18319 gene locus_tag LOCUS_11100 19398 18319 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288210.1 protein_id gnl|my_center|LOCUS_11100 19532 20686 gene locus_tag LOCUS_11110 19532 20686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 20782 21894 gene locus_tag LOCUS_11120 20782 21894 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107236.1 protein_id gnl|my_center|LOCUS_11120 21906 22853 gene locus_tag LOCUS_11130 21906 22853 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108799.1 protein_id gnl|my_center|LOCUS_11130 22846 24315 gene locus_tag LOCUS_11140 22846 24315 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767818.1 protein_id gnl|my_center|LOCUS_11140 24394 25509 gene locus_tag LOCUS_11150 24394 25509 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986574.1 protein_id gnl|my_center|LOCUS_11150 25531 26463 gene locus_tag LOCUS_11160 25531 26463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 26510 28165 gene locus_tag LOCUS_11170 26510 28165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 >Feature sequence23 1327 473 gene locus_tag LOCUS_11180 1327 473 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812647.1 protein_id gnl|my_center|LOCUS_11180 2135 1317 gene locus_tag LOCUS_11190 2135 1317 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389753.1 protein_id gnl|my_center|LOCUS_11190 3505 2255 gene locus_tag LOCUS_11200 3505 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 3909 3502 gene locus_tag LOCUS_11210 3909 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 5076 3988 gene locus_tag LOCUS_11220 gene ruvB 5076 3988 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_11220 5712 5080 gene locus_tag LOCUS_11230 gene ruvA 5712 5080 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_11230 6383 5709 gene locus_tag LOCUS_11240 6383 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 8654 6582 gene locus_tag LOCUS_11250 8654 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 9066 8674 gene locus_tag LOCUS_11260 9066 8674 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048271.1 protein_id gnl|my_center|LOCUS_11260 13158 9265 gene locus_tag LOCUS_11270 13158 9265 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_11270 16933 13325 gene locus_tag LOCUS_11280 16933 13325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 20142 16933 gene locus_tag LOCUS_11290 20142 16933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 20554 20249 gene locus_tag LOCUS_11300 20554 20249 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869726.1 protein_id gnl|my_center|LOCUS_11300 20728 21087 gene locus_tag LOCUS_11310 20728 21087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 21403 21200 gene locus_tag LOCUS_11320 21403 21200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 22270 21803 gene locus_tag LOCUS_11330 22270 21803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 23958 22501 gene locus_tag LOCUS_11340 23958 22501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 24653 23958 gene locus_tag LOCUS_11350 24653 23958 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_11350 25460 24741 gene locus_tag LOCUS_11360 25460 24741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 26242 25460 gene locus_tag LOCUS_11370 gene pstB 26242 25460 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868848.1 protein_id gnl|my_center|LOCUS_11370 27021 26242 gene locus_tag LOCUS_11380 gene pstB 27021 26242 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289486.1 protein_id gnl|my_center|LOCUS_11380 27983 27030 gene locus_tag LOCUS_11390 gene pstA 27983 27030 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722630.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence24 2381 1623 gene locus_tag LOCUS_11400 gene cysE 2381 1623 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411985.1 protein_id gnl|my_center|LOCUS_11400 3298 2384 gene locus_tag LOCUS_11410 gene cysK 3298 2384 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_11410 4749 3577 gene locus_tag LOCUS_11420 4749 3577 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_11420 5870 4824 gene locus_tag LOCUS_11430 gene serC 5870 4824 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_11430 6805 6077 gene locus_tag LOCUS_11440 6805 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 7220 8005 gene locus_tag LOCUS_11450 gene sufC 7220 8005 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894511.1 protein_id gnl|my_center|LOCUS_11450 8007 9416 gene locus_tag LOCUS_11460 gene sufB 8007 9416 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_11460 9416 10501 gene locus_tag LOCUS_11470 gene sufD 9416 10501 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681871.1 protein_id gnl|my_center|LOCUS_11470 10502 11767 gene locus_tag LOCUS_11480 10502 11767 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376739.1 protein_id gnl|my_center|LOCUS_11480 11754 12188 gene locus_tag LOCUS_11490 11754 12188 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_11490 12191 12652 gene locus_tag LOCUS_11500 12191 12652 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479949.1 protein_id gnl|my_center|LOCUS_11500 13807 12935 gene locus_tag LOCUS_11510 13807 12935 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290335.1 protein_id gnl|my_center|LOCUS_11510 14105 15055 gene locus_tag LOCUS_11520 14105 