>Feature sequence001 160 720 gene locus_tag LOCUS_00010 160 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1625 759 gene locus_tag LOCUS_00020 1625 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1721 2998 gene locus_tag LOCUS_00030 1721 2998 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837568.1 protein_id gnl|my_center|LOCUS_00030 3138 4343 gene locus_tag LOCUS_00040 3138 4343 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693372.1 protein_id gnl|my_center|LOCUS_00040 4828 5412 gene locus_tag LOCUS_00050 4828 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5980 6264 gene locus_tag LOCUS_00060 5980 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6447 7256 gene locus_tag LOCUS_00070 6447 7256 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549642.1 protein_id gnl|my_center|LOCUS_00070 7551 7739 gene locus_tag LOCUS_00080 7551 7739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7934 8176 gene locus_tag LOCUS_00090 7934 8176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8151 8414 gene locus_tag LOCUS_00100 8151 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 8428 8610 gene locus_tag LOCUS_00110 8428 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10147 8666 gene locus_tag LOCUS_00120 10147 8666 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254310.1 protein_id gnl|my_center|LOCUS_00120 10382 12475 gene locus_tag LOCUS_00130 10382 12475 CDS product putative ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547166.1 protein_id gnl|my_center|LOCUS_00130 12486 13751 gene locus_tag LOCUS_00140 12486 13751 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547168.1 protein_id gnl|my_center|LOCUS_00140 14454 13804 gene locus_tag LOCUS_00150 14454 13804 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549430.1 protein_id gnl|my_center|LOCUS_00150 14596 15153 gene locus_tag LOCUS_00160 14596 15153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640240.1 protein_id gnl|my_center|LOCUS_00160 15395 15204 gene locus_tag LOCUS_00170 15395 15204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 15555 15385 gene locus_tag LOCUS_00180 15555 15385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 15726 17000 gene locus_tag LOCUS_00190 15726 17000 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211863.1 protein_id gnl|my_center|LOCUS_00190 17045 17452 gene locus_tag LOCUS_00200 17045 17452 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546185.1 protein_id gnl|my_center|LOCUS_00200 17765 19627 gene locus_tag LOCUS_00210 17765 19627 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399157.1 protein_id gnl|my_center|LOCUS_00210 19750 20301 gene locus_tag LOCUS_00220 19750 20301 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254459.1 protein_id gnl|my_center|LOCUS_00220 20574 20356 gene locus_tag LOCUS_00230 20574 20356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 22481 20961 gene locus_tag LOCUS_00240 22481 20961 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549425.1 protein_id gnl|my_center|LOCUS_00240 23993 22605 gene locus_tag LOCUS_00250 gene gndA 23993 22605 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254636.1 protein_id gnl|my_center|LOCUS_00250 25967 24159 gene locus_tag LOCUS_00260 gene spxB 25967 24159 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254637.1 protein_id gnl|my_center|LOCUS_00260 28176 26260 gene locus_tag LOCUS_00270 gene mnmG 28176 26260 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549419.1 protein_id gnl|my_center|LOCUS_00270 29569 28184 gene locus_tag LOCUS_00280 gene mnmE 29569 28184 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549418.1 protein_id gnl|my_center|LOCUS_00280 30549 29677 gene locus_tag LOCUS_00290 30549 29677 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254638.1 protein_id gnl|my_center|LOCUS_00290 30913 30551 gene locus_tag LOCUS_00300 gene rnpA 30913 30551 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549413.1 protein_id gnl|my_center|LOCUS_00300 31101 30961 gene locus_tag LOCUS_00310 gene rpmH 31101 30961 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549412.1 protein_id gnl|my_center|LOCUS_00310 31574 32935 gene locus_tag LOCUS_00320 gene dnaA 31574 32935 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011253999.1 protein_id gnl|my_center|LOCUS_00320 33120 34250 gene locus_tag LOCUS_00330 gene dnaN 33120 34250 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549381.1 protein_id gnl|my_center|LOCUS_00330 34444 34665 gene locus_tag LOCUS_00340 gene yaaA 34444 34665 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254000.1 protein_id gnl|my_center|LOCUS_00340 34668 35792 gene locus_tag LOCUS_00350 gene recF 34668 35792 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549377.1 protein_id gnl|my_center|LOCUS_00350 35793 37760 gene locus_tag LOCUS_00360 gene gyrB 35793 37760 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549374.1 protein_id gnl|my_center|LOCUS_00360 37770 40277 gene locus_tag LOCUS_00370 gene gyrA 37770 40277 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549372.1 protein_id gnl|my_center|LOCUS_00370 40469 40765 gene locus_tag LOCUS_00380 gene rpsF 40469 40765 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549370.1 protein_id gnl|my_center|LOCUS_00380 40803 41318 gene locus_tag LOCUS_00390 gene ssb 40803 41318 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254001.1 protein_id gnl|my_center|LOCUS_00390 41345 41581 gene locus_tag LOCUS_00400 gene rpsR 41345 41581 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701427.1 protein_id gnl|my_center|LOCUS_00400 41680 42597 gene locus_tag LOCUS_00410 41680 42597 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475999.1 protein_id gnl|my_center|LOCUS_00410 42785 44803 gene locus_tag LOCUS_00420 42785 44803 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549345.1 protein_id gnl|my_center|LOCUS_00420 44816 45271 gene locus_tag LOCUS_00430 gene rplI 44816 45271 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549343.1 protein_id gnl|my_center|LOCUS_00430 45278 46657 gene locus_tag LOCUS_00440 gene dnaB 45278 46657 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549341.1 protein_id gnl|my_center|LOCUS_00440 46771 47661 gene locus_tag LOCUS_00450 46771 47661 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254003.1 protein_id gnl|my_center|LOCUS_00450 48663 47737 gene locus_tag LOCUS_00460 48663 47737 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643099.1 protein_id gnl|my_center|LOCUS_00460 48796 50679 gene locus_tag LOCUS_00470 48796 50679 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187364788.1 protein_id gnl|my_center|LOCUS_00470 50711 51199 gene locus_tag LOCUS_00480 50711 51199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 52425 51274 gene locus_tag LOCUS_00490 52425 51274 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254005.1 protein_id gnl|my_center|LOCUS_00490 52653 54581 gene locus_tag LOCUS_00500 52653 54581 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254014.1 protein_id gnl|my_center|LOCUS_00500 55345 54635 gene locus_tag LOCUS_00510 55345 54635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 56226 55486 gene locus_tag LOCUS_00520 56226 55486 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254139.1 protein_id gnl|my_center|LOCUS_00520 57025 56312 gene locus_tag LOCUS_00530 gene deoC 57025 56312 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254138.1 protein_id gnl|my_center|LOCUS_00530 57269 57688 gene locus_tag LOCUS_00540 57269 57688 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549981.1 protein_id gnl|my_center|LOCUS_00540 57700 58191 gene locus_tag LOCUS_00550 57700 58191 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896729.1 protein_id gnl|my_center|LOCUS_00550 58398 59081 gene locus_tag LOCUS_00560 58398 59081 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476682.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00560 59093 59929 gene locus_tag LOCUS_00570 59093 59929 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706181.1 protein_id gnl|my_center|LOCUS_00570 60071 60145 gene locus_tag LOCUS_t00010 60071 60145 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 60778 61755 gene locus_tag LOCUS_00580 60778 61755 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364967.1 protein_id gnl|my_center|LOCUS_00580 61761 63323 gene locus_tag LOCUS_00590 61761 63323 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254430.1 protein_id gnl|my_center|LOCUS_00590 63325 64899 gene locus_tag LOCUS_00600 63325 64899 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547992.1 protein_id gnl|my_center|LOCUS_00600 65910 65218 gene locus_tag LOCUS_00610 65910 65218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 66316 66663 gene locus_tag LOCUS_00620 66316 66663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 66671 67780 gene locus_tag LOCUS_00630 66671 67780 CDS product cell division protein FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546175.1 protein_id gnl|my_center|LOCUS_00630 67786 68211 gene locus_tag LOCUS_00640 67786 68211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 68432 69454 gene locus_tag LOCUS_00650 68432 69454 CDS product Rep family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546178.1 protein_id gnl|my_center|LOCUS_00650 69432 69632 gene locus_tag LOCUS_00660 69432 69632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549318.1 protein_id gnl|my_center|LOCUS_00660 69698 70897 gene locus_tag LOCUS_00670 69698 70897 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546183.1 protein_id gnl|my_center|LOCUS_00670 71195 73126 gene locus_tag LOCUS_00680 71195 73126 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548782.1 protein_id gnl|my_center|LOCUS_00680 73391 83161 gene locus_tag LOCUS_00690 73391 83161 CDS product DUF1542 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254514.1 protein_id gnl|my_center|LOCUS_00690 83735 83205 gene locus_tag LOCUS_00700 83735 83205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 84015 84644 gene locus_tag LOCUS_00710 84015 84644 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548174.1 protein_id gnl|my_center|LOCUS_00710 86026 84683 gene locus_tag LOCUS_00720 86026 84683 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475560.1 protein_id gnl|my_center|LOCUS_00720 86304 86038 gene locus_tag LOCUS_00730 86304 86038 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703119.1 protein_id gnl|my_center|LOCUS_00730 86496 87146 gene locus_tag LOCUS_00740 86496 87146 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547411.1 protein_id gnl|my_center|LOCUS_00740 87205 87978 gene locus_tag LOCUS_00750 87205 87978 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254619.1 protein_id gnl|my_center|LOCUS_00750 88044 88118 gene locus_tag LOCUS_t00020 88044 88118 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 88285 88953 gene locus_tag LOCUS_00760 88285 88953 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700625.1 protein_id gnl|my_center|LOCUS_00760 89234 89043 gene locus_tag LOCUS_00770 89234 89043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 89409 90116 gene locus_tag LOCUS_00780 89409 90116 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025079808.1 protein_id gnl|my_center|LOCUS_00780 91430 90162 gene locus_tag LOCUS_00790 91430 90162 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254534.1 protein_id gnl|my_center|LOCUS_00790 92817 91981 gene locus_tag LOCUS_00800 92817 91981 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476577.1 protein_id gnl|my_center|LOCUS_00800 93167 92982 gene locus_tag LOCUS_00810 93167 92982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 94176 93289 gene locus_tag LOCUS_00820 94176 93289 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296674.1 protein_id gnl|my_center|LOCUS_00820 94464 94628 gene locus_tag LOCUS_00830 94464 94628 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546918.1 protein_id gnl|my_center|LOCUS_00830 94678 94944 gene locus_tag LOCUS_00840 94678 94944 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546917.1 protein_id gnl|my_center|LOCUS_00840 >Feature sequence002 1896 49 gene locus_tag LOCUS_00850 1896 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 3665 2112 gene locus_tag LOCUS_00860 gene guaA 3665 2112 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548925.1 protein_id gnl|my_center|LOCUS_00860 4063 4638 gene locus_tag LOCUS_00870 4063 4638 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254090.1 protein_id gnl|my_center|LOCUS_00870 4641 5990 gene locus_tag LOCUS_00880 4641 5990 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548915.1 protein_id gnl|my_center|LOCUS_00880 7444 6002 gene locus_tag LOCUS_00890 gene gtfA 7444 6002 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254462.1 protein_id gnl|my_center|LOCUS_00890 9652 7457 gene locus_tag LOCUS_00900 9652 7457 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548136.1 protein_id gnl|my_center|LOCUS_00900 10575 9742 gene locus_tag LOCUS_00910 10575 9742 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254463.1 protein_id gnl|my_center|LOCUS_00910 11466 10591 gene locus_tag LOCUS_00920 11466 10591 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548142.1 protein_id gnl|my_center|LOCUS_00920 12741 11479 gene locus_tag LOCUS_00930 12741 11479 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254464.1 protein_id gnl|my_center|LOCUS_00930 12936 13898 gene locus_tag LOCUS_00940 12936 13898 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363973.1 protein_id gnl|my_center|LOCUS_00940 15235 13970 gene locus_tag LOCUS_00950 15235 13970 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254086.1 protein_id gnl|my_center|LOCUS_00950 17015 15393 gene locus_tag LOCUS_00960 17015 15393 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254085.1 protein_id gnl|my_center|LOCUS_00960 17676 17128 gene locus_tag LOCUS_00970 gene rpoE 17676 17128 CDS product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548904.1 protein_id gnl|my_center|LOCUS_00970 18144 17716 gene locus_tag LOCUS_00980 18144 17716 CDS product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548902.1 protein_id gnl|my_center|LOCUS_00980 18262 19623 gene locus_tag LOCUS_00990 18262 19623 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548899.1 protein_id gnl|my_center|LOCUS_00990 20653 19673 gene locus_tag LOCUS_01000 20653 19673 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254080.1 protein_id gnl|my_center|LOCUS_01000 22158 20773 gene locus_tag LOCUS_01010 gene glmU 22158 20773 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548882.1 protein_id gnl|my_center|LOCUS_01010 23036 22206 gene locus_tag LOCUS_01020 gene purR 23036 22206 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548880.1 protein_id gnl|my_center|LOCUS_01020 23393 23154 gene locus_tag LOCUS_01030 23393 23154 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548879.1 protein_id gnl|my_center|LOCUS_01030 24348 23458 gene locus_tag LOCUS_01040 gene rsmA 24348 23458 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548878.1 protein_id gnl|my_center|LOCUS_01040 24898 24338 gene locus_tag LOCUS_01050 gene rnmV 24898 24338 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548877.1 protein_id gnl|my_center|LOCUS_01050 25655 24885 gene locus_tag LOCUS_01060 25655 24885 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548876.1 protein_id gnl|my_center|LOCUS_01060 27637 25655 gene locus_tag LOCUS_01070 gene metG 27637 25655 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254078.1 protein_id gnl|my_center|LOCUS_01070 28775 27753 gene locus_tag LOCUS_01080 28775 27753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 29684 29091 gene locus_tag LOCUS_01090 29684 29091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 30162 29668 gene locus_tag LOCUS_01100 30162 29668 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548871.1 protein_id gnl|my_center|LOCUS_01100 31194 30172 gene locus_tag LOCUS_01110 gene trpS 31194 30172 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548870.1 protein_id gnl|my_center|LOCUS_01110 31340 31954 gene locus_tag LOCUS_01120 31340 31954 CDS product SOS response-associated peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548869.1 protein_id gnl|my_center|LOCUS_01120 31978 32048 gene locus_tag LOCUS_t00030 31978 32048 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 32769 32098 gene locus_tag LOCUS_01130 32769 32098 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254077.1 protein_id gnl|my_center|LOCUS_01130 33194 32832 gene locus_tag LOCUS_01140 33194 32832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566163.1 protein_id gnl|my_center|LOCUS_01140 34500 33187 gene locus_tag LOCUS_01150 34500 33187 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564452.1 protein_id gnl|my_center|LOCUS_01150 34638 35504 gene locus_tag LOCUS_01160 34638 35504 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613346.1 protein_id gnl|my_center|LOCUS_01160 35654 37036 gene locus_tag LOCUS_01170 35654 37036 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546946.1 protein_id gnl|my_center|LOCUS_01170 37058 38410 gene locus_tag LOCUS_01180 37058 38410 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798146.1 protein_id gnl|my_center|LOCUS_01180 38547 38870 gene locus_tag LOCUS_01190 38547 38870 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642267.1 protein_id gnl|my_center|LOCUS_01190 38970 39299 gene locus_tag LOCUS_01200 38970 39299 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577029.1 protein_id gnl|my_center|LOCUS_01200 39302 40024 gene locus_tag LOCUS_01210 39302 40024 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254280.1 protein_id gnl|my_center|LOCUS_01210 40041 41522 gene locus_tag LOCUS_01220 40041 41522 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546937.1 protein_id gnl|my_center|LOCUS_01220 42356 41652 gene locus_tag LOCUS_01230 42356 41652 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226988.1 protein_id gnl|my_center|LOCUS_01230 43806 42442 gene locus_tag LOCUS_01240 gene celB 43806 42442 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014565762.1 protein_id gnl|my_center|LOCUS_01240 44327 43830 gene locus_tag LOCUS_01250 44327 43830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254277.1 protein_id gnl|my_center|LOCUS_01250 44455 45903 gene locus_tag LOCUS_01260 44455 45903 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546921.1 protein_id gnl|my_center|LOCUS_01260 46085 46513 gene locus_tag LOCUS_01270 46085 46513 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254076.1 protein_id gnl|my_center|LOCUS_01270 47033 46572 gene locus_tag LOCUS_01280 gene greA 47033 46572 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548866.1 protein_id gnl|my_center|LOCUS_01280 47591 47049 gene locus_tag LOCUS_01290 47591 47049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 47802 49118 gene locus_tag LOCUS_01300 47802 49118 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254075.1 protein_id gnl|my_center|LOCUS_01300 50210 49212 gene locus_tag LOCUS_01310 50210 49212 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475724.1 protein_id gnl|my_center|LOCUS_01310 53287 50249 gene locus_tag LOCUS_01320 53287 50249 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475723.1 protein_id gnl|my_center|LOCUS_01320 55166 53274 gene locus_tag LOCUS_01330 55166 53274 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643065.1 protein_id gnl|my_center|LOCUS_01330 56080 55427 gene locus_tag LOCUS_01340 56080 55427 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254070.1 protein_id gnl|my_center|LOCUS_01340 57478 56165 gene locus_tag LOCUS_01350 57478 56165 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254069.1 protein_id gnl|my_center|LOCUS_01350 57654 57582 gene locus_tag LOCUS_t00040 57654 57582 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 58635 57709 gene locus_tag LOCUS_01360 58635 57709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01360 60126 58864 gene locus_tag LOCUS_01370 gene tyrS 60126 58864 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548823.1 protein_id gnl|my_center|LOCUS_01370 62837 60393 gene locus_tag LOCUS_01380 62837 60393 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548819.1 protein_id gnl|my_center|LOCUS_01380 62785 63210 gene locus_tag LOCUS_01390 62785 63210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 64046 63423 gene locus_tag LOCUS_01400 64046 63423 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548818.1 protein_id gnl|my_center|LOCUS_01400 65146 64046 gene locus_tag LOCUS_01410 65146 64046 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548816.1 protein_id gnl|my_center|LOCUS_01410 66180 65299 gene locus_tag LOCUS_01420 66180 65299 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129425.1 protein_id gnl|my_center|LOCUS_01420 67306 66443 gene locus_tag LOCUS_01430 67306 66443 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548017.1 protein_id gnl|my_center|LOCUS_01430 68342 67410 gene locus_tag LOCUS_01440 68342 67410 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547856.1 protein_id gnl|my_center|LOCUS_01440 68769 68344 gene locus_tag LOCUS_01450 68769 68344 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254406.1 protein_id gnl|my_center|LOCUS_01450 68946 69203 gene locus_tag LOCUS_01460 gene rpsN 68946 69203 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674890.1 protein_id gnl|my_center|LOCUS_01460 69950 69258 gene locus_tag LOCUS_01470 69950 69258 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548802.1 protein_id gnl|my_center|LOCUS_01470 70119 70544 gene locus_tag LOCUS_01480 70119 70544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 70625 71443 gene locus_tag LOCUS_01490 70625 71443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 71458 72267 gene locus_tag LOCUS_01500 71458 72267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 74172 72331 gene locus_tag LOCUS_01510 74172 72331 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254067.1 protein_id gnl|my_center|LOCUS_01510 75901 74264 gene locus_tag LOCUS_01520 75901 74264 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254405.1 protein_id gnl|my_center|LOCUS_01520 76840 75998 gene locus_tag LOCUS_01530 gene pfkB 76840 75998 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263695.1 protein_id gnl|my_center|LOCUS_01530 78283 76937 gene locus_tag LOCUS_01540 78283 76937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 80111 78339 gene locus_tag LOCUS_01550 80111 78339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 80968 80441 gene locus_tag LOCUS_01560 80968 80441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 82242 81043 gene locus_tag LOCUS_01570 82242 81043 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549215.1 protein_id gnl|my_center|LOCUS_01570 82393 83499 gene locus_tag LOCUS_01580 82393 83499 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286587.1 protein_id gnl|my_center|LOCUS_01580 83681 85345 gene locus_tag LOCUS_01590 83681 85345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 85431 86114 gene locus_tag LOCUS_01600 85431 86114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 >Feature sequence003 2299 896 gene locus_tag LOCUS_01610 2299 896 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701275.1 protein_id gnl|my_center|LOCUS_01610 4550 2430 gene locus_tag LOCUS_01620 4550 2430 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254615.1 protein_id gnl|my_center|LOCUS_01620 5704 4802 gene locus_tag LOCUS_01630 5704 4802 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549553.1 protein_id gnl|my_center|LOCUS_01630 6899 5694 gene locus_tag LOCUS_01640 6899 5694 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549552.1 protein_id gnl|my_center|LOCUS_01640 7156 7386 gene locus_tag LOCUS_01650 7156 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 7485 8684 gene locus_tag LOCUS_01660 7485 8684 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674376.1 protein_id gnl|my_center|LOCUS_01660 8942 9592 gene locus_tag LOCUS_01670 8942 9592 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642467.1 protein_id gnl|my_center|LOCUS_01670 11899 9626 gene locus_tag LOCUS_01680 11899 9626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 12131 11892 gene locus_tag LOCUS_01690 gene dltC 12131 11892 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549523.1 protein_id gnl|my_center|LOCUS_01690 13388 12171 gene locus_tag LOCUS_01700 gene dltB 13388 12171 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254621.1 protein_id gnl|my_center|LOCUS_01700 14899 13385 gene locus_tag LOCUS_01710 gene dltA 14899 13385 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549519.1 protein_id gnl|my_center|LOCUS_01710 15083 14922 gene locus_tag LOCUS_01720 15083 14922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 16673 15525 gene locus_tag LOCUS_01730 16673 15525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549513.1 protein_id gnl|my_center|LOCUS_01730 17357 17842 gene locus_tag LOCUS_01740 17357 17842 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549510.1 protein_id gnl|my_center|LOCUS_01740 17929 19815 gene locus_tag LOCUS_01750 17929 19815 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549508.1 protein_id gnl|my_center|LOCUS_01750 19959 21119 gene locus_tag LOCUS_01760 19959 21119 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549506.1 protein_id gnl|my_center|LOCUS_01760 21770 21168 gene locus_tag LOCUS_01770 21770 21168 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254622.1 protein_id gnl|my_center|LOCUS_01770 23405 21840 gene locus_tag LOCUS_01780 23405 21840 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254623.1 protein_id gnl|my_center|LOCUS_01780 23514 24365 gene locus_tag LOCUS_01790 23514 24365 CDS product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254624.1 protein_id gnl|my_center|LOCUS_01790 24467 24859 gene locus_tag LOCUS_01800 24467 24859 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813029.1 protein_id gnl|my_center|LOCUS_01800 25979 24921 gene locus_tag LOCUS_01810 25979 24921 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254572.1 protein_id gnl|my_center|LOCUS_01810 26358 26107 gene locus_tag LOCUS_01820 26358 26107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 26741 26995 gene locus_tag LOCUS_01830 26741 26995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 28014 27367 gene locus_tag LOCUS_01840 gene pcp 28014 27367 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592791.1 protein_id gnl|my_center|LOCUS_01840 28619 28128 gene locus_tag LOCUS_01850 28619 28128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 28793 29293 gene locus_tag LOCUS_01860 28793 29293 CDS product DUF1440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161023296.1 protein_id gnl|my_center|LOCUS_01860 29995 29339 gene locus_tag LOCUS_01870 29995 29339 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549496.1 protein_id gnl|my_center|LOCUS_01870 30411 31211 gene locus_tag LOCUS_01880 30411 31211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 31235 33571 gene locus_tag LOCUS_01890 31235 33571 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254626.1 protein_id gnl|my_center|LOCUS_01890 33830 35221 gene locus_tag LOCUS_01900 33830 35221 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674819.1 protein_id gnl|my_center|LOCUS_01900 35221 36243 gene locus_tag LOCUS_01910 gene cydB 35221 36243 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571229.1 protein_id gnl|my_center|LOCUS_01910 36264 38075 gene locus_tag LOCUS_01920 gene cydD 36264 38075 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378477.1 protein_id gnl|my_center|LOCUS_01920 38072 39817 gene locus_tag LOCUS_01930 gene cydC 38072 39817 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641327.1 protein_id gnl|my_center|LOCUS_01930 39840 40757 gene locus_tag LOCUS_01940 39840 40757 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476123.1 protein_id gnl|my_center|LOCUS_01940 40988 41932 gene locus_tag LOCUS_01950 gene phnD 40988 41932 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254002.1 protein_id gnl|my_center|LOCUS_01950 42093 43163 gene locus_tag LOCUS_01960 42093 43163 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254628.1 protein_id gnl|my_center|LOCUS_01960 43300 44205 gene locus_tag LOCUS_01970 43300 44205 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254084.1 protein_id gnl|my_center|LOCUS_01970 44208 45068 gene locus_tag LOCUS_01980 44208 45068 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924049.1 protein_id gnl|my_center|LOCUS_01980 45182 46078 gene locus_tag LOCUS_01990 45182 46078 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547989.1 protein_id gnl|my_center|LOCUS_01990 46101 47294 gene locus_tag LOCUS_02000 46101 47294 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002351560.1 protein_id gnl|my_center|LOCUS_02000 47741 47385 gene locus_tag LOCUS_02010 47741 47385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 48604 47765 gene locus_tag LOCUS_02020 48604 47765 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549471.1 protein_id gnl|my_center|LOCUS_02020 48730 49449 gene locus_tag LOCUS_02030 gene nagB 48730 49449 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549469.1 protein_id gnl|my_center|LOCUS_02030 50430 49537 gene locus_tag LOCUS_02040 gene murQ 50430 49537 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254545.1 protein_id gnl|my_center|LOCUS_02040 51290 50448 gene locus_tag LOCUS_02050 51290 50448 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585938.1 protein_id gnl|my_center|LOCUS_02050 52035 51304 gene locus_tag LOCUS_02060 52035 51304 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675017.1 protein_id gnl|my_center|LOCUS_02060 53093 52038 gene locus_tag LOCUS_02070 53093 52038 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585932.1 protein_id gnl|my_center|LOCUS_02070 54109 53090 gene locus_tag LOCUS_02080 54109 53090 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675018.1 protein_id gnl|my_center|LOCUS_02080 54597 54118 gene locus_tag LOCUS_02090 54597 54118 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568129.1 protein_id gnl|my_center|LOCUS_02090 55467 54616 gene locus_tag LOCUS_02100 55467 54616 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568131.1 protein_id gnl|my_center|LOCUS_02100 56329 55460 gene locus_tag LOCUS_02110 56329 55460 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568133.1 protein_id gnl|my_center|LOCUS_02110 56564 57211 gene locus_tag LOCUS_02120 56564 57211 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549467.1 protein_id gnl|my_center|LOCUS_02120 57235 57921 gene locus_tag LOCUS_02130 57235 57921 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549464.1 protein_id gnl|my_center|LOCUS_02130 59270 58032 gene locus_tag LOCUS_02140 59270 58032 CDS product lactate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674866.1 protein_id gnl|my_center|LOCUS_02140 59508 60818 gene locus_tag LOCUS_02150 59508 60818 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549459.1 protein_id gnl|my_center|LOCUS_02150 61660 60950 gene locus_tag LOCUS_02160 61660 60950 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549433.1 protein_id gnl|my_center|LOCUS_02160 62455 61727 gene locus_tag LOCUS_02170 62455 61727 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549457.1 protein_id gnl|my_center|LOCUS_02170 62576 62857 gene locus_tag LOCUS_02180 62576 62857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02180 62891 63151 gene locus_tag LOCUS_02190 62891 63151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02190 63425 64738 gene locus_tag LOCUS_02200 63425 64738 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025014283.1 protein_id gnl|my_center|LOCUS_02200 64842 65255 gene locus_tag LOCUS_02210 64842 65255 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254019.1 protein_id gnl|my_center|LOCUS_02210 65406 66938 gene locus_tag LOCUS_02220 65406 66938 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812813.1 protein_id gnl|my_center|LOCUS_02220 67594 67034 gene locus_tag LOCUS_02230 67594 67034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 67711 68532 gene locus_tag LOCUS_02240 67711 68532 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548701.1 protein_id gnl|my_center|LOCUS_02240 68661 69053 gene locus_tag LOCUS_02250 68661 69053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 69072 69401 gene locus_tag LOCUS_02260 69072 69401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 69453 69956 gene locus_tag LOCUS_02270 69453 69956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 70100 70537 gene locus_tag LOCUS_02280 70100 70537 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549441.1 protein_id gnl|my_center|LOCUS_02280 70549 70926 gene locus_tag LOCUS_02290 70549 70926 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549440.1 protein_id gnl|my_center|LOCUS_02290 70926 71213 gene locus_tag LOCUS_02300 70926 71213 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549438.1 protein_id gnl|my_center|LOCUS_02300 71213 73138 gene locus_tag LOCUS_02310 71213 73138 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549436.1 protein_id gnl|my_center|LOCUS_02310 73521 73177 gene locus_tag LOCUS_02320 73521 73177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 73958 73542 gene locus_tag LOCUS_02330 73958 73542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 75415 74141 gene locus_tag LOCUS_02340 75415 74141 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775182.1 protein_id gnl|my_center|LOCUS_02340 75525 76385 gene locus_tag LOCUS_02350 75525 76385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 76426 77289 gene locus_tag LOCUS_02360 76426 77289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 77374 78210 gene locus_tag LOCUS_02370 77374 78210 