15055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052675.1 protein_id gnl|my_center|LOCUS_11520 15654 15052 gene locus_tag LOCUS_11530 gene yfbR 15654 15052 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813860.1 protein_id gnl|my_center|LOCUS_11530 16826 16011 gene locus_tag LOCUS_11540 16826 16011 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184185.1 protein_id gnl|my_center|LOCUS_11540 17878 16829 gene locus_tag LOCUS_11550 17878 16829 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461831.1 protein_id gnl|my_center|LOCUS_11550 18543 17878 gene locus_tag LOCUS_11560 18543 17878 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461832.1 protein_id gnl|my_center|LOCUS_11560 19009 18671 gene locus_tag LOCUS_11570 19009 18671 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461833.1 protein_id gnl|my_center|LOCUS_11570 21451 19268 gene locus_tag LOCUS_11580 21451 19268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 21689 22480 gene locus_tag LOCUS_11590 21689 22480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 23035 23256 gene locus_tag LOCUS_11600 23035 23256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence25 1910 1317 gene locus_tag LOCUS_11610 1910 1317 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902004.1 protein_id gnl|my_center|LOCUS_11610 3548 2037 gene locus_tag LOCUS_11620 gene lysS 3548 2037 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701392.1 protein_id gnl|my_center|LOCUS_11620 4165 3692 gene locus_tag LOCUS_11630 gene greA 4165 3692 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475971.1 protein_id gnl|my_center|LOCUS_11630 4507 4307 gene locus_tag LOCUS_11640 4507 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 4608 4748 gene locus_tag LOCUS_11650 4608 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 4774 5574 gene locus_tag LOCUS_11660 4774 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 6642 7253 gene locus_tag LOCUS_11670 6642 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 8770 7580 gene locus_tag LOCUS_11680 8770 7580 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001812710.1 protein_id gnl|my_center|LOCUS_11680 9010 9726 gene locus_tag LOCUS_11690 9010 9726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 10844 9789 gene locus_tag LOCUS_11700 10844 9789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 11794 10964 gene locus_tag LOCUS_11710 11794 10964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 11926 13782 gene locus_tag LOCUS_11720 11926 13782 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868842.1 protein_id gnl|my_center|LOCUS_11720 14466 13867 gene locus_tag LOCUS_11730 14466 13867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 15602 14490 gene locus_tag LOCUS_11740 15602 14490 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721658.1 protein_id gnl|my_center|LOCUS_11740 16040 15612 gene locus_tag LOCUS_11750 16040 15612 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706826.1 protein_id gnl|my_center|LOCUS_11750 17540 16041 gene locus_tag LOCUS_11760 17540 16041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 18547 17540 gene locus_tag LOCUS_11770 18547 17540 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585662.1 protein_id gnl|my_center|LOCUS_11770 19462 18662 gene locus_tag LOCUS_11780 gene agaD 19462 18662 CDS product PTS galactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534351.1 protein_id gnl|my_center|LOCUS_11780 20231 19452 gene locus_tag LOCUS_11790 gene agaC 20231 19452 CDS product PTS galactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101866.1 protein_id gnl|my_center|LOCUS_11790 20796 20323 gene locus_tag LOCUS_11800 gene agaB 20796 20323 CDS product PTS galactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098022.1 protein_id gnl|my_center|LOCUS_11800 21731 21027 gene locus_tag LOCUS_11810 21731 21027 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254139.1 protein_id gnl|my_center|LOCUS_11810 21901 22611 gene locus_tag LOCUS_11820 gene deoC 21901 22611 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254138.1 protein_id gnl|my_center|LOCUS_11820 22861 22785 gene locus_tag LOCUS_t00340 22861 22785 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence26 1596 394 gene locus_tag LOCUS_11830 1596 394 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_11830 2618 1980 gene locus_tag LOCUS_11840 gene deoC 2618 1980 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017446.1 protein_id gnl|my_center|LOCUS_11840 4701 3061 gene locus_tag LOCUS_11850 gene groL 4701 3061 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804390.1 protein_id gnl|my_center|LOCUS_11850 5069 4779 gene locus_tag LOCUS_11860 gene groES 5069 4779 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_11860 7323 5365 gene locus_tag LOCUS_11870 7323 5365 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_11870 7586 8866 gene locus_tag LOCUS_11880 7586 8866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 9055 10686 gene locus_tag LOCUS_11890 9055 10686 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257624.1 protein_id gnl|my_center|LOCUS_11890 11771 10980 gene locus_tag LOCUS_11900 11771 10980 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356242.1 protein_id gnl|my_center|LOCUS_11900 12974 11781 gene locus_tag LOCUS_11910 12974 