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548701.1 protein_id gnl|my_center|LOCUS_02370 78374 78661 gene locus_tag LOCUS_02380 78374 78661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 78722 79339 gene locus_tag LOCUS_02390 78722 79339 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939892.1 protein_id gnl|my_center|LOCUS_02390 79341 80492 gene locus_tag LOCUS_02400 79341 80492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 80712 80530 gene locus_tag LOCUS_02410 80712 80530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 80999 80853 gene locus_tag LOCUS_02420 80999 80853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 81152 81397 gene locus_tag LOCUS_02430 81152 81397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547379.1 protein_id gnl|my_center|LOCUS_02430 >Feature sequence004 2179 1481 gene locus_tag LOCUS_02440 2179 1481 CDS product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547788.1 protein_id gnl|my_center|LOCUS_02440 4064 2226 gene locus_tag LOCUS_02450 gene lepA 4064 2226 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254395.1 protein_id gnl|my_center|LOCUS_02450 5348 4200 gene locus_tag LOCUS_02460 gene dnaJ 5348 4200 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547790.1 protein_id gnl|my_center|LOCUS_02460 7290 5431 gene locus_tag LOCUS_02470 gene dnaK 7290 5431 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547791.1 protein_id gnl|my_center|LOCUS_02470 7912 7310 gene locus_tag LOCUS_02480 gene grpE 7912 7310 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547792.1 protein_id gnl|my_center|LOCUS_02480 8983 7925 gene locus_tag LOCUS_02490 gene hrcA 8983 7925 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547794.1 protein_id gnl|my_center|LOCUS_02490 10592 9093 gene locus_tag LOCUS_02500 10592 9093 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547799.1 protein_id gnl|my_center|LOCUS_02500 11796 10858 gene locus_tag LOCUS_02510 gene ribF 11796 10858 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547803.1 protein_id gnl|my_center|LOCUS_02510 12704 11811 gene locus_tag LOCUS_02520 gene truB 12704 11811 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547805.1 protein_id gnl|my_center|LOCUS_02520 13123 12758 gene locus_tag LOCUS_02530 13123 12758 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547807.1 protein_id gnl|my_center|LOCUS_02530 15791 13152 gene locus_tag LOCUS_02540 gene infB 15791 13152 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254396.1 protein_id gnl|my_center|LOCUS_02540 16110 15796 gene locus_tag LOCUS_02550 16110 15796 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547810.1 protein_id gnl|my_center|LOCUS_02550 16388 16113 gene locus_tag LOCUS_02560 16388 16113 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547812.1 protein_id gnl|my_center|LOCUS_02560 17647 16427 gene locus_tag LOCUS_02570 gene nusA 17647 16427 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254397.1 protein_id gnl|my_center|LOCUS_02570 18143 17667 gene locus_tag LOCUS_02580 gene rimP 18143 17667 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254398.1 protein_id gnl|my_center|LOCUS_02580 22554 18250 gene locus_tag LOCUS_02590 22554 18250 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547817.1 protein_id gnl|my_center|LOCUS_02590 24258 22561 gene locus_tag LOCUS_02600 24258 22561 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547819.1 protein_id gnl|my_center|LOCUS_02600 25537 24281 gene locus_tag LOCUS_02610 gene rseP 25537 24281 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547820.1 protein_id gnl|my_center|LOCUS_02610 26346 25549 gene locus_tag LOCUS_02620 26346 25549 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547823.1 protein_id gnl|my_center|LOCUS_02620 27101 26382 gene locus_tag LOCUS_02630 27101 26382 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547825.1 protein_id gnl|my_center|LOCUS_02630 27670 27113 gene locus_tag LOCUS_02640 gene frr 27670 27113 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095341972.1 protein_id gnl|my_center|LOCUS_02640 28395 27670 gene locus_tag LOCUS_02650 gene pyrH 28395 27670 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254400.1 protein_id gnl|my_center|LOCUS_02650 29533 28508 gene locus_tag LOCUS_02660 gene tsf 29533 28508 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547835.1 protein_id gnl|my_center|LOCUS_02660 30363 29572 gene locus_tag LOCUS_02670 gene rpsB 30363 29572 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547837.1 protein_id gnl|my_center|LOCUS_02670 31549 30518 gene locus_tag LOCUS_02680 31549 30518 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547839.1 protein_id gnl|my_center|LOCUS_02680 31617 32231 gene locus_tag LOCUS_02690 31617 32231 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547840.1 protein_id gnl|my_center|LOCUS_02690 32323 33504 gene locus_tag LOCUS_02700 32323 33504 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254401.1 protein_id gnl|my_center|LOCUS_02700 34951 33548 gene locus_tag LOCUS_02710 34951 33548 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965834.1 protein_id gnl|my_center|LOCUS_02710 36864 35071 gene locus_tag LOCUS_02720 36864 35071 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613381.1 protein_id gnl|my_center|LOCUS_02720 38623 36857 gene locus_tag LOCUS_02730 38623 36857 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254403.1 protein_id gnl|my_center|LOCUS_02730 38933 38712 gene locus_tag LOCUS_02740 38933 38712 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547849.1 protein_id gnl|my_center|LOCUS_02740 39251 39003 gene locus_tag LOCUS_02750 39251 39003 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547851.1 protein_id gnl|my_center|LOCUS_02750 39398 40021 gene locus_tag LOCUS_02760 gene lexA 39398 40021 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254404.1 protein_id gnl|my_center|LOCUS_02760 40889 40065 gene locus_tag LOCUS_02770 40889 40065 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644407.1 protein_id gnl|my_center|LOCUS_02770 41597 40950 gene locus_tag LOCUS_02780 41597 40950 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547855.1 protein_id gnl|my_center|LOCUS_02780 42004 41594 gene locus_tag LOCUS_02790 42004 41594 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546138.1 protein_id gnl|my_center|LOCUS_02790 42752 42006 gene locus_tag LOCUS_02800 42752 42006 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547854.1 protein_id gnl|my_center|LOCUS_02800 43766 42771 gene locus_tag LOCUS_02810 43766 42771 CDS product class III bacteriocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548389.1 protein_id gnl|my_center|LOCUS_02810 45456 43876 gene locus_tag LOCUS_02820 45456 43876 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547496.1 protein_id gnl|my_center|LOCUS_02820 47042 45459 gene locus_tag LOCUS_02830 47042 45459 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547498.1 protein_id gnl|my_center|LOCUS_02830 47594 47244 gene locus_tag LOCUS_02840 gene rplS 47594 47244 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003629071.1 protein_id gnl|my_center|LOCUS_02840 48437 47715 gene locus_tag LOCUS_02850 gene trmD 48437 47715 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254407.1 protein_id gnl|my_center|LOCUS_02850 48954 48427 gene locus_tag LOCUS_02860 gene rimM 48954 48427 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254408.1 protein_id gnl|my_center|LOCUS_02860 49296 49024 gene locus_tag LOCUS_02870 gene rpsP 49296 49024 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547870.1 protein_id gnl|my_center|LOCUS_02870 50811 49384 gene locus_tag LOCUS_02880 gene ffh 50811 49384 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547873.1 protein_id gnl|my_center|LOCUS_02880 51156 50815 gene locus_tag LOCUS_02890 51156 50815 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547875.1 protein_id gnl|my_center|LOCUS_02890 51282 51599 gene locus_tag LOCUS_02900 51282 51599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564747.1 protein_id gnl|my_center|LOCUS_02900 53081 51660 gene locus_tag LOCUS_02910 53081 51660 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254410.1 protein_id gnl|my_center|LOCUS_02910 54549 53128 gene locus_tag LOCUS_02920 gene ftsY 54549 53128 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547883.1 protein_id gnl|my_center|LOCUS_02920 58105 54551 gene locus_tag LOCUS_02930 gene smc 58105 54551 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254411.1 protein_id gnl|my_center|LOCUS_02930 58801 58124 gene locus_tag LOCUS_02940 gene rnc 58801 58124 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547887.1 protein_id gnl|my_center|LOCUS_02940 60136 58901 gene locus_tag LOCUS_02950 60136 58901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02950 60661 60374 gene locus_tag LOCUS_02960 60661 60374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02960 62536 60782 gene locus_tag LOCUS_02970 62536 60782 CDS product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254413.1 protein_id gnl|my_center|LOCUS_02970 62847 62653 gene locus_tag LOCUS_02980 62847 62653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 63753 62866 gene locus_tag LOCUS_02990 gene galU 63753 62866 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546456.1 protein_id gnl|my_center|LOCUS_02990 65848 63890 gene locus_tag LOCUS_03000 65848 63890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 66932 65970 gene locus_tag LOCUS_03010 66932 65970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 67446 66997 gene locus_tag LOCUS_03020 67446 66997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 <68438 67582 gene locus_tag LOCUS_03030 <68438 67582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003642878.1:putative frv operon regulatory protein >Feature sequence005 40 777 gene locus_tag LOCUS_03040 40 777 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546366.1 protein_id gnl|my_center|LOCUS_03040 787 1608 gene locus_tag LOCUS_03050 787 1608 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546367.1 protein_id gnl|my_center|LOCUS_03050 1605 2243 gene locus_tag LOCUS_03060 1605 2243 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546368.1 protein_id gnl|my_center|LOCUS_03060 2254 2907 gene locus_tag LOCUS_03070 2254 2907 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546369.1 protein_id gnl|my_center|LOCUS_03070 3573 4634 gene locus_tag LOCUS_03080 3573 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 6334 4676 gene locus_tag LOCUS_03090 gene treC 6334 4676 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254315.1 protein_id gnl|my_center|LOCUS_03090 7120 6347 gene locus_tag LOCUS_03100 gene treR 7120 6347 CDS product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547196.1 protein_id gnl|my_center|LOCUS_03100 7245 9176 gene locus_tag LOCUS_03110 7245 9176 CDS product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547194.1 protein_id gnl|my_center|LOCUS_03110 9287 9841 gene locus_tag LOCUS_03120 9287 9841 CDS product phenolic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641609.1 protein_id gnl|my_center|LOCUS_03120 9898 10431 gene locus_tag LOCUS_03130 9898 10431 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775286.1 protein_id gnl|my_center|LOCUS_03130 10536 11330 gene locus_tag LOCUS_03140 10536 11330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 12004 11366 gene locus_tag LOCUS_03150 gene udk 12004 11366 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546365.1 protein_id gnl|my_center|LOCUS_03150 12190 13554 gene locus_tag LOCUS_03160 12190 13554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 13911 14951 gene locus_tag LOCUS_03170 13911 14951 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359995.1 protein_id gnl|my_center|LOCUS_03170 15114 15965 gene locus_tag LOCUS_03180 15114 15965 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_03180 15962 17275 gene locus_tag LOCUS_03190 15962 17275 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_03190 17465 19291 gene locus_tag LOCUS_03200 17465 19291 CDS product PTS beta-glucoside transporter subunit IIBCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642375.1 protein_id gnl|my_center|LOCUS_03200 19311 20756 gene locus_tag LOCUS_03210 19311 20756 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642374.1 protein_id gnl|my_center|LOCUS_03210 20774 21619 gene locus_tag LOCUS_03220 20774 21619 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860774.1 protein_id gnl|my_center|LOCUS_03220 21753 23237 gene locus_tag LOCUS_03230 21753 23237 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548719.1 protein_id gnl|my_center|LOCUS_03230 23230 23964 gene locus_tag LOCUS_03240 23230 23964 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254050.1 protein_id gnl|my_center|LOCUS_03240 25458 24004 gene locus_tag LOCUS_03250 25458 24004 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548232.1 protein_id gnl|my_center|LOCUS_03250 26414 25473 gene locus_tag LOCUS_03260 26414 25473 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548230.1 protein_id gnl|my_center|LOCUS_03260 27240 26407 gene locus_tag LOCUS_03270 27240 26407 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548228.1 protein_id gnl|my_center|LOCUS_03270 27372 28394 gene locus_tag LOCUS_03280 27372 28394 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548226.1 protein_id gnl|my_center|LOCUS_03280 28507 29961 gene locus_tag LOCUS_03290 28507 29961 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254481.1 protein_id gnl|my_center|LOCUS_03290 29970 31256 gene locus_tag LOCUS_03300 29970 31256 CDS product DUF4038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254478.1 protein_id gnl|my_center|LOCUS_03300 31288 32196 gene locus_tag LOCUS_03310 31288 32196 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548210.1 protein_id gnl|my_center|LOCUS_03310 32400 33236 gene locus_tag LOCUS_03320 32400 33236 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254477.1 protein_id gnl|my_center|LOCUS_03320 33247 35448 gene locus_tag LOCUS_03330 33247 35448 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548211.1 protein_id gnl|my_center|LOCUS_03330 35503 36282 gene locus_tag LOCUS_03340 35503 36282 CDS product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644021.1 protein_id gnl|my_center|LOCUS_03340 36291 39053 gene locus_tag LOCUS_03350 36291 39053 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548204.1 protein_id gnl|my_center|LOCUS_03350 40063 39104 gene locus_tag LOCUS_03360 40063 39104 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548202.1 protein_id gnl|my_center|LOCUS_03360 40236 41450 gene locus_tag LOCUS_03370 40236 41450 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254474.1 protein_id gnl|my_center|LOCUS_03370 41478 43010 gene locus_tag LOCUS_03380 41478 43010 CDS product DUF5060 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548190.1 protein_id gnl|my_center|LOCUS_03380 43144 44616 gene locus_tag LOCUS_03390 43144 44616 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546652.1 protein_id gnl|my_center|LOCUS_03390 44731 45651 gene locus_tag LOCUS_03400 44731 45651 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549601.1 protein_id gnl|my_center|LOCUS_03400 45737 46351 gene locus_tag LOCUS_03410 45737 46351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 46431 46964 gene locus_tag LOCUS_03420 46431 46964 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643199.1 protein_id gnl|my_center|LOCUS_03420 47095 47970 gene locus_tag LOCUS_03430 47095 47970 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254125.1 protein_id gnl|my_center|LOCUS_03430 47973 48968 gene locus_tag LOCUS_03440 gene pstC 47973 48968 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549098.1 protein_id gnl|my_center|LOCUS_03440 48968 49861 gene locus_tag LOCUS_03450 gene pstA 48968 49861 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549099.1 protein_id gnl|my_center|LOCUS_03450 49874 50674 gene locus_tag LOCUS_03460 gene pstB 49874 50674 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613297.1 protein_id gnl|my_center|LOCUS_03460 50683 51438 gene locus_tag LOCUS_03470 gene pstB 50683 51438 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549101.1 protein_id gnl|my_center|LOCUS_03470 51453 52139 gene locus_tag LOCUS_03480 gene phoU 51453 52139 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549102.1 protein_id gnl|my_center|LOCUS_03480 52268 53803 gene locus_tag LOCUS_03490 52268 53803 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949006.1 protein_id gnl|my_center|LOCUS_03490 53882 54349 gene locus_tag LOCUS_03500 53882 54349 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297290.1 protein_id gnl|my_center|LOCUS_03500 54435 55358 gene locus_tag LOCUS_03510 gene rbsK 54435 55358 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563212.1 protein_id gnl|my_center|LOCUS_03510 55361 56059 gene locus_tag LOCUS_03520 gene rpiA 55361 56059 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254196.1 protein_id gnl|my_center|LOCUS_03520 56157 56522 gene locus_tag LOCUS_03530 56157 56522 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254569.1 protein_id gnl|my_center|LOCUS_03530 56660 57583 gene locus_tag LOCUS_03540 56660 57583 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546379.1 protein_id gnl|my_center|LOCUS_03540 57583 58311 gene locus_tag LOCUS_03550 57583 58311 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546381.1 protein_id gnl|my_center|LOCUS_03550 58759 58388 gene locus_tag LOCUS_03560 58759 58388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 59526 58762 gene locus_tag LOCUS_03570 59526 58762 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475503.1 protein_id gnl|my_center|LOCUS_03570 59810 62215 gene locus_tag LOCUS_03580 59810 62215 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254199.1 protein_id gnl|my_center|LOCUS_03580 62391 63044 gene locus_tag LOCUS_03590 62391 63044 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546429.1 protein_id gnl|my_center|LOCUS_03590 63155 65665 gene locus_tag LOCUS_03600 63155 65665 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496762.1 protein_id gnl|my_center|LOCUS_03600 >Feature sequence006 189 869 gene locus_tag LOCUS_03610 189 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 856 1197 gene locus_tag LOCUS_03620 856 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03620 1207 1578 gene locus_tag LOCUS_03630 1207 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03630 1716 9128 gene locus_tag LOCUS_03640 1716 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 9294 10118 gene locus_tag LOCUS_03650 9294 10118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 10494 11858 gene locus_tag LOCUS_03660 gene brnQ 10494 11858 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254324.1 protein_id gnl|my_center|LOCUS_03660 12056 13285 gene locus_tag LOCUS_03670 12056 13285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 13520 14251 gene locus_tag LOCUS_03680 13520 14251 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102162.1 protein_id gnl|my_center|LOCUS_03680 14276 15190 gene locus_tag LOCUS_03690 14276 15190 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550037.1 protein_id gnl|my_center|LOCUS_03690 16430 15480 gene locus_tag LOCUS_03700 gene bsh 16430 15480 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389832.1 protein_id gnl|my_center|LOCUS_03700 17797 16433 gene locus_tag LOCUS_03710 17797 16433 CDS product conjugated bile salt MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861900.1 protein_id gnl|my_center|LOCUS_03710 19200 17839 gene locus_tag LOCUS_03720 19200 17839 CDS product conjugated bile salt MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861900.1 protein_id gnl|my_center|LOCUS_03720 20834 19404 gene locus_tag LOCUS_03730 20834 19404 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254081.1 protein_id gnl|my_center|LOCUS_03730 21693 20965 gene locus_tag LOCUS_03740 21693 20965 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254082.1 protein_id gnl|my_center|LOCUS_03740 21884 23215 gene locus_tag LOCUS_03750 21884 23215 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254083.1 protein_id gnl|my_center|LOCUS_03750 23525 23292 gene locus_tag LOCUS_03760 23525 23292 CDS product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548562.1 protein_id gnl|my_center|LOCUS_03760 23943 23599 gene locus_tag LOCUS_03770 23943 23599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 24840 23971 gene locus_tag LOCUS_03780 24840 23971 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548564.1 protein_id gnl|my_center|LOCUS_03780 25838 24888 gene locus_tag LOCUS_03790 25838 24888 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548569.1 protein_id gnl|my_center|LOCUS_03790 26686 25868 gene locus_tag LOCUS_03800 26686 25868 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254021.1 protein_id gnl|my_center|LOCUS_03800 27464 26700 gene locus_tag LOCUS_03810 27464 26700 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254023.1 protein_id gnl|my_center|LOCUS_03810 27606 27533 gene locus_tag LOCUS_t00050 27606 27533 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 27751 28458 gene locus_tag LOCUS_03820 gene yycF 27751 28458 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548578.1 protein_id gnl|my_center|LOCUS_03820 28559 30358 gene locus_tag LOCUS_03830 gene walK 28559 30358 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254027.1 protein_id gnl|my_center|LOCUS_03830 30348 31682 gene locus_tag LOCUS_03840 30348 31682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548582.1 protein_id gnl|my_center|LOCUS_03840 31672 32508 gene locus_tag LOCUS_03850 31672 32508 CDS product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548584.1 protein_id gnl|my_center|LOCUS_03850 32521 33318 gene locus_tag LOCUS_03860 32521 33318 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254029.1 protein_id gnl|my_center|LOCUS_03860 33398 34651 gene locus_tag LOCUS_03870 33398 34651 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613276.1 protein_id gnl|my_center|LOCUS_03870 35160 35639 gene locus_tag LOCUS_03880 gene rlmH 35160 35639 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548590.1 protein_id gnl|my_center|LOCUS_03880 36313 35657 gene locus_tag LOCUS_03890 36313 35657 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548607.1 protein_id gnl|my_center|LOCUS_03890 37687 36323 gene locus_tag LOCUS_03900 37687 36323 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548609.1 protein_id gnl|my_center|LOCUS_03900 38228 37656 gene locus_tag LOCUS_03910 38228 37656 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643692.1 protein_id gnl|my_center|LOCUS_03910 38481 39422 gene locus_tag LOCUS_03920 38481 39422 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548611.1 protein_id gnl|my_center|LOCUS_03920 40594 39695 gene locus_tag LOCUS_03930 40594 39695 CDS product SEC10/PgrA surface exclusion domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549962.1 protein_id gnl|my_center|LOCUS_03930 40742 40581 gene locus_tag LOCUS_03940 40742 40581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 42666 41191 gene locus_tag LOCUS_03950 42666 41191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 42937 43812 gene locus_tag LOCUS_03960 42937 43812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 44767 43862 gene locus_tag LOCUS_03970 gene htpX 44767 43862 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254032.1 protein_id gnl|my_center|LOCUS_03970 45324 44767 gene locus_tag LOCUS_03980 45324 44767 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254033.1 protein_id gnl|my_center|LOCUS_03980 46533 45427 gene locus_tag LOCUS_03990 46533 45427 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254034.1 protein_id gnl|my_center|LOCUS_03990 46709 47119 gene locus_tag LOCUS_04000 46709 47119 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548621.1 protein_id gnl|my_center|LOCUS_04000 47219 47359 gene locus_tag LOCUS_04010 47219 47359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548644.1 protein_id gnl|my_center|LOCUS_04010 47501 48148 gene locus_tag LOCUS_04020 47501 48148 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254040.1 protein_id gnl|my_center|LOCUS_04020 48149 49072 gene locus_tag LOCUS_04030 48149 49072 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254041.1 protein_id gnl|my_center|LOCUS_04030 49519 49253 gene locus_tag LOCUS_04040 49519 49253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 50483 49725 gene locus_tag LOCUS_04050 50483 49725 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548674.1 protein_id gnl|my_center|LOCUS_04050 52101 50473 gene locus_tag LOCUS_04060 52101 50473 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254042.1 protein_id gnl|my_center|LOCUS_04060 53063 52425 gene locus_tag LOCUS_04070 53063 52425 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254043.1 protein_id gnl|my_center|LOCUS_04070 53137 53499 gene locus_tag LOCUS_04080 53137 53499 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548679.1 protein_id gnl|my_center|LOCUS_04080 54278 53496 gene locus_tag LOCUS_04090 54278 53496 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548681.1 protein_id gnl|my_center|LOCUS_04090 54795 54265 gene locus_tag LOCUS_04100 54795 54265 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004039686.1 protein_id gnl|my_center|LOCUS_04100 55629 54910 gene locus_tag LOCUS_04110 55629 54910 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613281.1 protein_id gnl|my_center|LOCUS_04110 55761 56237 gene locus_tag LOCUS_04120 55761 56237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254045.1 protein_id gnl|my_center|LOCUS_04120 57727 56270 gene locus_tag LOCUS_04130 gene cls 57727 56270 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548687.1 protein_id gnl|my_center|LOCUS_04130 58690 57752 gene locus_tag LOCUS_04140 58690 57752 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548688.1 protein_id gnl|my_center|LOCUS_04140 58818 59582 gene locus_tag LOCUS_04150 58818 59582 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548691.1 protein_id gnl|my_center|LOCUS_04150 60607 59639 gene locus_tag LOCUS_04160 60607 59639 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548693.1 protein_id gnl|my_center|LOCUS_04160 60726 61553 gene locus_tag LOCUS_04170 60726 61553 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254046.1 protein_id gnl|my_center|LOCUS_04170 61780 61550 gene locus_tag LOCUS_04180 61780 61550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562902.1 protein_id gnl|my_center|LOCUS_04180 61869 62525 gene locus_tag LOCUS_04190 61869 62525 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254047.1 protein_id gnl|my_center|LOCUS_04190 62615 63604 gene locus_tag LOCUS_04200 62615 63604 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548712.1 protein_id gnl|my_center|LOCUS_04200 >Feature sequence007 486 947 gene locus_tag LOCUS_04210 486 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04210 940 1644 gene locus_tag LOCUS_04220 940 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 1647 3602 gene locus_tag LOCUS_04230 1647 3602 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233883.1 protein_id gnl|my_center|LOCUS_04230 3595 4497 gene locus_tag LOCUS_04240 3595 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 5559 4762 gene locus_tag LOCUS_04250 5559 4762 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437151.1 protein_id gnl|my_center|LOCUS_04250 6343 6008 gene locus_tag LOCUS_04260 6343 6008 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644291.1 protein_id gnl|my_center|LOCUS_04260 6500 7522 gene locus_tag LOCUS_04270 6500 7522 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003715873.1 protein_id gnl|my_center|LOCUS_04270 8188 7616 gene locus_tag LOCUS_04280 8188 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 8277 9443 gene locus_tag LOCUS_04290 8277 9443 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860075.1 protein_id gnl|my_center|LOCUS_04290 9458 10108 gene locus_tag LOCUS_04300 9458 10108 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831317.1 protein_id gnl|my_center|LOCUS_04300 11015 10431 gene locus_tag LOCUS_04310 11015 10431 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594613.1 protein_id gnl|my_center|LOCUS_04310 11430 11864 gene locus_tag LOCUS_04320 11430 11864 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700966.1 protein_id gnl|my_center|LOCUS_04320 11861 12307 gene locus_tag LOCUS_04330 11861 12307 CDS product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793164.1 protein_id gnl|my_center|LOCUS_04330 12461 12745 gene locus_tag LOCUS_04340 12461 12745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 13726 12752 gene locus_tag LOCUS_04350 13726 12752 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548923.1 protein_id gnl|my_center|LOCUS_04350 14014 15153 gene locus_tag LOCUS_04360 14014 15153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549513.1 protein_id gnl|my_center|LOCUS_04360 15177 15677 gene locus_tag LOCUS_04370 15177 15677 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548936.1 protein_id gnl|my_center|LOCUS_04370 15809 16480 gene locus_tag LOCUS_04380 15809 16480 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254328.1 protein_id gnl|my_center|LOCUS_04380 16554 17039 gene locus_tag LOCUS_04390 16554 17039 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548951.1 protein_id gnl|my_center|LOCUS_04390 17331 18185 gene locus_tag LOCUS_04400 17331 18185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548928.1 protein_id gnl|my_center|LOCUS_04400 18185 19042 gene locus_tag LOCUS_04410 18185 19042 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548929.1 protein_id gnl|my_center|LOCUS_04410 19044 19496 gene locus_tag LOCUS_04420 19044 19496 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548931.1 protein_id gnl|my_center|LOCUS_04420 19496 19891 gene locus_tag LOCUS_04430 19496 19891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 19943 20785 gene locus_tag LOCUS_04440 19943 20785 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089316.1 protein_id gnl|my_center|LOCUS_04440 21330 20812 gene locus_tag LOCUS_04450 21330 20812 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547298.1 protein_id gnl|my_center|LOCUS_04450 21906 21391 gene locus_tag LOCUS_04460 21906 21391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613291.1 protein_id gnl|my_center|LOCUS_04460 23400 22051 gene locus_tag LOCUS_04470 gene frc 23400 22051 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549137.1 protein_id gnl|my_center|LOCUS_04470 25133 23403 gene locus_tag LOCUS_04480 gene oxc 25133 23403 CDS product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044304031.1 protein_id gnl|my_center|LOCUS_04480 27965 25305 gene locus_tag LOCUS_04490 27965 25305 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254541.1 protein_id gnl|my_center|LOCUS_04490 29531 28116 gene locus_tag LOCUS_04500 29531 28116 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674698.1 protein_id gnl|my_center|LOCUS_04500 29875 30867 gene locus_tag LOCUS_04510 gene trpX 29875 30867 CDS product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700783.1 protein_id gnl|my_center|LOCUS_04510 30864 31763 gene locus_tag LOCUS_04520 30864 31763 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642727.1 protein_id gnl|my_center|LOCUS_04520 31756 32520 gene locus_tag LOCUS_04530 31756 32520 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475531.1 protein_id gnl|my_center|LOCUS_04530 32597 34186 gene locus_tag LOCUS_04540 32597 34186 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254096.1 protein_id gnl|my_center|LOCUS_04540 34277 34993 gene locus_tag LOCUS_04550 34277 34993 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732391.1 protein_id gnl|my_center|LOCUS_04550 35110 36522 gene locus_tag LOCUS_04560 35110 36522 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566732.1 protein_id gnl|my_center|LOCUS_04560 36522 38048 gene locus_tag LOCUS_04570 36522 38048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 39207 38158 gene locus_tag LOCUS_04580 39207 38158 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296414.1 protein_id gnl|my_center|LOCUS_04580 39375 40805 gene locus_tag LOCUS_04590 39375 40805 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102003.1 protein_id gnl|my_center|LOCUS_04590 40815 43031 gene locus_tag LOCUS_04600 40815 43031 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674363.1 protein_id gnl|my_center|LOCUS_04600 43129 43380 gene locus_tag LOCUS_04610 43129 43380 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548978.1 protein_id gnl|my_center|LOCUS_04610 43540 44907 gene locus_tag LOCUS_04620 43540 44907 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548990.1 protein_id gnl|my_center|LOCUS_04620 44923 46383 gene locus_tag LOCUS_04630 44923 46383 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548992.1 protein_id gnl|my_center|LOCUS_04630 46423 46785 gene locus_tag LOCUS_04640 gene acpS 46423 46785 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254099.1 protein_id gnl|my_center|LOCUS_04640 46791 47927 gene locus_tag LOCUS_04650 gene alr 46791 47927 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548996.1 protein_id gnl|my_center|LOCUS_04650 48683 48000 gene locus_tag LOCUS_04660 gene cbpA 48683 48000 CDS product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254100.1 protein_id gnl|my_center|LOCUS_04660 49839 48868 gene locus_tag LOCUS_04670 49839 48868 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549000.1 protein_id gnl|my_center|LOCUS_04670 49982 50539 gene locus_tag LOCUS_04680 gene pth 49982 50539 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549001.1 protein_id gnl|my_center|LOCUS_04680 50541 54035 gene locus_tag LOCUS_04690 gene mfd 50541 54035 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254101.1 protein_id gnl|my_center|LOCUS_04690 54054 54296 gene locus_tag LOCUS_04700 54054 54296 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_04700 54398 54775 gene locus_tag LOCUS_04710 54398 54775 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254103.1 protein_id gnl|my_center|LOCUS_04710 54775 55122 gene locus_tag LOCUS_04720 54775 55122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 55159 56463 gene locus_tag LOCUS_04730 gene tilS 55159 56463 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549010.1 protein_id gnl|my_center|LOCUS_04730 56532 58700 gene locus_tag LOCUS_04740 gene ftsH 56532 58700 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254105.1 protein_id gnl|my_center|LOCUS_04740 58748 59626 gene locus_tag LOCUS_04750 gene hslO 58748 59626 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549012.1 protein_id gnl|my_center|LOCUS_04750 59702 60697 gene locus_tag LOCUS_04760 gene dusB 59702 60697 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254106.1 protein_id gnl|my_center|LOCUS_04760 60718 62259 gene locus_tag LOCUS_04770 gene lysS 60718 62259 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254107.1 protein_id gnl|my_center|LOCUS_04770 >Feature sequence008 970 296 gene locus_tag LOCUS_04780 970 296 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254590.1 protein_id gnl|my_center|LOCUS_04780 2038 983 gene locus_tag LOCUS_04790 2038 983 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254591.1 protein_id gnl|my_center|LOCUS_04790 2567 2043 gene locus_tag LOCUS_04800 2567 2043 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254592.1 protein_id gnl|my_center|LOCUS_04800 3354 2755 gene locus_tag LOCUS_04810 3354 2755 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549678.1 protein_id gnl|my_center|LOCUS_04810 3987 3361 gene locus_tag LOCUS_04820 3987 3361 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549678.1 protein_id gnl|my_center|LOCUS_04820 4133 4879 gene locus_tag LOCUS_04830 4133 4879 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254593.1 protein_id gnl|my_center|LOCUS_04830 5653 4901 gene locus_tag LOCUS_04840 gene yaaA 5653 4901 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254594.1 protein_id gnl|my_center|LOCUS_04840 5734 6432 gene locus_tag LOCUS_04850 5734 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549674.1 protein_id gnl|my_center|LOCUS_04850 8243 6471 gene locus_tag LOCUS_04860 8243 6471 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548622.1 protein_id gnl|my_center|LOCUS_04860 9244 8444 gene locus_tag LOCUS_04870 9244 8444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 10087 9305 gene locus_tag LOCUS_04880 10087 9305 CDS product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549672.1 protein_id gnl|my_center|LOCUS_04880 10683 10249 gene locus_tag LOCUS_04890 10683 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 12125 10740 gene locus_tag LOCUS_04900 12125 10740 CDS product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355598.1 protein_id gnl|my_center|LOCUS_04900 12255 12437 gene locus_tag LOCUS_04910 12255 12437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 13259 12402 gene locus_tag LOCUS_04920 13259 12402 CDS product cytochrome C5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549662.1 protein_id gnl|my_center|LOCUS_04920 13479 14159 gene locus_tag LOCUS_04930 13479 14159 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100889.1 protein_id gnl|my_center|LOCUS_04930 14988 14224 gene locus_tag LOCUS_04940 14988 14224 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549071.1 protein_id gnl|my_center|LOCUS_04940 15569 15069 gene locus_tag LOCUS_04950 15569 15069 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549649.1 protein_id gnl|my_center|LOCUS_04950 16222 15572 gene locus_tag LOCUS_04960 16222 15572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 18360 16405 gene locus_tag LOCUS_04970 18360 16405 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254141.1 protein_id gnl|my_center|LOCUS_04970 18486 20102 gene locus_tag LOCUS_04980 18486 20102 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475493.1 protein_id gnl|my_center|LOCUS_04980 20119 21102 gene locus_tag LOCUS_04990 20119 21102 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700709.1 protein_id gnl|my_center|LOCUS_04990 22795 21176 gene locus_tag LOCUS_05000 22795 21176 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254098.1 protein_id gnl|my_center|LOCUS_05000 23791 22934 gene locus_tag LOCUS_05010 23791 22934 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549634.1 protein_id gnl|my_center|LOCUS_05010 25149 23794 gene locus_tag LOCUS_05020 25149 23794 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549632.1 protein_id gnl|my_center|LOCUS_05020 26429 25215 gene locus_tag LOCUS_05030 26429 25215 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549630.1 protein_id gnl|my_center|LOCUS_05030 27626 26520 gene locus_tag LOCUS_05040 27626 26520 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549629.1 protein_id gnl|my_center|LOCUS_05040 28303 27626 gene locus_tag LOCUS_05050 gene pgmB 28303 27626 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549628.1 protein_id gnl|my_center|LOCUS_05050 30561 28288 gene locus_tag LOCUS_05060 30561 28288 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549627.1 protein_id gnl|my_center|LOCUS_05060 32442 30721 gene locus_tag LOCUS_05070 32442 30721 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549626.1 protein_id gnl|my_center|LOCUS_05070 34122 32467 gene locus_tag LOCUS_05080 34122 32467 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254601.1 protein_id gnl|my_center|LOCUS_05080 35179 34229 gene locus_tag LOCUS_05090 35179 34229 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564289.1 protein_id gnl|my_center|LOCUS_05090 36037 35261 gene locus_tag LOCUS_05100 36037 35261 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549621.1 protein_id gnl|my_center|LOCUS_05100 37576 36080 gene locus_tag LOCUS_05110 gene glpK 37576 36080 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569146.1 protein_id gnl|my_center|LOCUS_05110 37731 38546 gene locus_tag LOCUS_05120 gene thiD 37731 38546 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549612.1 protein_id gnl|my_center|LOCUS_05120 38701 39384 gene locus_tag LOCUS_05130 38701 39384 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549605.1 protein_id gnl|my_center|LOCUS_05130 39365 40750 gene locus_tag LOCUS_05140 39365 40750 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613351.1 protein_id gnl|my_center|LOCUS_05140 41706 40870 gene locus_tag LOCUS_05150 41706 40870 CDS product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254624.1 protein_id gnl|my_center|LOCUS_05150 41722 41880 gene locus_tag LOCUS_05160 41722 41880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 42034 41831 gene locus_tag LOCUS_05170 42034 41831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 42136 42906 gene locus_tag LOCUS_05180 42136 42906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 43143 44528 gene locus_tag LOCUS_05190 43143 44528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 45023 44598 gene locus_tag LOCUS_05200 45023 44598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 45952 45035 gene locus_tag LOCUS_05210 45952 45035 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549600.1 protein_id gnl|my_center|LOCUS_05210 46374 47384 gene locus_tag LOCUS_05220 gene asnA 46374 47384 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549578.1 protein_id gnl|my_center|LOCUS_05220 48877 47477 gene locus_tag LOCUS_05230 48877 47477 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549571.1 protein_id gnl|my_center|LOCUS_05230 49623 48901 gene locus_tag LOCUS_05240 49623 48901 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254611.1 protein_id gnl|my_center|LOCUS_05240 51090 49714 gene locus_tag LOCUS_05250 51090 49714 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549564.1 protein_id gnl|my_center|LOCUS_05250 52483 51080 gene locus_tag LOCUS_05260 52483 51080 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546978.1 protein_id gnl|my_center|LOCUS_05260 53019 52645 gene locus_tag LOCUS_05270 53019 52645 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699888.1 protein_id gnl|my_center|LOCUS_05270 54004 53084 gene locus_tag LOCUS_05280 54004 53084 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475511.1 protein_id gnl|my_center|LOCUS_05280 54837 54028 gene locus_tag LOCUS_05290 54837 54028 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475510.1 protein_id gnl|my_center|LOCUS_05290 55854 54850 gene locus_tag LOCUS_05300 55854 54850 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700744.1 protein_id gnl|my_center|LOCUS_05300 56222 56148 gene locus_tag LOCUS_t00060 56222 56148 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 56348 56238 gene locus_tag LOCUS_r00010 56348 56238 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence009 446 144 gene locus_tag LOCUS_05310 446 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 533 1654 gene locus_tag LOCUS_05320 533 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546248.1 protein_id gnl|my_center|LOCUS_05320 1729 2430 gene locus_tag LOCUS_05330 1729 2430 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546250.1 protein_id gnl|my_center|LOCUS_05330 2872 2486 gene locus_tag LOCUS_05340 gene tagD 2872 2486 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254173.1 protein_id gnl|my_center|LOCUS_05340 2993 4132 gene locus_tag LOCUS_05350 2993 4132 CDS product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546266.1 protein_id gnl|my_center|LOCUS_05350 4143 5573 gene locus_tag LOCUS_05360 4143 5573 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254175.1 protein_id gnl|my_center|LOCUS_05360 5583 6311 gene locus_tag LOCUS_05370 5583 6311 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546254.1 protein_id gnl|my_center|LOCUS_05370 6346 7446 gene locus_tag LOCUS_05380 6346 7446 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546257.1 protein_id gnl|my_center|LOCUS_05380 7448 9427 gene locus_tag LOCUS_05390 7448 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 9424 10122 gene locus_tag LOCUS_05400 9424 10122 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546270.1 protein_id gnl|my_center|LOCUS_05400 10221 11693 gene locus_tag LOCUS_05410 10221 11693 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254174.1 protein_id gnl|my_center|LOCUS_05410 11697 12530 gene locus_tag LOCUS_05420 gene nadE 11697 12530 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546262.1 protein_id gnl|my_center|LOCUS_05420 12702 15371 gene locus_tag LOCUS_05430 12702 15371 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546265.1 protein_id gnl|my_center|LOCUS_05430 15447 15905 gene locus_tag LOCUS_05440 15447 15905 CDS product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700699.1 protein_id gnl|my_center|LOCUS_05440 15960 16046 gene locus_tag LOCUS_t00070 15960 16046 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16118 16735 gene locus_tag LOCUS_05450 16118 16735 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254627.1 protein_id gnl|my_center|LOCUS_05450 16739 17371 gene locus_tag LOCUS_05460 16739 17371 CDS product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546273.1 protein_id gnl|my_center|LOCUS_05460 17457 19703 gene locus_tag LOCUS_05470 gene pcrA 17457 19703 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546275.1 protein_id gnl|my_center|LOCUS_05470 19740 21746 gene locus_tag LOCUS_05480 gene ligA 19740 21746 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546277.1 protein_id gnl|my_center|LOCUS_05480 21761 22900 gene locus_tag LOCUS_05490 21761 22900 CDS product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546280.1 protein_id gnl|my_center|LOCUS_05490 22911 23213 gene locus_tag LOCUS_05500 gene gatC 22911 23213 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546283.1 protein_id gnl|my_center|LOCUS_05500 23213 24652 gene locus_tag LOCUS_05510 gene gatA 23213 24652 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546285.1 protein_id gnl|my_center|LOCUS_05510 24656 26086 gene locus_tag LOCUS_05520 gene gatB 24656 26086 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254176.1 protein_id gnl|my_center|LOCUS_05520 26105 27013 gene locus_tag LOCUS_05530 26105 27013 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546288.1 protein_id gnl|my_center|LOCUS_05530 27189 28379 gene locus_tag LOCUS_05540 gene secY2 27189 28379 CDS product accessory Sec system protein translocase subunit SecY2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161877.1 protein_id gnl|my_center|LOCUS_05540 28381 29886 gene locus_tag LOCUS_05550 gene asp1 28381 29886 CDS product accessory Sec system protein Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468347.1 protein_id gnl|my_center|LOCUS_05550 29883 31436 gene locus_tag LOCUS_05560 gene asp2 29883 31436 CDS product accessory Sec system protein Asp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032114.1 protein_id gnl|my_center|LOCUS_05560 31438 32298 gene locus_tag LOCUS_05570 31438 32298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 32303 34669 gene locus_tag LOCUS_05580 gene secA2 32303 34669 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836745.1 protein_id gnl|my_center|LOCUS_05580 34682 36211 gene locus_tag LOCUS_05590 gene gtfA 34682 36211 CDS product accessory Sec system glycosyltransferase GtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158445.1 protein_id gnl|my_center|LOCUS_05590 36204 37532 gene locus_tag LOCUS_05600 gene gtfB 36204 37532 CDS product accessory Sec system glycosylation chaperone GtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836747.1 protein_id gnl|my_center|LOCUS_05600 37525 37707 gene locus_tag LOCUS_05610 37525 37707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 37899 42587 gene locus_tag LOCUS_05620 37899 42587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 44777 44607 gene locus_tag LOCUS_05630 44777 44607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 47567 47397 gene locus_tag LOCUS_05640 47567 47397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 49505 49344 gene locus_tag LOCUS_05650 49505 49344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 49480 49854 gene locus_tag LOCUS_05660 49480 49854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 50010 52040 gene locus_tag LOCUS_05670 50010 52040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 52079 54109 gene locus_tag LOCUS_05680 52079 54109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 54156 55349 gene locus_tag LOCUS_05690 54156 55349 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528551.1 protein_id gnl|my_center|LOCUS_05690 >Feature sequence010 912 436 gene locus_tag LOCUS_05700 912 436 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613286.1 protein_id gnl|my_center|LOCUS_05700 1056 1541 gene locus_tag LOCUS_05710 1056 1541 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548750.1 protein_id gnl|my_center|LOCUS_05710 2320 1586 gene locus_tag LOCUS_05720 2320 1586 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194099.1 protein_id gnl|my_center|LOCUS_05720 3138 2338 gene locus_tag LOCUS_05730 3138 2338 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548752.1 protein_id gnl|my_center|LOCUS_05730 3357 3851 gene locus_tag LOCUS_05740 3357 3851 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548753.1 protein_id gnl|my_center|LOCUS_05740 4040 4171 gene locus_tag LOCUS_05750 4040 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 4284 5213 gene locus_tag LOCUS_05760 4284 5213 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254057.1 protein_id gnl|my_center|LOCUS_05760 5273 6199 gene locus_tag LOCUS_05770 5273 6199 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254057.1 protein_id gnl|my_center|LOCUS_05770 6219 7001 gene locus_tag LOCUS_05780 gene phnC 6219 7001 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548759.1 protein_id gnl|my_center|LOCUS_05780 6994 7800 gene locus_tag LOCUS_05790 gene phnE 6994 7800 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254058.1 protein_id gnl|my_center|LOCUS_05790 7800 8612 gene locus_tag LOCUS_05800 gene phnE 7800 8612 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548762.1 protein_id gnl|my_center|LOCUS_05800 9079 8690 gene locus_tag LOCUS_05810 9079 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 9288 9770 gene locus_tag LOCUS_05820 9288 9770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548767.1 protein_id gnl|my_center|LOCUS_05820 9831 11225 gene locus_tag LOCUS_05830 9831 11225 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254060.1 protein_id gnl|my_center|LOCUS_05830 11267 13216 gene locus_tag LOCUS_05840 gene asnB 11267 13216 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548773.1 protein_id gnl|my_center|LOCUS_05840 13245 14570 gene locus_tag LOCUS_05850 13245 14570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548775.1 protein_id gnl|my_center|LOCUS_05850 14812 17982 gene locus_tag LOCUS_05860 14812 17982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 18212 20422 gene locus_tag LOCUS_05870 gene nrdD 18212 20422 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254061.1 protein_id gnl|my_center|LOCUS_05870 20422 21135 gene locus_tag LOCUS_05880 gene nrdG 20422 21135 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548777.1 protein_id gnl|my_center|LOCUS_05880 21190 21783 gene locus_tag LOCUS_05890 21190 21783 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254062.1 protein_id gnl|my_center|LOCUS_05890 21850 23058 gene locus_tag LOCUS_05900 21850 23058 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548779.1 protein_id gnl|my_center|LOCUS_05900 23243 37132 gene locus_tag LOCUS_05910 23243 37132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 37227 38444 gene locus_tag LOCUS_05920 37227 38444 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548780.1 protein_id gnl|my_center|LOCUS_05920 38529 40478 gene locus_tag LOCUS_05930 38529 40478 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548782.1 protein_id gnl|my_center|LOCUS_05930 40708 40998 gene locus_tag LOCUS_05940 40708 40998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 41143 41346 gene locus_tag LOCUS_05950 41143 41346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 41483 43141 gene locus_tag LOCUS_05960 41483 43141 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546143.1 protein_id gnl|my_center|LOCUS_05960 43678 43295 gene locus_tag LOCUS_05970 43678 43295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 43928 43671 gene locus_tag LOCUS_05980 43928 43671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 46288 44249 gene locus_tag LOCUS_05990 46288 44249 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087236515.1 protein_id gnl|my_center|LOCUS_05990 46843 46412 gene locus_tag LOCUS_06000 46843 46412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548785.1 protein_id gnl|my_center|LOCUS_06000 47840 46932 gene locus_tag LOCUS_06010 47840 46932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 48025 48240 gene locus_tag LOCUS_06020 48025 48240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 48302 48541 gene locus_tag LOCUS_06030 48302 48541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 49027 50643 gene locus_tag LOCUS_06040 49027 50643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 51985 50789 gene locus_tag LOCUS_06050 51985 50789 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693372.1 protein_id gnl|my_center|LOCUS_06050 52441 52280 gene locus_tag LOCUS_06060 52441 52280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 >Feature sequence011 1166 168 gene locus_tag LOCUS_06070 1166 168 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549214.1 protein_id gnl|my_center|LOCUS_06070 1311 2417 gene locus_tag LOCUS_06080 1311 2417 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549213.1 protein_id gnl|my_center|LOCUS_06080 2810 2475 gene locus_tag LOCUS_06090 2810 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549212.1 protein_id gnl|my_center|LOCUS_06090 3267 2836 gene locus_tag LOCUS_06100 3267 2836 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549209.1 protein_id gnl|my_center|LOCUS_06100 3391 4233 gene locus_tag LOCUS_06110 3391 4233 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674287.1 protein_id gnl|my_center|LOCUS_06110 4898 4272 gene locus_tag LOCUS_06120 4898 4272 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549206.1 protein_id gnl|my_center|LOCUS_06120 5704 4916 gene locus_tag LOCUS_06130 gene murI 5704 4916 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549203.1 protein_id gnl|my_center|LOCUS_06130 5805 6203 gene locus_tag LOCUS_06140 5805 6203 CDS product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549202.1 protein_id gnl|my_center|LOCUS_06140 6561 6250 gene locus_tag LOCUS_06150 gene trxA 6561 6250 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254147.1 protein_id gnl|my_center|LOCUS_06150 8996 6633 gene locus_tag LOCUS_06160 8996 6633 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549197.1 protein_id gnl|my_center|LOCUS_06160 9578 9036 gene locus_tag LOCUS_06170 9578 9036 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564014.1 protein_id gnl|my_center|LOCUS_06170 9939 9628 gene locus_tag LOCUS_06180 9939 9628 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549194.1 protein_id gnl|my_center|LOCUS_06180 10370 9942 gene locus_tag LOCUS_06190 gene ruvX 10370 9942 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549192.1 protein_id gnl|my_center|LOCUS_06190 10627 10370 gene locus_tag LOCUS_06200 10627 10370 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549189.1 protein_id gnl|my_center|LOCUS_06200 13328 10680 gene locus_tag LOCUS_06210 gene alaS 13328 10680 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549179.1 protein_id gnl|my_center|LOCUS_06210 14940 13561 gene locus_tag LOCUS_06220 14940 13561 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549176.1 protein_id gnl|my_center|LOCUS_06220 15889 14927 gene locus_tag LOCUS_06230 15889 14927 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254146.1 protein_id gnl|my_center|LOCUS_06230 16209 15922 gene locus_tag LOCUS_06240 16209 15922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06240 17040 16270 gene locus_tag LOCUS_06250 17040 16270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06250 18488 17040 gene locus_tag LOCUS_06260 gene zwf 18488 17040 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549170.1 protein_id gnl|my_center|LOCUS_06260 19027 18602 gene locus_tag LOCUS_06270 gene yajC 19027 18602 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613305.1 protein_id gnl|my_center|LOCUS_06270 20124 19117 gene locus_tag LOCUS_06280 gene ruvB 20124 19117 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549167.1 protein_id gnl|my_center|LOCUS_06280 20745 20167 gene locus_tag LOCUS_06290 gene ruvA 20745 20167 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549165.1 protein_id gnl|my_center|LOCUS_06290 22640 20751 gene locus_tag LOCUS_06300 gene mutL 22640 20751 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549162.1 protein_id gnl|my_center|LOCUS_06300 25219 22640 gene locus_tag LOCUS_06310 gene mutS 25219 22640 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254144.1 protein_id gnl|my_center|LOCUS_06310 27111 25348 gene locus_tag LOCUS_06320 27111 25348 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254599.1 protein_id gnl|my_center|LOCUS_06320 29013 27382 gene locus_tag LOCUS_06330 gene groL 29013 27382 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549158.1 protein_id gnl|my_center|LOCUS_06330 29329 29045 gene locus_tag LOCUS_06340 gene groES 29329 29045 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549156.1 protein_id gnl|my_center|LOCUS_06340 30413 29652 gene locus_tag LOCUS_06350 30413 29652 CDS product LiaF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549154.1 protein_id gnl|my_center|LOCUS_06350 30868 30410 gene locus_tag LOCUS_06360 30868 30410 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721270.1 protein_id gnl|my_center|LOCUS_06360 31661 31023 gene locus_tag LOCUS_06370 31661 31023 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549143.1 protein_id gnl|my_center|LOCUS_06370 31860 33788 gene locus_tag LOCUS_06380 31860 33788 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549141.1 protein_id gnl|my_center|LOCUS_06380 34597 33833 gene locus_tag LOCUS_06390 34597 33833 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702140.1 protein_id gnl|my_center|LOCUS_06390 35852 34584 gene locus_tag LOCUS_06400 35852 34584 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613327.1 protein_id gnl|my_center|LOCUS_06400 36567 35938 gene locus_tag LOCUS_06410 36567 35938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 36815 36567 gene locus_tag LOCUS_06420 36815 36567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 38252 36957 gene locus_tag LOCUS_06430 gene purB 38252 36957 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254607.1 protein_id gnl|my_center|LOCUS_06430 39545 38256 gene locus_tag LOCUS_06440 39545 38256 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549585.1 protein_id gnl|my_center|LOCUS_06440 39736 40728 gene locus_tag LOCUS_06450 39736 40728 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254608.1 protein_id gnl|my_center|LOCUS_06450 41498 40788 gene locus_tag LOCUS_06460 41498 40788 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476371.1 protein_id gnl|my_center|LOCUS_06460 42670 41624 gene locus_tag LOCUS_06470 gene tsaD 42670 41624 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549127.1 protein_id gnl|my_center|LOCUS_06470 43227 42667 gene locus_tag LOCUS_06480 gene rimI 43227 42667 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549125.1 protein_id gnl|my_center|LOCUS_06480 43942 43211 gene locus_tag LOCUS_06490 gene tsaB 43942 43211 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549123.1 protein_id gnl|my_center|LOCUS_06490 44525 43968 gene locus_tag LOCUS_06500 44525 43968 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613301.1 protein_id gnl|my_center|LOCUS_06500 45261 44530 gene locus_tag LOCUS_06510 45261 44530 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254136.1 protein_id gnl|my_center|LOCUS_06510 46127 45270 gene locus_tag LOCUS_06520 gene rsmI 46127 45270 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549119.1 protein_id gnl|my_center|LOCUS_06520 46476 46129 gene locus_tag LOCUS_06530 gene yabA 46476 46129 CDS product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254135.1 protein_id gnl|my_center|LOCUS_06530 47345 46497 gene locus_tag LOCUS_06540 47345 46497 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549117.1 protein_id gnl|my_center|LOCUS_06540 47674 47345 gene locus_tag LOCUS_06550 47674 47345 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567098.1 protein_id gnl|my_center|LOCUS_06550 48328 47687 gene locus_tag LOCUS_06560 gene tmk 48328 47687 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254134.1 protein_id gnl|my_center|LOCUS_06560 48674 48438 gene locus_tag LOCUS_06570 48674 48438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 49270 48671 gene locus_tag LOCUS_06580 gene recR 49270 48671 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549113.1 protein_id gnl|my_center|LOCUS_06580 49601 49272 gene locus_tag LOCUS_06590 49601 49272 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549112.1 protein_id gnl|my_center|LOCUS_06590 51442 49619 gene locus_tag LOCUS_06600 gene dnaX 51442 49619 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549111.1 protein_id gnl|my_center|LOCUS_06600 52159 51650 gene locus_tag LOCUS_06610 gene tadA 52159 51650 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 protein_id gnl|my_center|LOCUS_06610 52444 52271 gene locus_tag LOCUS_06620 52444 52271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 53178 52561 gene locus_tag LOCUS_06630 53178 52561 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254130.1 protein_id gnl|my_center|LOCUS_06630 >Feature sequence012 <1 1350 gene locus_tag LOCUS_06640 <1 1350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003700881.1:acetolactate synthase AlsS 1361 2080 gene locus_tag LOCUS_06650 gene budA 1361 2080 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101638.1 protein_id gnl|my_center|LOCUS_06650 2300 3193 gene locus_tag LOCUS_06660 2300 3193 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546685.1 protein_id gnl|my_center|LOCUS_06660 3197 4369 gene locus_tag LOCUS_06670 3197 4369 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158181789.1 protein_id gnl|my_center|LOCUS_06670 4402 5370 gene locus_tag LOCUS_06680 gene manA 4402 5370 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546690.1 protein_id gnl|my_center|LOCUS_06680 5397 5792 gene locus_tag LOCUS_06690 5397 5792 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288595.1 protein_id gnl|my_center|LOCUS_06690 5789 6493 gene locus_tag LOCUS_06700 5789 6493 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254236.1 protein_id gnl|my_center|LOCUS_06700 6497 7948 gene locus_tag LOCUS_06710 6497 7948 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546698.1 protein_id gnl|my_center|LOCUS_06710 10208 8019 gene locus_tag LOCUS_06720 10208 8019 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546703.1 protein_id gnl|my_center|LOCUS_06720 10370 10984 gene locus_tag LOCUS_06730 10370 10984 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254238.1 protein_id gnl|my_center|LOCUS_06730 11054 12394 gene locus_tag LOCUS_06740 11054 12394 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546706.1 protein_id gnl|my_center|LOCUS_06740 12513 13907 gene locus_tag LOCUS_06750 12513 13907 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254239.1 protein_id gnl|my_center|LOCUS_06750 14789 13947 gene locus_tag LOCUS_06760 14789 13947 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475550.1 protein_id gnl|my_center|LOCUS_06760 14957 15250 gene locus_tag LOCUS_06770 14957 15250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906205.1 protein_id gnl|my_center|LOCUS_06770 15263 15664 gene locus_tag LOCUS_06780 15263 15664 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254438.1 protein_id gnl|my_center|LOCUS_06780 15668 15934 gene locus_tag LOCUS_06790 15668 15934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 16451 16379 gene locus_tag LOCUS_t00080 16451 16379 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 16529 16456 gene locus_tag LOCUS_t00090 16529 16456 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 16636 17655 gene locus_tag LOCUS_06800 16636 17655 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546711.1 protein_id gnl|my_center|LOCUS_06800 19036 17684 gene locus_tag LOCUS_06810 19036 17684 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546733.1 protein_id gnl|my_center|LOCUS_06810 19168 19770 gene locus_tag LOCUS_06820 19168 19770 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613340.1 protein_id gnl|my_center|LOCUS_06820 19798 20886 gene locus_tag LOCUS_06830 gene prfA 19798 20886 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546735.1 protein_id gnl|my_center|LOCUS_06830 20879 21721 gene locus_tag LOCUS_06840 gene prmC 20879 21721 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546736.1 protein_id gnl|my_center|LOCUS_06840 21722 22720 gene locus_tag LOCUS_06850 21722 22720 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546737.1 protein_id gnl|my_center|LOCUS_06850 22817 23446 gene locus_tag LOCUS_06860 gene upp 22817 23446 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546738.1 protein_id gnl|my_center|LOCUS_06860 23550 24266 gene locus_tag LOCUS_06870 gene atpB 23550 24266 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546739.1 protein_id gnl|my_center|LOCUS_06870 24287 24499 gene locus_tag LOCUS_06880 gene atpE 24287 24499 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029779745.1 protein_id gnl|my_center|LOCUS_06880 24539 25039 gene locus_tag LOCUS_06890 gene atpF 24539 25039 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546741.1 protein_id gnl|my_center|LOCUS_06890 25039 25587 gene locus_tag LOCUS_06900 25039 25587 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546742.1 protein_id gnl|my_center|LOCUS_06900 25602 27113 gene locus_tag LOCUS_06910 gene atpA 25602 27113 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254246.1 protein_id gnl|my_center|LOCUS_06910 27131 28087 gene locus_tag LOCUS_06920 27131 28087 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546744.1 protein_id gnl|my_center|LOCUS_06920 28106 29554 gene locus_tag LOCUS_06930 gene atpD 28106 29554 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254247.1 protein_id gnl|my_center|LOCUS_06930 29566 30006 gene locus_tag LOCUS_06940 29566 30006 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546746.1 protein_id gnl|my_center|LOCUS_06940 30049 30282 gene locus_tag LOCUS_06950 30049 30282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 30387 31376 gene locus_tag LOCUS_06960 30387 31376 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546749.1 protein_id gnl|my_center|LOCUS_06960 31379 31564 gene locus_tag LOCUS_06970 31379 31564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 31566 31859 gene locus_tag LOCUS_06980 gene yidD 31566 31859 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564982.1 protein_id gnl|my_center|LOCUS_06980 31874 32101 gene locus_tag LOCUS_06990 31874 32101 CDS product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546751.1 protein_id gnl|my_center|LOCUS_06990 32120 33310 gene locus_tag LOCUS_07000 32120 33310 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546752.1 protein_id gnl|my_center|LOCUS_07000 33485 34924 gene locus_tag LOCUS_07010 33485 