11781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 13978 13028 gene locus_tag LOCUS_11920 13978 13028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 15252 14185 gene locus_tag LOCUS_11930 15252 14185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 16210 15446 gene locus_tag LOCUS_11940 16210 15446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 17120 16287 gene locus_tag LOCUS_11950 gene truA 17120 16287 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_11950 17683 17219 gene locus_tag LOCUS_11960 17683 17219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 18657 17716 gene locus_tag LOCUS_11970 18657 17716 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567511.1 protein_id gnl|my_center|LOCUS_11970 19286 18681 gene locus_tag LOCUS_11980 gene rpsD 19286 18681 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_11980 19706 19305 gene locus_tag LOCUS_11990 gene rpsK 19706 19305 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_11990 20081 19710 gene locus_tag LOCUS_12000 gene rpsM 20081 19710 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_12000 20557 20339 gene locus_tag LOCUS_12010 gene infA 20557 20339 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence27 536 721 gene locus_tag LOCUS_12020 536 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 807 1478 gene locus_tag LOCUS_12030 807 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1707 3743 gene locus_tag LOCUS_12040 1707 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 4144 5442 gene locus_tag LOCUS_12050 4144 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 5638 6867 gene locus_tag LOCUS_12060 5638 6867 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_12060 6956 7831 gene locus_tag LOCUS_12070 6956 7831 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_12070 7836 8954 gene locus_tag LOCUS_12080 7836 8954 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_12080 8947 9867 gene locus_tag LOCUS_12090 8947 9867 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_12090 9871 10578 gene locus_tag LOCUS_12100 9871 10578 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_12100 10722 12542 gene locus_tag LOCUS_12110 10722 12542 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030802.1 protein_id gnl|my_center|LOCUS_12110 12551 13858 gene locus_tag LOCUS_12120 12551 13858 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766478.1 protein_id gnl|my_center|LOCUS_12120 14880 13954 gene locus_tag LOCUS_12130 gene thrB 14880 13954 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674786.1 protein_id gnl|my_center|LOCUS_12130 16370 14877 gene locus_tag LOCUS_12140 gene thrC 16370 14877 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390008.1 protein_id gnl|my_center|LOCUS_12140 16472 17620 gene locus_tag LOCUS_12150 16472 17620 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674788.1 protein_id gnl|my_center|LOCUS_12150 17624 18949 gene locus_tag LOCUS_12160 17624 18949 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286872.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence28 670 1203 gene locus_tag LOCUS_12170 670 1203 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837101.1 protein_id gnl|my_center|LOCUS_12170 1519 2715 gene locus_tag LOCUS_12180 1519 2715 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_12180 2845 3222 gene locus_tag LOCUS_12190 2845 3222 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566897.1 protein_id gnl|my_center|LOCUS_12190 3225 4250 gene locus_tag LOCUS_12200 3225 4250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_12200 4251 4967 gene locus_tag LOCUS_12210 4251 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 5755 5033 gene locus_tag LOCUS_12220 5755 5033 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027675.1 protein_id gnl|my_center|LOCUS_12220 5949 8468 gene locus_tag LOCUS_12230 gene pcrA 5949 8468 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319708.1 protein_id gnl|my_center|LOCUS_12230 8541 9443 gene locus_tag LOCUS_12240 gene rfbA 8541 9443 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068370.1 protein_id gnl|my_center|LOCUS_12240 9528 10550 gene locus_tag LOCUS_12250 gene rfbB 9528 10550 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389372.1 protein_id gnl|my_center|LOCUS_12250 10573 12051 gene locus_tag LOCUS_12260 10573 12051 CDS product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068371.1 protein_id gnl|my_center|LOCUS_12260 12061 12483 gene locus_tag LOCUS_12270 gene queD 12061 12483 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949100.1 protein_id gnl|my_center|LOCUS_12270 12631 13674 gene locus_tag LOCUS_12280 12631 13674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 13674 14588 gene locus_tag LOCUS_12290 gene rsmI 13674 14588 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288078.1 protein_id gnl|my_center|LOCUS_12290 14695 16320 gene locus_tag LOCUS_12300 gene metG 14695 16320 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080396.1 protein_id gnl|my_center|LOCUS_12300 16401 17282 gene locus_tag LOCUS_12310 gene rsmA 16401 17282 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013966.1 protein_id gnl|my_center|LOCUS_12310 17279 18265 gene locus_tag LOCUS_12320 17279 18265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 18356 19171 gene locus_tag LOCUS_12330 18356 19171 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541081.