34924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549986.1 protein_id gnl|my_center|LOCUS_07010 35152 35910 gene locus_tag LOCUS_07020 35152 35910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 35999 36742 gene locus_tag LOCUS_07030 35999 36742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 36889 37803 gene locus_tag LOCUS_07040 36889 37803 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476433.1 protein_id gnl|my_center|LOCUS_07040 37861 39120 gene locus_tag LOCUS_07050 37861 39120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 39260 40090 gene locus_tag LOCUS_07060 39260 40090 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549642.1 protein_id gnl|my_center|LOCUS_07060 40617 40138 gene locus_tag LOCUS_07070 40617 40138 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546753.1 protein_id gnl|my_center|LOCUS_07070 40957 40673 gene locus_tag LOCUS_07080 40957 40673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 42557 41259 gene locus_tag LOCUS_07090 42557 41259 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546755.1 protein_id gnl|my_center|LOCUS_07090 43025 42558 gene locus_tag LOCUS_07100 43025 42558 CDS product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254248.1 protein_id gnl|my_center|LOCUS_07100 43715 43104 gene locus_tag LOCUS_07110 gene rpsD 43715 43104 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254249.1 protein_id gnl|my_center|LOCUS_07110 >Feature sequence013 82 1086 gene locus_tag LOCUS_07120 82 1086 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546680.1 protein_id gnl|my_center|LOCUS_07120 1104 2288 gene locus_tag LOCUS_07130 1104 2288 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546683.1 protein_id gnl|my_center|LOCUS_07130 2348 2709 gene locus_tag LOCUS_tm00010 2348 2709 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3984 2800 gene locus_tag LOCUS_07140 3984 2800 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087235334.1 protein_id gnl|my_center|LOCUS_07140 4645 4145 gene locus_tag LOCUS_07150 4645 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 5101 4685 gene locus_tag LOCUS_07160 5101 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 5441 5085 gene locus_tag LOCUS_07170 5441 5085 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645954.1 protein_id gnl|my_center|LOCUS_07170 5707 5895 gene locus_tag LOCUS_07180 5707 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009552367.1 protein_id gnl|my_center|LOCUS_07180 5907 6116 gene locus_tag LOCUS_07190 5907 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 6198 6410 gene locus_tag LOCUS_07200 6198 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 6382 6528 gene locus_tag LOCUS_07210 6382 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 6525 7001 gene locus_tag LOCUS_07220 6525 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 7001 7177 gene locus_tag LOCUS_07230 7001 7177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 7238 7477 gene locus_tag LOCUS_07240 7238 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 7634 8905 gene locus_tag LOCUS_07250 7634 8905 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972453.1 protein_id gnl|my_center|LOCUS_07250 8902 9090 gene locus_tag LOCUS_07260 8902 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 9090 9779 gene locus_tag LOCUS_07270 9090 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 9782 10084 gene locus_tag LOCUS_07280 9782 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 10229 10849 gene locus_tag LOCUS_07290 10229 10849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 10849 11133 gene locus_tag LOCUS_07300 10849 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 11117 11926 gene locus_tag LOCUS_07310 11117 11926 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232980.1 protein_id gnl|my_center|LOCUS_07310 11916 13202 gene locus_tag LOCUS_07320 11916 13202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 13572 13871 gene locus_tag LOCUS_07330 13572 13871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 13875 14132 gene locus_tag LOCUS_07340 13875 14132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 14132 14329 gene locus_tag LOCUS_07350 14132 14329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 14337 14537 gene locus_tag LOCUS_07360 14337 14537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 14534 14788 gene locus_tag LOCUS_07370 14534 14788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 14808 15149 gene locus_tag LOCUS_07380 14808 15149 CDS product VRR-NUC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834374.1 protein_id gnl|my_center|LOCUS_07380 15133 15624 gene locus_tag LOCUS_07390 15133 15624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 15640 16083 gene locus_tag LOCUS_07400 15640 16083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 16500 16859 gene locus_tag LOCUS_07410 16500 16859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 16958 17221 gene locus_tag LOCUS_07420 16958 17221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 17205 18665 gene locus_tag LOCUS_07430 17205 18665 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256853.1 protein_id gnl|my_center|LOCUS_07430 18668 20122 gene locus_tag LOCUS_07440 18668 20122 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108668.1 protein_id gnl|my_center|LOCUS_07440 20112 20786 gene locus_tag LOCUS_07450 20112 20786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 20913 21380 gene locus_tag LOCUS_07460 20913 21380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 21398 22273 gene locus_tag LOCUS_07470 21398 22273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 22285 22416 gene locus_tag LOCUS_07480 22285 22416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 22419 22793 gene locus_tag LOCUS_07490 22419 22793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 22780 23112 gene locus_tag LOCUS_07500 22780 23112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093651380.1 protein_id gnl|my_center|LOCUS_07500 23105 23350 gene locus_tag LOCUS_07510 23105 23350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032787.1 protein_id gnl|my_center|LOCUS_07510 23350 23679 gene locus_tag LOCUS_07520 23350 23679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573598.1 protein_id gnl|my_center|LOCUS_07520 23695 24288 gene locus_tag LOCUS_07530 23695 24288 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226354.1 protein_id gnl|my_center|LOCUS_07530 24288 24575 gene locus_tag LOCUS_07540 24288 24575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 24587 24964 gene locus_tag LOCUS_07550 24587 24964 CDS product DUF5361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922454.1 protein_id gnl|my_center|LOCUS_07550 24957 27902 gene locus_tag LOCUS_07560 24957 27902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 27899 28627 gene locus_tag LOCUS_07570 27899 28627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 28624 30411 gene locus_tag LOCUS_07580 28624 30411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 30414 30626 gene locus_tag LOCUS_07590 30414 30626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 30616 32658 gene locus_tag LOCUS_07600 30616 32658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 32665 33057 gene locus_tag LOCUS_07610 32665 33057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 33058 33465 gene locus_tag LOCUS_07620 33058 33465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 33466 33873 gene locus_tag LOCUS_07630 33466 33873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 33870 34139 gene locus_tag LOCUS_07640 33870 34139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 34173 34652 gene locus_tag LOCUS_07650 34173 34652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 34652 34846 gene locus_tag LOCUS_07660 34652 34846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 34818 35216 gene locus_tag LOCUS_07670 34818 35216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 35227 35517 gene locus_tag LOCUS_07680 35227 35517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 35489 35674 gene locus_tag LOCUS_07690 35489 35674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 35661 36050 gene locus_tag LOCUS_07700 35661 36050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 36123 37217 gene locus_tag LOCUS_07710 36123 37217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence014 1236 289 gene locus_tag LOCUS_07720 1236 289 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254563.1 protein_id gnl|my_center|LOCUS_07720 1697 1239 gene locus_tag LOCUS_07730 gene nrdI 1697 1239 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549835.1 protein_id gnl|my_center|LOCUS_07730 1859 2488 gene locus_tag LOCUS_07740 1859 2488 CDS product LVIS_2131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549837.1 protein_id gnl|my_center|LOCUS_07740 4029 2497 gene locus_tag LOCUS_07750 4029 2497 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549839.1 protein_id gnl|my_center|LOCUS_07750 4429 4124 gene locus_tag LOCUS_07760 4429 4124 CDS product DUF2187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549842.1 protein_id gnl|my_center|LOCUS_07760 4518 5075 gene locus_tag LOCUS_07770 4518 5075 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041814911.1 protein_id gnl|my_center|LOCUS_07770 5282 5989 gene locus_tag LOCUS_07780 5282 5989 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549854.1 protein_id gnl|my_center|LOCUS_07780 6086 7279 gene locus_tag LOCUS_07790 6086 7279 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547189.1 protein_id gnl|my_center|LOCUS_07790 8583 7303 gene locus_tag LOCUS_07800 gene hflX 8583 7303 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549861.1 protein_id gnl|my_center|LOCUS_07800 10226 8772 gene locus_tag LOCUS_07810 10226 8772 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566325.1 protein_id gnl|my_center|LOCUS_07810 10512 11258 gene locus_tag LOCUS_07820 10512 11258 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549987.1 protein_id gnl|my_center|LOCUS_07820 11282 13150 gene locus_tag LOCUS_07830 11282 13150 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549988.1 protein_id gnl|my_center|LOCUS_07830 14534 13209 gene locus_tag LOCUS_07840 14534 13209 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101340.1 protein_id gnl|my_center|LOCUS_07840 15468 14527 gene locus_tag LOCUS_07850 gene hemH 15468 14527 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101341.1 protein_id gnl|my_center|LOCUS_07850 16127 15477 gene locus_tag LOCUS_07860 16127 15477 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549989.1 protein_id gnl|my_center|LOCUS_07860 16284 17048 gene locus_tag LOCUS_07870 16284 17048 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549947.1 protein_id gnl|my_center|LOCUS_07870 17125 17481 gene locus_tag LOCUS_07880 17125 17481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 17651 18508 gene locus_tag LOCUS_07890 17651 18508 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254546.1 protein_id gnl|my_center|LOCUS_07890 18505 20379 gene locus_tag LOCUS_07900 18505 20379 CDS product PTS beta-glucoside transporter subunit IIBCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549922.1 protein_id gnl|my_center|LOCUS_07900 20388 21869 gene locus_tag LOCUS_07910 20388 21869 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549927.1 protein_id gnl|my_center|LOCUS_07910 22561 21917 gene locus_tag LOCUS_07920 22561 21917 CDS product matrixin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549990.1 protein_id gnl|my_center|LOCUS_07920 22712 23134 gene locus_tag LOCUS_07930 22712 23134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 23240 24610 gene locus_tag LOCUS_07940 23240 24610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 24750 27044 gene locus_tag LOCUS_07950 gene helD 24750 27044 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_056990024.1 protein_id gnl|my_center|LOCUS_07950 27073 27357 gene locus_tag LOCUS_07960 27073 27357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 27968 27414 gene locus_tag LOCUS_07970 27968 27414 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550008.1 protein_id gnl|my_center|LOCUS_07970 28058 28888 gene locus_tag LOCUS_07980 gene coaA 28058 28888 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550009.1 protein_id gnl|my_center|LOCUS_07980 28899 29474 gene locus_tag LOCUS_07990 gene efp 28899 29474 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550017.1 protein_id gnl|my_center|LOCUS_07990 29620 30354 gene locus_tag LOCUS_08000 29620 30354 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254533.1 protein_id gnl|my_center|LOCUS_08000 34670 30423 gene locus_tag LOCUS_08010 34670 30423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 35461 34658 gene locus_tag LOCUS_08020 35461 34658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 36033 35659 gene locus_tag LOCUS_08030 gene mscL 36033 35659 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643168.1 protein_id gnl|my_center|LOCUS_08030 36309 37079 gene locus_tag LOCUS_08040 gene pnuC 36309 37079 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550046.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence015 1254 220 gene locus_tag LOCUS_08050 1254 220 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546595.1 protein_id gnl|my_center|LOCUS_08050 2144 1269 gene locus_tag LOCUS_08060 gene rapZ 2144 1269 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546593.1 protein_id gnl|my_center|LOCUS_08060 2784 2242 gene locus_tag LOCUS_08070 2784 2242 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546590.1 protein_id gnl|my_center|LOCUS_08070 5681 2832 gene locus_tag LOCUS_08080 gene uvrA 5681 2832 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546588.1 protein_id gnl|my_center|LOCUS_08080 7716 5671 gene locus_tag LOCUS_08090 gene uvrB 7716 5671 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546586.1 protein_id gnl|my_center|LOCUS_08090 9540 7816 gene locus_tag LOCUS_08100 9540 7816 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546584.1 protein_id gnl|my_center|LOCUS_08100 11368 9599 gene locus_tag LOCUS_08110 11368 9599 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254225.1 protein_id gnl|my_center|LOCUS_08110 13767 11368 gene locus_tag LOCUS_08120 13767 11368 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546577.1 protein_id gnl|my_center|LOCUS_08120 15212 13782 gene locus_tag LOCUS_08130 gene glgA 15212 13782 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546574.1 protein_id gnl|my_center|LOCUS_08130 16364 15222 gene locus_tag LOCUS_08140 gene glgD 16364 15222 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546573.1 protein_id gnl|my_center|LOCUS_08140 17499 16354 gene locus_tag LOCUS_08150 17499 16354 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546570.1 protein_id gnl|my_center|LOCUS_08150 19429 17528 gene locus_tag LOCUS_08160 gene glgB 19429 17528 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254224.1 protein_id gnl|my_center|LOCUS_08160 20546 19611 gene locus_tag LOCUS_08170 gene trxB 20546 19611 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254223.1 protein_id gnl|my_center|LOCUS_08170 21641 20622 gene locus_tag LOCUS_08180 21641 20622 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546563.1 protein_id gnl|my_center|LOCUS_08180 22521 21685 gene locus_tag LOCUS_08190 gene lgt 22521 21685 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613330.1 protein_id gnl|my_center|LOCUS_08190 23471 22521 gene locus_tag LOCUS_08200 gene hprK 23471 22521 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546560.1 protein_id gnl|my_center|LOCUS_08200 23708 23481 gene locus_tag LOCUS_08210 23708 23481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 24717 23719 gene locus_tag LOCUS_08220 gene prfB 24717 23719 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095522727.1 protein_id gnl|my_center|LOCUS_08220 27283 24884 gene locus_tag LOCUS_08230 gene secA 27283 24884 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254222.1 protein_id gnl|my_center|LOCUS_08230 27972 27427 gene locus_tag LOCUS_08240 gene raiA 27972 27427 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254221.1 protein_id gnl|my_center|LOCUS_08240 28737 28057 gene locus_tag LOCUS_08250 28737 28057 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254220.1 protein_id gnl|my_center|LOCUS_08250 30002 28734 gene locus_tag LOCUS_08260 30002 28734 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546538.1 protein_id gnl|my_center|LOCUS_08260 30045 30710 gene locus_tag LOCUS_08270 30045 30710 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546537.1 protein_id gnl|my_center|LOCUS_08270 31865 30732 gene locus_tag LOCUS_08280 31865 30732 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546535.1 protein_id gnl|my_center|LOCUS_08280 33617 31977 gene locus_tag LOCUS_08290 gene rny 33617 31977 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254219.1 protein_id gnl|my_center|LOCUS_08290 34843 33746 gene locus_tag LOCUS_08300 gene recA 34843 33746 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546531.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence016 772 149 gene locus_tag LOCUS_08310 772 149 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549687.1 protein_id gnl|my_center|LOCUS_08310 1156 914 gene locus_tag LOCUS_08320 1156 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007126009.1 protein_id gnl|my_center|LOCUS_08320 1238 2650 gene locus_tag LOCUS_08330 1238 2650 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549685.1 protein_id gnl|my_center|LOCUS_08330 2995 2819 gene locus_tag LOCUS_08340 2995 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 4119 3016 gene locus_tag LOCUS_08350 4119 3016 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549629.1 protein_id gnl|my_center|LOCUS_08350 5046 4225 gene locus_tag LOCUS_08360 5046 4225 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287150.1 protein_id gnl|my_center|LOCUS_08360 6462 5056 gene locus_tag LOCUS_08370 6462 5056 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641582.1 protein_id gnl|my_center|LOCUS_08370 8139 6472 gene locus_tag LOCUS_08380 8139 6472 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102273.1 protein_id gnl|my_center|LOCUS_08380 8750 8139 gene locus_tag LOCUS_08390 8750 8139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 10325 8865 gene locus_tag LOCUS_08400 10325 8865 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641586.1 protein_id gnl|my_center|LOCUS_08400 11268 10348 gene locus_tag LOCUS_08410 11268 10348 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643598.1 protein_id gnl|my_center|LOCUS_08410 12222 11281 gene locus_tag LOCUS_08420 12222 11281 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641588.1 protein_id gnl|my_center|LOCUS_08420 13519 12497 gene locus_tag LOCUS_08430 13519 12497 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101398.1 protein_id gnl|my_center|LOCUS_08430 15367 13580 gene locus_tag LOCUS_08440 15367 13580 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102275.1 protein_id gnl|my_center|LOCUS_08440 18050 15378 gene locus_tag LOCUS_08450 18050 15378 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102268.1 protein_id gnl|my_center|LOCUS_08450 19360 18080 gene locus_tag LOCUS_08460 19360 18080 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285982.1 protein_id gnl|my_center|LOCUS_08460 19486 20541 gene locus_tag LOCUS_08470 19486 20541 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102279.1 protein_id gnl|my_center|LOCUS_08470 20532 22598 gene locus_tag LOCUS_08480 20532 22598 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002374433.1 protein_id gnl|my_center|LOCUS_08480 24080 22674 gene locus_tag LOCUS_08490 24080 22674 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549685.1 protein_id gnl|my_center|LOCUS_08490 26395 24269 gene locus_tag LOCUS_08500 26395 24269 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548080.1 protein_id gnl|my_center|LOCUS_08500 26512 27378 gene locus_tag LOCUS_08510 26512 27378 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254454.1 protein_id gnl|my_center|LOCUS_08510 27668 27402 gene locus_tag LOCUS_08520 27668 27402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 28412 27681 gene locus_tag LOCUS_08530 28412 27681 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642916.1 protein_id gnl|my_center|LOCUS_08530 30272 28437 gene locus_tag LOCUS_08540 30272 28437 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989498.1 protein_id gnl|my_center|LOCUS_08540 30537 30277 gene locus_tag LOCUS_08550 30537 30277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 30894 30601 gene locus_tag LOCUS_08560 30894 30601 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453958.1 protein_id gnl|my_center|LOCUS_08560 32319 30907 gene locus_tag LOCUS_08570 32319 30907 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887822.1 protein_id gnl|my_center|LOCUS_08570 32787 32323 gene locus_tag LOCUS_08580 32787 32323 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892531.1 protein_id gnl|my_center|LOCUS_08580 >Feature sequence017 640 80 gene locus_tag LOCUS_08590 gene pgsA 640 80 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546529.1 protein_id gnl|my_center|LOCUS_08590 1785 643 gene locus_tag LOCUS_08600 1785 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 2569 1841 gene locus_tag LOCUS_08610 2569 1841 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546523.1 protein_id gnl|my_center|LOCUS_08610 3804 2566 gene locus_tag LOCUS_08620 3804 2566 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546521.1 protein_id gnl|my_center|LOCUS_08620 5015 3801 gene locus_tag LOCUS_08630 5015 3801 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254218.1 protein_id gnl|my_center|LOCUS_08630 7470 5008 gene locus_tag LOCUS_08640 7470 5008 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546517.1 protein_id gnl|my_center|LOCUS_08640 7926 7483 gene locus_tag LOCUS_08650 7926 7483 CDS product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546515.1 protein_id gnl|my_center|LOCUS_08650 8483 7929 gene locus_tag LOCUS_08660 8483 7929 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546513.1 protein_id gnl|my_center|LOCUS_08660 9752 8556 gene locus_tag LOCUS_08670 9752 8556 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546511.1 protein_id gnl|my_center|LOCUS_08670 10144 9752 gene locus_tag LOCUS_08680 10144 9752 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546509.1 protein_id gnl|my_center|LOCUS_08680 10287 11315 gene locus_tag LOCUS_08690 10287 11315 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546505.1 protein_id gnl|my_center|LOCUS_08690 13173 11398 gene locus_tag LOCUS_08700 13173 11398 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254216.1 protein_id gnl|my_center|LOCUS_08700 14173 13280 gene locus_tag LOCUS_08710 14173 13280 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546500.1 protein_id gnl|my_center|LOCUS_08710 14982 14173 gene locus_tag LOCUS_08720 14982 14173 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254215.1 protein_id gnl|my_center|LOCUS_08720 15608 14982 gene locus_tag LOCUS_08730 15608 14982 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546495.1 protein_id gnl|my_center|LOCUS_08730 15686 16309 gene locus_tag LOCUS_08740 15686 16309 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546493.1 protein_id gnl|my_center|LOCUS_08740 16388 16996 gene locus_tag LOCUS_08750 16388 16996 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546492.1 protein_id gnl|my_center|LOCUS_08750 17877 17026 gene locus_tag LOCUS_08760 17877 17026 CDS product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254214.1 protein_id gnl|my_center|LOCUS_08760 18589 17930 gene locus_tag LOCUS_08770 18589 17930 CDS product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546487.1 protein_id gnl|my_center|LOCUS_08770 19093 18695 gene locus_tag LOCUS_08780 gene spxA 19093 18695 CDS product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254213.1 protein_id gnl|my_center|LOCUS_08780 21074 19335 gene locus_tag LOCUS_08790 gene ptsP 21074 19335 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254212.1 protein_id gnl|my_center|LOCUS_08790 21340 21074 gene locus_tag LOCUS_08800 21340 21074 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546482.1 protein_id gnl|my_center|LOCUS_08800 21655 21461 gene locus_tag LOCUS_08810 21655 21461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 21865 24021 gene locus_tag LOCUS_08820 21865 24021 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254211.1 protein_id gnl|my_center|LOCUS_08820 24136 24414 gene locus_tag LOCUS_08830 24136 24414 CDS product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546474.1 protein_id gnl|my_center|LOCUS_08830 26036 24468 gene locus_tag LOCUS_08840 26036 24468 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546473.1 protein_id gnl|my_center|LOCUS_08840 26902 26036 gene locus_tag LOCUS_08850 26902 26036 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546472.1 protein_id gnl|my_center|LOCUS_08850 27011 27472 gene locus_tag LOCUS_08860 27011 27472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 27971 27480 gene locus_tag LOCUS_08870 27971 27480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254210.1 protein_id gnl|my_center|LOCUS_08870 28533 27904 gene locus_tag LOCUS_08880 28533 27904 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003710725.1 protein_id gnl|my_center|LOCUS_08880 29385 28570 gene locus_tag LOCUS_08890 gene recX 29385 28570 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546469.1 protein_id gnl|my_center|LOCUS_08890 29500 30879 gene locus_tag LOCUS_08900 gene rlmD 29500 30879 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546467.1 protein_id gnl|my_center|LOCUS_08900 32182 31232 gene locus_tag LOCUS_08910 32182 31232 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254232.1 protein_id gnl|my_center|LOCUS_08910 32302 32598 gene locus_tag LOCUS_08920 32302 32598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 <33371 32595 gene locus_tag LOCUS_08930 <33371 32595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546456.1:UTP--glucose-1-phosphate uridylyltransferase GalU >Feature sequence018 303 575 gene locus_tag LOCUS_08940 303 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 703 1455 gene locus_tag LOCUS_08950 703 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 1647 1510 gene locus_tag LOCUS_08960 1647 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 1727 2512 gene locus_tag LOCUS_08970 1727 2512 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547007.1 protein_id gnl|my_center|LOCUS_08970 2688 3335 gene locus_tag LOCUS_08980 2688 3335 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254444.1 protein_id gnl|my_center|LOCUS_08980 3996 3379 gene locus_tag LOCUS_08990 3996 3379 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254296.1 protein_id gnl|my_center|LOCUS_08990 4947 4015 gene locus_tag LOCUS_09000 4947 4015 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254272.1 protein_id gnl|my_center|LOCUS_09000 5092 6894 gene locus_tag LOCUS_09010 gene uvrC 5092 6894 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547051.1 protein_id gnl|my_center|LOCUS_09010 6970 8259 gene locus_tag LOCUS_09020 gene obgE 6970 8259 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254297.1 protein_id gnl|my_center|LOCUS_09020 8281 10203 gene locus_tag LOCUS_09030 8281 10203 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025015105.1 protein_id gnl|my_center|LOCUS_09030 10214 11155 gene locus_tag LOCUS_09040 gene rnz 10214 11155 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547055.1 protein_id gnl|my_center|LOCUS_09040 11148 11942 gene locus_tag LOCUS_09050 11148 11942 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547056.1 protein_id gnl|my_center|LOCUS_09050 11952 12320 gene locus_tag LOCUS_09060 11952 12320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 12428 12619 gene locus_tag LOCUS_09070 gene rpmF 12428 12619 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547064.1 protein_id gnl|my_center|LOCUS_09070 12667 14232 gene locus_tag LOCUS_09080 12667 14232 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547066.1 protein_id gnl|my_center|LOCUS_09080 14485 14288 gene locus_tag LOCUS_09090 14485 14288 CDS product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254299.1 protein_id gnl|my_center|LOCUS_09090 14588 17707 gene locus_tag LOCUS_09100 14588 17707 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547069.1 protein_id gnl|my_center|LOCUS_09100 17886 18845 gene locus_tag LOCUS_09110 gene pfkA 17886 18845 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547070.1 protein_id gnl|my_center|LOCUS_09110 18881 20650 gene locus_tag LOCUS_09120 gene pyk 18881 20650 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547072.1 protein_id gnl|my_center|LOCUS_09120 20762 21658 gene locus_tag LOCUS_09130 20762 21658 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254300.1 protein_id gnl|my_center|LOCUS_09130 21639 22538 gene locus_tag LOCUS_09140 gene xerD 21639 22538 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547075.1 protein_id gnl|my_center|LOCUS_09140 22549 22920 gene locus_tag LOCUS_09150 22549 22920 CDS product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254301.1 protein_id gnl|my_center|LOCUS_09150 22904 23650 gene locus_tag LOCUS_09160 22904 23650 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547078.1 protein_id gnl|my_center|LOCUS_09160 23640 24245 gene locus_tag LOCUS_09170 gene scpB 23640 24245 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547080.1 protein_id gnl|my_center|LOCUS_09170 24246 24962 gene locus_tag LOCUS_09180 24246 24962 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547082.1 protein_id gnl|my_center|LOCUS_09180 25048 25728 gene locus_tag LOCUS_09190 25048 25728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 26001 26594 gene locus_tag LOCUS_09200 26001 26594 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547084.1 protein_id gnl|my_center|LOCUS_09200 26702 27367 gene locus_tag LOCUS_09210 gene cmk 26702 27367 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 protein_id gnl|my_center|LOCUS_09210 27430 28635 gene locus_tag LOCUS_09220 gene rpsA 27430 28635 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547091.1 protein_id gnl|my_center|LOCUS_09220 28709 30016 gene locus_tag LOCUS_09230 gene der 28709 30016 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254303.1 protein_id gnl|my_center|LOCUS_09230 30194 30469 gene locus_tag LOCUS_09240 30194 30469 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547110.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence019 53 373 gene locus_tag LOCUS_09250 53 373 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254504.1 protein_id gnl|my_center|LOCUS_09250 399 1046 gene locus_tag LOCUS_09260 399 1046 CDS product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548415.1 protein_id gnl|my_center|LOCUS_09260 1140 2453 gene locus_tag LOCUS_09270 gene murC 1140 2453 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548413.1 protein_id gnl|my_center|LOCUS_09270 2528 3622 gene locus_tag LOCUS_09280 2528 3622 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836412.1 protein_id gnl|my_center|LOCUS_09280 3714 4490 gene locus_tag LOCUS_09290 3714 4490 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730500.1 protein_id gnl|my_center|LOCUS_09290 4610 7288 gene locus_tag LOCUS_09300 gene polA 4610 7288 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548351.1 protein_id gnl|my_center|LOCUS_09300 7300 8130 gene locus_tag LOCUS_09310 gene mutM 7300 8130 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548349.1 protein_id gnl|my_center|LOCUS_09310 8127 8738 gene locus_tag LOCUS_09320 gene coaE 8127 8738 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548347.1 protein_id gnl|my_center|LOCUS_09320 8773 9240 gene locus_tag LOCUS_09330 gene nrdR 8773 9240 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548345.1 protein_id gnl|my_center|LOCUS_09330 9246 10592 gene locus_tag LOCUS_09340 9246 10592 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548343.1 protein_id gnl|my_center|LOCUS_09340 10606 11505 gene locus_tag LOCUS_09350 gene dnaI 10606 11505 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254494.1 protein_id gnl|my_center|LOCUS_09350 11784 13715 gene locus_tag LOCUS_09360 gene thrS 11784 13715 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548338.1 protein_id gnl|my_center|LOCUS_09360 14734 13781 gene locus_tag LOCUS_09370 14734 13781 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642346.1 protein_id gnl|my_center|LOCUS_09370 15255 14845 gene locus_tag LOCUS_09380 15255 14845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 15439 15873 gene locus_tag LOCUS_09390 15439 15873 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548336.1 protein_id gnl|my_center|LOCUS_09390 15870 16295 gene locus_tag LOCUS_09400 15870 16295 CDS product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548334.1 protein_id gnl|my_center|LOCUS_09400 16308 17270 gene locus_tag LOCUS_09410 16308 17270 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846404.1 protein_id gnl|my_center|LOCUS_09410 17239 18003 gene locus_tag LOCUS_09420 17239 18003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 18230 19135 gene locus_tag LOCUS_09430 18230 19135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09430 19132 19368 gene locus_tag LOCUS_09440 19132 19368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 19543 20061 gene locus_tag LOCUS_09450 gene infC 19543 20061 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075917325.1 protein_id gnl|my_center|LOCUS_09450 20080 20280 gene locus_tag LOCUS_09460 gene rpmI 20080 20280 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548328.1 protein_id gnl|my_center|LOCUS_09460 20314 20670 gene locus_tag LOCUS_09470 gene rplT 20314 20670 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548326.1 protein_id gnl|my_center|LOCUS_09470 20790 21308 gene locus_tag LOCUS_09480 20790 21308 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254490.1 protein_id gnl|my_center|LOCUS_09480 21305 22417 gene locus_tag LOCUS_09490 gene yqeH 21305 22417 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548317.1 protein_id gnl|my_center|LOCUS_09490 22417 23055 gene locus_tag LOCUS_09500 22417 23055 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548315.1 protein_id gnl|my_center|LOCUS_09500 23036 23632 gene locus_tag LOCUS_09510 gene yqeK 23036 23632 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548313.1 protein_id gnl|my_center|LOCUS_09510 23647 24000 gene locus_tag LOCUS_09520 gene rsfS 23647 24000 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548311.1 protein_id gnl|my_center|LOCUS_09520 24003 25163 gene locus_tag LOCUS_09530 24003 25163 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548309.1 protein_id gnl|my_center|LOCUS_09530 25165 25713 gene locus_tag LOCUS_09540 25165 25713 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548307.1 protein_id gnl|my_center|LOCUS_09540 25819 26547 gene locus_tag LOCUS_09550 25819 26547 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548305.1 protein_id gnl|my_center|LOCUS_09550 26513 28048 gene locus_tag LOCUS_09560 26513 28048 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254489.1 protein_id gnl|my_center|LOCUS_09560 29080 28097 gene locus_tag LOCUS_09570 gene yidC 29080 28097 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254488.1 protein_id gnl|my_center|LOCUS_09570 29413 29138 gene locus_tag LOCUS_09580 29413 29138 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564577.1 protein_id gnl|my_center|LOCUS_09580 29513 30274 gene locus_tag LOCUS_09590 29513 30274 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548298.1 protein_id gnl|my_center|LOCUS_09590 30378 30731 gene locus_tag LOCUS_09600 30378 30731 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254487.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence020 121 1206 gene locus_tag LOCUS_09610 121 1206 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254531.1 protein_id gnl|my_center|LOCUS_09610 1206 2069 gene locus_tag LOCUS_09620 1206 2069 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550063.1 protein_id gnl|my_center|LOCUS_09620 2071 2907 gene locus_tag LOCUS_09630 2071 2907 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254529.1 protein_id gnl|my_center|LOCUS_09630 2891 4195 gene locus_tag LOCUS_09640 2891 4195 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550067.1 protein_id gnl|my_center|LOCUS_09640 4244 5542 gene locus_tag LOCUS_09650 4244 5542 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550069.1 protein_id gnl|my_center|LOCUS_09650 5971 5600 gene locus_tag LOCUS_09660 5971 5600 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550019.1 protein_id gnl|my_center|LOCUS_09660 6698 5988 gene locus_tag LOCUS_09670 6698 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 6844 7299 gene locus_tag LOCUS_09680 6844 7299 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254537.1 protein_id gnl|my_center|LOCUS_09680 7299 7820 gene locus_tag LOCUS_09690 7299 7820 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550021.1 protein_id gnl|my_center|LOCUS_09690 7835 8275 gene locus_tag LOCUS_09700 7835 8275 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550006.1 protein_id gnl|my_center|LOCUS_09700 8380 10188 gene locus_tag LOCUS_09710 8380 10188 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254424.1 protein_id gnl|my_center|LOCUS_09710 11230 10307 gene locus_tag LOCUS_09720 11230 10307 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548278.1 protein_id gnl|my_center|LOCUS_09720 11399 12337 gene locus_tag LOCUS_09730 11399 12337 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254527.1 protein_id gnl|my_center|LOCUS_09730 12491 13057 gene locus_tag LOCUS_09740 12491 13057 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254526.1 protein_id gnl|my_center|LOCUS_09740 13084 16536 gene locus_tag LOCUS_09750 13084 16536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 17893 16607 gene locus_tag LOCUS_09760 17893 16607 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548475.1 protein_id gnl|my_center|LOCUS_09760 19354 17921 gene locus_tag LOCUS_09770 gene aaxC 19354 17921 CDS product arginine/agmatine antiporter AaxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892188.1 protein_id gnl|my_center|LOCUS_09770 20681 19395 gene locus_tag LOCUS_09780 20681 19395 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548475.1 protein_id gnl|my_center|LOCUS_09780 21130 21819 gene locus_tag LOCUS_09790 21130 21819 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254217.1 protein_id gnl|my_center|LOCUS_09790 22608 21931 gene locus_tag LOCUS_09800 22608 21931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 22705 23715 gene locus_tag LOCUS_09810 22705 23715 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550081.1 protein_id gnl|my_center|LOCUS_09810 25149 23773 gene locus_tag LOCUS_09820 25149 23773 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254522.1 protein_id gnl|my_center|LOCUS_09820 26098 25253 gene locus_tag LOCUS_09830 26098 25253 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550089.1 protein_id gnl|my_center|LOCUS_09830 26886 26095 gene locus_tag LOCUS_09840 26886 26095 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254520.1 protein_id gnl|my_center|LOCUS_09840 27060 27659 gene locus_tag LOCUS_09850 27060 27659 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550094.1 protein_id gnl|my_center|LOCUS_09850 27659 28213 gene locus_tag LOCUS_09860 27659 28213 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550097.1 protein_id gnl|my_center|LOCUS_09860 28425 29735 gene locus_tag LOCUS_09870 gene serS 28425 29735 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254519.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence021 897 142 gene locus_tag LOCUS_09880 897 142 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254508.1 protein_id gnl|my_center|LOCUS_09880 1080 2543 gene locus_tag LOCUS_09890 1080 2543 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254182.1 protein_id gnl|my_center|LOCUS_09890 2660 4114 gene locus_tag LOCUS_09900 2660 4114 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254182.1 protein_id gnl|my_center|LOCUS_09900 4297 4725 gene locus_tag LOCUS_09910 4297 4725 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546335.1 protein_id gnl|my_center|LOCUS_09910 4975 4778 gene locus_tag LOCUS_09920 4975 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 5356 5060 gene locus_tag LOCUS_09930 5356 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 6091 5672 gene locus_tag LOCUS_09940 6091 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 7508 6183 gene locus_tag LOCUS_09950 7508 6183 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546343.1 protein_id gnl|my_center|LOCUS_09950 8053 7523 gene locus_tag LOCUS_09960 gene pyrR 8053 7523 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546345.1 protein_id gnl|my_center|LOCUS_09960 9265 8264 gene locus_tag LOCUS_09970 9265 8264 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254469.1 protein_id gnl|my_center|LOCUS_09970 9430 10350 gene locus_tag LOCUS_09980 gene glsA 9430 10350 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295938.1 protein_id gnl|my_center|LOCUS_09980 11872 10457 gene locus_tag LOCUS_09990 11872 10457 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475567.1 protein_id gnl|my_center|LOCUS_09990 13218 11890 gene locus_tag LOCUS_10000 13218 11890 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714165.1 protein_id gnl|my_center|LOCUS_10000 14898 13249 gene locus_tag LOCUS_10010 14898 13249 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 protein_id gnl|my_center|LOCUS_10010 14990 15205 gene locus_tag LOCUS_10020 14990 15205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 15544 16923 gene locus_tag LOCUS_10030 15544 16923 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547458.1 protein_id gnl|my_center|LOCUS_10030 18186 16984 gene locus_tag LOCUS_10040 18186 16984 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254190.1 protein_id gnl|my_center|LOCUS_10040 18615 18190 gene locus_tag LOCUS_10050 18615 18190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 20495 18744 gene locus_tag LOCUS_10060 20495 18744 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546396.1 protein_id gnl|my_center|LOCUS_10060 20704 22197 gene locus_tag LOCUS_10070 20704 22197 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254595.1 protein_id gnl|my_center|LOCUS_10070 22400 23755 gene locus_tag LOCUS_10080 22400 23755 CDS product C45 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022064.1 protein_id gnl|my_center|LOCUS_10080 24448 23822 gene locus_tag LOCUS_10090 gene pyrE 24448 23822 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548040.1 protein_id gnl|my_center|LOCUS_10090 25155 24448 gene locus_tag LOCUS_10100 gene pyrF 25155 24448 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548039.1 protein_id gnl|my_center|LOCUS_10100 25417 26658 gene locus_tag LOCUS_10110 25417 26658 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288985.1 protein_id gnl|my_center|LOCUS_10110 26651 27568 gene locus_tag LOCUS_10120 26651 27568 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254443.1 protein_id gnl|my_center|LOCUS_10120 27780 27565 gene locus_tag LOCUS_10130 27780 27565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 29318 27906 gene locus_tag LOCUS_10140 29318 27906 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548236.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence022 452 123 gene locus_tag LOCUS_10150 452 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1923 685 gene locus_tag LOCUS_10160 1923 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 3028 1976 gene locus_tag LOCUS_10170 3028 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3963 3493 gene locus_tag LOCUS_10180 3963 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4827 4306 gene locus_tag LOCUS_10190 4827 4306 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254447.1 protein_id gnl|my_center|LOCUS_10190 5314 4943 gene locus_tag LOCUS_10200 5314 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 6093 5311 gene locus_tag LOCUS_10210 6093 5311 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549642.1 protein_id gnl|my_center|LOCUS_10210 8013 6184 gene locus_tag LOCUS_10220 8013 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 11699 8100 gene locus_tag LOCUS_10230 11699 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 11940 13154 gene locus_tag LOCUS_10240 11940 13154 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106642.1 protein_id gnl|my_center|LOCUS_10240 13279 13205 gene locus_tag LOCUS_t00100 13279 13205 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13475 13609 gene locus_tag LOCUS_10250 13475 13609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 14264 13602 gene locus_tag LOCUS_10260 14264 13602 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546159.1 protein_id gnl|my_center|LOCUS_10260 15639 14311 gene locus_tag LOCUS_10270 15639 14311 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254382.1 protein_id gnl|my_center|LOCUS_10270 15799 16791 gene locus_tag LOCUS_10280 gene galE 15799 16791 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548187.1 protein_id gnl|my_center|LOCUS_10280 19067 16845 gene locus_tag LOCUS_10290 19067 16845 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546149.1 protein_id gnl|my_center|LOCUS_10290 20413 19082 gene locus_tag LOCUS_10300 20413 19082 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546148.1 protein_id gnl|my_center|LOCUS_10300 22261 20417 gene locus_tag LOCUS_10310 22261 20417 CDS product TerB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546145.1 protein_id gnl|my_center|LOCUS_10310 22723 22388 gene locus_tag LOCUS_10320 22723 22388 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667012.1 protein_id gnl|my_center|LOCUS_10320 22968 22723 gene locus_tag LOCUS_10330 22968 22723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 24062 23094 gene locus_tag LOCUS_10340 24062 23094 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548798.1 protein_id gnl|my_center|LOCUS_10340 24866 24141 gene locus_tag LOCUS_10350 24866 24141 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254163.1 protein_id gnl|my_center|LOCUS_10350 25141 25542 gene locus_tag LOCUS_10360 25141 25542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547151.1 protein_id gnl|my_center|LOCUS_10360 28293 25687 gene locus_tag LOCUS_10370 gene adhE 28293 25687 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546132.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence023 199 741 gene locus_tag LOCUS_10380 199 741 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549688.1 protein_id gnl|my_center|LOCUS_10380 760 1314 gene locus_tag LOCUS_10390 760 1314 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549689.1 protein_id gnl|my_center|LOCUS_10390 1435 2235 gene locus_tag LOCUS_10400 1435 2235 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549690.1 protein_id gnl|my_center|LOCUS_10400 2237 3163 gene locus_tag LOCUS_10410 2237 3163 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549691.1 protein_id gnl|my_center|LOCUS_10410 3730 3194 gene locus_tag LOCUS_10420 3730 3194 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549693.1 protein_id gnl|my_center|LOCUS_10420 3915 4634 gene locus_tag LOCUS_10430 gene rsmG 3915 4634 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 protein_id gnl|my_center|LOCUS_10430 4655 5512 gene locus_tag LOCUS_10440 gene noc 4655 5512 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254588.1 protein_id gnl|my_center|LOCUS_10440 5529 6302 gene locus_tag LOCUS_10450 5529 6302 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254587.1 protein_id gnl|my_center|LOCUS_10450 6286 7179 gene locus_tag LOCUS_10460 6286 7179 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549701.1 protein_id gnl|my_center|LOCUS_10460 7209 7460 gene locus_tag LOCUS_10470 7209 7460 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549703.1 protein_id gnl|my_center|LOCUS_10470 7477 8577 gene locus_tag LOCUS_10480 gene ychF 7477 8577 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549709.1 protein_id gnl|my_center|LOCUS_10480 8587 9441 gene locus_tag LOCUS_10490 8587 9441 CDS product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549711.1 protein_id gnl|my_center|LOCUS_10490 9571 11295 gene locus_tag LOCUS_10500 9571 11295 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254586.1 protein_id gnl|my_center|LOCUS_10500 11305 13158 gene locus_tag LOCUS_10510 11305 13158 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721608.1 protein_id gnl|my_center|LOCUS_10510 13288 13974 gene locus_tag LOCUS_10520 13288 13974 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549720.1 protein_id gnl|my_center|LOCUS_10520 13978 15129 gene locus_tag LOCUS_10530 13978 15129 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549721.1 protein_id gnl|my_center|LOCUS_10530 15178 16755 gene locus_tag LOCUS_10540 15178 16755 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254584.1 protein_id gnl|my_center|LOCUS_10540 16769 17518 gene locus_tag LOCUS_10550 16769 17518 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549723.1 protein_id gnl|my_center|LOCUS_10550 17563 18534 gene locus_tag LOCUS_10560 17563 18534 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549788.1 protein_id gnl|my_center|LOCUS_10560 18527 19753 gene locus_tag LOCUS_10570 18527 19753 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549790.1 protein_id gnl|my_center|LOCUS_10570 19861 22152 gene locus_tag LOCUS_10580 19861 22152 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254583.1 protein_id gnl|my_center|LOCUS_10580 22288 22476 gene locus_tag LOCUS_10590 22288 22476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 22492 22707 gene locus_tag LOCUS_10600 22492 22707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 22774 22935 gene locus_tag LOCUS_10610 22774 22935 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081068.1 protein_id gnl|my_center|LOCUS_10610 22922 23428 gene locus_tag LOCUS_10620 22922 23428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 23502 24026 gene locus_tag LOCUS_10630 23502 24026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549769.1 protein_id gnl|my_center|LOCUS_10630 24042 24248 gene locus_tag LOCUS_10640 24042 24248 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549779.1 protein_id gnl|my_center|LOCUS_10640 24375 25289 gene locus_tag LOCUS_10650 gene pfkB 24375 25289 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549796.1 protein_id gnl|my_center|LOCUS_10650 25407 26198 gene locus_tag LOCUS_10660 25407 26198 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097421.1 protein_id gnl|my_center|LOCUS_10660 26293 27171 gene locus_tag LOCUS_10670 26293 27171 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254571.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence024 485 973 gene locus_tag LOCUS_10680 485 973 CDS product PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156967.1 protein_id gnl|my_center|LOCUS_10680 984 1904 gene locus_tag LOCUS_10690 984 1904 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357253.1 protein_id gnl|my_center|LOCUS_10690 1891 2709 gene locus_tag LOCUS_10700 1891 2709 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357254.1 protein_id gnl|my_center|LOCUS_10700 2730 3131 gene locus_tag LOCUS_10710 2730 3131 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836305.1 protein_id gnl|my_center|LOCUS_10710 3560 6238 gene locus_tag LOCUS_10720 gene mgtA 3560 6238 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548873.1 protein_id gnl|my_center|LOCUS_10720 6370 7407 gene locus_tag LOCUS_10730 6370 7407 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643716.1 protein_id gnl|my_center|LOCUS_10730 9477 7459 gene locus_tag LOCUS_10740 9477 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 9688 10683 gene locus_tag LOCUS_10750 9688 10683 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567744.1 protein_id gnl|my_center|LOCUS_10750 15373 10769 gene locus_tag LOCUS_10760 15373 10769 CDS product BspA family leucine-rich repeat surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549857.1 protein_id gnl|my_center|LOCUS_10760 15681 16256 gene locus_tag LOCUS_10770 15681 16256 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546208.1 protein_id gnl|my_center|LOCUS_10770 16494 18524 gene locus_tag LOCUS_10780 16494 18524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 19239 18658 gene locus_tag LOCUS_10790 19239 18658 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546204.1 protein_id gnl|my_center|LOCUS_10790 20279 19485 gene locus_tag LOCUS_10800 20279 19485 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549462.1 protein_id gnl|my_center|LOCUS_10800 20463 20534 gene locus_tag LOCUS_t00110 20463 20534 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 20648 21556 gene locus_tag LOCUS_10810 20648 21556 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548290.1 protein_id gnl|my_center|LOCUS_10810 21662 22432 gene locus_tag LOCUS_10820 21662 22432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 22487 22568 gene locus_tag LOCUS_t00120 22487 22568 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 22575 22647 gene locus_tag LOCUS_t00130 22575 22647 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 22662 22735 gene locus_tag LOCUS_t00140 22662 22735 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 22741 22814 gene locus_tag LOCUS_t00150 22741 22814 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 22835 22905 gene locus_tag LOCUS_t00160 22835 22905 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 22936 23021 gene locus_tag LOCUS_t00170 22936 23021 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 23136 24296 gene locus_tag LOCUS_10830 23136 24296 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550126.1 protein_id gnl|my_center|LOCUS_10830 24296 25339 gene locus_tag LOCUS_10840 24296 25339 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550128.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence025 311 78 gene locus_tag LOCUS_10850 311 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10850 3220 482 gene locus_tag LOCUS_10860 gene ppc 3220 482 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254335.1 protein_id gnl|my_center|LOCUS_10860 3583 4767 gene locus_tag LOCUS_10870 3583 4767 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_10870 5694 4828 gene locus_tag LOCUS_10880 5694 4828 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254320.1 protein_id gnl|my_center|LOCUS_10880 5802 6665 gene locus_tag LOCUS_10890 5802 6665 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547290.1 protein_id gnl|my_center|LOCUS_10890 6681 7550 gene locus_tag LOCUS_10900 6681 7550 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547292.1 protein_id gnl|my_center|LOCUS_10900 8264 7572 gene locus_tag LOCUS_10910 8264 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 8688 9674 gene locus_tag LOCUS_10920 8688 9674 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227818.1 protein_id gnl|my_center|LOCUS_10920 9822 10736 gene locus_tag LOCUS_10930 9822 10736 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964783.1 protein_id gnl|my_center|LOCUS_10930 10788 11432 gene locus_tag LOCUS_10940 10788 11432 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964782.1 protein_id gnl|my_center|LOCUS_10940 11413 12180 gene locus_tag LOCUS_10950 11413 12180 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964784.1 protein_id gnl|my_center|LOCUS_10950 12177 12821 gene locus_tag LOCUS_10960 12177 12821 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964785.1 protein_id gnl|my_center|LOCUS_10960 12802 13161 gene locus_tag LOCUS_10970 12802 13161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10970 13195 14121 gene locus_tag LOCUS_10980 13195 14121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10980 14556 15377 gene locus_tag LOCUS_10990 gene bltR 14556 15377 CDS product multidrug efflux transcriptional regulator BltR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229881.1 protein_id gnl|my_center|LOCUS_10990 15491 16417 gene locus_tag LOCUS_11000 15491 16417 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546465.1 protein_id gnl|my_center|LOCUS_11000 16472 18979 gene locus_tag LOCUS_11010 16472 18979 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254312.1 protein_id gnl|my_center|LOCUS_11010 19361 20743 gene locus_tag LOCUS_11020 gene brnQ 19361 20743 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254324.1 protein_id gnl|my_center|LOCUS_11020 21275 20784 gene locus_tag LOCUS_11030 21275 20784 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905994.1 protein_id gnl|my_center|LOCUS_11030 21361 21915 gene locus_tag LOCUS_11040 21361 21915 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642721.1 protein_id gnl|my_center|LOCUS_11040 22081 22566 gene locus_tag LOCUS_11050 22081 22566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 22878 23672 gene locus_tag LOCUS_11060 22878 23672 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475553.1 protein_id gnl|my_center|LOCUS_11060 23901 24983 gene locus_tag LOCUS_11070 23901 24983 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158181852.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence026 61 603 gene locus_tag LOCUS_11080 61 603 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254121.1 protein_id gnl|my_center|LOCUS_11080 603 1982 gene locus_tag LOCUS_11090 gene radA 603 1982 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549080.1 protein_id gnl|my_center|LOCUS_11090 2047 3552 gene locus_tag LOCUS_11100 gene gltX 2047 3552 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254122.1 protein_id gnl|my_center|LOCUS_11100 3647 5056 gene locus_tag LOCUS_11110 gene cysS 3647 5056 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549082.1 protein_id gnl|my_center|LOCUS_11110 5049 5489 gene locus_tag LOCUS_11120 5049 5489 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549083.1 protein_id gnl|my_center|LOCUS_11120 5476 6231 gene locus_tag LOCUS_11130 gene rlmB 5476 6231 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254123.1 protein_id gnl|my_center|LOCUS_11130 6246 6905 gene locus_tag LOCUS_11140 6246 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 7074 7637 gene locus_tag LOCUS_11150 7074 7637 CDS product DNA-directed RNA polymerase subunit sigma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254124.1 protein_id gnl|my_center|LOCUS_11150 7712 7927 gene locus_tag LOCUS_11160 7712 7927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549087.1 protein_id gnl|my_center|LOCUS_11160 8083 9588 gene locus_tag LOCUS_11170 8083 9588 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549089.1 protein_id gnl|my_center|LOCUS_11170 10764 9613 gene locus_tag LOCUS_11180 10764 9613 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966119.1 protein_id gnl|my_center|LOCUS_11180 12054 10837 gene locus_tag LOCUS_11190 12054 10837 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813994.1 protein_id gnl|my_center|LOCUS_11190 13193 12198 gene locus_tag LOCUS_11200 13193 12198 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002372605.1 protein_id gnl|my_center|LOCUS_11200 13743 13210 gene locus_tag LOCUS_11210 13743 13210 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567195.1 protein_id gnl|my_center|LOCUS_11210 14192 13740 gene locus_tag LOCUS_11220 14192 13740 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294810.1 protein_id gnl|my_center|LOCUS_11220 16166 14280 gene locus_tag LOCUS_11230 16166 14280 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588665.1 protein_id gnl|my_center|LOCUS_11230 16443 17366 gene locus_tag LOCUS_11240 16443 17366 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674851.1 protein_id gnl|my_center|LOCUS_11240 17428 18501 gene locus_tag LOCUS_11250 17428 18501 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644095.1 protein_id gnl|my_center|LOCUS_11250 18564 18713 gene locus_tag LOCUS_11260 gene rpmG 18564 18713 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549092.1 protein_id gnl|my_center|LOCUS_11260 18718 18888 gene locus_tag LOCUS_11270 gene secE 18718 18888 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549093.1 protein_id gnl|my_center|LOCUS_11270 18975 19526 gene locus_tag LOCUS_11280 gene nusG 18975 19526 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549094.1 protein_id gnl|my_center|LOCUS_11280 19648 20073 gene locus_tag LOCUS_11290 gene rplK 19648 20073 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549095.1 protein_id gnl|my_center|LOCUS_11290 20168 20860 gene locus_tag LOCUS_11300 gene rplA 20168 20860 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549096.1 protein_id gnl|my_center|LOCUS_11300 20994 21638 gene locus_tag LOCUS_11310 20994 21638 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641492.1 protein_id gnl|my_center|LOCUS_11310 21625 22281 gene locus_tag LOCUS_11320 21625 22281 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700465.1 protein_id gnl|my_center|LOCUS_11320 22278 23066 gene locus_tag LOCUS_11330 22278 23066 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674447.1 protein_id gnl|my_center|LOCUS_11330 23264 23764 gene locus_tag LOCUS_11340 gene rplJ 23264 23764 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549105.1 protein_id gnl|my_center|LOCUS_11340 23813 24175 gene locus_tag LOCUS_11350 gene rplL 23813 24175 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254128.1 protein_id gnl|my_center|LOCUS_11350 24274 25101 gene locus_tag LOCUS_11360 24274 25101 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549107.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence027 399 707 gene locus_tag LOCUS_11370 gene rpsJ 399 707 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549023.1 protein_id gnl|my_center|LOCUS_11370 735 1364 gene locus_tag LOCUS_11380 gene rplC 735 1364 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549024.1 protein_id gnl|my_center|LOCUS_11380 1379 1996 gene locus_tag LOCUS_11390 gene rplD 1379 1996 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549025.1 protein_id gnl|my_center|LOCUS_11390 1996 2295 gene locus_tag LOCUS_11400 gene rplW 1996 2295 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549026.1 protein_id gnl|my_center|LOCUS_11400 2312 3148 gene locus_tag LOCUS_11410 gene rplB 2312 3148 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254111.1 protein_id gnl|my_center|LOCUS_11410 3170 3457 gene locus_tag LOCUS_11420 gene rpsS 3170 3457 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638064.1 protein_id gnl|my_center|LOCUS_11420 3478 3831 gene locus_tag LOCUS_11430 gene rplV 3478 3831 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549029.1 protein_id gnl|my_center|LOCUS_11430 3846 4517 gene locus_tag LOCUS_11440 gene rpsC 3846 4517 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254113.1 protein_id gnl|my_center|LOCUS_11440 4520 4957 gene locus_tag LOCUS_11450 gene rplP 4520 4957 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549031.1 protein_id gnl|my_center|LOCUS_11450 4947 5144 gene locus_tag LOCUS_11460 gene rpmC 4947 5144 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549032.1 protein_id gnl|my_center|LOCUS_11460 5166 5432 gene locus_tag LOCUS_11470 gene rpsQ 5166 5432 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254114.1 protein_id gnl|my_center|LOCUS_11470 5466 5834 gene locus_tag LOCUS_11480 gene rplN 5466 5834 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549034.1 protein_id gnl|my_center|LOCUS_11480 5855 6100 gene locus_tag LOCUS_11490 5855 6100 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549035.1 protein_id gnl|my_center|LOCUS_11490 6115 6657 gene locus_tag LOCUS_11500 gene rplE 6115 6657 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549036.1 protein_id gnl|my_center|LOCUS_11500 6672 6857 gene locus_tag LOCUS_11510 6672 6857 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549037.1 protein_id gnl|my_center|LOCUS_11510 6881 7279 gene locus_tag LOCUS_11520 gene rpsH 6881 7279 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_11520 7304 7834 gene locus_tag LOCUS_11530 gene rplF 7304 7834 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549039.1 protein_id gnl|my_center|LOCUS_11530 7862 8221 gene locus_tag LOCUS_11540 gene rplR 7862 8221 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549040.1 protein_id gnl|my_center|LOCUS_11540 8239 8763 gene locus_tag LOCUS_11550 gene rpsE 8239 8763 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549041.1 protein_id gnl|my_center|LOCUS_11550 8777 8962 gene locus_tag LOCUS_11560 gene rpmD 8777 8962 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549042.1 protein_id gnl|my_center|LOCUS_11560 8987 9427 gene locus_tag LOCUS_11570 gene rplO 8987 9427 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549043.1 protein_id gnl|my_center|LOCUS_11570 9427 10722 gene locus_tag LOCUS_11580 gene secY 9427 10722 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549044.1 protein_id gnl|my_center|LOCUS_11580 10731 11384 gene locus_tag LOCUS_11590 10731 11384 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549045.1 protein_id gnl|my_center|LOCUS_11590 11458 11679 gene locus_tag LOCUS_11600 gene infA 11458 11679 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878178.1 protein_id gnl|my_center|LOCUS_11600 11842 12189 gene locus_tag LOCUS_11610 gene rpsM 11842 12189 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549046.1 protein_id gnl|my_center|LOCUS_11610 12207 12596 gene locus_tag LOCUS_11620 gene rpsK 12207 12596 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613292.1 protein_id gnl|my_center|LOCUS_11620 12642 13580 gene locus_tag LOCUS_11630 12642 13580 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549048.1 protein_id gnl|my_center|LOCUS_11630 13607 13990 gene locus_tag LOCUS_11640 gene rplQ 13607 13990 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549049.1 protein_id gnl|my_center|LOCUS_11640 14166 15014 gene locus_tag LOCUS_11650 14166 15014 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549050.1 protein_id gnl|my_center|LOCUS_11650 14990 15850 gene locus_tag LOCUS_11660 14990 15850 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549051.1 protein_id gnl|my_center|LOCUS_11660 15843 16640 gene locus_tag LOCUS_11670 15843 16640 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549052.1 protein_id gnl|my_center|LOCUS_11670 16655 17443 gene locus_tag LOCUS_11680 gene truA 16655 17443 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549053.1 protein_id gnl|my_center|LOCUS_11680 17545 17988 gene locus_tag LOCUS_11690 gene rplM 17545 17988 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549054.1 protein_id gnl|my_center|LOCUS_11690 18002 18397 gene locus_tag LOCUS_11700 gene rpsI 18002 18397 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549055.1 protein_id gnl|my_center|LOCUS_11700 18736 18945 gene locus_tag LOCUS_11710 18736 18945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11710 19147 19284 gene locus_tag LOCUS_11720 19147 19284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11720 19492 20139 gene locus_tag LOCUS_11730 19492 20139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 20126 20620 gene locus_tag LOCUS_11740 20126 20620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178084644.1 protein_id gnl|my_center|LOCUS_11740 21028 22617 gene locus_tag LOCUS_11750 21028 22617 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548575.