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence29 1156 833 gene locus_tag LOCUS_12340 1156 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 2344 1265 gene locus_tag LOCUS_12350 2344 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 2716 2348 gene locus_tag LOCUS_12360 gene czrA 2716 2348 CDS product Zn(II)-responsive metalloregulatory transcriptional repressor CzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829898.1 protein_id gnl|my_center|LOCUS_12360 3142 3918 gene locus_tag LOCUS_12370 3142 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 3915 6071 gene locus_tag LOCUS_12380 3915 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 6171 7040 gene locus_tag LOCUS_12390 6171 7040 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_12390 7155 8333 gene locus_tag LOCUS_12400 7155 8333 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966853.1 protein_id gnl|my_center|LOCUS_12400 8346 10046 gene locus_tag LOCUS_12410 8346 10046 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919299.1 protein_id gnl|my_center|LOCUS_12410 10102 11574 gene locus_tag LOCUS_12420 10102 11574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 13907 11625 gene locus_tag LOCUS_12430 gene uvrB 13907 11625 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_12430 14330 13914 gene locus_tag LOCUS_12440 14330 13914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 15145 14387 gene locus_tag LOCUS_12450 15145 14387 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003604400.1 protein_id gnl|my_center|LOCUS_12450 15959 15207 gene locus_tag LOCUS_12460 15959 15207 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137994.1 protein_id gnl|my_center|LOCUS_12460 16857 16015 gene locus_tag LOCUS_12470 16857 16015 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776970.1 protein_id gnl|my_center|LOCUS_12470 17513 16854 gene locus_tag LOCUS_12480 17513 16854 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776971.1 protein_id gnl|my_center|LOCUS_12480 18550 17576 gene locus_tag LOCUS_12490 18550 17576 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776972.1 protein_id gnl|my_center|LOCUS_12490 19315 18686 gene locus_tag LOCUS_12500 gene coaE 19315 18686 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence30 409 101 gene locus_tag LOCUS_12510 409 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1380 730 gene locus_tag LOCUS_12520 1380 730 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_12520 1500 1748 gene locus_tag LOCUS_12530 gene secG 1500 1748 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325957.1 protein_id gnl|my_center|LOCUS_12530 3981 2209 gene locus_tag LOCUS_12540 3981 2209 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389694.1 protein_id gnl|my_center|LOCUS_12540 6239 4197 gene locus_tag LOCUS_12550 6239 4197 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_12550 7356 6319 gene locus_tag LOCUS_12560 7356 6319 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812440.1 protein_id gnl|my_center|LOCUS_12560 8359 7367 gene locus_tag LOCUS_12570 8359 7367 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812438.1 protein_id gnl|my_center|LOCUS_12570 8791 9717 gene locus_tag LOCUS_12580 8791 9717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_12580 9726 10784 gene locus_tag LOCUS_12590 9726 10784 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_12590 10802 11824 gene locus_tag LOCUS_12600 10802 11824 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812003.1 protein_id gnl|my_center|LOCUS_12600 11826 12839 gene locus_tag LOCUS_12610 11826 12839 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812005.1 protein_id gnl|my_center|LOCUS_12610 12968 14869 gene locus_tag LOCUS_12620 12968 14869 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812007.1 protein_id gnl|my_center|LOCUS_12620 15092 15574 gene locus_tag LOCUS_12630 gene rnhA 15092 15574 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921194.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence31 96 1262 gene locus_tag LOCUS_12640 96 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1368 1961 gene locus_tag LOCUS_12650 gene raiA 1368 1961 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056677.1 protein_id gnl|my_center|LOCUS_12650 1948 3039 gene locus_tag LOCUS_12660 1948 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 3179 4204 gene locus_tag LOCUS_12670 3179 4204 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812339.1 protein_id gnl|my_center|LOCUS_12670 4243 5022 gene locus_tag LOCUS_12680 4243 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 5058 5657 gene locus_tag LOCUS_12690 5058 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 5791 6660 gene locus_tag LOCUS_12700 5791 6660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 6700 6870 gene locus_tag LOCUS_12710 6700 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 6867 7856 gene locus_tag LOCUS_12720 6867 7856 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727836.1 protein_id gnl|my_center|LOCUS_12720 10510 7871 gene locus_tag LOCUS_12730 10510 7871 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067921.1 protein_id gnl|my_center|LOCUS_12730 10824 11549 gene locus_tag LOCUS_12740 10824 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 11634 12497 gene locus_tag LOCUS_12750 