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence028 184 468 gene locus_tag LOCUS_11760 184 468 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101001.1 protein_id gnl|my_center|LOCUS_11760 487 786 gene locus_tag LOCUS_11770 487 786 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646479.1 protein_id gnl|my_center|LOCUS_11770 880 1707 gene locus_tag LOCUS_11780 880 1707 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549252.1 protein_id gnl|my_center|LOCUS_11780 1720 2580 gene locus_tag LOCUS_11790 1720 2580 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824466.1 protein_id gnl|my_center|LOCUS_11790 2676 5504 gene locus_tag LOCUS_11800 2676 5504 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254017.1 protein_id gnl|my_center|LOCUS_11800 5812 8118 gene locus_tag LOCUS_11810 5812 8118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 8514 11588 gene locus_tag LOCUS_11820 8514 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 13451 11694 gene locus_tag LOCUS_11830 13451 11694 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549091.1 protein_id gnl|my_center|LOCUS_11830 13617 14501 gene locus_tag LOCUS_11840 13617 14501 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262269.1 protein_id gnl|my_center|LOCUS_11840 14589 15446 gene locus_tag LOCUS_11850 14589 15446 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254321.1 protein_id gnl|my_center|LOCUS_11850 15686 15474 gene locus_tag LOCUS_11860 15686 15474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 15835 16890 gene locus_tag LOCUS_11870 15835 16890 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549287.1 protein_id gnl|my_center|LOCUS_11870 17130 18656 gene locus_tag LOCUS_11880 17130 18656 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_11880 20432 18834 gene locus_tag LOCUS_11890 20432 18834 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288026.1 protein_id gnl|my_center|LOCUS_11890 <21448 20600 gene locus_tag LOCUS_11900 <21448 20600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015613274.1:D-2-hydroxyacid dehydrogenase >Feature sequence029 2723 189 gene locus_tag LOCUS_11910 2723 189 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476508.1 protein_id gnl|my_center|LOCUS_11910 3485 2733 gene locus_tag LOCUS_11920 3485 2733 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549550.1 protein_id gnl|my_center|LOCUS_11920 3735 5264 gene locus_tag LOCUS_11930 3735 5264 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549809.1 protein_id gnl|my_center|LOCUS_11930 5462 5387 gene locus_tag LOCUS_t00180 5462 5387 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5842 5522 gene locus_tag LOCUS_11940 5842 5522 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641143.1 protein_id gnl|my_center|LOCUS_11940 8487 5953 gene locus_tag LOCUS_11950 8487 5953 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101213.1 protein_id gnl|my_center|LOCUS_11950 8659 11043 gene locus_tag LOCUS_11960 8659 11043 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548011.1 protein_id gnl|my_center|LOCUS_11960 11533 11120 gene locus_tag LOCUS_11970 11533 11120 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548115.1 protein_id gnl|my_center|LOCUS_11970 13192 11645 gene locus_tag LOCUS_11980 13192 11645 CDS product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289765.1 protein_id gnl|my_center|LOCUS_11980 14156 13185 gene locus_tag LOCUS_11990 14156 13185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905586.1 protein_id gnl|my_center|LOCUS_11990 15041 14226 gene locus_tag LOCUS_12000 15041 14226 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254431.1 protein_id gnl|my_center|LOCUS_12000 16237 15062 gene locus_tag LOCUS_12010 16237 15062 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548117.1 protein_id gnl|my_center|LOCUS_12010 20780 16356 gene locus_tag LOCUS_12020 20780 16356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence030 1443 640 gene locus_tag LOCUS_12030 1443 640 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546626.1 protein_id gnl|my_center|LOCUS_12030 2572 1445 gene locus_tag LOCUS_12040 2572 1445 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546625.1 protein_id gnl|my_center|LOCUS_12040 3520 2615 gene locus_tag LOCUS_12050 gene murB 3520 2615 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546624.1 protein_id gnl|my_center|LOCUS_12050 3625 4158 gene locus_tag LOCUS_12060 3625 4158 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546623.1 protein_id gnl|my_center|LOCUS_12060 4655 4176 gene locus_tag LOCUS_12070 gene tsaE 4655 4176 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546616.1 protein_id gnl|my_center|LOCUS_12070 5634 4660 gene locus_tag LOCUS_12080 gene pta 5634 4660 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641060.1 protein_id gnl|my_center|LOCUS_12080 6388 5693 gene locus_tag LOCUS_12090 6388 5693 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546612.1 protein_id gnl|my_center|LOCUS_12090 6464 7330 gene locus_tag LOCUS_12100 6464 7330 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546611.1 protein_id gnl|my_center|LOCUS_12100 7332 7844 gene locus_tag LOCUS_12110 7332 7844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254226.1 protein_id gnl|my_center|LOCUS_12110 8431 7841 gene locus_tag LOCUS_12120 8431 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 9097 8531 gene locus_tag LOCUS_12130 9097 8531 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254542.1 protein_id gnl|my_center|LOCUS_12130 9558 9100 gene locus_tag LOCUS_12140 gene smpB 9558 9100 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550138.1 protein_id gnl|my_center|LOCUS_12140 11821 9569 gene locus_tag LOCUS_12150 gene rnr 11821 9569 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550136.1 protein_id gnl|my_center|LOCUS_12150 12209 11976 gene locus_tag LOCUS_12160 12209 11976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 13729 12431 gene locus_tag LOCUS_12170 gene eno 13729 12431 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564271.1 protein_id gnl|my_center|LOCUS_12170 14537 13782 gene locus_tag LOCUS_12180 gene tpiA 14537 13782 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546605.1 protein_id gnl|my_center|LOCUS_12180 15771 14557 gene locus_tag LOCUS_12190 15771 14557 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546602.1 protein_id gnl|my_center|LOCUS_12190 16891 15875 gene locus_tag LOCUS_12200 gene gap 16891 15875 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546601.1 protein_id gnl|my_center|LOCUS_12200 17974 16943 gene locus_tag LOCUS_12210 17974 16943 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546600.1 protein_id gnl|my_center|LOCUS_12210 18204 18277 gene locus_tag LOCUS_t00190 18204 18277 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18484 19068 gene locus_tag LOCUS_12220 gene clpP 18484 19068 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546597.1 protein_id gnl|my_center|LOCUS_12220 <19795 19111 gene locus_tag LOCUS_12230 <19795 19111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546596.1:DNA-binding protein WhiA >Feature sequence031 414 1277 gene locus_tag LOCUS_12240 414 1277 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254320.1 protein_id gnl|my_center|LOCUS_12240 2620 1361 gene locus_tag LOCUS_12250 2620 1361 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101454.1 protein_id gnl|my_center|LOCUS_12250 3193 2636 gene locus_tag LOCUS_12260 3193 2636 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254344.1 protein_id gnl|my_center|LOCUS_12260 4327 3308 gene locus_tag LOCUS_12270 4327 3308 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263364.1 protein_id gnl|my_center|LOCUS_12270 4876 4331 gene locus_tag LOCUS_12280 4876 4331 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_12280 5348 7096 gene locus_tag LOCUS_12290 5348 7096 CDS product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547891.1 protein_id gnl|my_center|LOCUS_12290 7256 8482 gene locus_tag LOCUS_12300 7256 8482 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254359.1 protein_id gnl|my_center|LOCUS_12300 9235 8489 gene locus_tag LOCUS_12310 9235 8489 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644056.1 protein_id gnl|my_center|LOCUS_12310 9522 9379 gene locus_tag LOCUS_12320 9522 9379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 9830 9597 gene locus_tag LOCUS_12330 9830 9597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254332.1 protein_id gnl|my_center|LOCUS_12330 13406 9963 gene locus_tag LOCUS_12340 gene pulA 13406 9963 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549917.1 protein_id gnl|my_center|LOCUS_12340 14393 13572 gene locus_tag LOCUS_12350 14393 13572 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_12350 15219 14527 gene locus_tag LOCUS_12360 15219 14527 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701796.1 protein_id gnl|my_center|LOCUS_12360 15379 15212 gene locus_tag LOCUS_12370 15379 15212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 17111 15345 gene locus_tag LOCUS_12380 17111 15345 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546396.1 protein_id gnl|my_center|LOCUS_12380 17639 17205 gene locus_tag LOCUS_12390 17639 17205 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546394.1 protein_id gnl|my_center|LOCUS_12390 17843 18334 gene locus_tag LOCUS_12400 gene tpx 17843 18334 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547331.1 protein_id gnl|my_center|LOCUS_12400 18741 19148 gene locus_tag LOCUS_12410 18741 19148 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475679.1 protein_id gnl|my_center|LOCUS_12410 19161 19493 gene locus_tag LOCUS_12420 19161 19493 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355924.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence032 1138 320 gene locus_tag LOCUS_12430 1138 320 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563836.1 protein_id gnl|my_center|LOCUS_12430 2960 1191 gene locus_tag LOCUS_12440 2960 1191 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254194.1 protein_id gnl|my_center|LOCUS_12440 4725 2953 gene locus_tag LOCUS_12450 4725 2953 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254193.1 protein_id gnl|my_center|LOCUS_12450 5132 4683 gene locus_tag LOCUS_12460 5132 4683 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254192.1 protein_id gnl|my_center|LOCUS_12460 5936 5289 gene locus_tag LOCUS_12470 5936 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 6097 5924 gene locus_tag LOCUS_12480 6097 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 7814 6072 gene locus_tag LOCUS_12490 7814 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 8088 7819 gene locus_tag LOCUS_12500 8088 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 8468 8103 gene locus_tag LOCUS_12510 8468 8103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 8885 8472 gene locus_tag LOCUS_12520 8885 8472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 13317 8905 gene locus_tag LOCUS_12530 gene essC 13317 8905 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966969.1 protein_id gnl|my_center|LOCUS_12530 14485 13298 gene locus_tag LOCUS_12540 14485 13298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 14740 14489 gene locus_tag LOCUS_12550 14740 14489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 15248 14727 gene locus_tag LOCUS_12560 15248 14727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 18288 15235 gene locus_tag LOCUS_12570 gene esaA 18288 15235 CDS product type VII secretion protein EsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989329.1 protein_id gnl|my_center|LOCUS_12570 18675 18379 gene locus_tag LOCUS_12580 18675 18379 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966973.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence033 <1 4951 gene locus_tag LOCUS_12590 <1 4951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011475661.1:tape measure protein 4962 5693 gene locus_tag LOCUS_12600 4962 5693 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109514.1 protein_id gnl|my_center|LOCUS_12600 5693 8599 gene locus_tag LOCUS_12610 5693 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 8608 8811 gene locus_tag LOCUS_12620 8608 8811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 8777 11413 gene locus_tag LOCUS_12630 8777 11413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 11420 11746 gene locus_tag LOCUS_12640 11420 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 11743 12069 gene locus_tag LOCUS_12650 11743 12069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 12059 12454 gene locus_tag LOCUS_12660 12059 12454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 12451 12801 gene locus_tag LOCUS_12670 12451 12801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 12847 13347 gene locus_tag LOCUS_12680 12847 13347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 13456 13920 gene locus_tag LOCUS_12690 13456 13920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 13920 14090 gene locus_tag LOCUS_12700 13920 14090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 14038 14478 gene locus_tag LOCUS_12710 14038 14478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 14491 14754 gene locus_tag LOCUS_12720 14491 14754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 14741 14902 gene locus_tag LOCUS_12730 14741 14902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 14895 15428 gene locus_tag LOCUS_12740 14895 15428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 15473 16558 gene locus_tag LOCUS_12750 15473 16558 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254350.1 protein_id gnl|my_center|LOCUS_12750 16716 16919 gene locus_tag LOCUS_12760 16716 16919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 16935 18794 gene locus_tag LOCUS_12770 16935 18794 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674071.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence034 157 1230 gene locus_tag LOCUS_12780 157 1230 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546630.1 protein_id gnl|my_center|LOCUS_12780 1273 2118 gene locus_tag LOCUS_12790 gene cdaA 1273 2118 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254229.1 protein_id gnl|my_center|LOCUS_12790 2115 3089 gene locus_tag LOCUS_12800 2115 3089 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546633.1 protein_id gnl|my_center|LOCUS_12800 3126 4484 gene locus_tag LOCUS_12810 gene glmM 3126 4484 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546635.1 protein_id gnl|my_center|LOCUS_12810 5869 4544 gene locus_tag LOCUS_12820 5869 4544 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714165.1 protein_id gnl|my_center|LOCUS_12820 7539 5893 gene locus_tag LOCUS_12830 7539 5893 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 protein_id gnl|my_center|LOCUS_12830 8125 9936 gene locus_tag LOCUS_12840 gene glmS 8125 9936 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546133.1 protein_id gnl|my_center|LOCUS_12840 10007 10816 gene locus_tag LOCUS_12850 10007 10816 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546639.1 protein_id gnl|my_center|LOCUS_12850 10816 11205 gene locus_tag LOCUS_12860 10816 11205 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254309.1 protein_id gnl|my_center|LOCUS_12860 11206 11559 gene locus_tag LOCUS_12870 gene crcB 11206 11559 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547161.1 protein_id gnl|my_center|LOCUS_12870 12813 11584 gene locus_tag LOCUS_12880 12813 11584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 12887 13405 gene locus_tag LOCUS_12890 12887 13405 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254234.1 protein_id gnl|my_center|LOCUS_12890 13466 14569 gene locus_tag LOCUS_12900 13466 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 14649 15377 gene locus_tag LOCUS_12910 14649 15377 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546668.1 protein_id gnl|my_center|LOCUS_12910 15504 16484 gene locus_tag LOCUS_12920 gene comGA 15504 16484 CDS product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546670.1 protein_id gnl|my_center|LOCUS_12920 16450 17451 gene locus_tag LOCUS_12930 16450 17451 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721297.1 protein_id gnl|my_center|LOCUS_12930 17463 17789 gene locus_tag LOCUS_12940 17463 17789 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475747.1 protein_id gnl|my_center|LOCUS_12940 17794 18201 gene locus_tag LOCUS_12950 17794 18201 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546675.1 protein_id gnl|my_center|LOCUS_12950 18194 18403 gene locus_tag LOCUS_12960 18194 18403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 18384 18974 gene locus_tag LOCUS_12970 18384 18974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence035 1044 406 gene locus_tag LOCUS_12980 1044 406 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644620.1 protein_id gnl|my_center|LOCUS_12980 1257 1048 gene locus_tag LOCUS_12990 1257 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1993 2229 gene locus_tag LOCUS_13000 1993 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 3201 2284 gene locus_tag LOCUS_13010 gene htpX 3201 2284 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254032.1 protein_id gnl|my_center|LOCUS_13010 3320 4474 gene locus_tag LOCUS_13020 3320 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 5656 4514 gene locus_tag LOCUS_13030 5656 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 6025 5672 gene locus_tag LOCUS_13040 6025 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 6758 6039 gene locus_tag LOCUS_13050 6758 6039 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254276.1 protein_id gnl|my_center|LOCUS_13050 6888 8246 gene locus_tag LOCUS_13060 6888 8246 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546946.1 protein_id gnl|my_center|LOCUS_13060 8262 9596 gene locus_tag LOCUS_13070 8262 9596 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097450.1 protein_id gnl|my_center|LOCUS_13070 11626 9683 gene locus_tag LOCUS_13080 11626 9683 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547843.1 protein_id gnl|my_center|LOCUS_13080 12609 11758 gene locus_tag LOCUS_13090 12609 11758 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547408.1 protein_id gnl|my_center|LOCUS_13090 13265 12609 gene locus_tag LOCUS_13100 13265 12609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547406.1 protein_id gnl|my_center|LOCUS_13100 13994 13368 gene locus_tag LOCUS_13110 13994 13368 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547344.1 protein_id gnl|my_center|LOCUS_13110 14699 14049 gene locus_tag LOCUS_13120 14699 14049 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549576.1 protein_id gnl|my_center|LOCUS_13120 14828 15931 gene locus_tag LOCUS_13130 14828 15931 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201247873.1 protein_id gnl|my_center|LOCUS_13130 16513 15950 gene locus_tag LOCUS_13140 16513 15950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 18392 16617 gene locus_tag LOCUS_13150 gene recQ 18392 16617 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547178.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence036 1819 95 gene locus_tag LOCUS_13160 1819 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476559.1 protein_id gnl|my_center|LOCUS_13160 2347 1820 gene locus_tag LOCUS_13170 2347 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 2915 2334 gene locus_tag LOCUS_13180 2915 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 3356 2925 gene locus_tag LOCUS_13190 3356 2925 CDS product RinA family phage transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379371.1 protein_id gnl|my_center|LOCUS_13190 5585 5055 gene locus_tag LOCUS_13200 5585 5055 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047623.1 protein_id gnl|my_center|LOCUS_13200 5979 5575 gene locus_tag LOCUS_13210 5979 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 6655 5984 gene locus_tag LOCUS_13220 6655 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 7517 6648 gene locus_tag LOCUS_13230 7517 6648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13230 8388 7792 gene locus_tag LOCUS_13240 8388 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 8918 8586 gene locus_tag LOCUS_13250 8918 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 9162 8908 gene locus_tag LOCUS_13260 9162 8908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 9453 9187 gene locus_tag LOCUS_13270 9453 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 9696 9511 gene locus_tag LOCUS_13280 9696 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 10011 9709 gene locus_tag LOCUS_13290 10011 9709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 10557 10012 gene locus_tag LOCUS_13300 10557 10012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 10764 10594 gene locus_tag LOCUS_13310 10764 10594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 11201 10797 gene locus_tag LOCUS_13320 11201 10797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 11862 11185 gene locus_tag LOCUS_13330 11862 11185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 12143 11865 gene locus_tag LOCUS_13340 12143 11865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 12412 12146 gene locus_tag LOCUS_13350 12412 12146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 12649 12416 gene locus_tag LOCUS_13360 12649 12416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 13231 12668 gene locus_tag LOCUS_13370 13231 12668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 13559 13281 gene locus_tag LOCUS_13380 13559 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 13807 13562 gene locus_tag LOCUS_13390 13807 13562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 14099 13797 gene locus_tag LOCUS_13400 14099 13797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 14377 14102 gene locus_tag LOCUS_13410 14377 14102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 14651 14367 gene locus_tag LOCUS_13420 14651 14367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 14896 14651 gene locus_tag LOCUS_13430 14896 14651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 15452 15234 gene locus_tag LOCUS_13440 15452 15234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 15842 15579 gene locus_tag LOCUS_13450 15842 15579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 16320 15853 gene locus_tag LOCUS_13460 gene ssb 16320 15853 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365911.1 protein_id gnl|my_center|LOCUS_13460 16702 16313 gene locus_tag LOCUS_13470 16702 16313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 16856 16695 gene locus_tag LOCUS_13480 16856 16695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence037 459 274 gene locus_tag LOCUS_13490 gene rpmB 459 274 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694225.1 protein_id gnl|my_center|LOCUS_13490 642 1004 gene locus_tag LOCUS_13500 642 1004 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547910.1 protein_id gnl|my_center|LOCUS_13500 1027 2691 gene locus_tag LOCUS_13510 1027 2691 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547907.1 protein_id gnl|my_center|LOCUS_13510 2695 4743 gene locus_tag LOCUS_13520 gene recG 2695 4743 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254414.1 protein_id gnl|my_center|LOCUS_13520 4762 5766 gene locus_tag LOCUS_13530 gene plsX 4762 5766 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547901.1 protein_id gnl|my_center|LOCUS_13530 5819 6061 gene locus_tag LOCUS_13540 gene acpP 5819 6061 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640376.1 protein_id gnl|my_center|LOCUS_13540 6216 7223 gene locus_tag LOCUS_13550 6216 7223 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547898.1 protein_id gnl|my_center|LOCUS_13550 7234 8202 gene locus_tag LOCUS_13560 7234 8202 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547895.1 protein_id gnl|my_center|LOCUS_13560 8205 9164 gene locus_tag LOCUS_13570 8205 9164 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547894.1 protein_id gnl|my_center|LOCUS_13570 9181 10095 gene locus_tag LOCUS_13580 9181 10095 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547893.1 protein_id gnl|my_center|LOCUS_13580 10596 10369 gene locus_tag LOCUS_13590 10596 10369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 10645 11394 gene locus_tag LOCUS_13600 10645 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 11416 12282 gene locus_tag LOCUS_13610 11416 12282 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549864.1 protein_id gnl|my_center|LOCUS_13610 12296 13057 gene locus_tag LOCUS_13620 12296 13057 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549866.1 protein_id gnl|my_center|LOCUS_13620 13060 13830 gene locus_tag LOCUS_13630 13060 13830 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549867.1 protein_id gnl|my_center|LOCUS_13630 13854 14510 gene locus_tag LOCUS_13640 13854 14510 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721391.1 protein_id gnl|my_center|LOCUS_13640 14565 15728 gene locus_tag LOCUS_13650 14565 15728 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039851544.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence038 1040 36 gene locus_tag LOCUS_13660 1040 36 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642835.1 protein_id gnl|my_center|LOCUS_13660 2557 1097 gene locus_tag LOCUS_13670 2557 1097 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643568.1 protein_id gnl|my_center|LOCUS_13670 2755 3642 gene locus_tag LOCUS_13680 2755 3642 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548278.1 protein_id gnl|my_center|LOCUS_13680 3658 4749 gene locus_tag LOCUS_13690 3658 4749 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547773.1 protein_id gnl|my_center|LOCUS_13690 4875 5528 gene locus_tag LOCUS_13700 4875 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 6434 5553 gene locus_tag LOCUS_13710 6434 5553 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254353.1 protein_id gnl|my_center|LOCUS_13710 7002 6538 gene locus_tag LOCUS_13720 7002 6538 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254354.1 protein_id gnl|my_center|LOCUS_13720 7202 8893 gene locus_tag LOCUS_13730 7202 8893 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547519.1 protein_id gnl|my_center|LOCUS_13730 12117 8953 gene locus_tag LOCUS_13740 12117 8953 CDS product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254355.1 protein_id gnl|my_center|LOCUS_13740 13176 12121 gene locus_tag LOCUS_13750 13176 12121 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547524.1 protein_id gnl|my_center|LOCUS_13750 14106 13195 gene locus_tag LOCUS_13760 14106 13195 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254356.1 protein_id gnl|my_center|LOCUS_13760 14581 14108 gene locus_tag LOCUS_13770 gene lspA 14581 14108 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613370.1 protein_id gnl|my_center|LOCUS_13770 16254 14581 gene locus_tag LOCUS_13780 16254 14581 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254358.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence039 341 1468 gene locus_tag LOCUS_13790 341 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1579 2388 gene locus_tag LOCUS_13800 gene yidA 1579 2388 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547047.1 protein_id gnl|my_center|LOCUS_13800 2490 2669 gene locus_tag LOCUS_13810 2490 2669 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547962.1 protein_id gnl|my_center|LOCUS_13810 2669 3124 gene locus_tag LOCUS_13820 2669 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 3392 4732 gene locus_tag LOCUS_13830 3392 4732 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254421.1 protein_id gnl|my_center|LOCUS_13830 4805 5644 gene locus_tag LOCUS_13840 4805 5644 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547954.1 protein_id gnl|my_center|LOCUS_13840 5995 5639 gene locus_tag LOCUS_13850 5995 5639 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254429.1 protein_id gnl|my_center|LOCUS_13850 6265 6576 gene locus_tag LOCUS_13860 gene rplU 6265 6576 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_13860 6596 6895 gene locus_tag LOCUS_13870 gene rpmA 6596 6895 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254420.1 protein_id gnl|my_center|LOCUS_13870 6962 8071 gene locus_tag LOCUS_13880 6962 8071 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547949.1 protein_id gnl|my_center|LOCUS_13880 8155 8724 gene locus_tag LOCUS_13890 gene efp 8155 8724 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547948.1 protein_id gnl|my_center|LOCUS_13890 8744 9175 gene locus_tag LOCUS_13900 8744 9175 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547946.1 protein_id gnl|my_center|LOCUS_13900 9175 9576 gene locus_tag LOCUS_13910 gene nusB 9175 9576 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547945.1 protein_id gnl|my_center|LOCUS_13910 9622 10470 gene locus_tag LOCUS_13920 9622 10470 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547942.1 protein_id gnl|my_center|LOCUS_13920 10463 11812 gene locus_tag LOCUS_13930 gene xseA 10463 11812 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547941.1 protein_id gnl|my_center|LOCUS_13930 11814 12059 gene locus_tag LOCUS_13940 11814 12059 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547938.1 protein_id gnl|my_center|LOCUS_13940 12059 12928 gene locus_tag LOCUS_13950 12059 12928 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547935.1 protein_id gnl|my_center|LOCUS_13950 12928 13740 gene locus_tag LOCUS_13960 12928 13740 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547933.1 protein_id gnl|my_center|LOCUS_13960 13750 15438 gene locus_tag LOCUS_13970 gene recN 13750 15438 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547931.1 protein_id gnl|my_center|LOCUS_13970 15890 15492 gene locus_tag LOCUS_13980 15890 15492 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546185.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence040 349 92 gene locus_tag LOCUS_13990 349 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 822 637 gene locus_tag LOCUS_14000 822 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 858 2246 gene locus_tag LOCUS_14010 858 2246 CDS product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254371.1 protein_id gnl|my_center|LOCUS_14010 3305 2274 gene locus_tag LOCUS_14020 gene fni 3305 2274 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254369.1 protein_id gnl|my_center|LOCUS_14020 4394 3318 gene locus_tag LOCUS_14030 4394 3318 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254368.1 protein_id gnl|my_center|LOCUS_14030 5395 4421 gene locus_tag LOCUS_14040 gene mvaD 5395 4421 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547574.1 protein_id gnl|my_center|LOCUS_14040 6315 5395 gene locus_tag LOCUS_14050 gene mvk 6315 5395 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547572.1 protein_id gnl|my_center|LOCUS_14050 6382 9855 gene locus_tag LOCUS_14060 6382 9855 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254367.1 protein_id gnl|my_center|LOCUS_14060 9857 13462 gene locus_tag LOCUS_14070 gene addA 9857 13462 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254366.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence041 115 1029 gene locus_tag LOCUS_14080 115 1029 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674841.1 protein_id gnl|my_center|LOCUS_14080 2478 1084 gene locus_tag LOCUS_14090 2478 1084 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 protein_id gnl|my_center|LOCUS_14090 2893 2465 gene locus_tag LOCUS_14100 2893 2465 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130017.1 protein_id gnl|my_center|LOCUS_14100 4443 3028 gene locus_tag LOCUS_14110 4443 3028 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641669.1 protein_id gnl|my_center|LOCUS_14110 6281 4467 gene locus_tag LOCUS_14120 6281 4467 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100862.1 protein_id gnl|my_center|LOCUS_14120 6599 7474 gene locus_tag LOCUS_14130 6599 7474 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643641.1 protein_id gnl|my_center|LOCUS_14130 9253 7475 gene locus_tag LOCUS_14140 9253 7475 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101224.1 protein_id gnl|my_center|LOCUS_14140 9452 10336 gene locus_tag LOCUS_14150 9452 10336 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643641.1 protein_id gnl|my_center|LOCUS_14150 11702 10374 gene locus_tag LOCUS_14160 11702 10374 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476236.1 protein_id gnl|my_center|LOCUS_14160 12008 11787 gene locus_tag LOCUS_14170 12008 11787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 12409 13734 gene locus_tag LOCUS_14180 12409 13734 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548393.1 protein_id gnl|my_center|LOCUS_14180 14099 13776 gene locus_tag LOCUS_14190 14099 13776 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565641.1 protein_id gnl|my_center|LOCUS_14190 <15495 14100 gene locus_tag LOCUS_14200 <15495 14100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014567504.1:Fe-S cluster assembly protein SufB >Feature sequence042 58 732 gene locus_tag LOCUS_14210 58 732 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547719.1 protein_id gnl|my_center|LOCUS_14210 1616 777 gene locus_tag LOCUS_14220 1616 777 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547712.1 protein_id gnl|my_center|LOCUS_14220 1773 1949 gene locus_tag LOCUS_14230 gene rpsU 1773 1949 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002880182.1 protein_id gnl|my_center|LOCUS_14230 2049 2492 gene locus_tag LOCUS_14240 2049 2492 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547630.1 protein_id gnl|my_center|LOCUS_14240 2513 3472 gene locus_tag LOCUS_14250 2513 3472 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254379.1 protein_id gnl|my_center|LOCUS_14250 3472 3999 gene locus_tag LOCUS_14260 gene ybeY 3472 3999 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547628.1 protein_id gnl|my_center|LOCUS_14260 4061 4963 gene locus_tag LOCUS_14270 gene era 4061 4963 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254378.1 protein_id gnl|my_center|LOCUS_14270 4963 5715 gene locus_tag LOCUS_14280 gene recO 4963 5715 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547622.1 protein_id gnl|my_center|LOCUS_14280 5975 6892 gene locus_tag LOCUS_14290 gene glyQ 5975 6892 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547621.1 protein_id gnl|my_center|LOCUS_14290 6885 8957 gene locus_tag LOCUS_14300 gene glyS 6885 8957 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547620.1 protein_id gnl|my_center|LOCUS_14300 8977 10791 gene locus_tag LOCUS_14310 gene dnaG 8977 10791 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547619.1 protein_id gnl|my_center|LOCUS_14310 10806 11945 gene locus_tag LOCUS_14320 gene rpoD 10806 11945 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254377.1 protein_id gnl|my_center|LOCUS_14320 12019 12702 gene locus_tag LOCUS_14330 12019 12702 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547613.1 protein_id gnl|my_center|LOCUS_14330 12699 13496 gene locus_tag LOCUS_14340 12699 13496 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547612.1 protein_id gnl|my_center|LOCUS_14340 13509 14756 gene locus_tag LOCUS_14350 gene pepT 13509 14756 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547606.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence043 171 662 gene locus_tag LOCUS_14360 171 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 923 6682 gene locus_tag LOCUS_14370 923 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 8246 6753 gene locus_tag LOCUS_14380 gene cls 8246 6753 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547770.1 protein_id gnl|my_center|LOCUS_14380 8405 9358 gene locus_tag LOCUS_14390 8405 9358 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546979.1 protein_id gnl|my_center|LOCUS_14390 9368 9871 gene locus_tag LOCUS_14400 9368 9871 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475879.1 protein_id gnl|my_center|LOCUS_14400 10090 12177 gene locus_tag LOCUS_14410 gene ppsA 10090 12177 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646028.1 protein_id gnl|my_center|LOCUS_14410 12339 12485 gene locus_tag LOCUS_14420 12339 12485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14420 12504 13139 gene locus_tag LOCUS_14430 12504 13139 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549206.1 protein_id gnl|my_center|LOCUS_14430 14013 13216 gene locus_tag LOCUS_14440 14013 13216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence044 103 1152 gene locus_tag LOCUS_14450 gene pheS 103 1152 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548296.1 protein_id gnl|my_center|LOCUS_14450 1152 3566 gene locus_tag LOCUS_14460 gene pheT 1152 3566 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548294.1 protein_id gnl|my_center|LOCUS_14460 3608 4705 gene locus_tag LOCUS_14470 gene mltG 3608 4705 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564593.1 protein_id gnl|my_center|LOCUS_14470 4781 5269 gene locus_tag LOCUS_14480 gene greA 4781 5269 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548292.1 protein_id gnl|my_center|LOCUS_14480 6654 5299 gene locus_tag LOCUS_14490 6654 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 6725 6922 gene locus_tag LOCUS_14500 6725 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 7943 10048 gene locus_tag LOCUS_14510 7943 10048 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254485.1 protein_id gnl|my_center|LOCUS_14510 10124 10273 gene locus_tag LOCUS_14520 gene rpmG 10124 10273 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548272.1 protein_id gnl|my_center|LOCUS_14520 10310 10870 gene locus_tag LOCUS_14530 10310 10870 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548253.1 protein_id gnl|my_center|LOCUS_14530 10885 11568 gene locus_tag LOCUS_14540 10885 11568 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254484.1 protein_id gnl|my_center|LOCUS_14540 11568 11783 gene locus_tag LOCUS_14550 11568 11783 CDS product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548250.1 protein_id gnl|my_center|LOCUS_14550 11836 12237 gene locus_tag LOCUS_14560 11836 12237 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548248.1 protein_id gnl|my_center|LOCUS_14560 12467 12288 gene locus_tag LOCUS_14570 12467 12288 CDS product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564621.1 protein_id gnl|my_center|LOCUS_14570 12614 13537 gene locus_tag LOCUS_14580 gene miaA 12614 13537 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548247.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence045 265 3324 gene locus_tag LOCUS_14590 265 3324 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548741.1 protein_id gnl|my_center|LOCUS_14590 4235 3411 gene locus_tag LOCUS_14600 4235 3411 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254053.1 protein_id gnl|my_center|LOCUS_14600 5030 4269 gene locus_tag LOCUS_14610 5030 4269 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548732.1 protein_id gnl|my_center|LOCUS_14610 6138 5032 gene locus_tag LOCUS_14620 6138 5032 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548730.1 protein_id gnl|my_center|LOCUS_14620 6222 7799 gene locus_tag LOCUS_14630 6222 7799 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824470.1 protein_id gnl|my_center|LOCUS_14630 8580 7828 gene locus_tag LOCUS_14640 8580 7828 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254052.1 protein_id gnl|my_center|LOCUS_14640 9685 8600 gene locus_tag LOCUS_14650 9685 8600 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548727.1 protein_id gnl|my_center|LOCUS_14650 9842 11353 gene locus_tag LOCUS_14660 9842 11353 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254051.1 protein_id gnl|my_center|LOCUS_14660 12468 11635 gene locus_tag LOCUS_14670 12468 11635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548717.1 protein_id gnl|my_center|LOCUS_14670 13152 12472 gene locus_tag LOCUS_14680 13152 12472 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254049.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence046 67 1428 gene locus_tag LOCUS_14690 67 1428 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460717.1 protein_id gnl|my_center|LOCUS_14690 4317 1585 gene locus_tag LOCUS_14700 4317 1585 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674291.1 protein_id gnl|my_center|LOCUS_14700 5809 4412 gene locus_tag LOCUS_14710 gene pepV 5809 4412 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547162.1 protein_id gnl|my_center|LOCUS_14710 7210 5837 gene locus_tag LOCUS_14720 7210 5837 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549215.1 protein_id gnl|my_center|LOCUS_14720 7309 7641 gene locus_tag LOCUS_14730 7309 7641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613308.1 protein_id gnl|my_center|LOCUS_14730 7645 8088 gene locus_tag LOCUS_14740 7645 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14740 8098 9015 gene locus_tag LOCUS_14750 8098 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14750 9017 9568 gene locus_tag LOCUS_14760 9017 9568 CDS product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549221.1 protein_id gnl|my_center|LOCUS_14760 9565 10341 gene locus_tag LOCUS_14770 9565 10341 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549224.1 protein_id gnl|my_center|LOCUS_14770 10338 10943 gene locus_tag LOCUS_14780 10338 10943 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254154.1 protein_id gnl|my_center|LOCUS_14780 11627 10977 gene locus_tag LOCUS_14790 11627 10977 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549229.1 protein_id gnl|my_center|LOCUS_14790 12584 11649 gene locus_tag LOCUS_14800 12584 11649 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014565583.1 protein_id gnl|my_center|LOCUS_14800 12698 13057 gene locus_tag LOCUS_14810 12698 13057 CDS product CvfD/Ygs/GSP13 family RNA-binding post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566816.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence047 802 245 gene locus_tag LOCUS_14820 gene msrA 802 245 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547717.1 protein_id gnl|my_center|LOCUS_14820 1668 901 gene locus_tag LOCUS_14830 1668 901 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547854.1 protein_id gnl|my_center|LOCUS_14830 2115 1675 gene locus_tag LOCUS_14840 gene msrB 2115 1675 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548013.1 protein_id gnl|my_center|LOCUS_14840 2246 3430 gene locus_tag LOCUS_14850 2246 3430 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547041.1 protein_id gnl|my_center|LOCUS_14850 5348 3495 gene locus_tag LOCUS_14860 gene aspS 5348 3495 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547039.1 protein_id gnl|my_center|LOCUS_14860 6641 5355 gene locus_tag LOCUS_14870 gene hisS 6641 5355 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547037.1 protein_id gnl|my_center|LOCUS_14870 7348 6911 gene locus_tag LOCUS_14880 gene dtd 7348 6911 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547036.1 protein_id gnl|my_center|LOCUS_14880 9594 7348 gene locus_tag LOCUS_14890 9594 7348 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254292.1 protein_id gnl|my_center|LOCUS_14890 9915 9610 gene locus_tag LOCUS_14900 9915 9610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 10950 10006 gene locus_tag LOCUS_14910 gene prmA 10950 10006 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547033.1 protein_id gnl|my_center|LOCUS_14910 11008 11511 gene locus_tag LOCUS_14920 gene ybaK 11008 11511 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254291.1 protein_id gnl|my_center|LOCUS_14920 11606 11740 gene locus_tag LOCUS_14930 11606 11740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 <13023 11803 gene locus_tag LOCUS_14940 <13023 11803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546985.1:HAD-IC family P-type ATPase >Feature sequence048 <1 986 gene locus_tag LOCUS_14950 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546759.1:septation ring formation regulator EzrA 1082 2236 gene locus_tag LOCUS_14960 1082 2236 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546760.1 protein_id gnl|my_center|LOCUS_14960 2246 3463 gene locus_tag LOCUS_14970 gene thiI 2246 3463 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546762.1 protein_id gnl|my_center|LOCUS_14970 3528 4247 gene locus_tag LOCUS_14980 3528 4247 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546764.1 protein_id gnl|my_center|LOCUS_14980 4544 7183 gene locus_tag LOCUS_14990 4544 7183 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254252.1 protein_id gnl|my_center|LOCUS_14990 7186 8442 gene locus_tag LOCUS_15000 7186 8442 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254253.1 protein_id gnl|my_center|LOCUS_15000 8432 9109 gene locus_tag LOCUS_15010 8432 9109 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546772.1 protein_id gnl|my_center|LOCUS_15010 9140 9763 gene locus_tag LOCUS_15020 gene radC 9140 9763 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546774.1 protein_id gnl|my_center|LOCUS_15020 9892 10893 gene locus_tag LOCUS_15030 9892 10893 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546776.1 protein_id gnl|my_center|LOCUS_15030 10943 11794 gene locus_tag LOCUS_15040 gene mreC 10943 11794 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546779.1 protein_id gnl|my_center|LOCUS_15040 11794 12327 gene locus_tag LOCUS_15050 gene mreD 11794 12327 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546782.1 protein_id gnl|my_center|LOCUS_15050 12484 12365 gene locus_tag LOCUS_15060 12484 12365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence049 46 747 gene locus_tag LOCUS_15070 46 747 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254262.1 protein_id gnl|my_center|LOCUS_15070 845 2005 gene locus_tag LOCUS_15080 845 2005 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101678.1 protein_id gnl|my_center|LOCUS_15080 2103 2438 gene locus_tag LOCUS_15090 2103 2438 CDS product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546822.1 protein_id gnl|my_center|LOCUS_15090 2454 3581 gene locus_tag LOCUS_15100 gene mnmA 2454 3581 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546824.1 protein_id gnl|my_center|LOCUS_15100 3696 4361 gene locus_tag LOCUS_15110 3696 4361 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546826.1 protein_id gnl|my_center|LOCUS_15110 4361 5005 gene locus_tag LOCUS_15120 4361 5005 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546828.1 protein_id gnl|my_center|LOCUS_15120 4992 7427 gene locus_tag LOCUS_15130 4992 7427 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546830.1 protein_id gnl|my_center|LOCUS_15130 7557 7781 gene locus_tag LOCUS_15140 7557 7781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15140 7753 8826 gene locus_tag LOCUS_15150 7753 8826 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254169.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15150 8828 9757 gene locus_tag LOCUS_15160 8828 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546199.1 protein_id gnl|my_center|LOCUS_15160 10765 9812 gene locus_tag LOCUS_15170 10765 9812 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546833.1 protein_id gnl|my_center|LOCUS_15170 12504 10819 gene locus_tag LOCUS_15180 12504 10819 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546834.1 protein_id gnl|my_center|LOCUS_15180 12731 12504 gene locus_tag LOCUS_15190 12731 12504 CDS product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546835.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence050 850 287 gene locus_tag LOCUS_15200 850 287 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254261.1 protein_id gnl|my_center|LOCUS_15200 1075 851 gene locus_tag LOCUS_15210 1075 851 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546816.1 protein_id gnl|my_center|LOCUS_15210 3864 1075 gene locus_tag LOCUS_15220 gene ileS 3864 1075 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254260.1 protein_id gnl|my_center|LOCUS_15220 4915 4073 gene locus_tag LOCUS_15230 4915 4073 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254259.1 protein_id gnl|my_center|LOCUS_15230 5720 4920 gene locus_tag LOCUS_15240 5720 4920 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546811.1 protein_id gnl|my_center|LOCUS_15240 6021 5737 gene locus_tag LOCUS_15250 6021 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 6446 6021 gene locus_tag LOCUS_15260 gene sepF 6446 6021 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254258.1 protein_id gnl|my_center|LOCUS_15260 7790 6465 gene locus_tag LOCUS_15270 gene ftsZ 7790 6465 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546805.1 protein_id gnl|my_center|LOCUS_15270 9179 7809 gene locus_tag LOCUS_15280 gene ftsA 9179 7809 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254257.1 protein_id gnl|my_center|LOCUS_15280 10098 9244 gene locus_tag LOCUS_15290 10098 9244 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546801.1 protein_id gnl|my_center|LOCUS_15290 11241 10123 gene locus_tag LOCUS_15300 gene murG 11241 10123 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254256.1 protein_id gnl|my_center|LOCUS_15300 <12618 11244 gene locus_tag LOCUS_15310 <12618 11244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546797.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase >Feature sequence051 900 199 gene locus_tag LOCUS_15320 900 199 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254285.1 protein_id gnl|my_center|LOCUS_15320 1942 893 gene locus_tag LOCUS_15330 1942 893 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546989.1 protein_id gnl|my_center|LOCUS_15330 2805 1954 gene locus_tag LOCUS_15340 2805 1954 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254284.1 protein_id gnl|my_center|LOCUS_15340 4575 3598 gene locus_tag LOCUS_15350 gene bsh 4575 3598 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547395.1 protein_id gnl|my_center|LOCUS_15350 6308 4683 gene locus_tag LOCUS_15360 6308 4683 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546358.1 protein_id gnl|my_center|LOCUS_15360 7723 6437 gene locus_tag LOCUS_15370 gene eno 7723 6437 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546959.1 protein_id gnl|my_center|LOCUS_15370 8482 7910 gene locus_tag LOCUS_15380 8482 7910 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546962.1 protein_id gnl|my_center|LOCUS_15380 9565 8573 gene locus_tag LOCUS_15390 9565 8573 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289652.1 protein_id gnl|my_center|LOCUS_15390 11032 9575 gene locus_tag LOCUS_15400 11032 9575 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003715509.1 protein_id gnl|my_center|LOCUS_15400 12221 11052 gene locus_tag LOCUS_15410 12221 11052 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548167.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence052 532 1233 gene locus_tag LOCUS_15420 532 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1284 2654 gene locus_tag LOCUS_15430 1284 2654 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546431.1 protein_id gnl|my_center|LOCUS_15430 2752 3321 gene locus_tag LOCUS_15440 gene hpt 2752 3321 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254205.1 protein_id gnl|my_center|LOCUS_15440 4694 3387 gene locus_tag LOCUS_15450 4694 3387 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254206.1 protein_id gnl|my_center|LOCUS_15450 4810 5520 gene locus_tag LOCUS_15460 4810 5520 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546437.1 protein_id gnl|my_center|LOCUS_15460 5535 6776 gene locus_tag LOCUS_15470 5535 6776 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546440.1 protein_id gnl|my_center|LOCUS_15470 6776 8107 gene locus_tag LOCUS_15480 6776 8107 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546442.1 protein_id gnl|my_center|LOCUS_15480 8159 8233 gene locus_tag LOCUS_t00200 8159 8233 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8463 8278 gene locus_tag LOCUS_15490 8463 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 8603 9745 gene locus_tag LOCUS_15500 gene wecB 8603 9745 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254207.1 protein_id gnl|my_center|LOCUS_15500 10282 9773 gene locus_tag LOCUS_15510 10282 9773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 10721 10275 gene locus_tag LOCUS_15520 10721 10275 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546448.1 protein_id gnl|my_center|LOCUS_15520 10878 11699 gene locus_tag LOCUS_15530 gene map 10878 11699 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254208.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence053 66 1967 gene locus_tag LOCUS_15540 gene hypBA1 66 1967 CDS product beta-L-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068480.1 protein_id gnl|my_center|LOCUS_15540 1971 3416 gene locus_tag LOCUS_15550 gene abfB 1971 3416 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_15550 4169 3549 gene locus_tag LOCUS_15560 4169 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 4413 5756 gene locus_tag LOCUS_15570 4413 5756 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399072.1 protein_id gnl|my_center|LOCUS_15570 5834 6748 gene locus_tag LOCUS_15580 5834 6748 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229507.1 protein_id gnl|my_center|LOCUS_15580 6765 7613 gene locus_tag LOCUS_15590 gene araQ 6765 7613 CDS product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 protein_id gnl|my_center|LOCUS_15590 7618 8064 gene locus_tag LOCUS_15600 7618 8064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 8352 9296 gene locus_tag LOCUS_15610 8352 9296 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287289.1 protein_id gnl|my_center|LOCUS_15610 9306 10799 gene locus_tag LOCUS_15620 9306 10799 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287297.1 protein_id gnl|my_center|LOCUS_15620 10808 11824 gene locus_tag LOCUS_15630 10808 11824 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254469.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence054 534 61 gene locus_tag LOCUS_15640 534 61 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640266.1 protein_id gnl|my_center|LOCUS_15640 1759 521 gene locus_tag LOCUS_15650 1759 521 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101419.1 protein_id gnl|my_center|LOCUS_15650 2999 1734 gene locus_tag LOCUS_15660 gene sufD 2999 1734 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101418.1 protein_id gnl|my_center|LOCUS_15660 3805 3011 gene locus_tag LOCUS_15670 gene sufC 3805 3011 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004894681.1 protein_id gnl|my_center|LOCUS_15670 4777 3968 gene locus_tag LOCUS_15680 4777 3968 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254202.1 protein_id gnl|my_center|LOCUS_15680 4884 5486 gene locus_tag LOCUS_15690 4884 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15690 5487 5729 gene locus_tag LOCUS_15700 5487 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15700 5781 6551 gene locus_tag LOCUS_15710 gene proC 5781 6551 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025006378.1 protein_id gnl|my_center|LOCUS_15710 7218 6586 gene locus_tag LOCUS_15720 7218 6586 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547184.1 protein_id gnl|my_center|LOCUS_15720 7902 7288 gene locus_tag LOCUS_15730 7902 7288 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254380.1 protein_id gnl|my_center|LOCUS_15730 9206 9826 gene locus_tag LOCUS_15740 9206 9826 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548123.1 protein_id gnl|my_center|LOCUS_15740 9829 10494 gene locus_tag LOCUS_15750 9829 10494 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548121.1 protein_id gnl|my_center|LOCUS_15750 10504 11760 gene locus_tag LOCUS_15760 10504 11760 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254461.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence055 48 344 gene locus_tag LOCUS_15770 48 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 348 704 gene locus_tag LOCUS_15780 348 704 CDS product DUF6176 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547349.1 protein_id gnl|my_center|LOCUS_15780 715 1506 gene locus_tag LOCUS_15790 715 1506 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549690.1 protein_id gnl|my_center|LOCUS_15790 1675 1541 gene locus_tag LOCUS_15800 1675 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1846 1697 gene locus_tag LOCUS_15810 1846 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2121 1846 gene locus_tag LOCUS_15820 2121 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2196 2714 gene locus_tag LOCUS_15830 2196 2714 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547351.1 protein_id gnl|my_center|LOCUS_15830 2913 3527 gene locus_tag LOCUS_15840 2913 3527 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476045.1 protein_id gnl|my_center|LOCUS_15840 3542 4321 gene locus_tag LOCUS_15850 3542 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 4367 4759 gene locus_tag LOCUS_15860 4367 4759 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948047.1 protein_id gnl|my_center|LOCUS_15860 4857 6035 gene locus_tag LOCUS_15870 4857 6035 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135960404.1 protein_id gnl|my_center|LOCUS_15870 6072 6575 gene locus_tag LOCUS_15880 6072 6575 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034532906.1 protein_id gnl|my_center|LOCUS_15880 6559 7380 gene locus_tag LOCUS_15890 6559 7380 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475838.1 protein_id gnl|my_center|LOCUS_15890 7381 7737 gene locus_tag LOCUS_15900 7381 7737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 7831 7971 gene locus_tag LOCUS_15910 7831 7971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15910 8064 8387 gene locus_tag LOCUS_15920 8064 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15920 8418 8591 gene locus_tag LOCUS_15930 8418 8591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15930 8603 9379 gene locus_tag LOCUS_15940 8603 9379 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547367.1 protein_id gnl|my_center|LOCUS_15940 9626 9390 gene locus_tag LOCUS_15950 9626 9390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 10284 9613 gene locus_tag LOCUS_15960 10284 9613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 10389 10838 gene locus_tag LOCUS_15970 10389 10838 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476013.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence056 <1 651 gene locus_tag LOCUS_15980 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549107.1:ion channel 655 1095 gene locus_tag LOCUS_15990 655 1095 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547614.1 protein_id gnl|my_center|LOCUS_15990 2178 1189 gene locus_tag LOCUS_16000 2178 1189 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476338.1 protein_id gnl|my_center|LOCUS_16000 2849 2175 gene locus_tag LOCUS_16010 2849 2175 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065989431.1 protein_id gnl|my_center|LOCUS_16010 3020 3859 gene locus_tag LOCUS_16020 3020 3859 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547578.1 protein_id gnl|my_center|LOCUS_16020 3994 4722 gene locus_tag LOCUS_16030 3994 4722 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101868.1 protein_id gnl|my_center|LOCUS_16030 4734 5213 gene locus_tag LOCUS_16040 gene agaB 4734 5213 CDS product PTS galactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101867.1 protein_id gnl|my_center|LOCUS_16040 5229 6035 gene locus_tag LOCUS_16050 gene agaC 5229 6035 CDS product PTS galactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101866.1 protein_id gnl|my_center|LOCUS_16050 6025 6840 gene locus_tag LOCUS_16060 gene agaD 6025 6840 CDS product PTS galactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101865.1 protein_id gnl|my_center|LOCUS_16060 6842 7279 gene locus_tag LOCUS_16070 6842 7279 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101864.1 protein_id gnl|my_center|LOCUS_16070 7373 8536 gene locus_tag LOCUS_16080 7373 8536 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254389.1 protein_id gnl|my_center|LOCUS_16080 8549 9442 gene locus_tag LOCUS_16090 8549 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 9632 10177 gene locus_tag LOCUS_16100 9632 10177 CDS product YagU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906096.1 protein_id gnl|my_center|LOCUS_16100 11096 10230 gene locus_tag LOCUS_16110 11096 10230 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548384.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence057 99 1397 gene locus_tag LOCUS_16120 gene asnS 99 1397 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547544.1 protein_id gnl|my_center|LOCUS_16120 1455 2093 gene locus_tag LOCUS_16130 1455 2093 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547543.1 protein_id gnl|my_center|LOCUS_16130 2100 2729 gene locus_tag LOCUS_16140 gene nth 2100 2729 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254362.1 protein_id gnl|my_center|LOCUS_16140 5209 2861 gene locus_tag LOCUS_16150 5209 2861 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254361.1 protein_id gnl|my_center|LOCUS_16150 5825 5211 gene locus_tag LOCUS_16160 gene recU 5825 5211 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254360.1 protein_id gnl|my_center|LOCUS_16160 5891 6454 gene locus_tag LOCUS_16170 5891 6454 CDS product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547535.1 protein_id gnl|my_center|LOCUS_16170 6545 6964 gene locus_tag LOCUS_16180 6545 6964 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547534.1 protein_id gnl|my_center|LOCUS_16180 7413 8543 gene locus_tag LOCUS_16190 7413 8543 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547533.1 protein_id gnl|my_center|LOCUS_16190 8550 9785 gene locus_tag LOCUS_16200 8550 9785 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254359.1 protein_id gnl|my_center|LOCUS_16200 10754 9822 gene locus_tag LOCUS_16210 10754 9822 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549336.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence058 456 1070 gene locus_tag LOCUS_16220 gene gmk 456 1070 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547929.1 protein_id gnl|my_center|LOCUS_16220 1074 1292 gene locus_tag LOCUS_16230 gene rpoZ 1074 1292 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547927.1 protein_id gnl|my_center|LOCUS_16230 1350 3746 gene locus_tag LOCUS_16240 gene priA 1350 3746 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547921.1 protein_id gnl|my_center|LOCUS_16240 3762 4706 gene locus_tag LOCUS_16250 gene fmt 3762 4706 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547919.1 protein_id gnl|my_center|LOCUS_16250 4699 6012 gene locus_tag LOCUS_16260 gene rsmB 4699 6012 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254418.1 protein_id gnl|my_center|LOCUS_16260 6019 6771 gene locus_tag LOCUS_16270 6019 6771 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254417.1 protein_id gnl|my_center|LOCUS_16270 6771 8741 gene locus_tag LOCUS_16280 gene pknB 6771 8741 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_056938256.1 protein_id gnl|my_center|LOCUS_16280 8741 9634 gene locus_tag LOCUS_16290 gene rsgA 8741 9634 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547915.1 protein_id gnl|my_center|LOCUS_16290 9647 10297 gene locus_tag LOCUS_16300 gene rpe 9647 10297 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547914.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence059 2266 209 gene locus_tag LOCUS_16310 2266 209 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548440.1 protein_id gnl|my_center|LOCUS_16310 2375 3259 gene locus_tag LOCUS_16320 2375 3259 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548442.1 protein_id gnl|my_center|LOCUS_16320 4203 3286 gene locus_tag LOCUS_16330 gene fba 4203 3286 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254510.1 protein_id gnl|my_center|LOCUS_16330 5998 4313 gene locus_tag LOCUS_16340 gene argS 5998 4313 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548463.1 protein_id gnl|my_center|LOCUS_16340 6908 6261 gene locus_tag LOCUS_16350 6908 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 8200 6980 gene locus_tag LOCUS_16360 8200 6980 CDS product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548796.1 protein_id gnl|my_center|LOCUS_16360 9444 8275 gene locus_tag LOCUS_16370 9444 8275 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254512.1 protein_id gnl|my_center|LOCUS_16370 10381 9521 gene locus_tag LOCUS_16380 10381 9521 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254511.1 protein_id gnl|my_center|LOCUS_16380 10462 10546 gene locus_tag LOCUS_t00210 10462 10546 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence060 1085 585 gene locus_tag LOCUS_16390 1085 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16390 2503 1112 gene locus_tag LOCUS_16400 2503 1112 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254446.1 protein_id gnl|my_center|LOCUS_16400 3466 4842 gene locus_tag LOCUS_16410 3466 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 5947 4862 gene locus_tag LOCUS_16420 gene xerS 5947 4862 CDS product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547513.1 protein_id gnl|my_center|LOCUS_16420 7775 7086 gene locus_tag LOCUS_16430 7775 7086 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547489.1 protein_id gnl|my_center|LOCUS_16430 8384 7788 gene locus_tag LOCUS_16440 8384 7788 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547484.1 protein_id gnl|my_center|LOCUS_16440 9392 8457 gene locus_tag LOCUS_16450 9392 8457 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547481.1 protein_id gnl|my_center|LOCUS_16450 10388 9435 gene locus_tag LOCUS_16460 10388 9435 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547480.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence061 11 472 gene locus_tag LOCUS_16470 11 472 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549015.1 protein_id gnl|my_center|LOCUS_16470 3593 552 gene locus_tag LOCUS_16480 3593 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16480 5832 3547 gene locus_tag LOCUS_16490 5832 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16490 6574 6023 gene locus_tag LOCUS_16500 6574 6023 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254059.1 protein_id gnl|my_center|LOCUS_16500 7867 6686 gene locus_tag LOCUS_16510 gene dpaL 7867 6686 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890217.1 protein_id gnl|my_center|LOCUS_16510 8143 7877 gene locus_tag LOCUS_16520 8143 7877 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355924.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16520 8498 8301 gene locus_tag LOCUS_16530 8498 8301 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982695.1 protein_id gnl|my_center|LOCUS_16530 8995 8498 gene locus_tag LOCUS_16540 8995 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 9667 9134 gene locus_tag LOCUS_16550 gene hpt 9667 9134 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705261.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence062 1056 361 gene locus_tag LOCUS_16560 1056 361 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355354.1 protein_id gnl|my_center|LOCUS_16560 1883 1056 gene locus_tag LOCUS_16570 1883 1056 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354796.1 protein_id gnl|my_center|LOCUS_16570 2713 1880 gene locus_tag LOCUS_16580 2713 1880 CDS product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365419.1 protein_id gnl|my_center|LOCUS_16580 3227 2733 gene locus_tag LOCUS_16590 3227 2733 CDS product PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984845.1 protein_id gnl|my_center|LOCUS_16590 3670 3251 gene locus_tag LOCUS_16600 3670 3251 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989935.1 protein_id gnl|my_center|LOCUS_16600 6271 3830 gene locus_tag LOCUS_16610 6271 3830 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304269.1 protein_id gnl|my_center|LOCUS_16610 6567 7283 gene locus_tag LOCUS_16620 6567 7283 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640270.1 protein_id gnl|my_center|LOCUS_16620 7402 8121 gene locus_tag LOCUS_16630 7402 8121 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640270.1 protein_id gnl|my_center|LOCUS_16630 8260 9270 gene locus_tag LOCUS_16640 8260 9270 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263776.