gene folP 11634 12497 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 protein_id gnl|my_center|LOCUS_12750 13351 12512 gene locus_tag LOCUS_12760 gene trmB 13351 12512 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239385.1 protein_id gnl|my_center|LOCUS_12760 15027 13366 gene locus_tag LOCUS_12770 15027 13366 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_12770 <16425 15178 gene locus_tag LOCUS_12780 <16425 15178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061070.1:fumarate reductase subunit A >Feature sequence32 919 1365 gene locus_tag LOCUS_12790 919 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1439 2188 gene locus_tag LOCUS_12800 1439 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 2199 3080 gene locus_tag LOCUS_12810 2199 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 4777 5439 gene locus_tag LOCUS_12820 4777 5439 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243153.1 protein_id gnl|my_center|LOCUS_12820 5439 6077 gene locus_tag LOCUS_12830 5439 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 6113 7021 gene locus_tag LOCUS_12840 6113 7021 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953624.1 protein_id gnl|my_center|LOCUS_12840 7277 8863 gene locus_tag LOCUS_12850 7277 8863 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116517.1 protein_id gnl|my_center|LOCUS_12850 8998 9939 gene locus_tag LOCUS_12860 8998 9939 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137618.1 protein_id gnl|my_center|LOCUS_12860 9942 11966 gene locus_tag LOCUS_12870 9942 11966 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993832.1 protein_id gnl|my_center|LOCUS_12870 11966 12817 gene locus_tag LOCUS_12880 11966 12817 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116524.1 protein_id gnl|my_center|LOCUS_12880 12900 13895 gene locus_tag LOCUS_12890 12900 13895 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795124.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence33 2534 171 gene locus_tag LOCUS_12900 2534 171 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809460.1 protein_id gnl|my_center|LOCUS_12900 3296 2541 gene locus_tag LOCUS_12910 3296 2541 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461283.1 protein_id gnl|my_center|LOCUS_12910 4959 3316 gene locus_tag LOCUS_12920 4959 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 6311 5346 gene locus_tag LOCUS_12930 6311 5346 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861477.1 protein_id gnl|my_center|LOCUS_12930 8907 6646 gene locus_tag LOCUS_12940 gene feoB 8907 6646 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_12940 9249 9028 gene locus_tag LOCUS_12950 9249 9028 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_12950 9634 9353 gene locus_tag LOCUS_12960 9634 9353 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811001.1 protein_id gnl|my_center|LOCUS_12960 12581 9870 gene locus_tag LOCUS_12970 12581 9870 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013362858.1 protein_id gnl|my_center|LOCUS_12970 12776 14197 gene locus_tag LOCUS_12980 12776 14197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence34 614 2422 gene locus_tag LOCUS_12990 gene ade 614 2422 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948084.1 protein_id gnl|my_center|LOCUS_12990 2455 3324 gene locus_tag LOCUS_13000 gene yidA 2455 3324 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723485.1 protein_id gnl|my_center|LOCUS_13000 5042 3321 gene locus_tag LOCUS_13010 gene cydC 5042 3321 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667625.1 protein_id gnl|my_center|LOCUS_13010 6787 5039 gene locus_tag LOCUS_13020 6787 5039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141300.1 protein_id gnl|my_center|LOCUS_13020 7335 8567 gene locus_tag LOCUS_13030 7335 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 10353 8659 gene locus_tag LOCUS_13040 gene pgi 10353 8659 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389549.1 protein_id gnl|my_center|LOCUS_13040 11315 10761 gene locus_tag LOCUS_13050 11315 10761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence35 3946 437 gene locus_tag LOCUS_13060 3946 437 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900992.1 protein_id gnl|my_center|LOCUS_13060 4802 4422 gene locus_tag LOCUS_13070 gene rplL 4802 4422 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940187.1 protein_id gnl|my_center|LOCUS_13070 5406 4885 gene locus_tag LOCUS_13080 gene rplJ 5406 4885 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870241.1 protein_id gnl|my_center|LOCUS_13080 6584 5877 gene locus_tag LOCUS_13090 gene rplA 6584 5877 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013680.1 protein_id gnl|my_center|LOCUS_13090 7104 6676 gene locus_tag LOCUS_13100 gene rplK 7104 6676 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776394.1 protein_id gnl|my_center|LOCUS_13100 7749 7201 gene locus_tag LOCUS_13110 gene nusG 7749 7201 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_13110 8120 7752 gene locus_tag LOCUS_13120 8120 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 8287 8212 gene locus_tag LOCUS_t00350 8287 8212 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 8452 8303 gene locus_tag LOCUS_13130 gene rpmG 8452 8303 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_13130 <9712 8756 gene locus_tag LOCUS_13140 <9712 