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence063 1184 714 gene locus_tag LOCUS_16650 1184 714 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549820.1 protein_id gnl|my_center|LOCUS_16650 1966 1184 gene locus_tag LOCUS_16660 1966 1184 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549818.1 protein_id gnl|my_center|LOCUS_16660 3531 1990 gene locus_tag LOCUS_16670 3531 1990 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549817.1 protein_id gnl|my_center|LOCUS_16670 3932 3528 gene locus_tag LOCUS_16680 3932 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549816.1 protein_id gnl|my_center|LOCUS_16680 4163 4792 gene locus_tag LOCUS_16690 4163 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 6049 4901 gene locus_tag LOCUS_16700 6049 4901 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549814.1 protein_id gnl|my_center|LOCUS_16700 6207 8006 gene locus_tag LOCUS_16710 gene pepF 6207 8006 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549813.1 protein_id gnl|my_center|LOCUS_16710 8838 8047 gene locus_tag LOCUS_16720 8838 8047 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613417.1 protein_id gnl|my_center|LOCUS_16720 9491 8838 gene locus_tag LOCUS_16730 9491 8838 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254570.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence064 <1 576 gene locus_tag LOCUS_16740 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547135.1:DNA-processing protein DprA 2025 868 gene locus_tag LOCUS_16750 2025 868 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179397.1 protein_id gnl|my_center|LOCUS_16750 2874 2191 gene locus_tag LOCUS_16760 2874 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 3752 2985 gene locus_tag LOCUS_16770 3752 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 4113 3745 gene locus_tag LOCUS_16780 4113 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 4379 4594 gene locus_tag LOCUS_16790 4379 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 4596 5360 gene locus_tag LOCUS_16800 4596 5360 CDS product phage antirepressor Ant inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072518.1 protein_id gnl|my_center|LOCUS_16800 5516 5806 gene locus_tag LOCUS_16810 5516 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 5800 5997 gene locus_tag LOCUS_16820 5800 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 5987 6256 gene locus_tag LOCUS_16830 5987 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 6389 6691 gene locus_tag LOCUS_16840 6389 6691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 6678 6836 gene locus_tag LOCUS_16850 6678 6836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 6906 7205 gene locus_tag LOCUS_16860 6906 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 7379 8023 gene locus_tag LOCUS_16870 7379 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 8029 8751 gene locus_tag LOCUS_16880 8029 8751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence065 126 821 gene locus_tag LOCUS_16890 126 821 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549072.1 protein_id gnl|my_center|LOCUS_16890 899 1783 gene locus_tag LOCUS_16900 899 1783 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549073.1 protein_id gnl|my_center|LOCUS_16900 1792 1998 gene locus_tag LOCUS_16910 1792 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 2016 2222 gene locus_tag LOCUS_16920 2016 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 2235 2918 gene locus_tag LOCUS_16930 2235 2918 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721658.1 protein_id gnl|my_center|LOCUS_16930 3015 3950 gene locus_tag LOCUS_16940 3015 3950 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549076.1 protein_id gnl|my_center|LOCUS_16940 4047 5015 gene locus_tag LOCUS_16950 4047 5015 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391645.1 protein_id gnl|my_center|LOCUS_16950 5015 5758 gene locus_tag LOCUS_16960 5015 5758 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877601.1 protein_id gnl|my_center|LOCUS_16960 5743 6498 gene locus_tag LOCUS_16970 5743 6498 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062285593.1 protein_id gnl|my_center|LOCUS_16970 7503 6547 gene locus_tag LOCUS_16980 gene menA 7503 6547 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130349.1 protein_id gnl|my_center|LOCUS_16980 8952 7603 gene locus_tag LOCUS_16990 gene pepC 8952 7603 CDS product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549077.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence066 241 873 gene locus_tag LOCUS_17000 241 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1077 2483 gene locus_tag LOCUS_17010 1077 2483 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546995.1 protein_id gnl|my_center|LOCUS_17010 2498 3886 gene locus_tag LOCUS_17020 2498 3886 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546997.1 protein_id gnl|my_center|LOCUS_17020 3979 4905 gene locus_tag LOCUS_17030 3979 4905 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547001.1 protein_id gnl|my_center|LOCUS_17030 4994 5809 gene locus_tag LOCUS_17040 4994 5809 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546636.1 protein_id gnl|my_center|LOCUS_17040 5868 7241 gene locus_tag LOCUS_17050 5868 7241 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547031.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence067 14 227 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq taggatcacctccacttgcgtggagaacac 1185 298 gene locus_tag LOCUS_17060 gene cas2e 1185 298 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674076.1 protein_id gnl|my_center|LOCUS_17060 2124 1186 gene locus_tag LOCUS_17070 gene cas1e 2124 1186 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674075.1 protein_id gnl|my_center|LOCUS_17070 2772 2128 gene locus_tag LOCUS_17080 gene cas6e 2772 2128 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 protein_id gnl|my_center|LOCUS_17080 3497 2784 gene locus_tag LOCUS_17090 gene cas5e 3497 2784 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674073.1 protein_id gnl|my_center|LOCUS_17090 4599 3478 gene locus_tag LOCUS_17100 gene cas7e 4599 3478 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674072.1 protein_id gnl|my_center|LOCUS_17100 5213 4602 gene locus_tag LOCUS_17110 gene casB 5213 4602 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994023.1 protein_id gnl|my_center|LOCUS_17110 6908 5223 gene locus_tag LOCUS_17120 6908 5223 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674071.1 protein_id gnl|my_center|LOCUS_17120 <8459 6901 gene locus_tag LOCUS_17130 <8459 6901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674070.1:CRISPR-associated helicase/endonuclease Cas3 >Feature sequence068 <1 530 gene locus_tag LOCUS_17140 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546862.1:elongation factor Tu 689 2062 gene locus_tag LOCUS_17150 gene tig 689 2062 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546863.1 protein_id gnl|my_center|LOCUS_17150 2205 3476 gene locus_tag LOCUS_17160 gene clpX 2205 3476 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546864.1 protein_id gnl|my_center|LOCUS_17160 3476 4060 gene locus_tag LOCUS_17170 gene yihA 3476 4060 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546867.1 protein_id gnl|my_center|LOCUS_17170 4193 4717 gene locus_tag LOCUS_17180 4193 4717 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254326.1 protein_id gnl|my_center|LOCUS_17180 4872 5390 gene locus_tag LOCUS_17190 4872 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546897.1 protein_id gnl|my_center|LOCUS_17190 5404 6144 gene locus_tag LOCUS_17200 5404 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 6267 6662 gene locus_tag LOCUS_17210 6267 6662 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_17210 6813 7784 gene locus_tag LOCUS_17220 6813 7784 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549977.1 protein_id gnl|my_center|LOCUS_17220 7882 8286 gene locus_tag LOCUS_17230 7882 8286 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475537.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence069 273 470 gene locus_tag LOCUS_17240 273 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 911 1504 gene locus_tag LOCUS_17250 911 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1730 1656 gene locus_tag LOCUS_t00220 1730 1656 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1909 2400 gene locus_tag LOCUS_17260 1909 2400 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702501.1 protein_id gnl|my_center|LOCUS_17260 2635 2561 gene locus_tag LOCUS_t00230 2635 2561 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3857 2868 gene locus_tag LOCUS_17270 3857 2868 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322451.1 protein_id gnl|my_center|LOCUS_17270 4720 3860 gene locus_tag LOCUS_17280 4720 3860 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966764.1 protein_id gnl|my_center|LOCUS_17280 5456 4725 gene locus_tag LOCUS_17290 gene frlR 5456 4725 CDS product transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228628.1 protein_id gnl|my_center|LOCUS_17290 6211 5477 gene locus_tag LOCUS_17300 6211 5477 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_17300 6863 6204 gene locus_tag LOCUS_17310 6863 6204 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358158.1 protein_id gnl|my_center|LOCUS_17310 7693 6887 gene locus_tag LOCUS_17320 7693 6887 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432207.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence070 2 556 gene locus_tag LOCUS_17330 2 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 546 1250 gene locus_tag LOCUS_17340 546 1250 CDS product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225426975.1 protein_id gnl|my_center|LOCUS_17340 1250 2428 gene locus_tag LOCUS_17350 1250 2428 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475947.1 protein_id gnl|my_center|LOCUS_17350 2650 2898 gene locus_tag LOCUS_17360 2650 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 2901 3251 gene locus_tag LOCUS_17370 2901 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3251 3613 gene locus_tag LOCUS_17380 3251 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 3606 4046 gene locus_tag LOCUS_17390 3606 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 4043 4423 gene locus_tag LOCUS_17400 4043 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 4436 5065 gene locus_tag LOCUS_17410 4436 5065 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905928.1 protein_id gnl|my_center|LOCUS_17410 5261 5695 gene locus_tag LOCUS_17420 5261 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 5749 5904 gene locus_tag LOCUS_17430 5749 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence071 688 2115 gene locus_tag LOCUS_17440 gene araA 688 2115 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642915.1 protein_id gnl|my_center|LOCUS_17440 3202 2303 gene locus_tag LOCUS_17450 3202 2303 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254505.1 protein_id gnl|my_center|LOCUS_17450 3647 3312 gene locus_tag LOCUS_17460 3647 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 4135 3653 gene locus_tag LOCUS_17470 4135 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 4655 4221 gene locus_tag LOCUS_17480 4655 4221 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548425.1 protein_id gnl|my_center|LOCUS_17480 4749 5492 gene locus_tag LOCUS_17490 4749 5492 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548423.1 protein_id gnl|my_center|LOCUS_17490 5485 6693 gene locus_tag LOCUS_17500 5485 6693 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613400.1 protein_id gnl|my_center|LOCUS_17500 6709 7362 gene locus_tag LOCUS_17510 gene trmB 6709 7362 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548419.1 protein_id gnl|my_center|LOCUS_17510 7801 7412 gene locus_tag LOCUS_17520 7801 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence072 2593 110 gene locus_tag LOCUS_17530 gene parC 2593 110 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547478.1 protein_id gnl|my_center|LOCUS_17530 4571 2613 gene locus_tag LOCUS_17540 gene parE 4571 2613 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547476.1 protein_id gnl|my_center|LOCUS_17540 4669 5310 gene locus_tag LOCUS_17550 gene plsY 4669 5310 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547474.1 protein_id gnl|my_center|LOCUS_17550 5416 5910 gene locus_tag LOCUS_17560 5416 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 6827 5952 gene locus_tag LOCUS_17570 6827 5952 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547292.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence073 592 1404 gene locus_tag LOCUS_17580 592 1404 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014584522.1 protein_id gnl|my_center|LOCUS_17580 1413 2126 gene locus_tag LOCUS_17590 gene cofE 1413 2126 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921993.1 protein_id gnl|my_center|LOCUS_17590 2323 2805 gene locus_tag LOCUS_17600 2323 2805 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546951.1 protein_id gnl|my_center|LOCUS_17600 4546 2969 gene locus_tag LOCUS_17610 4546 2969 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254534.1 protein_id gnl|my_center|LOCUS_17610 5202 4645 gene locus_tag LOCUS_17620 5202 4645 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639830.1 protein_id gnl|my_center|LOCUS_17620 5298 5750 gene locus_tag LOCUS_17630 5298 5750 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254394.1 protein_id gnl|my_center|LOCUS_17630 5747 5962 gene locus_tag LOCUS_17640 5747 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 6068 6199 gene locus_tag LOCUS_17650 6068 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 6511 6972 gene locus_tag LOCUS_17660 6511 6972 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254329.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence074 83 907 gene locus_tag LOCUS_17670 83 907 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709302.1 protein_id gnl|my_center|LOCUS_17670 930 2051 gene locus_tag LOCUS_17680 930 2051 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836412.1 protein_id gnl|my_center|LOCUS_17680 3035 2073 gene locus_tag LOCUS_17690 3035 2073 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550053.1 protein_id gnl|my_center|LOCUS_17690 3838 3038 gene locus_tag LOCUS_17700 3838 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550052.1 protein_id gnl|my_center|LOCUS_17700 4488 3835 gene locus_tag LOCUS_17710 4488 3835 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550051.1 protein_id gnl|my_center|LOCUS_17710 4937 4488 gene locus_tag LOCUS_17720 4937 4488 CDS product DUF3290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550049.1 protein_id gnl|my_center|LOCUS_17720 6214 4940 gene locus_tag LOCUS_17730 gene pepT 6214 4940 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548288.1 protein_id gnl|my_center|LOCUS_17730 6745 6272 gene locus_tag LOCUS_17740 6745 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 >Feature sequence075 6625 122 gene locus_tag LOCUS_17750 gene prtP 6625 122 CDS product PII-type proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674840.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence076 984 160 gene locus_tag LOCUS_17760 gene yidA 984 160 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377829.1 protein_id gnl|my_center|LOCUS_17760 1950 997 gene locus_tag LOCUS_17770 gene lacC 1950 997 CDS product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604134.1 protein_id gnl|my_center|LOCUS_17770 2705 1953 gene locus_tag LOCUS_17780 2705 1953 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288287.1 protein_id gnl|my_center|LOCUS_17780 2886 3344 gene locus_tag LOCUS_17790 2886 3344 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458431.1 protein_id gnl|my_center|LOCUS_17790 3381 3701 gene locus_tag LOCUS_17800 3381 3701 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288285.1 protein_id gnl|my_center|LOCUS_17800 3743 5128 gene locus_tag LOCUS_17810 3743 5128 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288281.1 protein_id gnl|my_center|LOCUS_17810 5147 5416 gene locus_tag LOCUS_17820 5147 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 5424 5597 gene locus_tag LOCUS_17830 5424 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17830 5700 6197 gene locus_tag LOCUS_17840 5700 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17840 >Feature sequence077 13 1212 gene locus_tag LOCUS_17850 13 1212 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547116.1 protein_id gnl|my_center|LOCUS_17850 1918 1253 gene locus_tag LOCUS_17860 1918 1253 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254304.1 protein_id gnl|my_center|LOCUS_17860 2046 2900 gene locus_tag LOCUS_17870 2046 2900 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254305.1 protein_id gnl|my_center|LOCUS_17870 2907 3137 gene locus_tag LOCUS_17880 2907 3137 CDS product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547128.1 protein_id gnl|my_center|LOCUS_17880 3149 4576 gene locus_tag LOCUS_17890 3149 4576 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101574.1 protein_id gnl|my_center|LOCUS_17890 4589 5428 gene locus_tag LOCUS_17900 gene ylqF 4589 5428 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547131.1 protein_id gnl|my_center|LOCUS_17900 5425 5571 gene locus_tag LOCUS_17910 5425 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 5674 6180 gene locus_tag LOCUS_17920 5674 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17920 6238 6366 gene locus_tag LOCUS_17930 6238 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence078 3886 3065 gene locus_tag LOCUS_17940 3886 3065 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549308.1 protein_id gnl|my_center|LOCUS_17940 4382 5959 gene locus_tag LOCUS_17950 4382 5959 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254430.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence079 <1 521 gene locus_tag LOCUS_17960 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202820.1:phage integrase SAM-like domain-containing protein 889 3303 gene locus_tag LOCUS_17970 gene leuS 889 3303 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548508.1 protein_id gnl|my_center|LOCUS_17970 3400 5064 gene locus_tag LOCUS_17980 3400 5064 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548498.1 protein_id gnl|my_center|LOCUS_17980 5206 5688 gene locus_tag LOCUS_17990 5206 5688 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence080 <1 3517 gene locus_tag LOCUS_18000 <1 3517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_057865751.1:type II CRISPR RNA-guided endonuclease Cas9 3725 4633 gene locus_tag LOCUS_18010 gene cas1 3725 4633 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475521.1 protein_id gnl|my_center|LOCUS_18010 4611 4916 gene locus_tag LOCUS_18020 gene cas2 4611 4916 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475522.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence081 583 891 gene locus_tag LOCUS_18030 583 891 CDS product PTS lactose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732400.1 protein_id gnl|my_center|LOCUS_18030 922 2151 gene locus_tag LOCUS_18040 922 2151 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861808.1 protein_id gnl|my_center|LOCUS_18040 2173 2514 gene locus_tag LOCUS_18050 2173 2514 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721484.1 protein_id gnl|my_center|LOCUS_18050 2514 3818 gene locus_tag LOCUS_18060 2514 3818 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930652.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18060 3760 3972 gene locus_tag LOCUS_18070 3760 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18070 >Feature sequence082 1167 181 gene locus_tag LOCUS_18080 gene rfbD 1167 181 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476435.1 protein_id gnl|my_center|LOCUS_18080 1792 1184 gene locus_tag LOCUS_18090 gene rfbC 1792 1184 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_18090 2701 1817 gene locus_tag LOCUS_18100 gene rfbA 2701 1817 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389370.1 protein_id gnl|my_center|LOCUS_18100 3743 2706 gene locus_tag LOCUS_18110 gene rfbB 3743 2706 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_18110 5067 3895 gene locus_tag LOCUS_18120 5067 3895 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948530.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence083 59 1138 gene locus_tag LOCUS_18130 59 1138 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056552.1 protein_id gnl|my_center|LOCUS_18130 1671 1183 gene locus_tag LOCUS_18140 1671 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 2387 1692 gene locus_tag LOCUS_18150 2387 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 3304 2444 gene locus_tag LOCUS_18160 3304 2444 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102090.1 protein_id gnl|my_center|LOCUS_18160 4060 3458 gene locus_tag LOCUS_18170 4060 3458 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547369.1 protein_id gnl|my_center|LOCUS_18170 5038 4181 gene locus_tag LOCUS_18180 5038 4181 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254321.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence084 915 28 gene locus_tag LOCUS_18190 915 28 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547149.1 protein_id gnl|my_center|LOCUS_18190 2337 943 gene locus_tag LOCUS_18200 gene hslU 2337 943 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254308.1 protein_id gnl|my_center|LOCUS_18200 2871 2347 gene locus_tag LOCUS_18210 gene hslV 2871 2347 CDS product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254307.1 protein_id gnl|my_center|LOCUS_18210 3803 2874 gene locus_tag LOCUS_18220 3803 2874 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547143.1 protein_id gnl|my_center|LOCUS_18220 <5113 3808 gene locus_tag LOCUS_18230 <5113 3808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547141.1:methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO >Feature sequence085 995 36 gene locus_tag LOCUS_18240 gene mraY 995 36 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546795.1 protein_id gnl|my_center|LOCUS_18240 3171 1015 gene locus_tag LOCUS_18250 3171 1015 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546793.1 protein_id gnl|my_center|LOCUS_18250 3536 3171 gene locus_tag LOCUS_18260 gene ftsL 3536 3171 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254255.1 protein_id gnl|my_center|LOCUS_18260 4509 3562 gene locus_tag LOCUS_18270 gene rsmH 4509 3562 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546789.1 protein_id gnl|my_center|LOCUS_18270 4943 4512 gene locus_tag LOCUS_18280 gene mraZ 4943 4512 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355890.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence086 1026 49 gene locus_tag LOCUS_18290 1026 49 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254506.1 protein_id gnl|my_center|LOCUS_18290 3459 1027 gene locus_tag LOCUS_18300 3459 1027 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254507.1 protein_id gnl|my_center|LOCUS_18300 4657 3446 gene locus_tag LOCUS_18310 4657 3446 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548436.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence087 42 2789 gene locus_tag LOCUS_18320 42 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 3055 2828 gene locus_tag LOCUS_18330 3055 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 3813 3214 gene locus_tag LOCUS_18340 3813 3214 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102061.1 protein_id gnl|my_center|LOCUS_18340 4532 3939 gene locus_tag LOCUS_18350 4532 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence088 1269 100 gene locus_tag LOCUS_18360 1269 100 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898687.1 protein_id gnl|my_center|LOCUS_18360 2018 1299 gene locus_tag LOCUS_18370 2018 1299 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437811.1 protein_id gnl|my_center|LOCUS_18370 2996 2232 gene locus_tag LOCUS_18380 2996 2232 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546204.1 protein_id gnl|my_center|LOCUS_18380 3803 3234 gene locus_tag LOCUS_18390 3803 3234 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546208.1 protein_id gnl|my_center|LOCUS_18390 3993 4400 gene locus_tag LOCUS_18400 gene psiE 3993 4400 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705589.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence089 627 406 gene locus_tag LOCUS_18410 627 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 1585 938 gene locus_tag LOCUS_18420 1585 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 3285 1603 gene locus_tag LOCUS_18430 3285 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 4314 3478 gene locus_tag LOCUS_18440 4314 3478 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082599082.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence090 2624 357 gene locus_tag LOCUS_18450 2624 357 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254392.1 protein_id gnl|my_center|LOCUS_18450 2732 3592 gene locus_tag LOCUS_18460 2732 3592 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254391.1 protein_id gnl|my_center|LOCUS_18460 3873 3960 gene locus_tag LOCUS_t00240 3873 3960 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4058 4390 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggatcacctccacttgcgtggagaacac >Feature sequence091 237 1085 gene locus_tag LOCUS_18470 237 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18470 1161 1466 gene locus_tag LOCUS_18480 1161 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18480 3974 1527 gene locus_tag LOCUS_18490 3974 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence092 789 235 gene locus_tag LOCUS_18500 gene def 789 235 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546838.1 protein_id gnl|my_center|LOCUS_18500 1088 2929 gene locus_tag LOCUS_18510 gene typA 1088 2929 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254264.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence093 144 479 gene locus_tag LOCUS_18520 144 479 CDS product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546844.1 protein_id gnl|my_center|LOCUS_18520 476 1024 gene locus_tag LOCUS_18530 gene rsmD 476 1024 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546846.1 protein_id gnl|my_center|LOCUS_18530 1026 1532 gene locus_tag LOCUS_18540 gene coaD 1026 1532 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546847.1 protein_id gnl|my_center|LOCUS_18540 1510 2541 gene locus_tag LOCUS_18550 1510 2541 CDS product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546849.1 protein_id gnl|my_center|LOCUS_18550 2615 3280 gene locus_tag LOCUS_18560 2615 3280 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546852.1 protein_id gnl|my_center|LOCUS_18560 >Feature sequence094 429 540 gene locus_tag LOCUS_r00020 429 540 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 548 622 gene locus_tag LOCUS_t00250 548 622 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1518 2177 gene locus_tag LOCUS_18570 1518 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2399 2989 gene locus_tag LOCUS_18580 2399 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 2989 3204 gene locus_tag LOCUS_18590 2989 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 3204 3608 gene locus_tag LOCUS_18600 3204 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence095 554 1213 gene locus_tag LOCUS_18610 554 1213 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966717.1 protein_id gnl|my_center|LOCUS_18610 1314 1535 gene locus_tag LOCUS_18620 1314 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 1671 2528 gene locus_tag LOCUS_18630 1671 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 2625 2912 gene locus_tag LOCUS_18640 2625 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 2902 3474 gene locus_tag LOCUS_18650 2902 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 3557 3727 gene locus_tag LOCUS_18660 3557 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence096 905 246 gene locus_tag LOCUS_18670 905 246 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475996.1 protein_id gnl|my_center|LOCUS_18670 1374 994 gene locus_tag LOCUS_18680 1374 994 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286801.1 protein_id gnl|my_center|LOCUS_18680 1570 1340 gene locus_tag LOCUS_18690 1570 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 2157 1657 gene locus_tag LOCUS_18700 2157 1657 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101189.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence097 426 1859 gene locus_tag LOCUS_18710 426 1859 CDS product PTS fructose-like transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102198.1 protein_id gnl|my_center|LOCUS_18710 1869 3026 gene locus_tag LOCUS_18720 1869 3026 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642879.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence098 2 76 gene locus_tag LOCUS_t00260 2 76 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 94 184 gene locus_tag LOCUS_t00270 94 184 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 280 353 gene locus_tag LOCUS_t00280 280 353 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 358 430 gene locus_tag LOCUS_t00290 358 430 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 575 1783 gene locus_tag LOCUS_18730 gene metK 575 1783 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548514.1 protein_id gnl|my_center|LOCUS_18730 1800 3251 gene locus_tag LOCUS_18740 1800 3251 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548513.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence099 1722 394 gene locus_tag LOCUS_18750 1722 394 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475678.1 protein_id gnl|my_center|LOCUS_18750 3121 1874 gene locus_tag LOCUS_18760 3121 1874 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577841.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence100 21 95 gene locus_tag LOCUS_t00300 21 95 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 135 210 gene locus_tag LOCUS_t00310 135 210 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 321 551 gene locus_tag LOCUS_18770 321 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 703 3174 gene locus_tag LOCUS_18780 703 3174 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549016.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence101 18 1343 gene locus_tag LOCUS_18790 18 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 1343 2332 gene locus_tag LOCUS_18800 gene holA 1343 2332 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546856.1 protein_id gnl|my_center|LOCUS_18800 2651 2394 gene locus_tag LOCUS_18810 gene rpsT 2651 2394 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546858.1 protein_id gnl|my_center|LOCUS_18810 2847 3116 gene locus_tag LOCUS_18820 gene rpsO 2847 3116 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354983.1 protein_id gnl|my_center|LOCUS_18820 >Feature sequence102 395 1105 gene locus_tag LOCUS_18830 395 1105 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547603.1 protein_id gnl|my_center|LOCUS_18830 1107 1934 gene locus_tag LOCUS_18840 1107 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254375.1 protein_id gnl|my_center|LOCUS_18840 2178 1993 gene locus_tag LOCUS_18850 2178 1993 CDS product LBP_cg2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547599.1 protein_id gnl|my_center|LOCUS_18850 2785 2204 gene locus_tag LOCUS_18860 gene lepB 2785 2204 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547598.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence103 129 1466 gene locus_tag LOCUS_18870 gene glnA 129 1466 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003627067.1 protein_id gnl|my_center|LOCUS_18870 2850 1543 gene locus_tag LOCUS_18880 2850 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence104 342 1568 gene locus_tag LOCUS_18890 342 1568 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549893.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence105 2050 1850 gene locus_tag LOCUS_18900 2050 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 2385 2014 gene locus_tag LOCUS_18910 2385 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18910 >Feature sequence106 58 693 gene locus_tag LOCUS_18920 58 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 736 1320 gene locus_tag LOCUS_18930 736 1320 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549069.1 protein_id gnl|my_center|LOCUS_18930 2237 1368 gene locus_tag LOCUS_18940 2237 1368 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974354.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence107 201 1298 gene locus_tag LOCUS_18950 201 1298 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102220.1 protein_id gnl|my_center|LOCUS_18950 <2692 1448 gene locus_tag LOCUS_18960 <2692 1448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963897.1:RICIN domain-containing protein >Feature sequence108 423 169 gene locus_tag LOCUS_18970 423 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 1231 437 gene locus_tag LOCUS_18980 1231 437 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793656.1 protein_id gnl|my_center|LOCUS_18980 2037 1231 gene locus_tag LOCUS_18990 2037 1231 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057803058.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence109 524 75 gene locus_tag LOCUS_19000 524 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 2331 517 gene locus_tag LOCUS_19010 2331 517 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546860.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence110 1856 2473 gene locus_tag LOCUS_19020 1856 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020