8756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545401.1:elongation factor Tu >Feature sequence36 22 1386 gene locus_tag LOCUS_13150 22 1386 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461680.1 protein_id gnl|my_center|LOCUS_13150 1491 2501 gene locus_tag LOCUS_13160 1491 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 3513 2590 gene locus_tag LOCUS_13170 gene murB 3513 2590 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_13170 3901 3572 gene locus_tag LOCUS_13180 3901 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 4578 3898 gene locus_tag LOCUS_13190 4578 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 5299 4607 gene locus_tag LOCUS_13200 5299 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 6205 5324 gene locus_tag LOCUS_13210 6205 5324 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245785.1 protein_id gnl|my_center|LOCUS_13210 6408 8087 gene locus_tag LOCUS_13220 6408 8087 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 protein_id gnl|my_center|LOCUS_13220 8252 9451 gene locus_tag LOCUS_13230 8252 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence37 1746 127 gene locus_tag LOCUS_13240 1746 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 2825 1758 gene locus_tag LOCUS_13250 2825 1758 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383751.1 protein_id gnl|my_center|LOCUS_13250 3558 2836 gene locus_tag LOCUS_13260 3558 2836 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380521.1 protein_id gnl|my_center|LOCUS_13260 6306 3667 gene locus_tag LOCUS_13270 gene ggaB 6306 3667 CDS product poly(glucosyl N-acetylgalactosamine 1-phosphate) glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227939.1 protein_id gnl|my_center|LOCUS_13270 7593 8189 gene locus_tag LOCUS_13280 7593 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 8267 9313 gene locus_tag LOCUS_13290 8267 9313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence38 1749 3782 gene locus_tag LOCUS_13300 1749 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 5444 3816 gene locus_tag LOCUS_13310 5444 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 6614 5487 gene locus_tag LOCUS_13320 6614 5487 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143333.1 protein_id gnl|my_center|LOCUS_13320 7940 6624 gene locus_tag LOCUS_13330 7940 6624 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905634.1 protein_id gnl|my_center|LOCUS_13330 8069 8500 gene locus_tag LOCUS_13340 gene tagD 8069 8500 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776758.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence39 436 1050 gene locus_tag LOCUS_13350 436 1050 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791124.1 protein_id gnl|my_center|LOCUS_13350 1066 2400 gene locus_tag LOCUS_13360 1066 2400 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_13360 2387 2608 gene locus_tag LOCUS_13370 2387 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 2804 2729 gene locus_tag LOCUS_t00360 2804 2729 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2933 3709 gene locus_tag LOCUS_13380 2933 3709 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108683.1 protein_id gnl|my_center|LOCUS_13380 4215 3715 gene locus_tag LOCUS_13390 4215 3715 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896384.1 protein_id gnl|my_center|LOCUS_13390 4412 5446 gene locus_tag LOCUS_13400 4412 5446 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_13400 5575 6627 gene locus_tag LOCUS_13410 5575 6627 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812796.1 protein_id gnl|my_center|LOCUS_13410 6679 7299 gene locus_tag LOCUS_13420 6679 7299 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356705.1 protein_id gnl|my_center|LOCUS_13420 7452 8765 gene locus_tag LOCUS_13430 gene hisS 7452 8765 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence40 <1 566 gene locus_tag LOCUS_13440 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003891419.1:DeoR/GlpR family DNA-binding transcription regulator 1250 651 gene locus_tag LOCUS_13450 1250 651 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142986.1 protein_id gnl|my_center|LOCUS_13450 1983 1252 gene locus_tag LOCUS_13460 gene rlmB 1983 1252 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966431.1 protein_id gnl|my_center|LOCUS_13460 2087 1917 gene locus_tag LOCUS_13470 2087 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 3663 2191 gene locus_tag LOCUS_13480 gene cysS 3663 2191 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459084.1 protein_id gnl|my_center|LOCUS_13480 4222 3731 gene locus_tag LOCUS_13490 gene ispF 4222 3731 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488386.1 protein_id gnl|my_center|LOCUS_13490 5068 4265 gene locus_tag LOCUS_13500 gene ispD 5068 4265 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056453.1 protein_id gnl|my_center|LOCUS_13500 6141 5065 gene locus_tag LOCUS_13510 gene disA 6141 5065 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_13510 <8380 6793 gene locus_tag LOCUS_13520 <8380 6793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011067907.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence41 1636 44 gene locus_tag LOCUS_13530 gene guaA 1636 44 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965987.1 protein_id gnl|my_center|LOCUS_13530 1859 2956 gene locus_tag LOCUS_13540 1859 2956 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592824.1 protein_id gnl|my_center|LOCUS_13540 4127 3063 gene locus_tag LOCUS_13550 gene ychF 4127 3063 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293105.1 protein_id gnl|my_center|LOCUS_13550 5483 4209 gene locus_tag LOCUS_13560 5483 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 7052 5721 gene locus_tag LOCUS_13570 7052 5721 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243069.1 protein_id gnl|my_center|LOCUS_13570 7492 7049 gene locus_tag LOCUS_13580 7492 7049 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964852.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence42 103 288 gene locus_tag LOCUS_13590 103 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 315 1118 gene locus_tag LOCUS_13600 315 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1236 1430 gene locus_tag LOCUS_13610 1236 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1471 2073 gene locus_tag LOCUS_13620 1471 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 2060 2539 gene locus_tag LOCUS_13630 2060 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 2529 4178 gene locus_tag LOCUS_13640 gene atpA 2529 4178 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356555.1 protein_id gnl|my_center|LOCUS_13640 4238 5104 gene locus_tag LOCUS_13650 4238 5104 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723463.1 protein_id gnl|my_center|LOCUS_13650 5104 6588 gene locus_tag LOCUS_13660 gene atpD 5104 6588 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_13660 6596 7036 gene locus_tag LOCUS_13670 6596 7036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence43 769 113 gene locus_tag LOCUS_13680 769 113 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095352.1 protein_id gnl|my_center|LOCUS_13680 940 1464 gene locus_tag LOCUS_13690 940 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1461 2462 gene locus_tag LOCUS_13700 gene ansA 1461 2462 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_13700 3785 2508 gene locus_tag LOCUS_13710 3785 2508 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442178.1 protein_id gnl|my_center|LOCUS_13710 4943 3825 gene locus_tag LOCUS_13720 4943 3825 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_13720 6210 5020 gene locus_tag LOCUS_13730 6210 5020 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948019.1 protein_id gnl|my_center|LOCUS_13730 <6889 6287 gene locus_tag LOCUS_13740 <6889 6287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790318.1:O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase >Feature sequence44 303 393 gene locus_tag LOCUS_t00370 303 393 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 803 727 gene locus_tag LOCUS_t00380 803 727 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1300 935 gene locus_tag LOCUS_13750 1300 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 3532 1463 gene locus_tag LOCUS_13760 gene fusA 3532 1463 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869860.1 protein_id gnl|my_center|LOCUS_13760 4501 3767 gene locus_tag LOCUS_13770 4501 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 5339 4608 gene locus_tag LOCUS_13780 gene rgbR 5339 4608 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_13780 5552 5388 gene locus_tag LOCUS_13790 5552 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence45 1390 101 gene locus_tag LOCUS_13800 gene eno 1390 101 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727923.1 protein_id gnl|my_center|LOCUS_13800 2237 1710 gene locus_tag LOCUS_13810 2237 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 2393 2818 gene locus_tag LOCUS_13820 2393 2818 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385810.1 protein_id gnl|my_center|LOCUS_13820 3371 2961 gene locus_tag LOCUS_13830 3371 2961 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459277.1 protein_id gnl|my_center|LOCUS_13830 4212 3451 gene locus_tag LOCUS_13840 4212 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 5158 4376 gene locus_tag LOCUS_13850 5158 4376 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_13850 5957 5256 gene locus_tag LOCUS_13860 5957 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence46 256 38 gene locus_tag LOCUS_13870 256 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1810 281 gene locus_tag LOCUS_13880 1810 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 2338 4566 gene locus_tag LOCUS_13890 gene nrdD 2338 4566 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263171.1 protein_id gnl|my_center|LOCUS_13890 <5471 4732 gene locus_tag LOCUS_13900 <5471 4732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861512.1:sensor histidine kinase >Feature sequence47 2157 40 gene locus_tag LOCUS_13910 2157 40 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296832.1 protein_id gnl|my_center|LOCUS_13910 3123 2161 gene locus_tag LOCUS_13920 3123 2161 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816259.1 protein_id gnl|my_center|LOCUS_13920 3259 4464 gene locus_tag LOCUS_13930 3259 4464 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence48 1032 100 gene locus_tag LOCUS_13940 gene pfkB 1032 100 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392148.1 protein_id gnl|my_center|LOCUS_13940 1531 1971 gene locus_tag LOCUS_13950 1531 1971 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361048.1 protein_id gnl|my_center|LOCUS_13950 1971 2264 gene locus_tag LOCUS_13960 1971 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 2324 2806 gene locus_tag LOCUS_13970 gene agaV 2324 2806 CDS product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387360.1 protein_id gnl|my_center|LOCUS_13970 2958 3755 gene locus_tag LOCUS_13980 gene agaW 2958 3755 CDS product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406209.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence49 3 770 gene locus_tag LOCUS_13990 3 770 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261248.1 protein_id gnl|my_center|LOCUS_13990 774 1808 gene locus_tag LOCUS_14000 774 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 2003 3514 gene locus_tag LOCUS_14010 2003 3514 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_14010 3581 3820 gene locus_tag LOCUS_14020 3581 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence50 1194 343 gene locus_tag LOCUS_14030 1194 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1477 2073 gene locus_tag LOCUS_14040 gene nrdG 1477 2073 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148220968.1 protein_id gnl|my_center|LOCUS_14040 3339 2194 gene locus_tag LOCUS_14050 3339 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 3866 3336 gene locus_tag LOCUS_14060 3866 3336 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence51 2564 2148 gene locus_tag LOCUS_14070 2564 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 3498 2581 gene locus_tag LOCUS_14080 3498 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence52 1884 931 gene locus_tag LOCUS_14090 1884 931 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167205.1 protein_id gnl|my_center|LOCUS_14090 2037 2156 gene locus_tag LOCUS_14100 2037 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 2421 2221 gene locus_tag LOCUS_14110 2421 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 <3731 2741 gene locus_tag LOCUS_14120 <3731 2741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459676.1:ATP-dependent 6-phosphofructokinase >Feature sequence53 >Feature sequence54 753 7 gene locus_tag LOCUS_14130 753 7 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263032.1 protein_id gnl|my_center|LOCUS_14130 839 1441 gene locus_tag LOCUS_14140 839 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence55 1189 188 gene locus_tag LOCUS_14150 1189 188 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_14150 1997 1218 gene locus_tag LOCUS_14160 1997 1218 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_14160 <3493 2188 gene locus_tag LOCUS_14170 <3493 2188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964961.1:insulinase family protein >Feature sequence56 1559 1708 gene locus_tag LOCUS_14180 1559 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 2691 1774 gene locus_tag LOCUS_14190 2691 1774 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096000.1 protein_id gnl|my_center|LOCUS_14190 <3440 2817 gene locus_tag LOCUS_14200 <3440 2817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438997.1:DegV family protein >Feature sequence57 235 1719 gene locus_tag LOCUS_14210 235 1719 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence58 <1 1415 gene locus_tag LOCUS_14220 <1 1415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021368039.1:glycoside hydrolase family 1 protein 1468 2328 gene locus_tag LOCUS_14230 1468 2328 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250748.1 protein_id gnl|my_center|LOCUS_14230 2343 2606 gene locus_tag LOCUS_14240 2343 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2612 3067 gene locus_tag LOCUS_14250 2612 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence59 185 628 gene locus_tag LOCUS_14260 185 628 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673217.1 protein_id gnl|my_center|LOCUS_14260 710 1606 gene locus_tag LOCUS_14270 gene galU 710 1606 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_14270 1619 3028 gene locus_tag LOCUS_14280 1619 3028 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence60 2459 264 gene locus_tag LOCUS_14290 gene rlmKL 2459 264 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819954.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence61 987 106 gene locus_tag LOCUS_14300 gene cwlH 987 106 CDS product N-acetylmuramoyl-L-alanine amidase CwlH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229963.1 protein_id gnl|my_center|LOCUS_14300 1115 996 gene locus_tag LOCUS_14310 1115 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1393 1115 gene locus_tag LOCUS_14320 1393 1115 CDS product phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384371.1 protein_id gnl|my_center|LOCUS_14320 1749 1393 gene locus_tag LOCUS_14330 1749 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 2246 1863 gene locus_tag LOCUS_14340 2246 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 2245 2394 gene locus_tag LOCUS_14350 2245 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence62 2348 1179 gene locus_tag LOCUS_14360 2348 1179 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002301130.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence63 1180 1695 gene locus_tag LOCUS_14370 1180 1695 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_14370 1897 2433 gene locus_tag LOCUS_14380 1897 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence64