>Feature sequence001 63 1715 gene locus_tag LOCUS_00010 63 1715 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922090.1 protein_id gnl|my_center|LOCUS_00010 1712 2227 gene locus_tag LOCUS_00020 1712 2227 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812221.1 protein_id gnl|my_center|LOCUS_00020 2378 3403 gene locus_tag LOCUS_00030 gene floA 2378 3403 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_00030 3506 4243 gene locus_tag LOCUS_00040 3506 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4278 5273 gene locus_tag LOCUS_00050 4278 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5270 6532 gene locus_tag LOCUS_00060 5270 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7178 6567 gene locus_tag LOCUS_00070 7178 6567 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725019.1 protein_id gnl|my_center|LOCUS_00070 7243 8001 gene locus_tag LOCUS_00080 7243 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9656 8013 gene locus_tag LOCUS_00090 9656 8013 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888181.1 protein_id gnl|my_center|LOCUS_00090 10204 9830 gene locus_tag LOCUS_00100 10204 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10085 10336 gene locus_tag LOCUS_00110 gene rpsO 10085 10336 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907966.1 protein_id gnl|my_center|LOCUS_00110 10583 12736 gene locus_tag LOCUS_00120 gene pnp 10583 12736 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037246149.1 protein_id gnl|my_center|LOCUS_00120 13033 13317 gene locus_tag LOCUS_00130 13033 13317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13385 14335 gene locus_tag LOCUS_00140 13385 14335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15523 14369 gene locus_tag LOCUS_00150 15523 14369 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249749.1 protein_id gnl|my_center|LOCUS_00150 17773 15566 gene locus_tag LOCUS_00160 17773 15566 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_00160 17946 18416 gene locus_tag LOCUS_00170 gene ndk 17946 18416 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256592.1 protein_id gnl|my_center|LOCUS_00170 19084 20364 gene locus_tag LOCUS_00180 19084 20364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 22078 20531 gene locus_tag LOCUS_00190 22078 20531 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270301.1 protein_id gnl|my_center|LOCUS_00190 22164 22379 gene locus_tag LOCUS_00200 22164 22379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 22458 23336 gene locus_tag LOCUS_00210 22458 23336 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889327.1 protein_id gnl|my_center|LOCUS_00210 23883 25244 gene locus_tag LOCUS_00220 23883 25244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25490 27187 gene locus_tag LOCUS_00230 gene gspE 25490 27187 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_00230 27194 28408 gene locus_tag LOCUS_00240 27194 28408 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_00240 28458 28889 gene locus_tag LOCUS_00250 gene gspG 28458 28889 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_00250 28971 29570 gene locus_tag LOCUS_00260 28971 29570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 29624 30091 gene locus_tag LOCUS_00270 29624 30091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30147 31094 gene locus_tag LOCUS_00280 30147 31094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 31091 32575 gene locus_tag LOCUS_00290 31091 32575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 32830 34629 gene locus_tag LOCUS_00300 32830 34629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 34847 34626 gene locus_tag LOCUS_00310 34847 34626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34876 35490 gene locus_tag LOCUS_00320 34876 35490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 35487 36644 gene locus_tag LOCUS_00330 35487 36644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 36835 39786 gene locus_tag LOCUS_00340 36835 39786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 39823 41085 gene locus_tag LOCUS_00350 39823 41085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 41638 41174 gene locus_tag LOCUS_00360 41638 41174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 46225 41825 gene locus_tag LOCUS_00370 46225 41825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 46578 47045 gene locus_tag LOCUS_00380 46578 47045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 47226 48293 gene locus_tag LOCUS_00390 47226 48293 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_00390 48297 49532 gene locus_tag LOCUS_00400 48297 49532 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_00400 49535 50101 gene locus_tag LOCUS_00410 49535 50101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 50259 52580 gene locus_tag LOCUS_00420 50259 52580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 52577 53167 gene locus_tag LOCUS_00430 52577 53167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 55421 53214 gene locus_tag LOCUS_00440 gene ppk1 55421 53214 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141500.1 protein_id gnl|my_center|LOCUS_00440 55744 55418 gene locus_tag LOCUS_00450 55744 55418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 55685 55873 gene locus_tag LOCUS_00460 55685 55873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 55972 57375 gene locus_tag LOCUS_00470 gene glmM 55972 57375 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922275.1 protein_id gnl|my_center|LOCUS_00470 57533 57949 gene locus_tag LOCUS_00480 57533 57949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 58074 58781 gene locus_tag LOCUS_00490 58074 58781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 59720 58827 gene locus_tag LOCUS_00500 gene thyX 59720 58827 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_00500 60289 59774 gene locus_tag LOCUS_00510 60289 59774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 61149 60289 gene locus_tag LOCUS_00520 61149 60289 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_00520 62835 61246 gene locus_tag LOCUS_00530 62835 61246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 64035 63061 gene locus_tag LOCUS_00540 gene panB 64035 63061 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763099.1 protein_id gnl|my_center|LOCUS_00540 64782 64099 gene locus_tag LOCUS_00550 64782 64099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 65439 64879 gene locus_tag LOCUS_00560 gene coaD 65439 64879 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122863.1 protein_id gnl|my_center|LOCUS_00560 66377 65862 gene locus_tag LOCUS_00570 66377 65862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 66791 66387 gene locus_tag LOCUS_00580 66791 66387 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326692.1 protein_id gnl|my_center|LOCUS_00580 67261 66851 gene locus_tag LOCUS_00590 67261 66851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 67389 70028 gene locus_tag LOCUS_00600 67389 70028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 70190 72022 gene locus_tag LOCUS_00610 70190 72022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 72093 72545 gene locus_tag LOCUS_00620 72093 72545 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048393.1 protein_id gnl|my_center|LOCUS_00620 72600 73313 gene locus_tag LOCUS_00630 gene pcp 72600 73313 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142404.1 protein_id gnl|my_center|LOCUS_00630 73313 74350 gene locus_tag LOCUS_00640 73313 74350 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093339.1 protein_id gnl|my_center|LOCUS_00640 74469 74960 gene locus_tag LOCUS_00650 74469 74960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 76642 75080 gene locus_tag LOCUS_00660 gene atpA 76642 75080 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462231.1 protein_id gnl|my_center|LOCUS_00660 77395 76790 gene locus_tag LOCUS_00670 gene atpH 77395 76790 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940786.1 protein_id gnl|my_center|LOCUS_00670 78003 77488 gene locus_tag LOCUS_00680 78003 77488 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948670.1 protein_id gnl|my_center|LOCUS_00680 79823 78750 gene locus_tag LOCUS_00690 79823 78750 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931715.1 protein_id gnl|my_center|LOCUS_00690 80438 80010 gene locus_tag LOCUS_00700 80438 80010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 80730 80425 gene locus_tag LOCUS_00710 80730 80425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 80678 81388 gene locus_tag LOCUS_00720 80678 81388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 85652 81489 gene locus_tag LOCUS_00730 85652 81489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 86974 85772 gene locus_tag LOCUS_00740 gene nadA 86974 85772 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858544.1 protein_id gnl|my_center|LOCUS_00740 88433 87465 gene locus_tag LOCUS_00750 88433 87465 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110450429.1 protein_id gnl|my_center|LOCUS_00750 88506 90212 gene locus_tag LOCUS_00760 88506 90212 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_00760 90800 90243 gene locus_tag LOCUS_00770 90800 90243 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173273.1 protein_id gnl|my_center|LOCUS_00770 90901 92409 gene locus_tag LOCUS_00780 90901 92409 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_00780 92406 93251 gene locus_tag LOCUS_00790 92406 93251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 93264 94118 gene locus_tag LOCUS_00800 93264 94118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 94157 94642 gene locus_tag LOCUS_00810 gene arfB 94157 94642 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538074.1 protein_id gnl|my_center|LOCUS_00810 94851 95147 gene locus_tag LOCUS_00820 94851 95147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 96487 95315 gene locus_tag LOCUS_00830 gene purM 96487 95315 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461474.1 protein_id gnl|my_center|LOCUS_00830 96634 97575 gene locus_tag LOCUS_00840 gene sucD 96634 97575 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327387.1 protein_id gnl|my_center|LOCUS_00840 97791 98732 gene locus_tag LOCUS_00850 97791 98732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 100865 98835 gene locus_tag LOCUS_00860 100865 98835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 102589 100997 gene locus_tag LOCUS_00870 102589 100997 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_00870 104121 102586 gene locus_tag LOCUS_00880 gene glpK 104121 102586 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 protein_id gnl|my_center|LOCUS_00880 106737 104296 gene locus_tag LOCUS_00890 106737 104296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 106718 106993 gene locus_tag LOCUS_00900 106718 106993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 107931 107188 gene locus_tag LOCUS_00910 107931 107188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 108715 108086 gene locus_tag LOCUS_00920 108715 108086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 111815 109185 gene locus_tag LOCUS_00930 111815 109185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 113733 112009 gene locus_tag LOCUS_00940 113733 112009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 114302 113730 gene locus_tag LOCUS_00950 114302 113730 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963161.1 protein_id gnl|my_center|LOCUS_00950 115164 114667 gene locus_tag LOCUS_00960 gene rpsG 115164 114667 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326864.1 protein_id gnl|my_center|LOCUS_00960 >Feature sequence002 3016 1961 gene locus_tag LOCUS_00970 3016 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 4617 3013 gene locus_tag LOCUS_00980 4617 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 6336 4804 gene locus_tag LOCUS_00990 6336 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 7055 6333 gene locus_tag LOCUS_01000 7055 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 7540 7052 gene locus_tag LOCUS_01010 7540 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 8423 7554 gene locus_tag LOCUS_01020 8423 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 9010 8474 gene locus_tag LOCUS_01030 gene gspG 9010 8474 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202879.1 protein_id gnl|my_center|LOCUS_01030 10317 9133 gene locus_tag LOCUS_01040 10317 9133 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328284.1 protein_id gnl|my_center|LOCUS_01040 11216 10434 gene locus_tag LOCUS_01050 11216 10434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 11610 12533 gene locus_tag LOCUS_01060 11610 12533 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_01060 12765 15386 gene locus_tag LOCUS_01070 gene clpB 12765 15386 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388511.1 protein_id gnl|my_center|LOCUS_01070 16190 15405 gene locus_tag LOCUS_01080 16190 15405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 16297 18069 gene locus_tag LOCUS_01090 16297 18069 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532166.1 protein_id gnl|my_center|LOCUS_01090 19022 18105 gene locus_tag LOCUS_01100 19022 18105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 19719 19306 gene locus_tag LOCUS_01110 19719 19306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 22072 20042 gene locus_tag LOCUS_01120 22072 20042 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_01120 23235 22069 gene locus_tag LOCUS_01130 gene aroC 23235 22069 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_01130 24576 23344 gene locus_tag LOCUS_01140 24576 23344 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922308.1 protein_id gnl|my_center|LOCUS_01140 24662 25348 gene locus_tag LOCUS_01150 24662 25348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 26470 25391 gene locus_tag LOCUS_01160 26470 25391 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970366.1 protein_id gnl|my_center|LOCUS_01160 27780 26575 gene locus_tag LOCUS_01170 27780 26575 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_01170 28928 27777 gene locus_tag LOCUS_01180 28928 27777 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190908.1 protein_id gnl|my_center|LOCUS_01180 31225 28925 gene locus_tag LOCUS_01190 31225 28925 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525365.1 protein_id gnl|my_center|LOCUS_01190 31881 31222 gene locus_tag LOCUS_01200 31881 31222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 33085 31904 gene locus_tag LOCUS_01210 33085 31904 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266948.1 protein_id gnl|my_center|LOCUS_01210 33642 33133 gene locus_tag LOCUS_01220 33642 33133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 35723 33642 gene locus_tag LOCUS_01230 35723 33642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 36638 35868 gene locus_tag LOCUS_01240 36638 35868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 36653 36928 gene locus_tag LOCUS_01250 36653 36928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 39928 36932 gene locus_tag LOCUS_01260 39928 36932 CDS product bifunctional fucokinase/fucose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108144.1 protein_id gnl|my_center|LOCUS_01260 39923 40351 gene locus_tag LOCUS_01270 39923 40351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 40369 41832 gene locus_tag LOCUS_01280 40369 41832 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811709.1 protein_id gnl|my_center|LOCUS_01280 41836 42639 gene locus_tag LOCUS_01290 41836 42639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 43127 42663 gene locus_tag LOCUS_01300 43127 42663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 44566 43196 gene locus_tag LOCUS_01310 44566 43196 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021355.1 protein_id gnl|my_center|LOCUS_01310 44987 44832 gene locus_tag LOCUS_01320 44987 44832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 44932 45768 gene locus_tag LOCUS_01330 44932 45768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 46159 45782 gene locus_tag LOCUS_01340 46159 45782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 46437 46943 gene locus_tag LOCUS_01350 46437 46943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 46940 47569 gene locus_tag LOCUS_01360 46940 47569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 48360 48166 gene locus_tag LOCUS_01370 48360 48166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 50573 48711 gene locus_tag LOCUS_01380 50573 48711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 50682 51464 gene locus_tag LOCUS_01390 gene pgeF 50682 51464 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336849.1 protein_id gnl|my_center|LOCUS_01390 54306 51481 gene locus_tag LOCUS_01400 54306 51481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 55042 54497 gene locus_tag LOCUS_01410 55042 54497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 56921 55560 gene locus_tag LOCUS_01420 56921 55560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 56812 57492 gene locus_tag LOCUS_01430 56812 57492 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921226.1 protein_id gnl|my_center|LOCUS_01430 57692 57765 gene locus_tag LOCUS_t00010 57692 57765 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 58619 57939 gene locus_tag LOCUS_01440 58619 57939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 58941 59393 gene locus_tag LOCUS_01450 gene guaD 58941 59393 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245084.1 protein_id gnl|my_center|LOCUS_01450 59927 59427 gene locus_tag LOCUS_01460 59927 59427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 60197 61000 gene locus_tag LOCUS_01470 60197 61000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 61389 62558 gene locus_tag LOCUS_01480 gene coxB 61389 62558 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171472.1 protein_id gnl|my_center|LOCUS_01480 62686 64251 gene locus_tag LOCUS_01490 gene ctaD 62686 64251 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533221.1 protein_id gnl|my_center|LOCUS_01490 64420 64998 gene locus_tag LOCUS_01500 64420 64998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 64995 65846 gene locus_tag LOCUS_01510 64995 65846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 65843 66634 gene locus_tag LOCUS_01520 65843 66634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 66631 67218 gene locus_tag LOCUS_01530 66631 67218 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942294.1 protein_id gnl|my_center|LOCUS_01530 67220 68740 gene locus_tag LOCUS_01540 67220 68740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 68784 71321 gene locus_tag LOCUS_01550 68784 71321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 71318 71851 gene locus_tag LOCUS_01560 71318 71851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 71911 73614 gene locus_tag LOCUS_01570 71911 73614 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_01570 >Feature sequence003 2321 216 gene locus_tag LOCUS_01580 2321 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 3073 2318 gene locus_tag LOCUS_01590 3073 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 3486 3070 gene locus_tag LOCUS_01600 3486 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 3542 5542 gene locus_tag LOCUS_01610 3542 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 5673 6476 gene locus_tag LOCUS_01620 5673 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 6637 7089 gene locus_tag LOCUS_01630 6637 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 7645 7214 gene locus_tag LOCUS_01640 7645 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 8155 7733 gene locus_tag LOCUS_01650 gene iscU 8155 7733 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552476.1 protein_id gnl|my_center|LOCUS_01650 9502 8264 gene locus_tag LOCUS_01660 9502 8264 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209836.1 protein_id gnl|my_center|LOCUS_01660 9747 10610 gene locus_tag LOCUS_01670 gene panC 9747 10610 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_01670 10696 11943 gene locus_tag LOCUS_01680 10696 11943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 12038 13036 gene locus_tag LOCUS_01690 12038 13036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 13086 14069 gene locus_tag LOCUS_01700 13086 14069 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381308.1 protein_id gnl|my_center|LOCUS_01700 15764 14121 gene locus_tag LOCUS_01710 15764 14121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 18211 15983 gene locus_tag LOCUS_01720 18211 15983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 18471 19643 gene locus_tag LOCUS_01730 18471 19643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 19712 20089 gene locus_tag LOCUS_01740 19712 20089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 20682 20101 gene locus_tag LOCUS_01750 gene sixA 20682 20101 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814151.1 protein_id gnl|my_center|LOCUS_01750 20858 22108 gene locus_tag LOCUS_01760 gene hutI 20858 22108 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889408.1 protein_id gnl|my_center|LOCUS_01760 22213 23025 gene locus_tag LOCUS_01770 gene map 22213 23025 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233851.1 protein_id gnl|my_center|LOCUS_01770 23246 25348 gene locus_tag LOCUS_01780 23246 25348 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922509.1 protein_id gnl|my_center|LOCUS_01780 25535 26962 gene locus_tag LOCUS_01790 gene sthA 25535 26962 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_01790 31618 27761 gene locus_tag LOCUS_01800 31618 27761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 32504 31632 gene locus_tag LOCUS_01810 32504 31632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 33460 35730 gene locus_tag LOCUS_01820 gene pcrA 33460 35730 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457083.1 protein_id gnl|my_center|LOCUS_01820 35845 36798 gene locus_tag LOCUS_01830 35845 36798 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037441.1 protein_id gnl|my_center|LOCUS_01830 37107 36805 gene locus_tag LOCUS_01840 37107 36805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 38053 37310 gene locus_tag LOCUS_01850 38053 37310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 40334 38133 gene locus_tag LOCUS_01860 40334 38133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 40528 41262 gene locus_tag LOCUS_01870 40528 41262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 41383 42504 gene locus_tag LOCUS_01880 41383 42504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 43112 42579 gene locus_tag LOCUS_01890 43112 42579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 44683 43109 gene locus_tag LOCUS_01900 44683 43109 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804819.1 protein_id gnl|my_center|LOCUS_01900 46557 44911 gene locus_tag LOCUS_01910 46557 44911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 47475 46783 gene locus_tag LOCUS_01920 47475 46783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 48877 47834 gene locus_tag LOCUS_01930 gene fbp 48877 47834 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171118.1 protein_id gnl|my_center|LOCUS_01930 49037 50221 gene locus_tag LOCUS_01940 49037 50221 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257413.1 protein_id gnl|my_center|LOCUS_01940 51181 50348 gene locus_tag LOCUS_01950 51181 50348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 51238 52329 gene locus_tag LOCUS_01960 51238 52329 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_01960 54014 52458 gene locus_tag LOCUS_01970 gene ahcY 54014 52458 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_01970 54265 54969 gene locus_tag LOCUS_01980 54265 54969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 56024 55113 gene locus_tag LOCUS_01990 56024 55113 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 protein_id gnl|my_center|LOCUS_01990 56686 56102 gene locus_tag LOCUS_02000 56686 56102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 56904 57287 gene locus_tag LOCUS_02010 56904 57287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 57284 57838 gene locus_tag LOCUS_02020 57284 57838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 57869 59674 gene locus_tag LOCUS_02030 57869 59674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 61786 59714 gene locus_tag LOCUS_02040 gene pilB 61786 59714 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_02040 62535 61795 gene locus_tag LOCUS_02050 62535 61795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 63137 62532 gene locus_tag LOCUS_02060 63137 62532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 63970 63134 gene locus_tag LOCUS_02070 63970 63134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 65241 63988 gene locus_tag LOCUS_02080 65241 63988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 66803 65460 gene locus_tag LOCUS_02090 gene hisS 66803 65460 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_02090 67619 67008 gene locus_tag LOCUS_02100 67619 67008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 >Feature sequence004 128 1174 gene locus_tag LOCUS_02110 128 1174 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324646.1 protein_id gnl|my_center|LOCUS_02110 1192 1371 gene locus_tag LOCUS_02120 1192 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 2642 1389 gene locus_tag LOCUS_02130 2642 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 2748 5639 gene locus_tag LOCUS_02140 gene ileS 2748 5639 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903528.1 protein_id gnl|my_center|LOCUS_02140 6421 6873 gene locus_tag LOCUS_02150 6421 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 6931 7995 gene locus_tag LOCUS_02160 6931 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 8097 9146 gene locus_tag LOCUS_02170 8097 9146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 10483 9188 gene locus_tag LOCUS_02180 10483 9188 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_02180 11128 12066 gene locus_tag LOCUS_02190 11128 12066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 12056 13006 gene locus_tag LOCUS_02200 12056 13006 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921459.1 protein_id gnl|my_center|LOCUS_02200 13522 14082 gene locus_tag LOCUS_02210 13522 14082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 14632 14063 gene locus_tag LOCUS_02220 14632 14063 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258172.1 protein_id gnl|my_center|LOCUS_02220 14734 14661 gene locus_tag LOCUS_t00020 14734 14661 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15657 14725 gene locus_tag LOCUS_02230 15657 14725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 16356 15793 gene locus_tag LOCUS_02240 16356 15793 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941008.1 protein_id gnl|my_center|LOCUS_02240 18595 16991 gene locus_tag LOCUS_02250 gene purH 18595 16991 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391402.1 protein_id gnl|my_center|LOCUS_02250 20033 18705 gene locus_tag LOCUS_02260 20033 18705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 20121 20840 gene locus_tag LOCUS_02270 20121 20840 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803670.1 protein_id gnl|my_center|LOCUS_02270 21998 20847 gene locus_tag LOCUS_02280 21998 20847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 22664 22179 gene locus_tag LOCUS_02290 22664 22179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 22789 23094 gene locus_tag LOCUS_02300 22789 23094 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259014.1 protein_id gnl|my_center|LOCUS_02300 24135 23110 gene locus_tag LOCUS_02310 24135 23110 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805158.1 protein_id gnl|my_center|LOCUS_02310 24509 24132 gene locus_tag LOCUS_02320 24509 24132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 24661 25263 gene locus_tag LOCUS_02330 24661 25263 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_02330 26425 25265 gene locus_tag LOCUS_02340 26425 25265 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328432.1 protein_id gnl|my_center|LOCUS_02340 26982 26422 gene locus_tag LOCUS_02350 26982 26422 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391707.1 protein_id gnl|my_center|LOCUS_02350 27903 27064 gene locus_tag LOCUS_02360 gene kdsA 27903 27064 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938915.1 protein_id gnl|my_center|LOCUS_02360 28154 28945 gene locus_tag LOCUS_02370 28154 28945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123328.1 protein_id gnl|my_center|LOCUS_02370 30163 28949 gene locus_tag LOCUS_02380 30163 28949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 31628 30246 gene locus_tag LOCUS_02390 31628 30246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 31756 33015 gene locus_tag LOCUS_02400 31756 33015 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_02400 33145 35211 gene locus_tag LOCUS_02410 gene shc 33145 35211 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529547.1 protein_id gnl|my_center|LOCUS_02410 35769 38360 gene locus_tag LOCUS_02420 35769 38360 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_02420 38393 39304 gene locus_tag LOCUS_02430 gene rocF 38393 39304 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808692.1 protein_id gnl|my_center|LOCUS_02430 40050 39385 gene locus_tag LOCUS_02440 40050 39385 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267128.1 protein_id gnl|my_center|LOCUS_02440 40050 41339 gene locus_tag LOCUS_02450 40050 41339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 41336 43021 gene locus_tag LOCUS_02460 gene nadB 41336 43021 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119573.1 protein_id gnl|my_center|LOCUS_02460 43054 43719 gene locus_tag LOCUS_02470 43054 43719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 44442 43756 gene locus_tag LOCUS_02480 44442 43756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 47758 45173 gene locus_tag LOCUS_02490 47758 45173 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_02490 48093 49343 gene locus_tag LOCUS_02500 48093 49343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 50061 49369 gene locus_tag LOCUS_02510 50061 49369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_02510 51857 50058 gene locus_tag LOCUS_02520 51857 50058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 53089 51878 gene locus_tag LOCUS_02530 53089 51878 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259674.1 protein_id gnl|my_center|LOCUS_02530 53337 54458 gene locus_tag LOCUS_02540 53337 54458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 56222 54501 gene locus_tag LOCUS_02550 56222 54501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 56881 56291 gene locus_tag LOCUS_02560 56881 56291 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194258.1 protein_id gnl|my_center|LOCUS_02560 59781 56989 gene locus_tag LOCUS_02570 gene gyrA 59781 56989 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922184.1 protein_id gnl|my_center|LOCUS_02570 60796 59942 gene locus_tag LOCUS_02580 gene lpxI 60796 59942 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922990.1 protein_id gnl|my_center|LOCUS_02580 61509 60880 gene locus_tag LOCUS_02590 61509 60880 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_02590 61508 62656 gene locus_tag LOCUS_02600 61508 62656 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121149.1 protein_id gnl|my_center|LOCUS_02600 >Feature sequence005 <1 1309 gene locus_tag LOCUS_02610 <1 1309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030785.1:type I polyketide synthase 1538 1326 gene locus_tag LOCUS_02620 1538 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 1542 1922 gene locus_tag LOCUS_02630 1542 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 3319 1913 gene locus_tag LOCUS_02640 3319 1913 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392258.1 protein_id gnl|my_center|LOCUS_02640 4876 3587 gene locus_tag LOCUS_02650 4876 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037383.1 protein_id gnl|my_center|LOCUS_02650 7805 5022 gene locus_tag LOCUS_02660 gene ppdK 7805 5022 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921479.1 protein_id gnl|my_center|LOCUS_02660 8005 9369 gene locus_tag LOCUS_02670 gene pabB 8005 9369 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267422.1 protein_id gnl|my_center|LOCUS_02670 10117 9341 gene locus_tag LOCUS_02680 10117 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 12601 10313 gene locus_tag LOCUS_02690 12601 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 13845 12598 gene locus_tag LOCUS_02700 13845 12598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 15241 13940 gene locus_tag LOCUS_02710 15241 13940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 17781 15298 gene locus_tag LOCUS_02720 17781 15298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 20824 17879 gene locus_tag LOCUS_02730 gene leuS 20824 17879 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231035.1 protein_id gnl|my_center|LOCUS_02730 22824 20974 gene locus_tag LOCUS_02740 22824 20974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 23399 24196 gene locus_tag LOCUS_02750 23399 24196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 24283 26724 gene locus_tag LOCUS_02760 gene hrpB 24283 26724 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275159.1 protein_id gnl|my_center|LOCUS_02760 27477 26737 gene locus_tag LOCUS_02770 27477 26737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 28197 27529 gene locus_tag LOCUS_02780 28197 27529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 29319 28396 gene locus_tag LOCUS_02790 gene ftsY 29319 28396 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_02790 29822 29316 gene locus_tag LOCUS_02800 29822 29316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 30304 29819 gene locus_tag LOCUS_02810 gene ribH 30304 29819 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634050.1 protein_id gnl|my_center|LOCUS_02810 30536 31420 gene locus_tag LOCUS_02820 30536 31420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 31454 34684 gene locus_tag LOCUS_02830 31454 34684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 34681 35175 gene locus_tag LOCUS_02840 34681 35175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 35172 35693 gene locus_tag LOCUS_02850 35172 35693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 36748 35681 gene locus_tag LOCUS_02860 gene ruvB 36748 35681 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038139.1 protein_id gnl|my_center|LOCUS_02860 37413 36829 gene locus_tag LOCUS_02870 37413 36829 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313108.1 protein_id gnl|my_center|LOCUS_02870 38240 37410 gene locus_tag LOCUS_02880 38240 37410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 38818 38249 gene locus_tag LOCUS_02890 38818 38249 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313108.1 protein_id gnl|my_center|LOCUS_02890 39456 38938 gene locus_tag LOCUS_02900 39456 38938 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141664.1 protein_id gnl|my_center|LOCUS_02900 39529 41178 gene locus_tag LOCUS_02910 39529 41178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 41197 41952 gene locus_tag LOCUS_02920 41197 41952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 42709 41984 gene locus_tag LOCUS_02930 42709 41984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 43709 42807 gene locus_tag LOCUS_02940 43709 42807 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_02940 45027 43912 gene locus_tag LOCUS_02950 gene neuC 45027 43912 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946490.1 protein_id gnl|my_center|LOCUS_02950 46082 45039 gene locus_tag LOCUS_02960 gene neuB 46082 45039 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066398080.1 protein_id gnl|my_center|LOCUS_02960 46795 46079 gene locus_tag LOCUS_02970 46795 46079 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392279.1 protein_id gnl|my_center|LOCUS_02970 50673 46792 gene locus_tag LOCUS_02980 50673 46792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 53648 50853 gene locus_tag LOCUS_02990 53648 50853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 53823 54857 gene locus_tag LOCUS_03000 53823 54857 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_03000 54880 55542 gene locus_tag LOCUS_03010 gene pgmB 54880 55542 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965902.1 protein_id gnl|my_center|LOCUS_03010 55555 56682 gene locus_tag LOCUS_03020 55555 56682 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 protein_id gnl|my_center|LOCUS_03020 57049 56741 gene locus_tag LOCUS_03030 57049 56741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 57168 58055 gene locus_tag LOCUS_03040 57168 58055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 58645 58181 gene locus_tag LOCUS_03050 58645 58181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 60768 58642 gene locus_tag LOCUS_03060 gene tkt 60768 58642 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092005623.1 protein_id gnl|my_center|LOCUS_03060 61057 61494 gene locus_tag LOCUS_03070 61057 61494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 63398 61596 gene locus_tag LOCUS_03080 63398 61596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 63924 63598 gene locus_tag LOCUS_03090 63924 63598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 >Feature sequence006 <1 937 gene locus_tag LOCUS_03100 <1 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_093151333.1:serine hydrolase 1984 1124 gene locus_tag LOCUS_03110 1984 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 3094 2432 gene locus_tag LOCUS_03120 3094 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 3231 3094 gene locus_tag LOCUS_03130 3231 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 3288 3521 gene locus_tag LOCUS_03140 3288 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 6241 3554 gene locus_tag LOCUS_03150 6241 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 6439 7059 gene locus_tag LOCUS_03160 6439 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 7156 8628 gene locus_tag LOCUS_03170 7156 8628 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_03170 8918 8691 gene locus_tag LOCUS_03180 8918 8691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 9686 9300 gene locus_tag LOCUS_03190 9686 9300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 10070 9699 gene locus_tag LOCUS_03200 10070 9699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 10618 10226 gene locus_tag LOCUS_03210 10618 10226 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324235.1 protein_id gnl|my_center|LOCUS_03210 11721 10615 gene locus_tag LOCUS_03220 11721 10615 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121326.1 protein_id gnl|my_center|LOCUS_03220 13187 11829 gene locus_tag LOCUS_03230 13187 11829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 15196 13526 gene locus_tag LOCUS_03240 15196 13526 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_03240 16567 15293 gene locus_tag LOCUS_03250 16567 15293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 16847 17119 gene locus_tag LOCUS_03260 gene rpsT 16847 17119 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258282.1 protein_id gnl|my_center|LOCUS_03260 17276 18139 gene locus_tag LOCUS_03270 17276 18139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 18144 19151 gene locus_tag LOCUS_03280 18144 19151 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176584.1 protein_id gnl|my_center|LOCUS_03280 19324 19788 gene locus_tag LOCUS_03290 19324 19788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 19785 23321 gene locus_tag LOCUS_03300 19785 23321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 23348 24145 gene locus_tag LOCUS_03310 23348 24145 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228729.1 protein_id gnl|my_center|LOCUS_03310 24376 26967 gene locus_tag LOCUS_03320 24376 26967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 27289 29994 gene locus_tag LOCUS_03330 27289 29994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 30130 31158 gene locus_tag LOCUS_03340 30130 31158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 31220 31921 gene locus_tag LOCUS_03350 31220 31921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 33992 31992 gene locus_tag LOCUS_03360 33992 31992 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122293.1 protein_id gnl|my_center|LOCUS_03360 35179 33989 gene locus_tag LOCUS_03370 gene rlmN 35179 33989 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391076.1 protein_id gnl|my_center|LOCUS_03370 35231 35644 gene locus_tag LOCUS_03380 gene fdx 35231 35644 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656373.1 protein_id gnl|my_center|LOCUS_03380 35685 35882 gene locus_tag LOCUS_03390 gene iscX 35685 35882 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812452.1 protein_id gnl|my_center|LOCUS_03390 35934 37058 gene locus_tag LOCUS_03400 35934 37058 CDS product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535791.1 protein_id gnl|my_center|LOCUS_03400 37350 40535 gene locus_tag LOCUS_03410 37350 40535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 40557 43580 gene locus_tag LOCUS_03420 40557 43580 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 protein_id gnl|my_center|LOCUS_03420 43606 45585 gene locus_tag LOCUS_03430 43606 45585 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_03430 46409 45654 gene locus_tag LOCUS_03440 46409 45654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 47436 46558 gene locus_tag LOCUS_03450 47436 46558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 47866 47474 gene locus_tag LOCUS_03460 47866 47474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 48360 47863 gene locus_tag LOCUS_03470 48360 47863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 48884 48510 gene locus_tag LOCUS_03480 48884 48510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 48814 49122 gene locus_tag LOCUS_03490 48814 49122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 49544 49200 gene locus_tag LOCUS_03500 49544 49200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 49721 51442 gene locus_tag LOCUS_03510 49721 51442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 51477 52859 gene locus_tag LOCUS_03520 51477 52859 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123577.1 protein_id gnl|my_center|LOCUS_03520 53441 52881 gene locus_tag LOCUS_03530 53441 52881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 55111 53438 gene locus_tag LOCUS_03540 55111 53438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 55728 55108 gene locus_tag LOCUS_03550 55728 55108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 56117 55725 gene locus_tag LOCUS_03560 56117 55725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 56494 58155 gene locus_tag LOCUS_03570 56494 58155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 58155 59300 gene locus_tag LOCUS_03580 58155 59300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 60314 59325 gene locus_tag LOCUS_03590 60314 59325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 >Feature sequence007 <1 1323 gene locus_tag LOCUS_03600 <1 1323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326676.1:DUF1501 domain-containing protein 1393 3717 gene locus_tag LOCUS_03610 gene priA 1393 3717 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922147.1 protein_id gnl|my_center|LOCUS_03610 3805 6753 gene locus_tag LOCUS_03620 3805 6753 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943088.1 protein_id gnl|my_center|LOCUS_03620 6881 8140 gene locus_tag LOCUS_03630 gene odhB 6881 8140 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267377.1 protein_id gnl|my_center|LOCUS_03630 8249 9883 gene locus_tag LOCUS_03640 8249 9883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 10356 10015 gene locus_tag LOCUS_03650 10356 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 10658 10353 gene locus_tag LOCUS_03660 10658 10353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 13375 11309 gene locus_tag LOCUS_03670 13375 11309 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427469.1 protein_id gnl|my_center|LOCUS_03670 13818 13372 gene locus_tag LOCUS_03680 13818 13372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 14641 13877 gene locus_tag LOCUS_03690 14641 13877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 15847 14843 gene locus_tag LOCUS_03700 gene rsmH 15847 14843 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_03700 17223 15844 gene locus_tag LOCUS_03710 17223 15844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 18293 17211 gene locus_tag LOCUS_03720 18293 17211 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037025.1 protein_id gnl|my_center|LOCUS_03720 20594 18390 gene locus_tag LOCUS_03730 20594 18390 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122749.1 protein_id gnl|my_center|LOCUS_03730 25374 20632 gene locus_tag LOCUS_03740 25374 20632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 26253 25381 gene locus_tag LOCUS_03750 26253 25381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 27301 26243 gene locus_tag LOCUS_03760 gene xrt 27301 26243 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176633.1 protein_id gnl|my_center|LOCUS_03760 29339 27729 gene locus_tag LOCUS_03770 29339 27729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 30574 29627 gene locus_tag LOCUS_03780 30574 29627 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390938.1 protein_id gnl|my_center|LOCUS_03780 32092 30713 gene locus_tag LOCUS_03790 32092 30713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 33658 32645 gene locus_tag LOCUS_03800 33658 32645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 33726 35285 gene locus_tag LOCUS_03810 33726 35285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 35625 36275 gene locus_tag LOCUS_03820 35625 36275 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327156.1 protein_id gnl|my_center|LOCUS_03820 36313 36933 gene locus_tag LOCUS_03830 gene clpP 36313 36933 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461047.1 protein_id gnl|my_center|LOCUS_03830 37054 38139 gene locus_tag LOCUS_03840 37054 38139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 38937 38176 gene locus_tag LOCUS_03850 38937 38176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 39143 39451 gene locus_tag LOCUS_03860 39143 39451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 40438 39476 gene locus_tag LOCUS_03870 40438 39476 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_03870 40553 41563 gene locus_tag LOCUS_03880 40553 41563 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326093.1 protein_id gnl|my_center|LOCUS_03880 41579 42727 gene locus_tag LOCUS_03890 41579 42727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 42732 43667 gene locus_tag LOCUS_03900 42732 43667 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918022.1 protein_id gnl|my_center|LOCUS_03900 43740 45338 gene locus_tag LOCUS_03910 gene aroE 43740 45338 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_03910 45356 46012 gene locus_tag LOCUS_03920 45356 46012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 46183 47067 gene locus_tag LOCUS_03930 gene phhA 46183 47067 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035413.1 protein_id gnl|my_center|LOCUS_03930 47856 49229 gene locus_tag LOCUS_03940 47856 49229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 49243 49638 gene locus_tag LOCUS_03950 49243 49638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 49722 51668 gene locus_tag LOCUS_03960 49722 51668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 52777 51890 gene locus_tag LOCUS_03970 52777 51890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 53790 53140 gene locus_tag LOCUS_03980 53790 53140 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939535.1 protein_id gnl|my_center|LOCUS_03980 54768 53878 gene locus_tag LOCUS_03990 54768 53878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 54951 56777 gene locus_tag LOCUS_04000 54951 56777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 >Feature sequence008 374 589 gene locus_tag LOCUS_04010 374 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 733 3912 gene locus_tag LOCUS_04020 733 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 4304 5908 gene locus_tag LOCUS_04030 4304 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 6524 5925 gene locus_tag LOCUS_04040 6524 5925 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969359.1 protein_id gnl|my_center|LOCUS_04040 6599 8698 gene locus_tag LOCUS_04050 6599 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 8695 9648 gene locus_tag LOCUS_04060 8695 9648 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119360.1 protein_id gnl|my_center|LOCUS_04060 10641 9697 gene locus_tag LOCUS_04070 10641 9697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 12226 11066 gene locus_tag LOCUS_04080 12226 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122677.1 protein_id gnl|my_center|LOCUS_04080 13206 14663 gene locus_tag LOCUS_04090 13206 14663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 15041 14862 gene locus_tag LOCUS_04100 15041 14862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 15040 15756 gene locus_tag LOCUS_04110 15040 15756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 16058 16663 gene locus_tag LOCUS_04120 16058 16663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 16831 16950 gene locus_tag LOCUS_04130 16831 16950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 17154 17759 gene locus_tag LOCUS_04140 17154 17759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 17952 19265 gene locus_tag LOCUS_04150 gene xylA 17952 19265 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118969.1 protein_id gnl|my_center|LOCUS_04150 19338 19877 gene locus_tag LOCUS_04160 19338 19877 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256478.1 protein_id gnl|my_center|LOCUS_04160 20781 19897 gene locus_tag LOCUS_04170 gene galK 20781 19897 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381253.1 protein_id gnl|my_center|LOCUS_04170 22929 20923 gene locus_tag LOCUS_04180 22929 20923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 23739 23074 gene locus_tag LOCUS_04190 23739 23074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 23684 23944 gene locus_tag LOCUS_04200 23684 23944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 23948 25546 gene locus_tag LOCUS_04210 gene metG 23948 25546 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942872.1 protein_id gnl|my_center|LOCUS_04210 25867 26034 gene locus_tag LOCUS_04220 25867 26034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 27558 26059 gene locus_tag LOCUS_04230 gene cysS 27558 26059 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_237701980.1 protein_id gnl|my_center|LOCUS_04230 28209 27652 gene locus_tag LOCUS_04240 28209 27652 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974186.1 protein_id gnl|my_center|LOCUS_04240 28282 29178 gene locus_tag LOCUS_04250 28282 29178 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898431.1 protein_id gnl|my_center|LOCUS_04250 30030 29158 gene locus_tag LOCUS_04260 30030 29158 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176621.1 protein_id gnl|my_center|LOCUS_04260 30788 30030 gene locus_tag LOCUS_04270 30788 30030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 32092 30845 gene locus_tag LOCUS_04280 32092 30845 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019809.1 protein_id gnl|my_center|LOCUS_04280 33078 32098 gene locus_tag LOCUS_04290 33078 32098 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_04290 33470 33093 gene locus_tag LOCUS_04300 33470 33093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 33606 33409 gene locus_tag LOCUS_04310 33606 33409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 34504 33695 gene locus_tag LOCUS_04320 34504 33695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 34914 38588 gene locus_tag LOCUS_04330 34914 38588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 38810 39853 gene locus_tag LOCUS_04340 gene gmd 38810 39853 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_04340 40070 40822 gene locus_tag LOCUS_04350 40070 40822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 40827 41453 gene locus_tag LOCUS_04360 40827 41453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 43504 41507 gene locus_tag LOCUS_04370 43504 41507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 44802 43633 gene locus_tag LOCUS_04380 44802 43633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 46216 44849 gene locus_tag LOCUS_04390 46216 44849 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152045320.1 protein_id gnl|my_center|LOCUS_04390 46791 46309 gene locus_tag LOCUS_04400 46791 46309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 50121 46882 gene locus_tag LOCUS_04410 50121 46882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 >Feature sequence009 875 429 gene locus_tag LOCUS_04420 875 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 1045 1851 gene locus_tag LOCUS_04430 gene cdaA 1045 1851 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808428.1 protein_id gnl|my_center|LOCUS_04430 1848 2273 gene locus_tag LOCUS_04440 1848 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 3573 2290 gene locus_tag LOCUS_04450 gene tyrS 3573 2290 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262278.1 protein_id gnl|my_center|LOCUS_04450 4780 3683 gene locus_tag LOCUS_04460 gene tal 4780 3683 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805126.1 protein_id gnl|my_center|LOCUS_04460 5043 6824 gene locus_tag LOCUS_04470 gene pgi 5043 6824 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141691.1 protein_id gnl|my_center|LOCUS_04470 6923 8320 gene locus_tag LOCUS_04480 6923 8320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 8421 9611 gene locus_tag LOCUS_04490 gene nifS 8421 9611 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_04490 10330 9725 gene locus_tag LOCUS_04500 10330 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 10791 10708 gene locus_tag LOCUS_t00030 10791 10708 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12635 11394 gene locus_tag LOCUS_04510 gene recA 12635 11394 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_04510 12589 12966 gene locus_tag LOCUS_04520 12589 12966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 13259 13077 gene locus_tag LOCUS_04530 13259 13077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 14308 13337 gene locus_tag LOCUS_04540 14308 13337 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921666.1 protein_id gnl|my_center|LOCUS_04540 14488 15612 gene locus_tag LOCUS_04550 14488 15612 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038918.1 protein_id gnl|my_center|LOCUS_04550 15670 16395 gene locus_tag LOCUS_04560 15670 16395 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_04560 16630 17844 gene locus_tag LOCUS_04570 16630 17844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 18004 18993 gene locus_tag LOCUS_04580 18004 18993 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140012.1 protein_id gnl|my_center|LOCUS_04580 19239 20132 gene locus_tag LOCUS_04590 gene pstC 19239 20132 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405018.1 protein_id gnl|my_center|LOCUS_04590 20132 21067 gene locus_tag LOCUS_04600 gene pstA 20132 21067 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405019.1 protein_id gnl|my_center|LOCUS_04600 21105 21962 gene locus_tag LOCUS_04610 gene pstB 21105 21962 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663066.1 protein_id gnl|my_center|LOCUS_04610 21989 22645 gene locus_tag LOCUS_04620 21989 22645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 22989 23474 gene locus_tag LOCUS_04630 22989 23474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 24227 23499 gene locus_tag LOCUS_04640 gene rnc 24227 23499 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120177.1 protein_id gnl|my_center|LOCUS_04640 24480 24614 gene locus_tag LOCUS_04650 24480 24614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 24853 25413 gene locus_tag LOCUS_04660 gene aroL 24853 25413 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938191.1 protein_id gnl|my_center|LOCUS_04660 25820 25314 gene locus_tag LOCUS_04670 25820 25314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 26045 27025 gene locus_tag LOCUS_04680 gene ilvC 26045 27025 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_04680 27111 27971 gene locus_tag LOCUS_04690 27111 27971 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721584.1 protein_id gnl|my_center|LOCUS_04690 28541 28035 gene locus_tag LOCUS_04700 28541 28035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 30637 28538 gene locus_tag LOCUS_04710 gene ligA 30637 28538 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_04710 30640 31008 gene locus_tag LOCUS_04720 30640 31008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 31927 31091 gene locus_tag LOCUS_04730 31927 31091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 32161 32883 gene locus_tag LOCUS_04740 32161 32883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 32880 33992 gene locus_tag LOCUS_04750 32880 33992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 34159 35649 gene locus_tag LOCUS_04760 34159 35649 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_04760 35656 36972 gene locus_tag LOCUS_04770 35656 36972 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_04770 36979 37359 gene locus_tag LOCUS_04780 36979 37359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 38545 37379 gene locus_tag LOCUS_04790 38545 37379 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_04790 39503 38574 gene locus_tag LOCUS_04800 39503 38574 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383736.1 protein_id gnl|my_center|LOCUS_04800 39611 42550 gene locus_tag LOCUS_04810 39611 42550 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938263.1 protein_id gnl|my_center|LOCUS_04810 43674 42682 gene locus_tag LOCUS_04820 43674 42682 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 protein_id gnl|my_center|LOCUS_04820 44037 45416 gene locus_tag LOCUS_04830 44037 45416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 45728 47743 gene locus_tag LOCUS_04840 45728 47743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 47871 48272 gene locus_tag LOCUS_04850 47871 48272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 >Feature sequence010 1 1686 gene locus_tag LOCUS_04860 1 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 1748 2701 gene locus_tag LOCUS_04870 1748 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 3243 2713 gene locus_tag LOCUS_04880 gene pyrE 3243 2713 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903560.1 protein_id gnl|my_center|LOCUS_04880 4543 3293 gene locus_tag LOCUS_04890 4543 3293 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_04890 5575 4568 gene locus_tag LOCUS_04900 5575 4568 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_04900 6834 5641 gene locus_tag LOCUS_04910 6834 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 8946 6952 gene locus_tag LOCUS_04920 gene asnB 8946 6952 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_04920 10305 8959 gene locus_tag LOCUS_04930 10305 8959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 11438 10302 gene locus_tag LOCUS_04940 11438 10302 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061500.1 protein_id gnl|my_center|LOCUS_04940 11574 12509 gene locus_tag LOCUS_04950 11574 12509 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331386.1 protein_id gnl|my_center|LOCUS_04950 12513 13376 gene locus_tag LOCUS_04960 12513 13376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 13530 14693 gene locus_tag LOCUS_04970 13530 14693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 14690 15703 gene locus_tag LOCUS_04980 14690 15703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 15694 16587 gene locus_tag LOCUS_04990 15694 16587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 16614 17924 gene locus_tag LOCUS_05000 16614 17924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 17921 19213 gene locus_tag LOCUS_05010 17921 19213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 19210 20025 gene locus_tag LOCUS_05020 19210 20025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 20926 20042 gene locus_tag LOCUS_05030 20926 20042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 21576 20923 gene locus_tag LOCUS_05040 21576 20923 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532722.1 protein_id gnl|my_center|LOCUS_05040 22398 21634 gene locus_tag LOCUS_05050 22398 21634 CDS product Stf0 family sulphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969658.1 protein_id gnl|my_center|LOCUS_05050 23863 22385 gene locus_tag LOCUS_05060 23863 22385 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532721.1 protein_id gnl|my_center|LOCUS_05060 24691 23864 gene locus_tag LOCUS_05070 24691 23864 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186421.1 protein_id gnl|my_center|LOCUS_05070 26303 24753 gene locus_tag LOCUS_05080 26303 24753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 29391 26704 gene locus_tag LOCUS_05090 29391 26704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 31289 29721 gene locus_tag LOCUS_05100 31289 29721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 33131 31632 gene locus_tag LOCUS_05110 33131 31632 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121461.1 protein_id gnl|my_center|LOCUS_05110 33479 35299 gene locus_tag LOCUS_05120 33479 35299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 35408 36367 gene locus_tag LOCUS_05130 35408 36367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 36684 39332 gene locus_tag LOCUS_05140 36684 39332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 39430 40770 gene locus_tag LOCUS_05150 39430 40770 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056626.1 protein_id gnl|my_center|LOCUS_05150 40878 43601 gene locus_tag LOCUS_05160 gene acnA 40878 43601 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888355.1 protein_id gnl|my_center|LOCUS_05160 >Feature sequence011 2179 392 gene locus_tag LOCUS_05170 2179 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 2434 2778 gene locus_tag LOCUS_05180 2434 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 5100 2872 gene locus_tag LOCUS_05190 5100 2872 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946450.1 protein_id gnl|my_center|LOCUS_05190 6027 5314 gene locus_tag LOCUS_05200 6027 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 6992 6024 gene locus_tag LOCUS_05210 6992 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 7152 7904 gene locus_tag LOCUS_05220 7152 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 8016 8522 gene locus_tag LOCUS_05230 8016 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 10094 8913 gene locus_tag LOCUS_05240 gene purT 10094 8913 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932738.1 protein_id gnl|my_center|LOCUS_05240 10555 10091 gene locus_tag LOCUS_05250 10555 10091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 11732 10599 gene locus_tag LOCUS_05260 gene truD 11732 10599 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881119.1 protein_id gnl|my_center|LOCUS_05260 11846 12952 gene locus_tag LOCUS_05270 11846 12952 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958355.1 protein_id gnl|my_center|LOCUS_05270 12971 13693 gene locus_tag LOCUS_05280 12971 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337106.1 protein_id gnl|my_center|LOCUS_05280 15268 13721 gene locus_tag LOCUS_05290 15268 13721 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402000.1 protein_id gnl|my_center|LOCUS_05290 16151 15261 gene locus_tag LOCUS_05300 16151 15261 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_05300 16601 16218 gene locus_tag LOCUS_05310 16601 16218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 17189 16764 gene locus_tag LOCUS_05320 17189 16764 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190402.1 protein_id gnl|my_center|LOCUS_05320 18554 17205 gene locus_tag LOCUS_05330 gene astB 18554 17205 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706894.1 protein_id gnl|my_center|LOCUS_05330 19685 18627 gene locus_tag LOCUS_05340 19685 18627 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229444.1 protein_id gnl|my_center|LOCUS_05340 19778 20656 gene locus_tag LOCUS_05350 19778 20656 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533022.1 protein_id gnl|my_center|LOCUS_05350 21496 20714 gene locus_tag LOCUS_05360 21496 20714 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184824.1 protein_id gnl|my_center|LOCUS_05360 22851 21493 gene locus_tag LOCUS_05370 22851 21493 CDS product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651334.1 protein_id gnl|my_center|LOCUS_05370 23873 22848 gene locus_tag LOCUS_05380 23873 22848 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975562.1 protein_id gnl|my_center|LOCUS_05380 25416 23992 gene locus_tag LOCUS_05390 25416 23992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 26034 25444 gene locus_tag LOCUS_05400 26034 25444 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528750.1 protein_id gnl|my_center|LOCUS_05400 28600 26081 gene locus_tag LOCUS_05410 28600 26081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 29789 28638 gene locus_tag LOCUS_05420 29789 28638 CDS product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089858.1 protein_id gnl|my_center|LOCUS_05420 30533 29991 gene locus_tag LOCUS_05430 30533 29991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 30973 32415 gene locus_tag LOCUS_05440 30973 32415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 33285 32431 gene locus_tag LOCUS_05450 33285 32431 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_05450 34785 33346 gene locus_tag LOCUS_05460 34785 33346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 36498 34840 gene locus_tag LOCUS_05470 36498 34840 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_05470 37634 36591 gene locus_tag LOCUS_05480 37634 36591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118058.1 protein_id gnl|my_center|LOCUS_05480 40108 37631 gene locus_tag LOCUS_05490 40108 37631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 42267 40252 gene locus_tag LOCUS_05500 42267 40252 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122605.1 protein_id gnl|my_center|LOCUS_05500 >Feature sequence012 3237 1264 gene locus_tag LOCUS_05510 3237 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 4836 3370 gene locus_tag LOCUS_05520 4836 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 6980 4836 gene locus_tag LOCUS_05530 6980 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 7618 9018 gene locus_tag LOCUS_05540 7618 9018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 10885 9191 gene locus_tag LOCUS_05550 10885 9191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 11737 11051 gene locus_tag LOCUS_05560 11737 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 11761 12486 gene locus_tag LOCUS_05570 11761 12486 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_05570 13927 12533 gene locus_tag LOCUS_05580 13927 12533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 14313 14489 gene locus_tag LOCUS_05590 14313 14489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 14679 16124 gene locus_tag LOCUS_05600 14679 16124 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529548.1 protein_id gnl|my_center|LOCUS_05600 16426 16211 gene locus_tag LOCUS_05610 16426 16211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 16455 19055 gene locus_tag LOCUS_05620 16455 19055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 19060 20007 gene locus_tag LOCUS_05630 19060 20007 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256857.1 protein_id gnl|my_center|LOCUS_05630 20115 20972 gene locus_tag LOCUS_05640 20115 20972 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_05640 21102 22499 gene locus_tag LOCUS_05650 gene serS 21102 22499 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887919.1 protein_id gnl|my_center|LOCUS_05650 23564 22551 gene locus_tag LOCUS_05660 23564 22551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 25197 23692 gene locus_tag LOCUS_05670 25197 23692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 25333 25406 gene locus_tag LOCUS_t00040 25333 25406 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 26639 25515 gene locus_tag LOCUS_05680 26639 25515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 27026 27277 gene locus_tag LOCUS_05690 27026 27277 CDS product hexameric tyrosine-coordinated heme protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963152.1 protein_id gnl|my_center|LOCUS_05690 27484 28359 gene locus_tag LOCUS_05700 27484 28359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 29623 28367 gene locus_tag LOCUS_05710 gene metK 29623 28367 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392413.1 protein_id gnl|my_center|LOCUS_05710 30999 29620 gene locus_tag LOCUS_05720 30999 29620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 31337 30996 gene locus_tag LOCUS_05730 31337 30996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 33194 31695 gene locus_tag LOCUS_05740 33194 31695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 35458 34211 gene locus_tag LOCUS_05750 35458 34211 CDS product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848418.1 protein_id gnl|my_center|LOCUS_05750 37026 35470 gene locus_tag LOCUS_05760 37026 35470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 37690 38112 gene locus_tag LOCUS_05770 37690 38112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 38651 41227 gene locus_tag LOCUS_05780 38651 41227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 42027 41809 gene locus_tag LOCUS_05790 42027 41809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 41959 42435 gene locus_tag LOCUS_05800 41959 42435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 >Feature sequence013 4054 287 gene locus_tag LOCUS_05810 4054 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 4638 6887 gene locus_tag LOCUS_05820 4638 6887 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338076.1 protein_id gnl|my_center|LOCUS_05820 8041 7034 gene locus_tag LOCUS_05830 gene pheS 8041 7034 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121253.1 protein_id gnl|my_center|LOCUS_05830 8175 8954 gene locus_tag LOCUS_05840 8175 8954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 9696 9070 gene locus_tag LOCUS_05850 9696 9070 CDS product L17 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123829.1 protein_id gnl|my_center|LOCUS_05850 10884 9886 gene locus_tag LOCUS_05860 10884 9886 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328400.1 protein_id gnl|my_center|LOCUS_05860 11511 11113 gene locus_tag LOCUS_05870 gene rpsK 11511 11113 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328401.1 protein_id gnl|my_center|LOCUS_05870 12088 11663 gene locus_tag LOCUS_05880 gene rpsM 12088 11663 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258255.1 protein_id gnl|my_center|LOCUS_05880 12778 12563 gene locus_tag LOCUS_05890 gene infA 12778 12563 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546095.1 protein_id gnl|my_center|LOCUS_05890 13852 12863 gene locus_tag LOCUS_05900 gene map 13852 12863 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869907.1 protein_id gnl|my_center|LOCUS_05900 15271 13853 gene locus_tag LOCUS_05910 gene secY 15271 13853 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326816.1 protein_id gnl|my_center|LOCUS_05910 15952 15470 gene locus_tag LOCUS_05920 gene rplO 15952 15470 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810128.1 protein_id gnl|my_center|LOCUS_05920 16933 16139 gene locus_tag LOCUS_05930 16933 16139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 17429 17070 gene locus_tag LOCUS_05940 gene rplR 17429 17070 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357434.1 protein_id gnl|my_center|LOCUS_05940 18101 17532 gene locus_tag LOCUS_05950 gene rplF 18101 17532 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121609.1 protein_id gnl|my_center|LOCUS_05950 18683 18285 gene locus_tag LOCUS_05960 gene rpsH 18683 18285 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245511.1 protein_id gnl|my_center|LOCUS_05960 18959 18774 gene locus_tag LOCUS_05970 18959 18774 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851478.1 protein_id gnl|my_center|LOCUS_05970 19608 19009 gene locus_tag LOCUS_05980 gene rplE 19608 19009 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403807.1 protein_id gnl|my_center|LOCUS_05980 20201 19749 gene locus_tag LOCUS_05990 20201 19749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 20591 20205 gene locus_tag LOCUS_06000 gene rplN 20591 20205 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326806.1 protein_id gnl|my_center|LOCUS_06000 21068 20784 gene locus_tag LOCUS_06010 21068 20784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 21298 21077 gene locus_tag LOCUS_06020 21298 21077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 21897 21475 gene locus_tag LOCUS_06030 gene rplP 21897 21475 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121605.1 protein_id gnl|my_center|LOCUS_06030 22692 21991 gene locus_tag LOCUS_06040 gene rpsC 22692 21991 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814512.1 protein_id gnl|my_center|LOCUS_06040 23064 22717 gene locus_tag LOCUS_06050 gene rplV 23064 22717 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383164.1 protein_id gnl|my_center|LOCUS_06050 23421 23143 gene locus_tag LOCUS_06060 gene rpsS 23421 23143 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_06060 24474 23623 gene locus_tag LOCUS_06070 gene rplB 24474 23623 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121603.1 protein_id gnl|my_center|LOCUS_06070 24837 24559 gene locus_tag LOCUS_06080 gene rplW 24837 24559 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963467.1 protein_id gnl|my_center|LOCUS_06080 25649 24837 gene locus_tag LOCUS_06090 gene rplD 25649 24837 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326797.1 protein_id gnl|my_center|LOCUS_06090 26695 25976 gene locus_tag LOCUS_06100 gene rplC 26695 25976 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_06100 27247 26939 gene locus_tag LOCUS_06110 gene rpsJ 27247 26939 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495158.1 protein_id gnl|my_center|LOCUS_06110 27880 29370 gene locus_tag LOCUS_06120 27880 29370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 29385 30101 gene locus_tag LOCUS_06130 29385 30101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 30124 30903 gene locus_tag LOCUS_06140 30124 30903 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_06140 30900 32198 gene locus_tag LOCUS_06150 30900 32198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 33728 32727 gene locus_tag LOCUS_06160 33728 32727 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_06160 34709 33765 gene locus_tag LOCUS_06170 34709 33765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 36343 34706 gene locus_tag LOCUS_06180 36343 34706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 38040 36340 gene locus_tag LOCUS_06190 gene lysS 38040 36340 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672011.1 protein_id gnl|my_center|LOCUS_06190 38155 39297 gene locus_tag LOCUS_06200 38155 39297 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459676.1 protein_id gnl|my_center|LOCUS_06200 39350 40396 gene locus_tag LOCUS_06210 39350 40396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 >Feature sequence014 1414 464 gene locus_tag LOCUS_06220 1414 464 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920613.1 protein_id gnl|my_center|LOCUS_06220 1470 3503 gene locus_tag LOCUS_06230 1470 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 3638 4093 gene locus_tag LOCUS_06240 3638 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 5620 4211 gene locus_tag LOCUS_06250 gene rsmB 5620 4211 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838452.1 protein_id gnl|my_center|LOCUS_06250 6915 5617 gene locus_tag LOCUS_06260 gene metK 6915 5617 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533374.1 protein_id gnl|my_center|LOCUS_06260 7353 8870 gene locus_tag LOCUS_06270 7353 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 8982 9440 gene locus_tag LOCUS_06280 8982 9440 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328635.1 protein_id gnl|my_center|LOCUS_06280 9433 10872 gene locus_tag LOCUS_06290 gene truD 9433 10872 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941188.1 protein_id gnl|my_center|LOCUS_06290 11552 10911 gene locus_tag LOCUS_06300 11552 10911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 12137 11604 gene locus_tag LOCUS_06310 gene tadA 12137 11604 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325362.1 protein_id gnl|my_center|LOCUS_06310 13429 12245 gene locus_tag LOCUS_06320 13429 12245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 13605 14399 gene locus_tag LOCUS_06330 13605 14399 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396453.1 protein_id gnl|my_center|LOCUS_06330 14670 15323 gene locus_tag LOCUS_06340 14670 15323 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123848.1 protein_id gnl|my_center|LOCUS_06340 15408 18716 gene locus_tag LOCUS_06350 15408 18716 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 protein_id gnl|my_center|LOCUS_06350 18713 20200 gene locus_tag LOCUS_06360 gene nrfD 18713 20200 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_06360 20216 20833 gene locus_tag LOCUS_06370 20216 20833 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_06370 20837 21604 gene locus_tag LOCUS_06380 20837 21604 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421545.1 protein_id gnl|my_center|LOCUS_06380 21604 22932 gene locus_tag LOCUS_06390 21604 22932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922553.1 protein_id gnl|my_center|LOCUS_06390 22984 23304 gene locus_tag LOCUS_06400 22984 23304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 23311 24234 gene locus_tag LOCUS_06410 23311 24234 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_06410 24249 25418 gene locus_tag LOCUS_06420 gene coxB 24249 25418 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404828.1 protein_id gnl|my_center|LOCUS_06420 25516 27210 gene locus_tag LOCUS_06430 25516 27210 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328372.1 protein_id gnl|my_center|LOCUS_06430 27214 28182 gene locus_tag LOCUS_06440 27214 28182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 28330 28716 gene locus_tag LOCUS_06450 28330 28716 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123858.1 protein_id gnl|my_center|LOCUS_06450 28767 29360 gene locus_tag LOCUS_06460 28767 29360 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142159.1 protein_id gnl|my_center|LOCUS_06460 31224 30034 gene locus_tag LOCUS_06470 31224 30034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 32225 31221 gene locus_tag LOCUS_06480 gene cyoE 32225 31221 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_06480 32417 33874 gene locus_tag LOCUS_06490 32417 33874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 35359 33884 gene locus_tag LOCUS_06500 35359 33884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 35821 35510 gene locus_tag LOCUS_06510 35821 35510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 36908 35919 gene locus_tag LOCUS_06520 36908 35919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 37076 38113 gene locus_tag LOCUS_06530 37076 38113 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_06530 38554 38751 gene locus_tag LOCUS_06540 38554 38751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 >Feature sequence015 76 285 gene locus_tag LOCUS_06550 76 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 497 3463 gene locus_tag LOCUS_06560 gene uvrA 497 3463 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467399.1 protein_id gnl|my_center|LOCUS_06560 4191 3568 gene locus_tag LOCUS_06570 4191 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 5759 4200 gene locus_tag LOCUS_06580 5759 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 5831 6271 gene locus_tag LOCUS_06590 5831 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 6268 6870 gene locus_tag LOCUS_06600 gene purN 6268 6870 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390017.1 protein_id gnl|my_center|LOCUS_06600 6867 8363 gene locus_tag LOCUS_06610 6867 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 8445 9320 gene locus_tag LOCUS_06620 8445 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 9422 9724 gene locus_tag LOCUS_06630 gene raiA 9422 9724 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021962.1 protein_id gnl|my_center|LOCUS_06630 9889 10365 gene locus_tag LOCUS_06640 9889 10365 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_06640 10370 10645 gene locus_tag LOCUS_06650 10370 10645 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218178.1 protein_id gnl|my_center|LOCUS_06650 11859 10690 gene locus_tag LOCUS_06660 11859 10690 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_06660 12194 11937 gene locus_tag LOCUS_06670 12194 11937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 12337 14364 gene locus_tag LOCUS_06680 12337 14364 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113075.1 protein_id gnl|my_center|LOCUS_06680 14550 15620 gene locus_tag LOCUS_06690 14550 15620 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_06690 15675 16847 gene locus_tag LOCUS_06700 gene mnmA 15675 16847 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120981.1 protein_id gnl|my_center|LOCUS_06700 16844 17797 gene locus_tag LOCUS_06710 16844 17797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118516.1 protein_id gnl|my_center|LOCUS_06710 18365 20482 gene locus_tag LOCUS_06720 gene fusA 18365 20482 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258228.1 protein_id gnl|my_center|LOCUS_06720 20634 22520 gene locus_tag LOCUS_06730 20634 22520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 22517 23650 gene locus_tag LOCUS_06740 gene ribD 22517 23650 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150215.1 protein_id gnl|my_center|LOCUS_06740 25103 23700 gene locus_tag LOCUS_06750 25103 23700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 27958 25100 gene locus_tag LOCUS_06760 27958 25100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 28845 27955 gene locus_tag LOCUS_06770 gene gldA 28845 27955 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_06770 29297 30964 gene locus_tag LOCUS_06780 29297 30964 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331356.1 protein_id gnl|my_center|LOCUS_06780 32133 30997 gene locus_tag LOCUS_06790 gene prmC 32133 30997 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_06790 32437 32889 gene locus_tag LOCUS_06800 32437 32889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 33005 34645 gene locus_tag LOCUS_06810 33005 34645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 34803 37820 gene locus_tag LOCUS_06820 34803 37820 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142749.1 protein_id gnl|my_center|LOCUS_06820 >Feature sequence016 1 1749 gene locus_tag LOCUS_06830 1 1749 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728459.1 protein_id gnl|my_center|LOCUS_06830 3716 1788 gene locus_tag LOCUS_06840 3716 1788 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920572.1 protein_id gnl|my_center|LOCUS_06840 5474 3897 gene locus_tag LOCUS_06850 5474 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 5927 6427 gene locus_tag LOCUS_06860 5927 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 7252 6455 gene locus_tag LOCUS_06870 7252 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 8185 7358 gene locus_tag LOCUS_06880 8185 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 8312 8833 gene locus_tag LOCUS_06890 gene purE 8312 8833 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115451.1 protein_id gnl|my_center|LOCUS_06890 8830 10032 gene locus_tag LOCUS_06900 8830 10032 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037635.1 protein_id gnl|my_center|LOCUS_06900 10078 10524 gene locus_tag LOCUS_06910 10078 10524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 11628 10633 gene locus_tag LOCUS_06920 gene xerC 11628 10633 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_06920 12766 12005 gene locus_tag LOCUS_06930 12766 12005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 14225 13092 gene locus_tag LOCUS_06940 14225 13092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 14224 14550 gene locus_tag LOCUS_06950 14224 14550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 14666 14739 gene locus_tag LOCUS_t00050 14666 14739 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 14937 18185 gene locus_tag LOCUS_06960 14937 18185 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020247.1 protein_id gnl|my_center|LOCUS_06960 18182 19429 gene locus_tag LOCUS_06970 18182 19429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 20114 19491 gene locus_tag LOCUS_06980 20114 19491 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883553.1 protein_id gnl|my_center|LOCUS_06980 23732 20136 gene locus_tag LOCUS_06990 23732 20136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 24339 24677 gene locus_tag LOCUS_07000 24339 24677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 24940 26061 gene locus_tag LOCUS_07010 24940 26061 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405202.1 protein_id gnl|my_center|LOCUS_07010 27405 26104 gene locus_tag LOCUS_07020 27405 26104 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057937.1 protein_id gnl|my_center|LOCUS_07020 27619 28200 gene locus_tag LOCUS_07030 27619 28200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 28264 28983 gene locus_tag LOCUS_07040 28264 28983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 29058 30725 gene locus_tag LOCUS_07050 29058 30725 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 protein_id gnl|my_center|LOCUS_07050 30851 32176 gene locus_tag LOCUS_07060 30851 32176 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532876.1 protein_id gnl|my_center|LOCUS_07060 32183 35329 gene locus_tag LOCUS_07070 32183 35329 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532875.1 protein_id gnl|my_center|LOCUS_07070 35329 36660 gene locus_tag LOCUS_07080 gene pepP 35329 36660 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693180.1 protein_id gnl|my_center|LOCUS_07080 >Feature sequence017 4166 624 gene locus_tag LOCUS_07090 gene carB 4166 624 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123580.1 protein_id gnl|my_center|LOCUS_07090 4572 5369 gene locus_tag LOCUS_07100 4572 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 5403 6053 gene locus_tag LOCUS_07110 5403 6053 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326966.1 protein_id gnl|my_center|LOCUS_07110 6134 7231 gene locus_tag LOCUS_07120 6134 7231 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 protein_id gnl|my_center|LOCUS_07120 7321 7809 gene locus_tag LOCUS_07130 gene ruvX 7321 7809 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939356.1 protein_id gnl|my_center|LOCUS_07130 7824 9782 gene locus_tag LOCUS_07140 7824 9782 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403487.1 protein_id gnl|my_center|LOCUS_07140 10620 9820 gene locus_tag LOCUS_07150 gene pgl 10620 9820 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_07150 12162 10651 gene locus_tag LOCUS_07160 gene zwf 12162 10651 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056390.1 protein_id gnl|my_center|LOCUS_07160 13165 12224 gene locus_tag LOCUS_07170 gene xerD 13165 12224 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921953.1 protein_id gnl|my_center|LOCUS_07170 13409 13110 gene locus_tag LOCUS_07180 13409 13110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 13734 14150 gene locus_tag LOCUS_07190 13734 14150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 14147 14944 gene locus_tag LOCUS_07200 14147 14944 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338881.1 protein_id gnl|my_center|LOCUS_07200 15032 15841 gene locus_tag LOCUS_07210 gene flgG 15032 15841 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382032.1 protein_id gnl|my_center|LOCUS_07210 15860 16954 gene locus_tag LOCUS_07220 15860 16954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 16978 17829 gene locus_tag LOCUS_07230 16978 17829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 18665 17859 gene locus_tag LOCUS_07240 gene trpC 18665 17859 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122620.1 protein_id gnl|my_center|LOCUS_07240 18841 19770 gene locus_tag LOCUS_07250 18841 19770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 19813 20892 gene locus_tag LOCUS_07260 gene trpS 19813 20892 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769841.1 protein_id gnl|my_center|LOCUS_07260 21336 20941 gene locus_tag LOCUS_07270 gene apaG 21336 20941 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533640.1 protein_id gnl|my_center|LOCUS_07270 21426 22535 gene locus_tag LOCUS_07280 21426 22535 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087456.1 protein_id gnl|my_center|LOCUS_07280 23000 23072 gene locus_tag LOCUS_t00060 23000 23072 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 23761 23201 gene locus_tag LOCUS_07290 23761 23201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 <36730 23761 gene locus_tag LOCUS_07300 <36730 23761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940997.1:type II secretion system secretin GspD >Feature sequence018 949 80 gene locus_tag LOCUS_07310 949 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 1324 1115 gene locus_tag LOCUS_07320 1324 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 1247 4960 gene locus_tag LOCUS_07330 1247 4960 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615762.1 protein_id gnl|my_center|LOCUS_07330 5068 6408 gene locus_tag LOCUS_07340 5068 6408 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943599.1 protein_id gnl|my_center|LOCUS_07340 6830 6432 gene locus_tag LOCUS_07350 6830 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 7032 7745 gene locus_tag LOCUS_07360 7032 7745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 7824 8075 gene locus_tag LOCUS_07370 7824 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 9387 8116 gene locus_tag LOCUS_07380 9387 8116 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327204.1 protein_id gnl|my_center|LOCUS_07380 9693 10211 gene locus_tag LOCUS_07390 9693 10211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 10564 10779 gene locus_tag LOCUS_07400 10564 10779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 11347 11991 gene locus_tag LOCUS_07410 gene dapB 11347 11991 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037010.1 protein_id gnl|my_center|LOCUS_07410 12595 12131 gene locus_tag LOCUS_07420 12595 12131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 12778 13311 gene locus_tag LOCUS_07430 12778 13311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 13308 13580 gene locus_tag LOCUS_07440 13308 13580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 13709 13587 gene locus_tag LOCUS_07450 13709 13587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 14230 15693 gene locus_tag LOCUS_07460 14230 15693 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957726.1 protein_id gnl|my_center|LOCUS_07460 16356 15724 gene locus_tag LOCUS_07470 16356 15724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 17190 16606 gene locus_tag LOCUS_07480 17190 16606 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067204.1 protein_id gnl|my_center|LOCUS_07480 17356 18183 gene locus_tag LOCUS_07490 17356 18183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 18791 18390 gene locus_tag LOCUS_07500 18791 18390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 18790 19569 gene locus_tag LOCUS_07510 18790 19569 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539281.1 protein_id gnl|my_center|LOCUS_07510 19569 20297 gene locus_tag LOCUS_07520 19569 20297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 21061 20321 gene locus_tag LOCUS_07530 21061 20321 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_07530 21249 22136 gene locus_tag LOCUS_07540 21249 22136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 22559 24514 gene locus_tag LOCUS_07550 22559 24514 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839145.1 protein_id gnl|my_center|LOCUS_07550 24672 25769 gene locus_tag LOCUS_07560 24672 25769 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388795.1 protein_id gnl|my_center|LOCUS_07560 26418 25942 gene locus_tag LOCUS_07570 26418 25942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 27689 26415 gene locus_tag LOCUS_07580 27689 26415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 27897 28109 gene locus_tag LOCUS_07590 27897 28109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 28690 28115 gene locus_tag LOCUS_07600 gene gmk 28690 28115 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515790.1 protein_id gnl|my_center|LOCUS_07600 29754 28693 gene locus_tag LOCUS_07610 29754 28693 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_07610 29817 30263 gene locus_tag LOCUS_07620 29817 30263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 31181 30396 gene locus_tag LOCUS_07630 31181 30396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 31700 31233 gene locus_tag LOCUS_07640 31700 31233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 31906 31832 gene locus_tag LOCUS_t00070 31906 31832 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 32155 31976 gene locus_tag LOCUS_07650 32155 31976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 33559 32351 gene locus_tag LOCUS_07660 gene tuf 33559 32351 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121621.1 protein_id gnl|my_center|LOCUS_07660 33769 33698 gene locus_tag LOCUS_t00080 33769 33698 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 35101 34235 gene locus_tag LOCUS_07670 35101 34235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence019 2188 239 gene locus_tag LOCUS_07680 2188 239 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104754.1 protein_id gnl|my_center|LOCUS_07680 2315 3349 gene locus_tag LOCUS_07690 2315 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 4642 3365 gene locus_tag LOCUS_07700 gene kynU 4642 3365 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057429.1 protein_id gnl|my_center|LOCUS_07700 4767 6227 gene locus_tag LOCUS_07710 4767 6227 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036736.1 protein_id gnl|my_center|LOCUS_07710 6224 7018 gene locus_tag LOCUS_07720 6224 7018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 7021 7683 gene locus_tag LOCUS_07730 gene kynB 7021 7683 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198883.1 protein_id gnl|my_center|LOCUS_07730 7667 8104 gene locus_tag LOCUS_07740 7667 8104 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462120.1 protein_id gnl|my_center|LOCUS_07740 8664 8149 gene locus_tag LOCUS_07750 8664 8149 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193331.1 protein_id gnl|my_center|LOCUS_07750 10145 8661 gene locus_tag LOCUS_07760 10145 8661 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_07760 10942 10142 gene locus_tag LOCUS_07770 10942 10142 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_07770 12790 11051 gene locus_tag LOCUS_07780 12790 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 12975 15095 gene locus_tag LOCUS_07790 12975 15095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 16737 15085 gene locus_tag LOCUS_07800 16737 15085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 18440 16836 gene locus_tag LOCUS_07810 18440 16836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 20130 18637 gene locus_tag LOCUS_07820 gene der 20130 18637 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330049.1 protein_id gnl|my_center|LOCUS_07820 21780 20134 gene locus_tag LOCUS_07830 gene gpmI 21780 20134 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435040.1 protein_id gnl|my_center|LOCUS_07830 22050 22883 gene locus_tag LOCUS_07840 22050 22883 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_07840 23064 23762 gene locus_tag LOCUS_07850 23064 23762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 25451 23961 gene locus_tag LOCUS_07860 25451 23961 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122596.1 protein_id gnl|my_center|LOCUS_07860 28563 25462 gene locus_tag LOCUS_07870 28563 25462 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122595.1 protein_id gnl|my_center|LOCUS_07870 29860 28826 gene locus_tag LOCUS_07880 29860 28826 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086857074.1 protein_id gnl|my_center|LOCUS_07880 31257 30256 gene locus_tag LOCUS_07890 31257 30256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 31306 31518 gene locus_tag LOCUS_07900 31306 31518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 31595 32083 gene locus_tag LOCUS_07910 31595 32083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 32751 32095 gene locus_tag LOCUS_07920 32751 32095 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918895.1 protein_id gnl|my_center|LOCUS_07920 33260 32748 gene locus_tag LOCUS_07930 33260 32748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 33357 34058 gene locus_tag LOCUS_07940 gene tmk 33357 34058 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence020 <1 1244 gene locus_tag LOCUS_07950 <1 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921574.1:PSD1 and planctomycete cytochrome C domain-containing protein 1303 2736 gene locus_tag LOCUS_07960 1303 2736 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_07960 2846 5557 gene locus_tag LOCUS_07970 2846 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 6995 5688 gene locus_tag LOCUS_07980 6995 5688 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123082.1 protein_id gnl|my_center|LOCUS_07980 7296 8888 gene locus_tag LOCUS_07990 7296 8888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 9805 8972 gene locus_tag LOCUS_08000 9805 8972 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683251.1 protein_id gnl|my_center|LOCUS_08000 11645 9966 gene locus_tag LOCUS_08010 11645 9966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 14219 11703 gene locus_tag LOCUS_08020 14219 11703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 14480 15349 gene locus_tag LOCUS_08030 14480 15349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 15736 15425 gene locus_tag LOCUS_08040 15736 15425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 15729 16004 gene locus_tag LOCUS_08050 15729 16004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 16869 16120 gene locus_tag LOCUS_08060 16869 16120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 18960 17215 gene locus_tag LOCUS_08070 18960 17215 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_08070 20961 19072 gene locus_tag LOCUS_08080 20961 19072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 22551 21004 gene locus_tag LOCUS_08090 22551 21004 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_08090 26040 22555 gene locus_tag LOCUS_08100 26040 22555 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117905.1 protein_id gnl|my_center|LOCUS_08100 30772 26966 gene locus_tag LOCUS_08110 30772 26966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 <33868 30769 gene locus_tag LOCUS_08120 <33868 30769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120395.1:PD-(D/E)XK nuclease family protein >Feature sequence021 441 1289 gene locus_tag LOCUS_08130 441 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1444 2001 gene locus_tag LOCUS_08140 1444 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225144.1 protein_id gnl|my_center|LOCUS_08140 1998 6068 gene locus_tag LOCUS_08150 1998 6068 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225145.1 protein_id gnl|my_center|LOCUS_08150 8441 6096 gene locus_tag LOCUS_08160 8441 6096 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_08160 8781 8434 gene locus_tag LOCUS_08170 gene trxA 8781 8434 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385489.1 protein_id gnl|my_center|LOCUS_08170 9057 9281 gene locus_tag LOCUS_08180 9057 9281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 9577 10485 gene locus_tag LOCUS_08190 gene prfA 9577 10485 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337837.1 protein_id gnl|my_center|LOCUS_08190 14535 10627 gene locus_tag LOCUS_08200 gene dnaE 14535 10627 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852165.1 protein_id gnl|my_center|LOCUS_08200 15088 14654 gene locus_tag LOCUS_08210 15088 14654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 15990 15085 gene locus_tag LOCUS_08220 15990 15085 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930002.1 protein_id gnl|my_center|LOCUS_08220 16472 15990 gene locus_tag LOCUS_08230 16472 15990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 16625 17269 gene locus_tag LOCUS_08240 16625 17269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 17359 18174 gene locus_tag LOCUS_08250 17359 18174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 18259 20346 gene locus_tag LOCUS_08260 18259 20346 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_08260 21370 20411 gene locus_tag LOCUS_08270 21370 20411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 22531 21983 gene locus_tag LOCUS_08280 22531 21983 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036526.1 protein_id gnl|my_center|LOCUS_08280 23045 23947 gene locus_tag LOCUS_08290 23045 23947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 24976 24044 gene locus_tag LOCUS_08300 24976 24044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 26187 24976 gene locus_tag LOCUS_08310 26187 24976 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_08310 26327 28255 gene locus_tag LOCUS_08320 gene dnaK 26327 28255 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932327.1 protein_id gnl|my_center|LOCUS_08320 28590 30359 gene locus_tag LOCUS_08330 gene ptsP 28590 30359 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence022 2164 743 gene locus_tag LOCUS_08340 gene sthA 2164 743 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_08340 2296 2790 gene locus_tag LOCUS_08350 2296 2790 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391393.1 protein_id gnl|my_center|LOCUS_08350 2793 3449 gene locus_tag LOCUS_08360 2793 3449 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921301.1 protein_id gnl|my_center|LOCUS_08360 4622 3486 gene locus_tag LOCUS_08370 gene serC 4622 3486 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_08370 5336 4743 gene locus_tag LOCUS_08380 5336 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 5628 5840 gene locus_tag LOCUS_08390 5628 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 6242 6643 gene locus_tag LOCUS_08400 6242 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 6767 7159 gene locus_tag LOCUS_08410 6767 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 7413 7808 gene locus_tag LOCUS_08420 7413 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 7824 8447 gene locus_tag LOCUS_08430 7824 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 8583 9767 gene locus_tag LOCUS_08440 8583 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 9764 10423 gene locus_tag LOCUS_08450 9764 10423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 10420 11055 gene locus_tag LOCUS_08460 10420 11055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 11052 11687 gene locus_tag LOCUS_08470 11052 11687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 11745 13871 gene locus_tag LOCUS_08480 11745 13871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 13964 15181 gene locus_tag LOCUS_08490 13964 15181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 15445 16590 gene locus_tag LOCUS_08500 15445 16590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 16593 16994 gene locus_tag LOCUS_08510 16593 16994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 16991 18568 gene locus_tag LOCUS_08520 16991 18568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 18565 18900 gene locus_tag LOCUS_08530 18565 18900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 18906 20639 gene locus_tag LOCUS_08540 gene pilB 18906 20639 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_08540 20653 21924 gene locus_tag LOCUS_08550 gene xcpS 20653 21924 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_08550 21998 22300 gene locus_tag LOCUS_08560 21998 22300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 23425 22406 gene locus_tag LOCUS_08570 23425 22406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 23806 24618 gene locus_tag LOCUS_08580 23806 24618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 25504 24599 gene locus_tag LOCUS_08590 25504 24599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 26355 25501 gene locus_tag LOCUS_08600 26355 25501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 27122 26352 gene locus_tag LOCUS_08610 27122 26352 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678718.1 protein_id gnl|my_center|LOCUS_08610 28063 27119 gene locus_tag LOCUS_08620 28063 27119 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427752.1 protein_id gnl|my_center|LOCUS_08620 29011 28475 gene locus_tag LOCUS_08630 gene mntR 29011 28475 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037316.1 protein_id gnl|my_center|LOCUS_08630 29655 29014 gene locus_tag LOCUS_08640 29655 29014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08640 30917 29664 gene locus_tag LOCUS_08650 30917 29664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08650 <33010 31198 gene locus_tag LOCUS_08660 <33010 31198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703239.1:alanine--tRNA ligase >Feature sequence023 278 187 gene locus_tag LOCUS_t00090 278 187 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 427 2418 gene locus_tag LOCUS_08670 427 2418 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_08670 5031 2419 gene locus_tag LOCUS_08680 5031 2419 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 protein_id gnl|my_center|LOCUS_08680 5353 5138 gene locus_tag LOCUS_08690 5353 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 5489 7477 gene locus_tag LOCUS_08700 5489 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 8848 7499 gene locus_tag LOCUS_08710 8848 7499 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_08710 9480 8845 gene locus_tag LOCUS_08720 9480 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 10045 9734 gene locus_tag LOCUS_08730 10045 9734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 10445 11884 gene locus_tag LOCUS_08740 10445 11884 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_08740 11881 12189 gene locus_tag LOCUS_08750 11881 12189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 12636 12845 gene locus_tag LOCUS_08760 12636 12845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 13193 14497 gene locus_tag LOCUS_08770 13193 14497 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146571912.1 protein_id gnl|my_center|LOCUS_08770 14494 15933 gene locus_tag LOCUS_08780 14494 15933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 15936 19169 gene locus_tag LOCUS_08790 15936 19169 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_08790 19210 19794 gene locus_tag LOCUS_08800 19210 19794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 22001 19929 gene locus_tag LOCUS_08810 gene ftsH 22001 19929 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938574.1 protein_id gnl|my_center|LOCUS_08810 22948 22403 gene locus_tag LOCUS_08820 gene lptE 22948 22403 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119987.1 protein_id gnl|my_center|LOCUS_08820 24066 22999 gene locus_tag LOCUS_08830 24066 22999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 24252 25181 gene locus_tag LOCUS_08840 24252 25181 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729742.1 protein_id gnl|my_center|LOCUS_08840 25336 25884 gene locus_tag LOCUS_08850 25336 25884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 26195 26554 gene locus_tag LOCUS_08860 26195 26554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 26651 27370 gene locus_tag LOCUS_08870 26651 27370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 27367 28140 gene locus_tag LOCUS_08880 27367 28140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 28140 28406 gene locus_tag LOCUS_08890 gene fliQ 28140 28406 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329633.1 protein_id gnl|my_center|LOCUS_08890 28456 29256 gene locus_tag LOCUS_08900 28456 29256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08900 29314 30396 gene locus_tag LOCUS_08910 29314 30396 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329631.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence024 821 51 gene locus_tag LOCUS_08920 gene lipB 821 51 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405264.1 protein_id gnl|my_center|LOCUS_08920 877 1707 gene locus_tag LOCUS_08930 gene lpxA 877 1707 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_08930 1704 2585 gene locus_tag LOCUS_08940 1704 2585 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_08940 2589 3440 gene locus_tag LOCUS_08950 2589 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 3519 5438 gene locus_tag LOCUS_08960 3519 5438 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_08960 5802 6488 gene locus_tag LOCUS_08970 gene rpsD 5802 6488 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215455.1 protein_id gnl|my_center|LOCUS_08970 6761 8686 gene locus_tag LOCUS_08980 6761 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 8756 9220 gene locus_tag LOCUS_08990 8756 9220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 10520 9249 gene locus_tag LOCUS_09000 10520 9249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 10631 12616 gene locus_tag LOCUS_09010 10631 12616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 12725 13582 gene locus_tag LOCUS_09020 12725 13582 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114880.1 protein_id gnl|my_center|LOCUS_09020 13632 14459 gene locus_tag LOCUS_09030 13632 14459 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936832.1 protein_id gnl|my_center|LOCUS_09030 15268 14468 gene locus_tag LOCUS_09040 15268 14468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 15706 16773 gene locus_tag LOCUS_09050 15706 16773 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328629.1 protein_id gnl|my_center|LOCUS_09050 18189 17044 gene locus_tag LOCUS_09060 gene gcvT 18189 17044 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121468.1 protein_id gnl|my_center|LOCUS_09060 18386 20968 gene locus_tag LOCUS_09070 18386 20968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 21155 21826 gene locus_tag LOCUS_09080 21155 21826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 21905 22570 gene locus_tag LOCUS_09090 21905 22570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 22563 23648 gene locus_tag LOCUS_09100 gene lpxD 22563 23648 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963712.1 protein_id gnl|my_center|LOCUS_09100 23645 25054 gene locus_tag LOCUS_09110 23645 25054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 25143 26021 gene locus_tag LOCUS_09120 gene lpxA 25143 26021 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565963.1 protein_id gnl|my_center|LOCUS_09120 26200 26829 gene locus_tag LOCUS_09130 26200 26829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 26944 27657 gene locus_tag LOCUS_09140 26944 27657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 28906 27761 gene locus_tag LOCUS_09150 28906 27761 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122832.1 protein_id gnl|my_center|LOCUS_09150 28972 29361 gene locus_tag LOCUS_09160 28972 29361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 29974 29414 gene locus_tag LOCUS_09170 29974 29414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 31951 30257 gene locus_tag LOCUS_09180 gene ettA 31951 30257 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_09180 32183 32256 gene locus_tag LOCUS_t00100 32183 32256 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence025 7739 3984 gene locus_tag LOCUS_09190 gene rpoB 7739 3984 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340662.1 protein_id gnl|my_center|LOCUS_09190 8606 8217 gene locus_tag LOCUS_09200 gene rplL 8606 8217 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931848.1 protein_id gnl|my_center|LOCUS_09200 9364 8825 gene locus_tag LOCUS_09210 gene rplJ 9364 8825 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324458.1 protein_id gnl|my_center|LOCUS_09210 10085 9408 gene locus_tag LOCUS_09220 gene rplA 10085 9408 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324457.1 protein_id gnl|my_center|LOCUS_09220 10517 10089 gene locus_tag LOCUS_09230 gene rplK 10517 10089 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667599.1 protein_id gnl|my_center|LOCUS_09230 13124 10890 gene locus_tag LOCUS_09240 13124 10890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 14439 13210 gene locus_tag LOCUS_09250 14439 13210 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133034483.1 protein_id gnl|my_center|LOCUS_09250 15093 14482 gene locus_tag LOCUS_09260 15093 14482 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340070.1 protein_id gnl|my_center|LOCUS_09260 15156 16268 gene locus_tag LOCUS_09270 gene tsaD 15156 16268 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_09270 16306 17730 gene locus_tag LOCUS_09280 16306 17730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 18765 17755 gene locus_tag LOCUS_09290 18765 17755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 18990 19457 gene locus_tag LOCUS_09300 18990 19457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 19529 19601 gene locus_tag LOCUS_t00110 19529 19601 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 20690 19719 gene locus_tag LOCUS_09310 20690 19719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 21671 20886 gene locus_tag LOCUS_09320 21671 20886 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266913.1 protein_id gnl|my_center|LOCUS_09320 21770 21844 gene locus_tag LOCUS_t00120 21770 21844 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 22125 23714 gene locus_tag LOCUS_09330 gene pckA 22125 23714 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392169.1 protein_id gnl|my_center|LOCUS_09330 23757 24440 gene locus_tag LOCUS_09340 23757 24440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 26641 24623 gene locus_tag LOCUS_09350 gene dxs 26641 24623 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971117.1 protein_id gnl|my_center|LOCUS_09350 27666 26779 gene locus_tag LOCUS_09360 27666 26779 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118683.1 protein_id gnl|my_center|LOCUS_09360 27772 28404 gene locus_tag LOCUS_09370 27772 28404 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141387.1 protein_id gnl|my_center|LOCUS_09370 28446 29807 gene locus_tag LOCUS_09380 28446 29807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 30899 29862 gene locus_tag LOCUS_09390 30899 29862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 31704 31048 gene locus_tag LOCUS_09400 31704 31048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence026 2109 958 gene locus_tag LOCUS_09410 gene eboE 2109 958 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328980.1 protein_id gnl|my_center|LOCUS_09410 2331 3242 gene locus_tag LOCUS_09420 2331 3242 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_09420 3935 3279 gene locus_tag LOCUS_09430 3935 3279 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_09430 4756 3956 gene locus_tag LOCUS_09440 4756 3956 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_09440 5081 4758 gene locus_tag LOCUS_09450 5081 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 6399 5242 gene locus_tag LOCUS_09460 6399 5242 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368549.1 protein_id gnl|my_center|LOCUS_09460 8230 6698 gene locus_tag LOCUS_09470 8230 6698 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933114.1 protein_id gnl|my_center|LOCUS_09470 9355 8531 gene locus_tag LOCUS_09480 9355 8531 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529912.1 protein_id gnl|my_center|LOCUS_09480 9620 9339 gene locus_tag LOCUS_09490 9620 9339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 9561 10961 gene locus_tag LOCUS_09500 gene mgtE 9561 10961 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939093.1 protein_id gnl|my_center|LOCUS_09500 11192 10983 gene locus_tag LOCUS_09510 11192 10983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 11441 12238 gene locus_tag LOCUS_09520 gene lnrL 11441 12238 CDS product linearmycin resistance ATP-binding protein LnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244346.1 protein_id gnl|my_center|LOCUS_09520 12235 13557 gene locus_tag LOCUS_09530 12235 13557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 13660 14445 gene locus_tag LOCUS_09540 13660 14445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 14442 15185 gene locus_tag LOCUS_09550 14442 15185 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_09550 15259 17142 gene locus_tag LOCUS_09560 15259 17142 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_09560 17215 18324 gene locus_tag LOCUS_09570 17215 18324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 21399 18442 gene locus_tag LOCUS_09580 gene gcvP 21399 18442 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140250.1 protein_id gnl|my_center|LOCUS_09580 21812 21555 gene locus_tag LOCUS_09590 21812 21555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 21811 23808 gene locus_tag LOCUS_09600 21811 23808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 23831 24658 gene locus_tag LOCUS_09610 23831 24658 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_09610 25159 24770 gene locus_tag LOCUS_09620 gene ndhC 25159 24770 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140750.1 protein_id gnl|my_center|LOCUS_09620 26950 25205 gene locus_tag LOCUS_09630 26950 25205 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421524.1 protein_id gnl|my_center|LOCUS_09630 27059 27718 gene locus_tag LOCUS_09640 27059 27718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 28556 27795 gene locus_tag LOCUS_09650 28556 27795 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403012.1 protein_id gnl|my_center|LOCUS_09650 28920 28993 gene locus_tag LOCUS_t00130 28920 28993 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 29367 29206 gene locus_tag LOCUS_09660 29367 29206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 29856 29551 gene locus_tag LOCUS_09670 29856 29551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 29977 30672 gene locus_tag LOCUS_09680 29977 30672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence027 <1 942 gene locus_tag LOCUS_09690 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550792.1:tRNA epoxyqueuosine(34) reductase QueG 2397 991 gene locus_tag LOCUS_09700 gene hpnE 2397 991 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_09700 3371 2394 gene locus_tag LOCUS_09710 3371 2394 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892168.1 protein_id gnl|my_center|LOCUS_09710 4483 3389 gene locus_tag LOCUS_09720 gene hpnC 4483 3389 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020997346.1 protein_id gnl|my_center|LOCUS_09720 4542 5606 gene locus_tag LOCUS_09730 4542 5606 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776295.1 protein_id gnl|my_center|LOCUS_09730 5741 6910 gene locus_tag LOCUS_09740 gene rlmN 5741 6910 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142077.1 protein_id gnl|my_center|LOCUS_09740 10293 6937 gene locus_tag LOCUS_09750 10293 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 10390 11277 gene locus_tag LOCUS_09760 10390 11277 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704075.1 protein_id gnl|my_center|LOCUS_09760 11515 12372 gene locus_tag LOCUS_09770 11515 12372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 12377 13615 gene locus_tag LOCUS_09780 12377 13615 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584158.1 protein_id gnl|my_center|LOCUS_09780 14101 13700 gene locus_tag LOCUS_09790 14101 13700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 14230 14730 gene locus_tag LOCUS_09800 14230 14730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 14727 15410 gene locus_tag LOCUS_09810 14727 15410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 15407 16372 gene locus_tag LOCUS_09820 15407 16372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 16369 18651 gene locus_tag LOCUS_09830 16369 18651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 18667 19521 gene locus_tag LOCUS_09840 18667 19521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 19511 20866 gene locus_tag LOCUS_09850 19511 20866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 20863 22956 gene locus_tag LOCUS_09860 20863 22956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 23932 22922 gene locus_tag LOCUS_09870 23932 22922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 23950 25386 gene locus_tag LOCUS_09880 gene hpnO 23950 25386 CDS product aminobacteriohopanetriol synthase HpnO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085794.1 protein_id gnl|my_center|LOCUS_09880 25817 25383 gene locus_tag LOCUS_09890 gene fabZ 25817 25383 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377815.1 protein_id gnl|my_center|LOCUS_09890 26083 25814 gene locus_tag LOCUS_09900 26083 25814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 26692 26147 gene locus_tag LOCUS_09910 26692 26147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 <30020 26768 gene locus_tag LOCUS_09920 <30020 26768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389847.1:efflux RND transporter permease subunit >Feature sequence028 53 520 gene locus_tag LOCUS_09930 53 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 517 1395 gene locus_tag LOCUS_09940 517 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1814 3130 gene locus_tag LOCUS_09950 1814 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 3170 3742 gene locus_tag LOCUS_09960 3170 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 3830 4324 gene locus_tag LOCUS_09970 3830 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 4350 6110 gene locus_tag LOCUS_09980 4350 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 7550 6270 gene locus_tag LOCUS_09990 7550 6270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 7867 9870 gene locus_tag LOCUS_10000 gene dnaX 7867 9870 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921981.1 protein_id gnl|my_center|LOCUS_10000 9998 10369 gene locus_tag LOCUS_10010 9998 10369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 10490 11116 gene locus_tag LOCUS_10020 gene recR 10490 11116 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327785.1 protein_id gnl|my_center|LOCUS_10020 11354 12859 gene locus_tag LOCUS_10030 gene rpoN 11354 12859 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435015.1 protein_id gnl|my_center|LOCUS_10030 13174 14043 gene locus_tag LOCUS_10040 gene ilvE 13174 14043 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_10040 14344 14979 gene locus_tag LOCUS_10050 14344 14979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 16592 15027 gene locus_tag LOCUS_10060 16592 15027 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943751.1 protein_id gnl|my_center|LOCUS_10060 17638 16589 gene locus_tag LOCUS_10070 17638 16589 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075125.1 protein_id gnl|my_center|LOCUS_10070 18639 17623 gene locus_tag LOCUS_10080 18639 17623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 18720 19373 gene locus_tag LOCUS_10090 18720 19373 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_10090 19428 20717 gene locus_tag LOCUS_10100 gene nuoD 19428 20717 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967799.1 protein_id gnl|my_center|LOCUS_10100 20787 21338 gene locus_tag LOCUS_10110 20787 21338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 21338 21682 gene locus_tag LOCUS_10120 21338 21682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 21748 23115 gene locus_tag LOCUS_10130 gene nuoF 21748 23115 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969255.1 protein_id gnl|my_center|LOCUS_10130 23178 23675 gene locus_tag LOCUS_10140 23178 23675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 23672 24994 gene locus_tag LOCUS_10150 23672 24994 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258059.1 protein_id gnl|my_center|LOCUS_10150 25105 25530 gene locus_tag LOCUS_10160 25105 25530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 25649 26404 gene locus_tag LOCUS_10170 gene lptB 25649 26404 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_10170 26441 26932 gene locus_tag LOCUS_10180 26441 26932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 27255 27899 gene locus_tag LOCUS_10190 27255 27899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 27881 28582 gene locus_tag LOCUS_10200 27881 28582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 29642 28599 gene locus_tag LOCUS_10210 gene galE 29642 28599 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615363.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence029 1428 160 gene locus_tag LOCUS_10220 gene tgt 1428 160 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129711.1 protein_id gnl|my_center|LOCUS_10220 2465 1425 gene locus_tag LOCUS_10230 2465 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 3771 2686 gene locus_tag LOCUS_10240 3771 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 4382 3768 gene locus_tag LOCUS_10250 4382 3768 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704380.1 protein_id gnl|my_center|LOCUS_10250 4401 5303 gene locus_tag LOCUS_10260 4401 5303 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332037.1 protein_id gnl|my_center|LOCUS_10260 5300 6331 gene locus_tag LOCUS_10270 5300 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 7149 6472 gene locus_tag LOCUS_10280 7149 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 8562 7231 gene locus_tag LOCUS_10290 8562 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 8958 8659 gene locus_tag LOCUS_10300 8958 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 10573 8951 gene locus_tag LOCUS_10310 gene xseA 10573 8951 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415249.1 protein_id gnl|my_center|LOCUS_10310 10640 12754 gene locus_tag LOCUS_10320 gene recG 10640 12754 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_10320 14541 12796 gene locus_tag LOCUS_10330 gene polX 14541 12796 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_10330 15835 14555 gene locus_tag LOCUS_10340 15835 14555 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123393.1 protein_id gnl|my_center|LOCUS_10340 16500 15907 gene locus_tag LOCUS_10350 16500 15907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 16568 20479 gene locus_tag LOCUS_10360 16568 20479 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922114.1 protein_id gnl|my_center|LOCUS_10360 21379 20513 gene locus_tag LOCUS_10370 21379 20513 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221095.1 protein_id gnl|my_center|LOCUS_10370 21958 22620 gene locus_tag LOCUS_10380 21958 22620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 22834 23175 gene locus_tag LOCUS_10390 22834 23175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 24180 23398 gene locus_tag LOCUS_10400 24180 23398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 24423 24223 gene locus_tag LOCUS_10410 24423 24223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 24660 25385 gene locus_tag LOCUS_10420 24660 25385 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707299.1 protein_id gnl|my_center|LOCUS_10420 25382 26662 gene locus_tag LOCUS_10430 25382 26662 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261129.1 protein_id gnl|my_center|LOCUS_10430 26698 27588 gene locus_tag LOCUS_10440 26698 27588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence030 1106 3865 gene locus_tag LOCUS_10450 1106 3865 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921950.1 protein_id gnl|my_center|LOCUS_10450 4087 6342 gene locus_tag LOCUS_10460 4087 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 6339 7835 gene locus_tag LOCUS_10470 6339 7835 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123415.1 protein_id gnl|my_center|LOCUS_10470 8877 7852 gene locus_tag LOCUS_10480 8877 7852 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118181.1 protein_id gnl|my_center|LOCUS_10480 10043 8916 gene locus_tag LOCUS_10490 10043 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 10805 10059 gene locus_tag LOCUS_10500 10805 10059 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 protein_id gnl|my_center|LOCUS_10500 12004 10802 gene locus_tag LOCUS_10510 12004 10802 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176601.1 protein_id gnl|my_center|LOCUS_10510 12651 12004 gene locus_tag LOCUS_10520 12651 12004 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461663.1 protein_id gnl|my_center|LOCUS_10520 13804 12644 gene locus_tag LOCUS_10530 13804 12644 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_10530 14002 14274 gene locus_tag LOCUS_10540 14002 14274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 15034 14237 gene locus_tag LOCUS_10550 15034 14237 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121328.1 protein_id gnl|my_center|LOCUS_10550 15804 15031 gene locus_tag LOCUS_10560 15804 15031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 15837 16871 gene locus_tag LOCUS_10570 15837 16871 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920485.1 protein_id gnl|my_center|LOCUS_10570 16884 18029 gene locus_tag LOCUS_10580 gene dinB 16884 18029 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119785.1 protein_id gnl|my_center|LOCUS_10580 18965 18063 gene locus_tag LOCUS_10590 18965 18063 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360173.1 protein_id gnl|my_center|LOCUS_10590 21385 18962 gene locus_tag LOCUS_10600 21385 18962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 21957 21475 gene locus_tag LOCUS_10610 21957 21475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 22435 21947 gene locus_tag LOCUS_10620 22435 21947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 23116 22454 gene locus_tag LOCUS_10630 23116 22454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 24168 23113 gene locus_tag LOCUS_10640 24168 23113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 24969 24340 gene locus_tag LOCUS_10650 24969 24340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 25138 25222 gene locus_tag LOCUS_t00140 25138 25222 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 25554 26798 gene locus_tag LOCUS_10660 25554 26798 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942381.1 protein_id gnl|my_center|LOCUS_10660 26829 26741 gene locus_tag LOCUS_t00150 26829 26741 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 26947 28191 gene locus_tag LOCUS_10670 26947 28191 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence031 136 1743 gene locus_tag LOCUS_10680 gene dnaB 136 1743 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546182.1 protein_id gnl|my_center|LOCUS_10680 1933 2439 gene locus_tag LOCUS_10690 1933 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 2741 3451 gene locus_tag LOCUS_10700 2741 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 3581 4420 gene locus_tag LOCUS_10710 3581 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 4510 5580 gene locus_tag LOCUS_10720 4510 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 5648 7540 gene locus_tag LOCUS_10730 5648 7540 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_10730 7619 9229 gene locus_tag LOCUS_10740 7619 9229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 9222 10742 gene locus_tag LOCUS_10750 9222 10742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 10742 11884 gene locus_tag LOCUS_10760 10742 11884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 11907 12365 gene locus_tag LOCUS_10770 gene dut 11907 12365 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933085.1 protein_id gnl|my_center|LOCUS_10770 12504 13715 gene locus_tag LOCUS_10780 12504 13715 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007341012.1 protein_id gnl|my_center|LOCUS_10780 13712 14980 gene locus_tag LOCUS_10790 gene rnd 13712 14980 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895548.1 protein_id gnl|my_center|LOCUS_10790 14980 16404 gene locus_tag LOCUS_10800 14980 16404 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037552.1 protein_id gnl|my_center|LOCUS_10800 17408 16473 gene locus_tag LOCUS_10810 17408 16473 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037553.1 protein_id gnl|my_center|LOCUS_10810 17530 18516 gene locus_tag LOCUS_10820 17530 18516 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523447.1 protein_id gnl|my_center|LOCUS_10820 18513 20123 gene locus_tag LOCUS_10830 18513 20123 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089209.1 protein_id gnl|my_center|LOCUS_10830 20843 20193 gene locus_tag LOCUS_10840 20843 20193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 21094 22224 gene locus_tag LOCUS_10850 21094 22224 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454927.1 protein_id gnl|my_center|LOCUS_10850 22334 23140 gene locus_tag LOCUS_10860 22334 23140 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454839.1 protein_id gnl|my_center|LOCUS_10860 23192 24340 gene locus_tag LOCUS_10870 23192 24340 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454833.1 protein_id gnl|my_center|LOCUS_10870 24410 25111 gene locus_tag LOCUS_10880 24410 25111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 25197 26573 gene locus_tag LOCUS_10890 25197 26573 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838739.1 protein_id gnl|my_center|LOCUS_10890 26618 28330 gene locus_tag LOCUS_10900 gene menD 26618 28330 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404103.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence032 586 266 gene locus_tag LOCUS_10910 586 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1866 583 gene locus_tag LOCUS_10920 1866 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 2299 1880 gene locus_tag LOCUS_10930 2299 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 2708 2938 gene locus_tag LOCUS_10940 2708 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 2949 3236 gene locus_tag LOCUS_10950 2949 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 4472 3504 gene locus_tag LOCUS_10960 4472 3504 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943294.1 protein_id gnl|my_center|LOCUS_10960 5861 4608 gene locus_tag LOCUS_10970 gene pdhA 5861 4608 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943293.1 protein_id gnl|my_center|LOCUS_10970 7223 5946 gene locus_tag LOCUS_10980 7223 5946 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312602.1 protein_id gnl|my_center|LOCUS_10980 8018 7236 gene locus_tag LOCUS_10990 8018 7236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 9756 8119 gene locus_tag LOCUS_11000 9756 8119 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095724.1 protein_id gnl|my_center|LOCUS_11000 9916 10461 gene locus_tag LOCUS_11010 9916 10461 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085340.1 protein_id gnl|my_center|LOCUS_11010 10596 11975 gene locus_tag LOCUS_11020 10596 11975 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863439.1 protein_id gnl|my_center|LOCUS_11020 12010 12414 gene locus_tag LOCUS_11030 12010 12414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 12685 12888 gene locus_tag LOCUS_11040 12685 12888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 12950 13231 gene locus_tag LOCUS_11050 12950 13231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 13301 13609 gene locus_tag LOCUS_11060 13301 13609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 13613 14611 gene locus_tag LOCUS_11070 gene deoC 13613 14611 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_11070 15099 16022 gene locus_tag LOCUS_11080 15099 16022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 16449 16279 gene locus_tag LOCUS_11090 16449 16279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 16483 17373 gene locus_tag LOCUS_11100 16483 17373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 18162 17419 gene locus_tag LOCUS_11110 18162 17419 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 protein_id gnl|my_center|LOCUS_11110 18289 19881 gene locus_tag LOCUS_11120 18289 19881 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 protein_id gnl|my_center|LOCUS_11120 19878 20753 gene locus_tag LOCUS_11130 19878 20753 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222792.1 protein_id gnl|my_center|LOCUS_11130 23437 20774 gene locus_tag LOCUS_11140 23437 20774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 23843 25561 gene locus_tag LOCUS_11150 23843 25561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 25602 27335 gene locus_tag LOCUS_11160 25602 27335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 28182 27376 gene locus_tag LOCUS_11170 gene gph 28182 27376 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532061.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence033 1084 233 gene locus_tag LOCUS_11180 1084 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 3026 1185 gene locus_tag LOCUS_11190 3026 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 3299 5179 gene locus_tag LOCUS_11200 3299 5179 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941595.1 protein_id gnl|my_center|LOCUS_11200 5263 6735 gene locus_tag LOCUS_11210 5263 6735 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941596.1 protein_id gnl|my_center|LOCUS_11210 7140 6895 gene locus_tag LOCUS_11220 7140 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 9358 7283 gene locus_tag LOCUS_11230 9358 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 11099 9447 gene locus_tag LOCUS_11240 gene murJ 11099 9447 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073367.1 protein_id gnl|my_center|LOCUS_11240 11519 11112 gene locus_tag LOCUS_11250 11519 11112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 12598 11648 gene locus_tag LOCUS_11260 12598 11648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 13878 12595 gene locus_tag LOCUS_11270 13878 12595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 15579 13900 gene locus_tag LOCUS_11280 15579 13900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 15688 16164 gene locus_tag LOCUS_11290 15688 16164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 16983 16273 gene locus_tag LOCUS_11300 16983 16273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 17912 17115 gene locus_tag LOCUS_11310 17912 17115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 18913 17909 gene locus_tag LOCUS_11320 gene nadC 18913 17909 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389186.1 protein_id gnl|my_center|LOCUS_11320 19320 18910 gene locus_tag LOCUS_11330 19320 18910 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004981.1 protein_id gnl|my_center|LOCUS_11330 19213 19470 gene locus_tag LOCUS_11340 19213 19470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 20807 19446 gene locus_tag LOCUS_11350 20807 19446 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257569.1 protein_id gnl|my_center|LOCUS_11350 21907 20975 gene locus_tag LOCUS_11360 21907 20975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence034 341 138 gene locus_tag LOCUS_11370 341 138 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_11370 498 1952 gene locus_tag LOCUS_11380 498 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1954 3390 gene locus_tag LOCUS_11390 1954 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 3438 4424 gene locus_tag LOCUS_11400 gene dapF 3438 4424 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_11400 4417 5652 gene locus_tag LOCUS_11410 4417 5652 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947432.1 protein_id gnl|my_center|LOCUS_11410 5777 7231 gene locus_tag LOCUS_11420 5777 7231 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338764.1 protein_id gnl|my_center|LOCUS_11420 7248 8309 gene locus_tag LOCUS_11430 gene astA 7248 8309 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705768.1 protein_id gnl|my_center|LOCUS_11430 8325 9830 gene locus_tag LOCUS_11440 gene astD 8325 9830 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706955.1 protein_id gnl|my_center|LOCUS_11440 12000 10438 gene locus_tag LOCUS_11450 12000 10438 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_11450 12698 12105 gene locus_tag LOCUS_11460 gene folE 12698 12105 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388024.1 protein_id gnl|my_center|LOCUS_11460 12890 13624 gene locus_tag LOCUS_11470 12890 13624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11470 13706 14002 gene locus_tag LOCUS_11480 13706 14002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 13999 14934 gene locus_tag LOCUS_11490 gene mak 13999 14934 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208690.1 protein_id gnl|my_center|LOCUS_11490 16296 14989 gene locus_tag LOCUS_11500 16296 14989 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921846.1 protein_id gnl|my_center|LOCUS_11500 17604 16474 gene locus_tag LOCUS_11510 17604 16474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 18571 17726 gene locus_tag LOCUS_11520 gene folD 18571 17726 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_11520 19545 18568 gene locus_tag LOCUS_11530 19545 18568 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050911213.1 protein_id gnl|my_center|LOCUS_11530 19787 21274 gene locus_tag LOCUS_11540 19787 21274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 21271 21804 gene locus_tag LOCUS_11550 21271 21804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 21801 25199 gene locus_tag LOCUS_11560 gene mfd 21801 25199 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427773.1 protein_id gnl|my_center|LOCUS_11560 25454 25831 gene locus_tag LOCUS_11570 25454 25831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 26563 25985 gene locus_tag LOCUS_11580 gene rplI 26563 25985 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383932.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence035 1478 915 gene locus_tag LOCUS_11590 1478 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1765 1532 gene locus_tag LOCUS_11600 1765 1532 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_11600 1826 2098 gene locus_tag LOCUS_11610 1826 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 2194 3681 gene locus_tag LOCUS_11620 2194 3681 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101230.1 protein_id gnl|my_center|LOCUS_11620 3745 4638 gene locus_tag LOCUS_11630 3745 4638 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_11630 4733 6088 gene locus_tag LOCUS_11640 4733 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 6076 7476 gene locus_tag LOCUS_11650 gene hydA 6076 7476 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651148.1 protein_id gnl|my_center|LOCUS_11650 8736 7492 gene locus_tag LOCUS_11660 8736 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 9496 8948 gene locus_tag LOCUS_11670 9496 8948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 13930 9989 gene locus_tag LOCUS_11680 13930 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 14901 14023 gene locus_tag LOCUS_11690 14901 14023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 15899 14898 gene locus_tag LOCUS_11700 15899 14898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 16807 15908 gene locus_tag LOCUS_11710 16807 15908 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703542.1 protein_id gnl|my_center|LOCUS_11710 17715 16804 gene locus_tag LOCUS_11720 17715 16804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 18623 17742 gene locus_tag LOCUS_11730 18623 17742 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407529.1 protein_id gnl|my_center|LOCUS_11730 19662 18664 gene locus_tag LOCUS_11740 19662 18664 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_11740 20961 19720 gene locus_tag LOCUS_11750 20961 19720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 22154 20988 gene locus_tag LOCUS_11760 22154 20988 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338923.1 protein_id gnl|my_center|LOCUS_11760 22841 24172 gene locus_tag LOCUS_11770 22841 24172 CDS product M64 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031040.1 protein_id gnl|my_center|LOCUS_11770 24267 25214 gene locus_tag LOCUS_11780 24267 25214 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_11780 25296 26369 gene locus_tag LOCUS_11790 25296 26369 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence036 509 2575 gene locus_tag LOCUS_11800 509 2575 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203328.1 protein_id gnl|my_center|LOCUS_11800 2668 4890 gene locus_tag LOCUS_11810 2668 4890 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922871.1 protein_id gnl|my_center|LOCUS_11810 4946 6313 gene locus_tag LOCUS_11820 4946 6313 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664582.1 protein_id gnl|my_center|LOCUS_11820 7198 6347 gene locus_tag LOCUS_11830 7198 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 8397 7282 gene locus_tag LOCUS_11840 8397 7282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 8540 10882 gene locus_tag LOCUS_11850 8540 10882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 10947 12137 gene locus_tag LOCUS_11860 gene solA 10947 12137 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_11860 13381 12491 gene locus_tag LOCUS_11870 13381 12491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 13545 16277 gene locus_tag LOCUS_11880 13545 16277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 16657 16298 gene locus_tag LOCUS_11890 16657 16298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 17572 16703 gene locus_tag LOCUS_11900 17572 16703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 17960 20767 gene locus_tag LOCUS_11910 17960 20767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 20832 22322 gene locus_tag LOCUS_11920 20832 22322 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_11920 22381 23775 gene locus_tag LOCUS_11930 22381 23775 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259268.1 protein_id gnl|my_center|LOCUS_11930 23788 24552 gene locus_tag LOCUS_11940 23788 24552 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612370.1 protein_id gnl|my_center|LOCUS_11940 24620 25699 gene locus_tag LOCUS_11950 24620 25699 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174243.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence037 3071 1191 gene locus_tag LOCUS_11960 gene argH 3071 1191 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465154.1 protein_id gnl|my_center|LOCUS_11960 4371 3085 gene locus_tag LOCUS_11970 4371 3085 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465152.1 protein_id gnl|my_center|LOCUS_11970 5520 4459 gene locus_tag LOCUS_11980 5520 4459 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070649.1 protein_id gnl|my_center|LOCUS_11980 6464 5520 gene locus_tag LOCUS_11990 gene argB 6464 5520 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281558.1 protein_id gnl|my_center|LOCUS_11990 7543 6461 gene locus_tag LOCUS_12000 gene argC 7543 6461 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262713.1 protein_id gnl|my_center|LOCUS_12000 8047 7589 gene locus_tag LOCUS_12010 8047 7589 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776177.1 protein_id gnl|my_center|LOCUS_12010 9117 8266 gene locus_tag LOCUS_12020 9117 8266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 9801 11198 gene locus_tag LOCUS_12030 9801 11198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 11361 12455 gene locus_tag LOCUS_12040 11361 12455 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230887.1 protein_id gnl|my_center|LOCUS_12040 12468 13730 gene locus_tag LOCUS_12050 12468 13730 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257780.1 protein_id gnl|my_center|LOCUS_12050 15165 13816 gene locus_tag LOCUS_12060 15165 13816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 17441 15336 gene locus_tag LOCUS_12070 gene thrS 17441 15336 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329329.1 protein_id gnl|my_center|LOCUS_12070 17491 19788 gene locus_tag LOCUS_12080 17491 19788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 19844 20335 gene locus_tag LOCUS_12090 gene nrdR 19844 20335 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203672.1 protein_id gnl|my_center|LOCUS_12090 20988 20422 gene locus_tag LOCUS_12100 gene frr 20988 20422 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339966.1 protein_id gnl|my_center|LOCUS_12100 21107 21832 gene locus_tag LOCUS_12110 gene pyrH 21107 21832 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_12110 22084 23100 gene locus_tag LOCUS_12120 22084 23100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 23097 24497 gene locus_tag LOCUS_12130 23097 24497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 24513 25220 gene locus_tag LOCUS_12140 24513 25220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 25249 25671 gene locus_tag LOCUS_12150 25249 25671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 25673 26080 gene locus_tag LOCUS_12160 25673 26080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence038 158 1051 gene locus_tag LOCUS_12170 158 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1263 3074 gene locus_tag LOCUS_12180 1263 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 3755 3087 gene locus_tag LOCUS_12190 3755 3087 CDS product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061919.1 protein_id gnl|my_center|LOCUS_12190 4079 5374 gene locus_tag LOCUS_12200 4079 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 6404 5400 gene locus_tag LOCUS_12210 6404 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 6774 9614 gene locus_tag LOCUS_12220 6774 9614 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120839.1 protein_id gnl|my_center|LOCUS_12220 9870 9700 gene locus_tag LOCUS_12230 9870 9700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 9869 11062 gene locus_tag LOCUS_12240 9869 11062 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_12240 14865 11161 gene locus_tag LOCUS_12250 14865 11161 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071882.1 protein_id gnl|my_center|LOCUS_12250 15812 14865 gene locus_tag LOCUS_12260 15812 14865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_12260 15790 15918 gene locus_tag LOCUS_12270 15790 15918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 16660 15995 gene locus_tag LOCUS_12280 16660 15995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 16887 17804 gene locus_tag LOCUS_12290 16887 17804 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228215.1 protein_id gnl|my_center|LOCUS_12290 18367 17846 gene locus_tag LOCUS_12300 18367 17846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 19442 18447 gene locus_tag LOCUS_12310 19442 18447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 20888 19635 gene locus_tag LOCUS_12320 20888 19635 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057961.1 protein_id gnl|my_center|LOCUS_12320 20875 21051 gene locus_tag LOCUS_12330 20875 21051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 21044 21544 gene locus_tag LOCUS_12340 21044 21544 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957577.1 protein_id gnl|my_center|LOCUS_12340 21767 23101 gene locus_tag LOCUS_12350 21767 23101 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_12350 23171 24022 gene locus_tag LOCUS_12360 23171 24022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 24306 24638 gene locus_tag LOCUS_12370 24306 24638 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_12370 25712 24792 gene locus_tag LOCUS_12380 gene murQ 25712 24792 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144000.1 protein_id gnl|my_center|LOCUS_12380 <27085 25709 gene locus_tag LOCUS_12390 <27085 25709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_076057163.1:S9 family peptidase >Feature sequence039 1501 2367 gene locus_tag LOCUS_12400 1501 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 2642 3460 gene locus_tag LOCUS_12410 2642 3460 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260645.1 protein_id gnl|my_center|LOCUS_12410 5118 3598 gene locus_tag LOCUS_12420 5118 3598 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_12420 6459 5299 gene locus_tag LOCUS_12430 6459 5299 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943706.1 protein_id gnl|my_center|LOCUS_12430 7482 6502 gene locus_tag LOCUS_12440 gene glcK 7482 6502 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 protein_id gnl|my_center|LOCUS_12440 10786 7529 gene locus_tag LOCUS_12450 10786 7529 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_12450 12185 10791 gene locus_tag LOCUS_12460 12185 10791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 12327 12638 gene locus_tag LOCUS_12470 gene gatC 12327 12638 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854761.1 protein_id gnl|my_center|LOCUS_12470 12635 14083 gene locus_tag LOCUS_12480 gene gatA 12635 14083 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 protein_id gnl|my_center|LOCUS_12480 15232 14147 gene locus_tag LOCUS_12490 gene mutY 15232 14147 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110600.1 protein_id gnl|my_center|LOCUS_12490 15484 16296 gene locus_tag LOCUS_12500 15484 16296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 16307 16966 gene locus_tag LOCUS_12510 16307 16966 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942553.1 protein_id gnl|my_center|LOCUS_12510 18144 17005 gene locus_tag LOCUS_12520 18144 17005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 19299 18574 gene locus_tag LOCUS_12530 19299 18574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 20207 19296 gene locus_tag LOCUS_12540 20207 19296 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169980830.1 protein_id gnl|my_center|LOCUS_12540 21277 20204 gene locus_tag LOCUS_12550 21277 20204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 22163 21381 gene locus_tag LOCUS_12560 22163 21381 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067013.1 protein_id gnl|my_center|LOCUS_12560 23671 22268 gene locus_tag LOCUS_12570 23671 22268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 26027 23970 gene locus_tag LOCUS_12580 26027 23970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence040 855 1895 gene locus_tag LOCUS_12590 855 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 2091 3857 gene locus_tag LOCUS_12600 2091 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 3854 5005 gene locus_tag LOCUS_12610 3854 5005 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_12610 6724 5162 gene locus_tag LOCUS_12620 gene guaA 6724 5162 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778965.1 protein_id gnl|my_center|LOCUS_12620 7709 6888 gene locus_tag LOCUS_12630 7709 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 8777 7992 gene locus_tag LOCUS_12640 8777 7992 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_12640 10526 9186 gene locus_tag LOCUS_12650 10526 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 11781 10606 gene locus_tag LOCUS_12660 11781 10606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 12022 14634 gene locus_tag LOCUS_12670 12022 14634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 14672 15208 gene locus_tag LOCUS_12680 14672 15208 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941953.1 protein_id gnl|my_center|LOCUS_12680 15260 16108 gene locus_tag LOCUS_12690 gene cheR 15260 16108 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382687.1 protein_id gnl|my_center|LOCUS_12690 16226 16705 gene locus_tag LOCUS_12700 16226 16705 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868668.1 protein_id gnl|my_center|LOCUS_12700 16693 17553 gene locus_tag LOCUS_12710 16693 17553 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358679.1 protein_id gnl|my_center|LOCUS_12710 17550 17963 gene locus_tag LOCUS_12720 17550 17963 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_12720 18003 18461 gene locus_tag LOCUS_12730 18003 18461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 18513 19718 gene locus_tag LOCUS_12740 18513 19718 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941806.1 protein_id gnl|my_center|LOCUS_12740 20815 19820 gene locus_tag LOCUS_12750 gene mdh 20815 19820 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325654.1 protein_id gnl|my_center|LOCUS_12750 21156 21081 gene locus_tag LOCUS_t00160 21156 21081 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 22368 21256 gene locus_tag LOCUS_12760 22368 21256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 23705 22365 gene locus_tag LOCUS_12770 23705 22365 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_12770 24387 23827 gene locus_tag LOCUS_12780 24387 23827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 26069 24384 gene locus_tag LOCUS_12790 26069 24384 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226294.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence041 42 1703 gene locus_tag LOCUS_12800 42 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1797 3248 gene locus_tag LOCUS_12810 1797 3248 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_12810 3406 4332 gene locus_tag LOCUS_12820 3406 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 4419 5969 gene locus_tag LOCUS_12830 4419 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 6037 6906 gene locus_tag LOCUS_12840 gene prpB 6037 6906 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846659.1 protein_id gnl|my_center|LOCUS_12840 8724 7072 gene locus_tag LOCUS_12850 8724 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 9101 8721 gene locus_tag LOCUS_12860 9101 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 10910 9546 gene locus_tag LOCUS_12870 10910 9546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 11685 12839 gene locus_tag LOCUS_12880 gene prpC 11685 12839 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070709.1 protein_id gnl|my_center|LOCUS_12880 15567 13066 gene locus_tag LOCUS_12890 15567 13066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 16084 16947 gene locus_tag LOCUS_12900 16084 16947 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538869.1 protein_id gnl|my_center|LOCUS_12900 17144 18313 gene locus_tag LOCUS_12910 17144 18313 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391475.1 protein_id gnl|my_center|LOCUS_12910 18476 19333 gene locus_tag LOCUS_12920 18476 19333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 24644 19371 gene locus_tag LOCUS_12930 24644 19371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence042 829 758 gene locus_tag LOCUS_t00170 829 758 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1379 1062 gene locus_tag LOCUS_12940 1379 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 5490 1507 gene locus_tag LOCUS_12950 5490 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 6817 5639 gene locus_tag LOCUS_12960 6817 5639 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_12960 6911 6821 gene locus_tag LOCUS_t00180 6911 6821 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9710 6981 gene locus_tag LOCUS_12970 9710 6981 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_12970 11812 9707 gene locus_tag LOCUS_12980 11812 9707 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_12980 13063 11861 gene locus_tag LOCUS_12990 13063 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 14056 13067 gene locus_tag LOCUS_13000 gene prfB 14056 13067 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096641376.1 protein_id gnl|my_center|LOCUS_13000 14247 15467 gene locus_tag LOCUS_13010 14247 15467 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383982.1 protein_id gnl|my_center|LOCUS_13010 15947 18304 gene locus_tag LOCUS_13020 15947 18304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 19540 18467 gene locus_tag LOCUS_13030 19540 18467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 20146 19574 gene locus_tag LOCUS_13040 20146 19574 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964321.1 protein_id gnl|my_center|LOCUS_13040 20795 20277 gene locus_tag LOCUS_13050 20795 20277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 22320 20812 gene locus_tag LOCUS_13060 22320 20812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 22694 23551 gene locus_tag LOCUS_13070 22694 23551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 <25546 23576 gene locus_tag LOCUS_13080 <25546 23576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004554541.1:DEAD/DEAH box helicase family protein >Feature sequence043 1210 167 gene locus_tag LOCUS_13090 1210 167 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125275.1 protein_id gnl|my_center|LOCUS_13090 1806 3155 gene locus_tag LOCUS_13100 gene murA 1806 3155 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_13100 4154 3246 gene locus_tag LOCUS_13110 4154 3246 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920173.1 protein_id gnl|my_center|LOCUS_13110 5422 4205 gene locus_tag LOCUS_13120 gene rho 5422 4205 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330229.1 protein_id gnl|my_center|LOCUS_13120 5357 6004 gene locus_tag LOCUS_13130 5357 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 8048 6978 gene locus_tag LOCUS_13140 8048 6978 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257902.1 protein_id gnl|my_center|LOCUS_13140 9478 8123 gene locus_tag LOCUS_13150 9478 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 9661 10926 gene locus_tag LOCUS_13160 9661 10926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 11049 12269 gene locus_tag LOCUS_13170 11049 12269 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031816.1 protein_id gnl|my_center|LOCUS_13170 12266 13471 gene locus_tag LOCUS_13180 12266 13471 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122037.1 protein_id gnl|my_center|LOCUS_13180 13581 15245 gene locus_tag LOCUS_13190 13581 15245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 15979 15497 gene locus_tag LOCUS_13200 gene rpsI 15979 15497 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814889.1 protein_id gnl|my_center|LOCUS_13200 16637 16098 gene locus_tag LOCUS_13210 gene rplM 16637 16098 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_13210 16973 18454 gene locus_tag LOCUS_13220 16973 18454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 19245 18520 gene locus_tag LOCUS_13230 19245 18520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 20094 19435 gene locus_tag LOCUS_13240 20094 19435 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_13240 20857 20240 gene locus_tag LOCUS_13250 20857 20240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 21401 21021 gene locus_tag LOCUS_13260 gene queD 21401 21021 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845978.1 protein_id gnl|my_center|LOCUS_13260 21893 21489 gene locus_tag LOCUS_13270 gene rplS 21893 21489 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814465.1 protein_id gnl|my_center|LOCUS_13270 22788 21931 gene locus_tag LOCUS_13280 gene trmD 22788 21931 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_13280 23193 22930 gene locus_tag LOCUS_13290 23193 22930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 24155 23469 gene locus_tag LOCUS_13300 24155 23469 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937452.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence044 288 965 gene locus_tag LOCUS_13310 gene bshB1 288 965 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333027.1 protein_id gnl|my_center|LOCUS_13310 1236 1979 gene locus_tag LOCUS_13320 1236 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 3126 2053 gene locus_tag LOCUS_13330 3126 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 5812 3344 gene locus_tag LOCUS_13340 5812 3344 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030755.1 protein_id gnl|my_center|LOCUS_13340 7845 5809 gene locus_tag LOCUS_13350 7845 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 11082 7891 gene locus_tag LOCUS_13360 11082 7891 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085775.1 protein_id gnl|my_center|LOCUS_13360 11181 12386 gene locus_tag LOCUS_13370 11181 12386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 12462 13352 gene locus_tag LOCUS_13380 12462 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 13572 13399 gene locus_tag LOCUS_13390 13572 13399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 13628 14032 gene locus_tag LOCUS_13400 13628 14032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 14149 15435 gene locus_tag LOCUS_13410 14149 15435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 15432 16925 gene locus_tag LOCUS_13420 15432 16925 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119838.1 protein_id gnl|my_center|LOCUS_13420 16922 17653 gene locus_tag LOCUS_13430 16922 17653 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_13430 17644 18798 gene locus_tag LOCUS_13440 17644 18798 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922783.1 protein_id gnl|my_center|LOCUS_13440 18795 19982 gene locus_tag LOCUS_13450 18795 19982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 20058 20555 gene locus_tag LOCUS_13460 20058 20555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 20565 22130 gene locus_tag LOCUS_13470 gene xylB 20565 22130 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_13470 22123 22320 gene locus_tag LOCUS_13480 22123 22320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 23289 22396 gene locus_tag LOCUS_13490 23289 22396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 24268 23381 gene locus_tag LOCUS_13500 24268 23381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence045 2666 360 gene locus_tag LOCUS_13510 2666 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 3126 4124 gene locus_tag LOCUS_13520 3126 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 5754 4144 gene locus_tag LOCUS_13530 gene trpE 5754 4144 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121650.1 protein_id gnl|my_center|LOCUS_13530 5873 6556 gene locus_tag LOCUS_13540 5873 6556 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_13540 6553 7086 gene locus_tag LOCUS_13550 gene ruvC 6553 7086 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120029.1 protein_id gnl|my_center|LOCUS_13550 7215 7976 gene locus_tag LOCUS_13560 7215 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 8393 9187 gene locus_tag LOCUS_13570 8393 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 9201 10667 gene locus_tag LOCUS_13580 9201 10667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 10946 10743 gene locus_tag LOCUS_13590 10946 10743 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015098.1 protein_id gnl|my_center|LOCUS_13590 11458 10988 gene locus_tag LOCUS_13600 11458 10988 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879168.1 protein_id gnl|my_center|LOCUS_13600 12388 11516 gene locus_tag LOCUS_13610 12388 11516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 12785 12600 gene locus_tag LOCUS_13620 12785 12600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 12694 14562 gene locus_tag LOCUS_13630 12694 14562 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_13630 14665 16917 gene locus_tag LOCUS_13640 gene recQ 14665 16917 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929065.1 protein_id gnl|my_center|LOCUS_13640 18766 16979 gene locus_tag LOCUS_13650 18766 16979 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930368.1 protein_id gnl|my_center|LOCUS_13650 20391 18820 gene locus_tag LOCUS_13660 20391 18820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 21684 20758 gene locus_tag LOCUS_13670 21684 20758 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326459.1 protein_id gnl|my_center|LOCUS_13670 22552 21773 gene locus_tag LOCUS_13680 22552 21773 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870068.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence046 106 789 gene locus_tag LOCUS_13690 106 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1171 2868 gene locus_tag LOCUS_13700 gene groL 1171 2868 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615436.1 protein_id gnl|my_center|LOCUS_13700 2979 3269 gene locus_tag LOCUS_13710 gene groES 2979 3269 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393620.1 protein_id gnl|my_center|LOCUS_13710 3354 4967 gene locus_tag LOCUS_13720 gene groL 3354 4967 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330146.1 protein_id gnl|my_center|LOCUS_13720 5103 6248 gene locus_tag LOCUS_13730 gene dnaJ 5103 6248 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122091.1 protein_id gnl|my_center|LOCUS_13730 6318 6848 gene locus_tag LOCUS_13740 gene grpE 6318 6848 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507314.1 protein_id gnl|my_center|LOCUS_13740 6954 7694 gene locus_tag LOCUS_13750 6954 7694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 7785 10250 gene locus_tag LOCUS_13760 gene rnr 7785 10250 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434984.1 protein_id gnl|my_center|LOCUS_13760 11750 10581 gene locus_tag LOCUS_13770 11750 10581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 12576 13253 gene locus_tag LOCUS_13780 12576 13253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 14721 13261 gene locus_tag LOCUS_13790 14721 13261 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922839.1 protein_id gnl|my_center|LOCUS_13790 17627 14718 gene locus_tag LOCUS_13800 17627 14718 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615465.1 protein_id gnl|my_center|LOCUS_13800 19123 17837 gene locus_tag LOCUS_13810 19123 17837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 20083 19349 gene locus_tag LOCUS_13820 20083 19349 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958017.1 protein_id gnl|my_center|LOCUS_13820 20808 20461 gene locus_tag LOCUS_13830 20808 20461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 20801 22261 gene locus_tag LOCUS_13840 20801 22261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence047 997 536 gene locus_tag LOCUS_13850 gene mraZ 997 536 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644614.1 protein_id gnl|my_center|LOCUS_13850 1213 1824 gene locus_tag LOCUS_13860 1213 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1863 2957 gene locus_tag LOCUS_13870 1863 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 3943 2924 gene locus_tag LOCUS_13880 3943 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 4663 3950 gene locus_tag LOCUS_13890 4663 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 5370 4747 gene locus_tag LOCUS_13900 5370 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 6011 5481 gene locus_tag LOCUS_13910 6011 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 6074 7111 gene locus_tag LOCUS_13920 6074 7111 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_13920 8556 7150 gene locus_tag LOCUS_13930 8556 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 9977 8553 gene locus_tag LOCUS_13940 9977 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 11210 10044 gene locus_tag LOCUS_13950 gene aroB 11210 10044 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037967.1 protein_id gnl|my_center|LOCUS_13950 11355 11528 gene locus_tag LOCUS_13960 11355 11528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 11644 11569 gene locus_tag LOCUS_t00190 11644 11569 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 13206 11815 gene locus_tag LOCUS_13970 13206 11815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 15441 13396 gene locus_tag LOCUS_13980 15441 13396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 16136 15438 gene locus_tag LOCUS_13990 16136 15438 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461981.1 protein_id gnl|my_center|LOCUS_13990 17613 16327 gene locus_tag LOCUS_14000 17613 16327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 20136 17632 gene locus_tag LOCUS_14010 20136 17632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 20503 20428 gene locus_tag LOCUS_t00200 20503 20428 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence048 145 981 gene locus_tag LOCUS_14020 145 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 3818 1041 gene locus_tag LOCUS_14030 3818 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 4970 3897 gene locus_tag LOCUS_14040 gene pdxA 4970 3897 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_14040 6305 5010 gene locus_tag LOCUS_14050 6305 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 7206 6502 gene locus_tag LOCUS_14060 7206 6502 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258342.1 protein_id gnl|my_center|LOCUS_14060 8435 7203 gene locus_tag LOCUS_14070 8435 7203 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_14070 8658 12524 gene locus_tag LOCUS_14080 8658 12524 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263823.1 protein_id gnl|my_center|LOCUS_14080 12753 14588 gene locus_tag LOCUS_14090 gene glmS 12753 14588 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931824.1 protein_id gnl|my_center|LOCUS_14090 15290 14706 gene locus_tag LOCUS_14100 15290 14706 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109429.1 protein_id gnl|my_center|LOCUS_14100 15401 17299 gene locus_tag LOCUS_14110 15401 17299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 17296 18195 gene locus_tag LOCUS_14120 gene folP 17296 18195 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971558.1 protein_id gnl|my_center|LOCUS_14120 18365 18694 gene locus_tag LOCUS_14130 gene trxA 18365 18694 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962434.1 protein_id gnl|my_center|LOCUS_14130 19527 18715 gene locus_tag LOCUS_14140 19527 18715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 21524 19923 gene locus_tag LOCUS_14150 21524 19923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence049 <1 1022 gene locus_tag LOCUS_14160 <1 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389437.1:NADH-quinone oxidoreductase subunit NuoH 1048 1242 gene locus_tag LOCUS_14170 1048 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1350 2957 gene locus_tag LOCUS_14180 gene radA 1350 2957 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927834.1 protein_id gnl|my_center|LOCUS_14180 3484 4839 gene locus_tag LOCUS_14190 3484 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 5126 6718 gene locus_tag LOCUS_14200 5126 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 7101 10088 gene locus_tag LOCUS_14210 gene purL 7101 10088 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120422.1 protein_id gnl|my_center|LOCUS_14210 10085 10933 gene locus_tag LOCUS_14220 gene purQ 10085 10933 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256638.1 protein_id gnl|my_center|LOCUS_14220 10930 12009 gene locus_tag LOCUS_14230 10930 12009 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_14230 12071 13609 gene locus_tag LOCUS_14240 12071 13609 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527331.1 protein_id gnl|my_center|LOCUS_14240 13636 14607 gene locus_tag LOCUS_14250 13636 14607 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_14250 14848 15807 gene locus_tag LOCUS_14260 14848 15807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 15922 16314 gene locus_tag LOCUS_14270 15922 16314 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_14270 19146 16405 gene locus_tag LOCUS_14280 19146 16405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 >Feature sequence050 1257 340 gene locus_tag LOCUS_14290 1257 340 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615947.1 protein_id gnl|my_center|LOCUS_14290 1340 1522 gene locus_tag LOCUS_14300 1340 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 2282 1656 gene locus_tag LOCUS_14310 2282 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 6241 2573 gene locus_tag LOCUS_14320 6241 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 8798 6417 gene locus_tag LOCUS_14330 8798 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922195.1 protein_id gnl|my_center|LOCUS_14330 11086 8795 gene locus_tag LOCUS_14340 11086 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 12051 11083 gene locus_tag LOCUS_14350 12051 11083 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_14350 13144 12080 gene locus_tag LOCUS_14360 13144 12080 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_14360 13467 14360 gene locus_tag LOCUS_14370 gene mutM 13467 14360 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246122.1 protein_id gnl|my_center|LOCUS_14370 16105 14861 gene locus_tag LOCUS_14380 gene dnaA 16105 14861 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428017.1 protein_id gnl|my_center|LOCUS_14380 17613 16474 gene locus_tag LOCUS_14390 17613 16474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 17895 18203 gene locus_tag LOCUS_14400 17895 18203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 18200 19138 gene locus_tag LOCUS_14410 18200 19138 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_14410 19320 19961 gene locus_tag LOCUS_14420 19320 19961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence051 1753 515 gene locus_tag LOCUS_14430 1753 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1995 3860 gene locus_tag LOCUS_14440 gene argS 1995 3860 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951154.1 protein_id gnl|my_center|LOCUS_14440 4916 3885 gene locus_tag LOCUS_14450 4916 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 5031 5645 gene locus_tag LOCUS_14460 gene upp 5031 5645 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437840.1 protein_id gnl|my_center|LOCUS_14460 6248 5673 gene locus_tag LOCUS_14470 6248 5673 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_14470 6394 6843 gene locus_tag LOCUS_14480 6394 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 7393 7815 gene locus_tag LOCUS_14490 7393 7815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 7728 8513 gene locus_tag LOCUS_14500 7728 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 8834 9964 gene locus_tag LOCUS_14510 8834 9964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 10205 10561 gene locus_tag LOCUS_14520 10205 10561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 10682 12478 gene locus_tag LOCUS_14530 gene muiA 10682 12478 CDS product mucoidy inhibitor MuiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_14530 14309 12678 gene locus_tag LOCUS_14540 gene groL 14309 12678 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939262.1 protein_id gnl|my_center|LOCUS_14540 14584 14381 gene locus_tag LOCUS_14550 14584 14381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 15023 14628 gene locus_tag LOCUS_14560 15023 14628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 15740 15105 gene locus_tag LOCUS_14570 15740 15105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 16320 17741 gene locus_tag LOCUS_14580 gene asnS 16320 17741 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705384.1 protein_id gnl|my_center|LOCUS_14580 17795 18022 gene locus_tag LOCUS_14590 17795 18022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 18106 18699 gene locus_tag LOCUS_14600 18106 18699 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_14600 18714 18992 gene locus_tag LOCUS_14610 18714 18992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 >Feature sequence052 78 1055 gene locus_tag LOCUS_14620 78 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 2416 1121 gene locus_tag LOCUS_14630 gene eno 2416 1121 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123706.1 protein_id gnl|my_center|LOCUS_14630 4333 2519 gene locus_tag LOCUS_14640 4333 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 6906 4330 gene locus_tag LOCUS_14650 6906 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 7130 7861 gene locus_tag LOCUS_14660 7130 7861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 7919 8620 gene locus_tag LOCUS_14670 7919 8620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 10262 8709 gene locus_tag LOCUS_14680 10262 8709 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036964.1 protein_id gnl|my_center|LOCUS_14680 10432 11115 gene locus_tag LOCUS_14690 10432 11115 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920264.1 protein_id gnl|my_center|LOCUS_14690 11106 13010 gene locus_tag LOCUS_14700 11106 13010 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550744.1 protein_id gnl|my_center|LOCUS_14700 15212 13077 gene locus_tag LOCUS_14710 15212 13077 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259247.1 protein_id gnl|my_center|LOCUS_14710 16123 15209 gene locus_tag LOCUS_14720 16123 15209 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427744.1 protein_id gnl|my_center|LOCUS_14720 17313 16123 gene locus_tag LOCUS_14730 17313 16123 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922072.1 protein_id gnl|my_center|LOCUS_14730 20281 17291 gene locus_tag LOCUS_14740 20281 17291 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922518.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence053 294 1019 gene locus_tag LOCUS_14750 294 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1260 3038 gene locus_tag LOCUS_14760 1260 3038 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937349.1 protein_id gnl|my_center|LOCUS_14760 4160 3063 gene locus_tag LOCUS_14770 4160 3063 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228099.1 protein_id gnl|my_center|LOCUS_14770 4357 5172 gene locus_tag LOCUS_14780 4357 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 6337 5291 gene locus_tag LOCUS_14790 6337 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 7123 6566 gene locus_tag LOCUS_14800 7123 6566 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174302.1 protein_id gnl|my_center|LOCUS_14800 7294 7151 gene locus_tag LOCUS_14810 7294 7151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 7443 7369 gene locus_tag LOCUS_t00210 7443 7369 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7873 7466 gene locus_tag LOCUS_14820 7873 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 8079 7807 gene locus_tag LOCUS_14830 8079 7807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 7970 9394 gene locus_tag LOCUS_14840 gene cls 7970 9394 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122347.1 protein_id gnl|my_center|LOCUS_14840 9628 9704 gene locus_tag LOCUS_t00220 9628 9704 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11656 9797 gene locus_tag LOCUS_14850 gene pyrG 11656 9797 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250144.1 protein_id gnl|my_center|LOCUS_14850 12549 11764 gene locus_tag LOCUS_14860 gene kdsB 12549 11764 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123860.1 protein_id gnl|my_center|LOCUS_14860 14048 12546 gene locus_tag LOCUS_14870 14048 12546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 14385 14888 gene locus_tag LOCUS_14880 gene def 14385 14888 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082176.1 protein_id gnl|my_center|LOCUS_14880 14889 15836 gene locus_tag LOCUS_14890 gene fmt 14889 15836 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383426.1 protein_id gnl|my_center|LOCUS_14890 16190 16690 gene locus_tag LOCUS_14900 16190 16690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 17862 16732 gene locus_tag LOCUS_14910 gene queA 17862 16732 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531823.1 protein_id gnl|my_center|LOCUS_14910 19510 18026 gene locus_tag LOCUS_14920 gene ffh 19510 18026 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_14920 <20341 19688 gene locus_tag LOCUS_14930 <20341 19688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007333812.1:DNA-directed RNA polymerase subunit beta' >Feature sequence054 5201 561 gene locus_tag LOCUS_14940 5201 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 5469 5789 gene locus_tag LOCUS_14950 5469 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 5791 6372 gene locus_tag LOCUS_14960 5791 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 6374 7654 gene locus_tag LOCUS_14970 6374 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 8311 7688 gene locus_tag LOCUS_14980 8311 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 8539 11193 gene locus_tag LOCUS_14990 8539 11193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 11621 13243 gene locus_tag LOCUS_15000 11621 13243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 14750 13284 gene locus_tag LOCUS_15010 14750 13284 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055172.1 protein_id gnl|my_center|LOCUS_15010 14881 15750 gene locus_tag LOCUS_15020 14881 15750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 16187 15759 gene locus_tag LOCUS_15030 16187 15759 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256033.1 protein_id gnl|my_center|LOCUS_15030 16296 17336 gene locus_tag LOCUS_15040 16296 17336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 17821 17357 gene locus_tag LOCUS_15050 17821 17357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 19120 17972 gene locus_tag LOCUS_15060 19120 17972 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_15060 20150 19842 gene locus_tag LOCUS_15070 20150 19842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence055 <1 1087 gene locus_tag LOCUS_15080 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327432.1:SLC13 family permease 1137 2126 gene locus_tag LOCUS_15090 1137 2126 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_15090 2711 2199 gene locus_tag LOCUS_15100 2711 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 2685 3656 gene locus_tag LOCUS_15110 gene cysD 2685 3656 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_15110 3656 5665 gene locus_tag LOCUS_15120 gene cysN 3656 5665 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121644.1 protein_id gnl|my_center|LOCUS_15120 6772 5669 gene locus_tag LOCUS_15130 6772 5669 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_15130 6852 7691 gene locus_tag LOCUS_15140 6852 7691 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811066.1 protein_id gnl|my_center|LOCUS_15140 7917 7720 gene locus_tag LOCUS_15150 7917 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 8471 7989 gene locus_tag LOCUS_15160 8471 7989 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_15160 11595 8575 gene locus_tag LOCUS_15170 11595 8575 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_15170 13017 11617 gene locus_tag LOCUS_15180 13017 11617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 14450 13128 gene locus_tag LOCUS_15190 14450 13128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 15078 14527 gene locus_tag LOCUS_15200 gene folK 15078 14527 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_15200 16363 15062 gene locus_tag LOCUS_15210 16363 15062 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940819.1 protein_id gnl|my_center|LOCUS_15210 17985 16360 gene locus_tag LOCUS_15220 17985 16360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 18915 18022 gene locus_tag LOCUS_15230 gene pyrF 18915 18022 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922551.1 protein_id gnl|my_center|LOCUS_15230 19320 18979 gene locus_tag LOCUS_15240 19320 18979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 19327 19851 gene locus_tag LOCUS_15250 19327 19851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence056 1447 2571 gene locus_tag LOCUS_15260 1447 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 2596 4545 gene locus_tag LOCUS_15270 2596 4545 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731086.1 protein_id gnl|my_center|LOCUS_15270 4542 5510 gene locus_tag LOCUS_15280 4542 5510 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329701.1 protein_id gnl|my_center|LOCUS_15280 6189 5545 gene locus_tag LOCUS_15290 6189 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 6378 8486 gene locus_tag LOCUS_15300 6378 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 8655 9470 gene locus_tag LOCUS_15310 gene rsmA 8655 9470 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114054.1 protein_id gnl|my_center|LOCUS_15310 11172 9616 gene locus_tag LOCUS_15320 11172 9616 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021220.1 protein_id gnl|my_center|LOCUS_15320 13103 11271 gene locus_tag LOCUS_15330 13103 11271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 13786 15366 gene locus_tag LOCUS_15340 gene rny 13786 15366 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870004.1 protein_id gnl|my_center|LOCUS_15340 15818 17428 gene locus_tag LOCUS_15350 15818 17428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 17866 17483 gene locus_tag LOCUS_15360 17866 17483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 18344 17985 gene locus_tag LOCUS_15370 18344 17985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 <19904 18519 gene locus_tag LOCUS_15380 <19904 18519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921428.1:general secretion pathway protein GspD >Feature sequence057 7395 862 gene locus_tag LOCUS_15390 7395 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 7909 9414 gene locus_tag LOCUS_15400 7909 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 9758 10447 gene locus_tag LOCUS_15410 9758 10447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 10501 11796 gene locus_tag LOCUS_15420 10501 11796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 11903 14467 gene locus_tag LOCUS_15430 11903 14467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 15475 14495 gene locus_tag LOCUS_15440 15475 14495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 15817 16725 gene locus_tag LOCUS_15450 15817 16725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 17144 16734 gene locus_tag LOCUS_15460 17144 16734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 17443 18138 gene locus_tag LOCUS_15470 17443 18138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 18976 18158 gene locus_tag LOCUS_15480 18976 18158 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944061.1 protein_id gnl|my_center|LOCUS_15480 19336 19142 gene locus_tag LOCUS_15490 19336 19142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence058 1296 2660 gene locus_tag LOCUS_15500 1296 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 2824 3471 gene locus_tag LOCUS_15510 2824 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 4578 3541 gene locus_tag LOCUS_15520 4578 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 4879 7083 gene locus_tag LOCUS_15530 4879 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 7193 8188 gene locus_tag LOCUS_15540 gene hflC 7193 8188 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106429.1 protein_id gnl|my_center|LOCUS_15540 8185 9651 gene locus_tag LOCUS_15550 8185 9651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 9792 11075 gene locus_tag LOCUS_15560 9792 11075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 11072 13141 gene locus_tag LOCUS_15570 11072 13141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 13143 15101 gene locus_tag LOCUS_15580 13143 15101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 15324 15980 gene locus_tag LOCUS_15590 15324 15980 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879714.1 protein_id gnl|my_center|LOCUS_15590 16183 15992 gene locus_tag LOCUS_15600 16183 15992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 16689 16192 gene locus_tag LOCUS_15610 16689 16192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 18410 16686 gene locus_tag LOCUS_15620 18410 16686 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065752.1 protein_id gnl|my_center|LOCUS_15620 18626 18865 gene locus_tag LOCUS_15630 18626 18865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence059 1672 317 gene locus_tag LOCUS_15640 gene lysA 1672 317 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_15640 2578 1685 gene locus_tag LOCUS_15650 2578 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 2858 3949 gene locus_tag LOCUS_15660 gene pheA 2858 3949 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_15660 3995 6208 gene locus_tag LOCUS_15670 3995 6208 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460118.1 protein_id gnl|my_center|LOCUS_15670 6232 6771 gene locus_tag LOCUS_15680 6232 6771 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_15680 8971 6893 gene locus_tag LOCUS_15690 8971 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 9088 9783 gene locus_tag LOCUS_15700 9088 9783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 11104 9749 gene locus_tag LOCUS_15710 11104 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 11381 11308 gene locus_tag LOCUS_t00230 11381 11308 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 15665 11520 gene locus_tag LOCUS_15720 15665 11520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 16257 15853 gene locus_tag LOCUS_15730 16257 15853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 16475 18121 gene locus_tag LOCUS_15740 16475 18121 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_15740 18118 19182 gene locus_tag LOCUS_15750 18118 19182 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721763.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence060 260 1420 gene locus_tag LOCUS_15760 260 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122677.1 protein_id gnl|my_center|LOCUS_15760 2327 1806 gene locus_tag LOCUS_15770 2327 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 4471 2492 gene locus_tag LOCUS_15780 4471 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 6337 4712 gene locus_tag LOCUS_15790 gene ade 6337 4712 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118829317.1 protein_id gnl|my_center|LOCUS_15790 7322 6441 gene locus_tag LOCUS_15800 7322 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 7481 8887 gene locus_tag LOCUS_15810 7481 8887 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017657362.1 protein_id gnl|my_center|LOCUS_15810 9488 9078 gene locus_tag LOCUS_15820 9488 9078 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119515.1 protein_id gnl|my_center|LOCUS_15820 11108 9534 gene locus_tag LOCUS_15830 11108 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 12031 11105 gene locus_tag LOCUS_15840 12031 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 12672 12331 gene locus_tag LOCUS_15850 12672 12331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 13549 12665 gene locus_tag LOCUS_15860 13549 12665 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_15860 14113 13679 gene locus_tag LOCUS_15870 14113 13679 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_15870 14284 16218 gene locus_tag LOCUS_15880 14284 16218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 16215 16973 gene locus_tag LOCUS_15890 16215 16973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 17019 17696 gene locus_tag LOCUS_15900 17019 17696 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123040.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence061 122 1369 gene locus_tag LOCUS_15910 122 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1581 3902 gene locus_tag LOCUS_15920 1581 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 3963 4508 gene locus_tag LOCUS_15930 3963 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 4665 6155 gene locus_tag LOCUS_15940 4665 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 6270 8666 gene locus_tag LOCUS_15950 6270 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 8666 8962 gene locus_tag LOCUS_15960 8666 8962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 8970 10238 gene locus_tag LOCUS_15970 gene mdtN 8970 10238 CDS product multidrug efflux transporter periplasmic adaptor subunit MdtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446338.1 protein_id gnl|my_center|LOCUS_15970 11957 10281 gene locus_tag LOCUS_15980 11957 10281 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938312.1 protein_id gnl|my_center|LOCUS_15980 12383 12132 gene locus_tag LOCUS_15990 12383 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 12312 12563 gene locus_tag LOCUS_16000 12312 12563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 12830 15025 gene locus_tag LOCUS_16010 gene katG 12830 15025 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522123.1 protein_id gnl|my_center|LOCUS_16010 15328 16233 gene locus_tag LOCUS_16020 15328 16233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 16711 18150 gene locus_tag LOCUS_16030 16711 18150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence062 1876 332 gene locus_tag LOCUS_16040 1876 332 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172762.1 protein_id gnl|my_center|LOCUS_16040 3309 1951 gene locus_tag LOCUS_16050 3309 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 3463 3918 gene locus_tag LOCUS_16060 3463 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 4333 5178 gene locus_tag LOCUS_16070 4333 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 5679 8636 gene locus_tag LOCUS_16080 5679 8636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 8779 9618 gene locus_tag LOCUS_16090 8779 9618 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815039.1 protein_id gnl|my_center|LOCUS_16090 9660 10871 gene locus_tag LOCUS_16100 9660 10871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 11931 10906 gene locus_tag LOCUS_16110 11931 10906 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127350626.1 protein_id gnl|my_center|LOCUS_16110 13481 12237 gene locus_tag LOCUS_16120 13481 12237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 17117 13611 gene locus_tag LOCUS_16130 17117 13611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 17855 17358 gene locus_tag LOCUS_16140 17855 17358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence063 807 2192 gene locus_tag LOCUS_16150 807 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 2414 3313 gene locus_tag LOCUS_16160 2414 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 3322 4260 gene locus_tag LOCUS_16170 3322 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 4257 5096 gene locus_tag LOCUS_16180 4257 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 5096 7375 gene locus_tag LOCUS_16190 5096 7375 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918053.1 protein_id gnl|my_center|LOCUS_16190 7860 7486 gene locus_tag LOCUS_16200 7860 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 8005 8910 gene locus_tag LOCUS_16210 8005 8910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 8976 13172 gene locus_tag LOCUS_16220 8976 13172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 13264 14163 gene locus_tag LOCUS_16230 gene rfbA 13264 14163 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_16230 14195 14755 gene locus_tag LOCUS_16240 gene rfbC 14195 14755 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_16240 14755 15633 gene locus_tag LOCUS_16250 gene rfbD 14755 15633 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_16250 15655 16776 gene locus_tag LOCUS_16260 gene rfbB 15655 16776 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266716.1 protein_id gnl|my_center|LOCUS_16260 17021 16758 gene locus_tag LOCUS_16270 17021 16758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence064 1169 1801 gene locus_tag LOCUS_16280 1169 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 2557 1931 gene locus_tag LOCUS_16290 2557 1931 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339235.1 protein_id gnl|my_center|LOCUS_16290 2842 3909 gene locus_tag LOCUS_16300 2842 3909 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920956.1 protein_id gnl|my_center|LOCUS_16300 3906 4760 gene locus_tag LOCUS_16310 3906 4760 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257270.1 protein_id gnl|my_center|LOCUS_16310 4819 5724 gene locus_tag LOCUS_16320 gene atpG 4819 5724 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244388.1 protein_id gnl|my_center|LOCUS_16320 6284 5847 gene locus_tag LOCUS_16330 6284 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 6673 7560 gene locus_tag LOCUS_16340 6673 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 7557 8408 gene locus_tag LOCUS_16350 7557 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 9701 8553 gene locus_tag LOCUS_16360 gene dnaN 9701 8553 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427747.1 protein_id gnl|my_center|LOCUS_16360 9990 10409 gene locus_tag LOCUS_16370 9990 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 10409 10711 gene locus_tag LOCUS_16380 10409 10711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 10770 11267 gene locus_tag LOCUS_16390 10770 11267 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583173.1 protein_id gnl|my_center|LOCUS_16390 11264 11728 gene locus_tag LOCUS_16400 gene rpiB 11264 11728 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_16400 11842 13323 gene locus_tag LOCUS_16410 11842 13323 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_16410 15406 13415 gene locus_tag LOCUS_16420 gene mnmG 15406 13415 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427787.1 protein_id gnl|my_center|LOCUS_16420 15483 15555 gene locus_tag LOCUS_t00240 15483 15555 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15581 17203 gene locus_tag LOCUS_16430 15581 17203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence065 2188 1256 gene locus_tag LOCUS_16440 2188 1256 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932656.1 protein_id gnl|my_center|LOCUS_16440 3029 2226 gene locus_tag LOCUS_16450 3029 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 3107 4672 gene locus_tag LOCUS_16460 gene hutH 3107 4672 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640105.1 protein_id gnl|my_center|LOCUS_16460 4683 6422 gene locus_tag LOCUS_16470 gene hutU 4683 6422 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889411.1 protein_id gnl|my_center|LOCUS_16470 6600 7574 gene locus_tag LOCUS_16480 6600 7574 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853543.1 protein_id gnl|my_center|LOCUS_16480 9464 7635 gene locus_tag LOCUS_16490 9464 7635 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942254.1 protein_id gnl|my_center|LOCUS_16490 9872 11194 gene locus_tag LOCUS_16500 9872 11194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 11406 11478 gene locus_tag LOCUS_t00250 11406 11478 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11617 12339 gene locus_tag LOCUS_16510 11617 12339 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907843.1 protein_id gnl|my_center|LOCUS_16510 13342 12368 gene locus_tag LOCUS_16520 13342 12368 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529938.1 protein_id gnl|my_center|LOCUS_16520 14726 13488 gene locus_tag LOCUS_16530 14726 13488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 16209 15043 gene locus_tag LOCUS_16540 16209 15043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 16817 16230 gene locus_tag LOCUS_16550 16817 16230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence066 1483 317 gene locus_tag LOCUS_16560 1483 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1833 3071 gene locus_tag LOCUS_16570 gene sucC 1833 3071 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 protein_id gnl|my_center|LOCUS_16570 3111 3848 gene locus_tag LOCUS_16580 3111 3848 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404382.1 protein_id gnl|my_center|LOCUS_16580 3904 4656 gene locus_tag LOCUS_16590 3904 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123337.1 protein_id gnl|my_center|LOCUS_16590 4687 5802 gene locus_tag LOCUS_16600 4687 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 6268 5948 gene locus_tag LOCUS_16610 6268 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 7653 6718 gene locus_tag LOCUS_16620 7653 6718 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245029.1 protein_id gnl|my_center|LOCUS_16620 8028 8942 gene locus_tag LOCUS_16630 8028 8942 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_16630 9010 9903 gene locus_tag LOCUS_16640 9010 9903 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_16640 9942 11042 gene locus_tag LOCUS_16650 9942 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 11039 12139 gene locus_tag LOCUS_16660 11039 12139 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_16660 12136 13212 gene locus_tag LOCUS_16670 12136 13212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16670 13209 14153 gene locus_tag LOCUS_16680 13209 14153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 14233 16077 gene locus_tag LOCUS_16690 14233 16077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 16074 16955 gene locus_tag LOCUS_16700 16074 16955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence067 2088 883 gene locus_tag LOCUS_16710 gene purD 2088 883 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334006.1 protein_id gnl|my_center|LOCUS_16710 1969 2301 gene locus_tag LOCUS_16720 1969 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 2294 3772 gene locus_tag LOCUS_16730 2294 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 3950 4951 gene locus_tag LOCUS_16740 3950 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 6248 4998 gene locus_tag LOCUS_16750 6248 4998 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921570.1 protein_id gnl|my_center|LOCUS_16750 8223 6394 gene locus_tag LOCUS_16760 gene aspS 8223 6394 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_16760 8378 9553 gene locus_tag LOCUS_16770 gene lpxB 8378 9553 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113865.1 protein_id gnl|my_center|LOCUS_16770 9853 9635 gene locus_tag LOCUS_16780 9853 9635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 9852 10919 gene locus_tag LOCUS_16790 9852 10919 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976809.1 protein_id gnl|my_center|LOCUS_16790 11071 12048 gene locus_tag LOCUS_16800 11071 12048 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937854.1 protein_id gnl|my_center|LOCUS_16800 12048 13082 gene locus_tag LOCUS_16810 12048 13082 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530006.1 protein_id gnl|my_center|LOCUS_16810 13079 14119 gene locus_tag LOCUS_16820 13079 14119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 14116 14883 gene locus_tag LOCUS_16830 14116 14883 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142892.1 protein_id gnl|my_center|LOCUS_16830 14971 16167 gene locus_tag LOCUS_16840 14971 16167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 16136 16627 gene locus_tag LOCUS_16850 16136 16627 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence068 1369 2457 gene locus_tag LOCUS_16860 gene ychF 1369 2457 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037200879.1 protein_id gnl|my_center|LOCUS_16860 3165 2551 gene locus_tag LOCUS_16870 3165 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 4224 3607 gene locus_tag LOCUS_16880 gene aat 4224 3607 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533070.1 protein_id gnl|my_center|LOCUS_16880 5638 4259 gene locus_tag LOCUS_16890 gene gabD 5638 4259 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246615.1 protein_id gnl|my_center|LOCUS_16890 6715 5714 gene locus_tag LOCUS_16900 6715 5714 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530018.1 protein_id gnl|my_center|LOCUS_16900 7840 7912 gene locus_tag LOCUS_t00260 7840 7912 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8073 8873 gene locus_tag LOCUS_16910 8073 8873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 8870 9853 gene locus_tag LOCUS_16920 8870 9853 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325730.1 protein_id gnl|my_center|LOCUS_16920 10032 10676 gene locus_tag LOCUS_16930 10032 10676 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324826.1 protein_id gnl|my_center|LOCUS_16930 10742 11473 gene locus_tag LOCUS_16940 gene pth 10742 11473 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_16940 11528 11998 gene locus_tag LOCUS_16950 11528 11998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 14129 12177 gene locus_tag LOCUS_16960 14129 12177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 15337 14126 gene locus_tag LOCUS_16970 15337 14126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 15738 15334 gene locus_tag LOCUS_16980 15738 15334 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 protein_id gnl|my_center|LOCUS_16980 16109 15798 gene locus_tag LOCUS_16990 16109 15798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence069 1444 164 gene locus_tag LOCUS_17000 1444 164 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530014.1 protein_id gnl|my_center|LOCUS_17000 1608 1892 gene locus_tag LOCUS_17010 1608 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1979 2764 gene locus_tag LOCUS_17020 1979 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 3713 2772 gene locus_tag LOCUS_17030 3713 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 5377 3905 gene locus_tag LOCUS_17040 5377 3905 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187771.1 protein_id gnl|my_center|LOCUS_17040 6654 5482 gene locus_tag LOCUS_17050 6654 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 8812 6785 gene locus_tag LOCUS_17060 8812 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 9464 8880 gene locus_tag LOCUS_17070 9464 8880 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_17070 11230 9530 gene locus_tag LOCUS_17080 11230 9530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 12777 11227 gene locus_tag LOCUS_17090 12777 11227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 13709 12828 gene locus_tag LOCUS_17100 13709 12828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 16197 13918 gene locus_tag LOCUS_17110 16197 13918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 16338 16411 gene locus_tag LOCUS_t00270 16338 16411 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence070 998 1123 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atgtgcctgtcaccgatgtgcctg 1186 1971 gene locus_tag LOCUS_17120 gene tpiA 1186 1971 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121241.1 protein_id gnl|my_center|LOCUS_17120 2089 2574 gene locus_tag LOCUS_17130 2089 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 2608 3498 gene locus_tag LOCUS_17140 2608 3498 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625866.1 protein_id gnl|my_center|LOCUS_17140 3502 4743 gene locus_tag LOCUS_17150 3502 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 4847 5857 gene locus_tag LOCUS_17160 4847 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 6515 5886 gene locus_tag LOCUS_17170 6515 5886 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963489.1 protein_id gnl|my_center|LOCUS_17170 6905 8560 gene locus_tag LOCUS_17180 6905 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17180 8557 9303 gene locus_tag LOCUS_17190 8557 9303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 11022 9622 gene locus_tag LOCUS_17200 11022 9622 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_17200 11874 11194 gene locus_tag LOCUS_17210 gene phoU 11874 11194 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080001.1 protein_id gnl|my_center|LOCUS_17210 11941 12786 gene locus_tag LOCUS_17220 gene pdxJ 11941 12786 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818969.1 protein_id gnl|my_center|LOCUS_17220 12866 13858 gene locus_tag LOCUS_17230 gene dapA 12866 13858 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921565.1 protein_id gnl|my_center|LOCUS_17230 13855 14406 gene locus_tag LOCUS_17240 13855 14406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 14700 14888 gene locus_tag LOCUS_17250 14700 14888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140805.1 protein_id gnl|my_center|LOCUS_17250 15089 16162 gene locus_tag LOCUS_17260 15089 16162 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118292.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence071 2646 5519 gene locus_tag LOCUS_17270 2646 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 5785 6381 gene locus_tag LOCUS_17280 5785 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 6378 6854 gene locus_tag LOCUS_17290 6378 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 7078 8940 gene locus_tag LOCUS_17300 7078 8940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 9778 8984 gene locus_tag LOCUS_17310 gene rsmG 9778 8984 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258170.1 protein_id gnl|my_center|LOCUS_17310 10955 9771 gene locus_tag LOCUS_17320 gene rodA 10955 9771 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_17320 13342 10952 gene locus_tag LOCUS_17330 13342 10952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 14619 13429 gene locus_tag LOCUS_17340 gene mraY 14619 13429 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545877.1 protein_id gnl|my_center|LOCUS_17340 <16198 14705 gene locus_tag LOCUS_17350 <16198 14705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194098.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence072 1228 515 gene locus_tag LOCUS_17360 1228 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 2181 1225 gene locus_tag LOCUS_17370 gene thiL 2181 1225 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_17370 2680 2186 gene locus_tag LOCUS_17380 2680 2186 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073310.1 protein_id gnl|my_center|LOCUS_17380 3336 2677 gene locus_tag LOCUS_17390 3336 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 3541 4671 gene locus_tag LOCUS_17400 3541 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 4668 5066 gene locus_tag LOCUS_17410 4668 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 5208 7469 gene locus_tag LOCUS_17420 gene nuoL 5208 7469 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037649.1 protein_id gnl|my_center|LOCUS_17420 7534 9360 gene locus_tag LOCUS_17430 7534 9360 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_17430 9434 11074 gene locus_tag LOCUS_17440 gene nuoN 9434 11074 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975095.1 protein_id gnl|my_center|LOCUS_17440 11270 11196 gene locus_tag LOCUS_t00280 11270 11196 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12897 11356 gene locus_tag LOCUS_17450 12897 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 13532 14323 gene locus_tag LOCUS_17460 13532 14323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 14328 14942 gene locus_tag LOCUS_17470 14328 14942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 15430 14987 gene locus_tag LOCUS_17480 15430 14987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 15641 15567 gene locus_tag LOCUS_t00290 15641 15567 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence073 2288 582 gene locus_tag LOCUS_17490 gene miaB 2288 582 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122282.1 protein_id gnl|my_center|LOCUS_17490 2365 3654 gene locus_tag LOCUS_17500 gene spoVE 2365 3654 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_17500 3651 4793 gene locus_tag LOCUS_17510 gene murG 3651 4793 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545433.1 protein_id gnl|my_center|LOCUS_17510 5927 4866 gene locus_tag LOCUS_17520 5927 4866 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_17520 5990 7240 gene locus_tag LOCUS_17530 5990 7240 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_17530 7237 7470 gene locus_tag LOCUS_17540 7237 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 7467 8345 gene locus_tag LOCUS_17550 7467 8345 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975575.1 protein_id gnl|my_center|LOCUS_17550 9205 8258 gene locus_tag LOCUS_17560 9205 8258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 11014 9341 gene locus_tag LOCUS_17570 11014 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 11952 11011 gene locus_tag LOCUS_17580 11952 11011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 12148 12381 gene locus_tag LOCUS_17590 12148 12381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 13917 12586 gene locus_tag LOCUS_17600 13917 12586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 14315 15742 gene locus_tag LOCUS_17610 14315 15742 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121489.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence074 943 2193 gene locus_tag LOCUS_17620 943 2193 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122791.1 protein_id gnl|my_center|LOCUS_17620 2235 3275 gene locus_tag LOCUS_17630 gene miaA 2235 3275 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_17630 3541 6417 gene locus_tag LOCUS_17640 3541 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 6557 10522 gene locus_tag LOCUS_17650 6557 10522 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119558.1 protein_id gnl|my_center|LOCUS_17650 14638 10586 gene locus_tag LOCUS_17660 gene hrpA 14638 10586 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_17660 14844 14917 gene locus_tag LOCUS_t00300 14844 14917 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence075 925 95 gene locus_tag LOCUS_17670 925 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 3327 1042 gene locus_tag LOCUS_17680 3327 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 5043 3601 gene locus_tag LOCUS_17690 gene atpD 5043 3601 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122672.1 protein_id gnl|my_center|LOCUS_17690 5754 5317 gene locus_tag LOCUS_17700 5754 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 6767 5916 gene locus_tag LOCUS_17710 6767 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 7430 6861 gene locus_tag LOCUS_17720 7430 6861 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_17720 8876 7575 gene locus_tag LOCUS_17730 8876 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 10180 8915 gene locus_tag LOCUS_17740 10180 8915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 11224 10259 gene locus_tag LOCUS_17750 11224 10259 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_17750 12013 11540 gene locus_tag LOCUS_17760 gene fabZ 12013 11540 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141864.1 protein_id gnl|my_center|LOCUS_17760 12215 12030 gene locus_tag LOCUS_17770 12215 12030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 12860 12282 gene locus_tag LOCUS_17780 12860 12282 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 protein_id gnl|my_center|LOCUS_17780 14394 12910 gene locus_tag LOCUS_17790 gene purB 14394 12910 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_17790 15246 14434 gene locus_tag LOCUS_17800 gene plsY 15246 14434 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence076 2366 705 gene locus_tag LOCUS_17810 2366 705 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057022.1 protein_id gnl|my_center|LOCUS_17810 2855 2409 gene locus_tag LOCUS_17820 2855 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 3253 2852 gene locus_tag LOCUS_17830 3253 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 4027 3434 gene locus_tag LOCUS_17840 4027 3434 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329551.1 protein_id gnl|my_center|LOCUS_17840 5174 4458 gene locus_tag LOCUS_17850 5174 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17850 6461 5205 gene locus_tag LOCUS_17860 gene ilvA 6461 5205 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_17860 7864 6458 gene locus_tag LOCUS_17870 gene accC 7864 6458 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332220.1 protein_id gnl|my_center|LOCUS_17870 8483 8055 gene locus_tag LOCUS_17880 gene accB 8483 8055 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214627.1 protein_id gnl|my_center|LOCUS_17880 8687 8887 gene locus_tag LOCUS_17890 8687 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 9805 8891 gene locus_tag LOCUS_17900 9805 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 10615 9827 gene locus_tag LOCUS_17910 10615 9827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013807.1 protein_id gnl|my_center|LOCUS_17910 11616 10603 gene locus_tag LOCUS_17920 11616 10603 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032710978.1 protein_id gnl|my_center|LOCUS_17920 12560 11613 gene locus_tag LOCUS_17930 12560 11613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 13156 12575 gene locus_tag LOCUS_17940 13156 12575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 15074 13242 gene locus_tag LOCUS_17950 15074 13242 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173455.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence077 1753 4872 gene locus_tag LOCUS_17960 1753 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 4869 5693 gene locus_tag LOCUS_17970 4869 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 6733 5771 gene locus_tag LOCUS_17980 6733 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 6781 8190 gene locus_tag LOCUS_17990 6781 8190 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528703.1 protein_id gnl|my_center|LOCUS_17990 8223 9434 gene locus_tag LOCUS_18000 8223 9434 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_18000 9438 10115 gene locus_tag LOCUS_18010 9438 10115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 10752 10132 gene locus_tag LOCUS_18020 gene pdxH 10752 10132 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_18020 11647 10763 gene locus_tag LOCUS_18030 11647 10763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 11963 12241 gene locus_tag LOCUS_18040 11963 12241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 12247 12720 gene locus_tag LOCUS_18050 12247 12720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 >Feature sequence078 154 882 gene locus_tag LOCUS_18060 154 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 879 3710 gene locus_tag LOCUS_18070 879 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 3710 5185 gene locus_tag LOCUS_18080 3710 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 5205 5684 gene locus_tag LOCUS_18090 5205 5684 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035384.1 protein_id gnl|my_center|LOCUS_18090 8303 5733 gene locus_tag LOCUS_18100 8303 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 8395 9948 gene locus_tag LOCUS_18110 8395 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 9945 10499 gene locus_tag LOCUS_18120 9945 10499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 12063 10504 gene locus_tag LOCUS_18130 12063 10504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 13098 12085 gene locus_tag LOCUS_18140 13098 12085 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_18140 13334 13630 gene locus_tag LOCUS_18150 13334 13630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 14020 13652 gene locus_tag LOCUS_18160 14020 13652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 14682 14344 gene locus_tag LOCUS_18170 14682 14344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence079 1124 753 gene locus_tag LOCUS_18180 1124 753 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043553480.1 protein_id gnl|my_center|LOCUS_18180 1646 1140 gene locus_tag LOCUS_18190 1646 1140 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073661.1 protein_id gnl|my_center|LOCUS_18190 3199 1925 gene locus_tag LOCUS_18200 3199 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 5416 3341 gene locus_tag LOCUS_18210 gene speA 5416 3341 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144058.1 protein_id gnl|my_center|LOCUS_18210 5720 6469 gene locus_tag LOCUS_18220 5720 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 8795 6450 gene locus_tag LOCUS_18230 8795 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 9439 8792 gene locus_tag LOCUS_18240 9439 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 11373 9484 gene locus_tag LOCUS_18250 gene hscA 11373 9484 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930571.1 protein_id gnl|my_center|LOCUS_18250 12094 11702 gene locus_tag LOCUS_18260 12094 11702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 13382 12888 gene locus_tag LOCUS_18270 13382 12888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 14143 13379 gene locus_tag LOCUS_18280 14143 13379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence080 1854 1081 gene locus_tag LOCUS_18290 1854 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 1872 2861 gene locus_tag LOCUS_18300 1872 2861 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_18300 4349 2970 gene locus_tag LOCUS_18310 4349 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 4981 4451 gene locus_tag LOCUS_18320 4981 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 5884 5117 gene locus_tag LOCUS_18330 5884 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 7036 5951 gene locus_tag LOCUS_18340 7036 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 8532 7033 gene locus_tag LOCUS_18350 8532 7033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 9665 8598 gene locus_tag LOCUS_18360 9665 8598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 12636 9802 gene locus_tag LOCUS_18370 12636 9802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 12713 13690 gene locus_tag LOCUS_18380 12713 13690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 <14544 13698 gene locus_tag LOCUS_18390 <14544 13698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942333.1:bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II >Feature sequence081 580 398 gene locus_tag LOCUS_18400 580 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 2037 589 gene locus_tag LOCUS_18410 gene malQ 2037 589 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479885.1 protein_id gnl|my_center|LOCUS_18410 4554 2071 gene locus_tag LOCUS_18420 4554 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 4632 6971 gene locus_tag LOCUS_18430 4632 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 6973 7839 gene locus_tag LOCUS_18440 6973 7839 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114402.1 protein_id gnl|my_center|LOCUS_18440 7932 9125 gene locus_tag LOCUS_18450 gene ugpC 7932 9125 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_18450 9768 9112 gene locus_tag LOCUS_18460 9768 9112 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992354.1 protein_id gnl|my_center|LOCUS_18460 11266 9833 gene locus_tag LOCUS_18470 11266 9833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 14081 11412 gene locus_tag LOCUS_18480 14081 11412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence082 1389 424 gene locus_tag LOCUS_18490 gene yedA 1389 424 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038991.1 protein_id gnl|my_center|LOCUS_18490 5020 1457 gene locus_tag LOCUS_18500 gene metH 5020 1457 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389284.1 protein_id gnl|my_center|LOCUS_18500 5344 6969 gene locus_tag LOCUS_18510 5344 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 7034 8026 gene locus_tag LOCUS_18520 7034 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 8309 9094 gene locus_tag LOCUS_18530 8309 9094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 9201 10253 gene locus_tag LOCUS_18540 9201 10253 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524830.1 protein_id gnl|my_center|LOCUS_18540 10246 11613 gene locus_tag LOCUS_18550 10246 11613 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839941.1 protein_id gnl|my_center|LOCUS_18550 11637 13133 gene locus_tag LOCUS_18560 11637 13133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 13544 13831 gene locus_tag LOCUS_18570 13544 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence083 <1 986 gene locus_tag LOCUS_18580 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000385090.1:chromosome condensation regulator 1368 2453 gene locus_tag LOCUS_18590 1368 2453 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_18590 3373 2948 gene locus_tag LOCUS_18600 3373 2948 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121782.1 protein_id gnl|my_center|LOCUS_18600 4874 3378 gene locus_tag LOCUS_18610 gene mnmE 4874 3378 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225859.1 protein_id gnl|my_center|LOCUS_18610 7130 4935 gene locus_tag LOCUS_18620 7130 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 7410 7210 gene locus_tag LOCUS_18630 7410 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 8308 7343 gene locus_tag LOCUS_18640 8308 7343 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_18640 11894 10407 gene locus_tag LOCUS_18650 11894 10407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 12111 13592 gene locus_tag LOCUS_18660 gene lpdA 12111 13592 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence084 1643 159 gene locus_tag LOCUS_18670 1643 159 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531232.1 protein_id gnl|my_center|LOCUS_18670 2124 1657 gene locus_tag LOCUS_18680 2124 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 4190 2121 gene locus_tag LOCUS_18690 4190 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 4662 5726 gene locus_tag LOCUS_18700 4662 5726 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081360963.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18700 6477 5737 gene locus_tag LOCUS_18710 6477 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 6592 6810 gene locus_tag LOCUS_18720 6592 6810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 6871 7755 gene locus_tag LOCUS_18730 6871 7755 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120018.1 protein_id gnl|my_center|LOCUS_18730 9210 7777 gene locus_tag LOCUS_18740 9210 7777 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_18740 9590 10543 gene locus_tag LOCUS_18750 9590 10543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 10658 11509 gene locus_tag LOCUS_18760 gene tsf 10658 11509 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975302.1 protein_id gnl|my_center|LOCUS_18760 13438 11786 gene locus_tag LOCUS_18770 13438 11786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence085 1872 2249 gene locus_tag LOCUS_18780 1872 2249 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948976.1 protein_id gnl|my_center|LOCUS_18780 4419 2275 gene locus_tag LOCUS_18790 4419 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 5020 4412 gene locus_tag LOCUS_18800 5020 4412 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_18800 5199 7220 gene locus_tag LOCUS_18810 5199 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 9852 8383 gene locus_tag LOCUS_18820 9852 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 11829 10360 gene locus_tag LOCUS_18830 11829 10360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 12202 11891 gene locus_tag LOCUS_18840 12202 11891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 12792 12346 gene locus_tag LOCUS_18850 12792 12346 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674247.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence086 529 1686 gene locus_tag LOCUS_18860 gene rhaI 529 1686 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582814.1 protein_id gnl|my_center|LOCUS_18860 1743 3182 gene locus_tag LOCUS_18870 1743 3182 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978046.1 protein_id gnl|my_center|LOCUS_18870 3227 5440 gene locus_tag LOCUS_18880 3227 5440 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258146.1 protein_id gnl|my_center|LOCUS_18880 5482 5802 gene locus_tag LOCUS_18890 5482 5802 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978053.1 protein_id gnl|my_center|LOCUS_18890 5848 7329 gene locus_tag LOCUS_18900 5848 7329 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190823.1 protein_id gnl|my_center|LOCUS_18900 9318 7336 gene locus_tag LOCUS_18910 9318 7336 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198677105.1 protein_id gnl|my_center|LOCUS_18910 10035 9403 gene locus_tag LOCUS_18920 10035 9403 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_18920 11700 10084 gene locus_tag LOCUS_18930 11700 10084 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143151.1 protein_id gnl|my_center|LOCUS_18930 11818 13359 gene locus_tag LOCUS_18940 gene aglB 11818 13359 CDS product cyclomaltodextrinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082380.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence087 741 298 gene locus_tag LOCUS_18950 gene rnhA 741 298 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326294.1 protein_id gnl|my_center|LOCUS_18950 1104 922 gene locus_tag LOCUS_18960 1104 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 1537 2565 gene locus_tag LOCUS_18970 gene plsX 1537 2565 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_18970 2562 3572 gene locus_tag LOCUS_18980 2562 3572 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_18980 3658 4680 gene locus_tag LOCUS_18990 gene fabD 3658 4680 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765648.1 protein_id gnl|my_center|LOCUS_18990 4740 5495 gene locus_tag LOCUS_19000 4740 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 5691 6404 gene locus_tag LOCUS_19010 gene fabG 5691 6404 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324898.1 protein_id gnl|my_center|LOCUS_19010 6680 6925 gene locus_tag LOCUS_19020 6680 6925 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324899.1 protein_id gnl|my_center|LOCUS_19020 7276 7530 gene locus_tag LOCUS_19030 gene acpP 7276 7530 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965054.1 protein_id gnl|my_center|LOCUS_19030 7663 8883 gene locus_tag LOCUS_19040 gene fabF 7663 8883 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036221.1 protein_id gnl|my_center|LOCUS_19040 9185 9454 gene locus_tag LOCUS_19050 9185 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 9545 11563 gene locus_tag LOCUS_19060 9545 11563 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978811.1 protein_id gnl|my_center|LOCUS_19060 11735 12340 gene locus_tag LOCUS_19070 11735 12340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 12906 12736 gene locus_tag LOCUS_19080 12906 12736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 >Feature sequence088 1 186 gene locus_tag LOCUS_19090 1 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1405 260 gene locus_tag LOCUS_19100 1405 260 CDS product small ribosomal subunit Rsm22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532524.1 protein_id gnl|my_center|LOCUS_19100 1559 1484 gene locus_tag LOCUS_t00310 1559 1484 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1686 2465 gene locus_tag LOCUS_19110 gene fabI 1686 2465 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532803.1 protein_id gnl|my_center|LOCUS_19110 3512 2493 gene locus_tag LOCUS_19120 gene mnmE 3512 2493 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970586.1 protein_id gnl|my_center|LOCUS_19120 4585 3608 gene locus_tag LOCUS_19130 4585 3608 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389445.1 protein_id gnl|my_center|LOCUS_19130 5545 4625 gene locus_tag LOCUS_19140 gene dat 5545 4625 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931211.1 protein_id gnl|my_center|LOCUS_19140 6487 5657 gene locus_tag LOCUS_19150 6487 5657 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257265.1 protein_id gnl|my_center|LOCUS_19150 7692 6484 gene locus_tag LOCUS_19160 7692 6484 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530638.1 protein_id gnl|my_center|LOCUS_19160 7892 8926 gene locus_tag LOCUS_19170 gene gap 7892 8926 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055898.1 protein_id gnl|my_center|LOCUS_19170 8967 9122 gene locus_tag LOCUS_19180 8967 9122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 9134 9730 gene locus_tag LOCUS_19190 9134 9730 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946157.1 protein_id gnl|my_center|LOCUS_19190 9727 10227 gene locus_tag LOCUS_19200 9727 10227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 12150 10402 gene locus_tag LOCUS_19210 12150 10402 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918720.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence089 335 30 gene locus_tag LOCUS_19220 335 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 698 1714 gene locus_tag LOCUS_19230 698 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 1790 2971 gene locus_tag LOCUS_19240 1790 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 3028 3531 gene locus_tag LOCUS_19250 3028 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 4517 3564 gene locus_tag LOCUS_19260 4517 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 5054 4644 gene locus_tag LOCUS_19270 5054 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 5309 5094 gene locus_tag LOCUS_19280 5309 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 6107 5505 gene locus_tag LOCUS_19290 6107 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 7485 6316 gene locus_tag LOCUS_19300 gene dusB 7485 6316 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912251.1 protein_id gnl|my_center|LOCUS_19300 8508 7645 gene locus_tag LOCUS_19310 8508 7645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 9959 8508 gene locus_tag LOCUS_19320 9959 8508 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368546.1 protein_id gnl|my_center|LOCUS_19320 10763 10050 gene locus_tag LOCUS_19330 10763 10050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 11867 11079 gene locus_tag LOCUS_19340 11867 11079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 12743 12120 gene locus_tag LOCUS_19350 12743 12120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence090 2 187 gene locus_tag LOCUS_19360 2 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 184 717 gene locus_tag LOCUS_19370 184 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 718 2586 gene locus_tag LOCUS_19380 718 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 2679 3656 gene locus_tag LOCUS_19390 gene tilS 2679 3656 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089882.1 protein_id gnl|my_center|LOCUS_19390 4422 3640 gene locus_tag LOCUS_19400 4422 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 6198 4609 gene locus_tag LOCUS_19410 6198 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 6427 7455 gene locus_tag LOCUS_19420 6427 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 8543 7440 gene locus_tag LOCUS_19430 8543 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 8699 8773 gene locus_tag LOCUS_t00320 8699 8773 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8897 9196 gene locus_tag LOCUS_19440 8897 9196 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868393.1 protein_id gnl|my_center|LOCUS_19440 9193 9681 gene locus_tag LOCUS_19450 9193 9681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 9760 10584 gene locus_tag LOCUS_19460 gene trpA 9760 10584 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 protein_id gnl|my_center|LOCUS_19460 <12556 10590 gene locus_tag LOCUS_19470 <12556 10590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197946502.1:WD40 repeat domain-containing protein >Feature sequence091 791 606 gene locus_tag LOCUS_19480 791 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 890 3763 gene locus_tag LOCUS_19490 890 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 6508 3788 gene locus_tag LOCUS_19500 6508 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 6974 6789 gene locus_tag LOCUS_19510 6974 6789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 7106 8740 gene locus_tag LOCUS_19520 7106 8740 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764923.1 protein_id gnl|my_center|LOCUS_19520 10115 8850 gene locus_tag LOCUS_19530 10115 8850 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_19530 11163 10132 gene locus_tag LOCUS_19540 11163 10132 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_19540 12447 11200 gene locus_tag LOCUS_19550 12447 11200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence092 710 369 gene locus_tag LOCUS_19560 710 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 1953 739 gene locus_tag LOCUS_19570 1953 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2117 2035 gene locus_tag LOCUS_t00330 2117 2035 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2941 2192 gene locus_tag LOCUS_19580 2941 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 4147 3125 gene locus_tag LOCUS_19590 gene gnd 4147 3125 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974205.1 protein_id gnl|my_center|LOCUS_19590 4874 4200 gene locus_tag LOCUS_19600 4874 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 5082 6833 gene locus_tag LOCUS_19610 5082 6833 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_19610 6986 8101 gene locus_tag LOCUS_19620 6986 8101 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_19620 8361 10136 gene locus_tag LOCUS_19630 8361 10136 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_19630 10249 11547 gene locus_tag LOCUS_19640 10249 11547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence093 2477 45 gene locus_tag LOCUS_19650 2477 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 4159 2852 gene locus_tag LOCUS_19660 4159 2852 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181768.1 protein_id gnl|my_center|LOCUS_19660 6169 4304 gene locus_tag LOCUS_19670 gene typA 6169 4304 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058116.1 protein_id gnl|my_center|LOCUS_19670 7849 6323 gene locus_tag LOCUS_19680 7849 6323 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_19680 9783 7975 gene locus_tag LOCUS_19690 9783 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 10012 11211 gene locus_tag LOCUS_19700 10012 11211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 11211 11654 gene locus_tag LOCUS_19710 gene dtd 11211 11654 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_19710 <12396 11667 gene locus_tag LOCUS_19720 <12396 11667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001973894.1:uracil-DNA glycosylase >Feature sequence094 903 76 gene locus_tag LOCUS_19730 903 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 3011 900 gene locus_tag LOCUS_19740 3011 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 5419 3119 gene locus_tag LOCUS_19750 5419 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 5820 5891 gene locus_tag LOCUS_t00340 5820 5891 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8436 6223 gene locus_tag LOCUS_19760 8436 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 9290 10204 gene locus_tag LOCUS_19770 9290 10204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 10180 10986 gene locus_tag LOCUS_19780 10180 10986 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120930.1 protein_id gnl|my_center|LOCUS_19780 10986 11201 gene locus_tag LOCUS_19790 10986 11201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 <12381 11229 gene locus_tag LOCUS_19800 <12381 11229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090225.1:DNA mismatch repair endonuclease MutL >Feature sequence095 434 1876 gene locus_tag LOCUS_19810 434 1876 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_19810 1882 2601 gene locus_tag LOCUS_19820 1882 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 3939 2617 gene locus_tag LOCUS_19830 gene fahA 3939 2617 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268360.1 protein_id gnl|my_center|LOCUS_19830 4880 3936 gene locus_tag LOCUS_19840 4880 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840171.1 protein_id gnl|my_center|LOCUS_19840 5378 6739 gene locus_tag LOCUS_19850 5378 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 6801 7232 gene locus_tag LOCUS_19860 6801 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 7330 7941 gene locus_tag LOCUS_19870 7330 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 9551 8022 gene locus_tag LOCUS_19880 9551 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 9853 10206 gene locus_tag LOCUS_19890 9853 10206 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945958.1 protein_id gnl|my_center|LOCUS_19890 10438 11694 gene locus_tag LOCUS_19900 10438 11694 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970398.1 protein_id gnl|my_center|LOCUS_19900 12016 11738 gene locus_tag LOCUS_19910 12016 11738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence096 671 102 gene locus_tag LOCUS_19920 671 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1948 842 gene locus_tag LOCUS_19930 1948 842 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092935.1 protein_id gnl|my_center|LOCUS_19930 2127 2672 gene locus_tag LOCUS_19940 2127 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2811 4124 gene locus_tag LOCUS_19950 2811 4124 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_19950 4443 4246 gene locus_tag LOCUS_19960 4443 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 4483 4728 gene locus_tag LOCUS_19970 4483 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 4844 5524 gene locus_tag LOCUS_19980 4844 5524 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749266.1 protein_id gnl|my_center|LOCUS_19980 5594 6544 gene locus_tag LOCUS_19990 5594 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 6875 9052 gene locus_tag LOCUS_20000 6875 9052 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275248.1 protein_id gnl|my_center|LOCUS_20000 9179 10912 gene locus_tag LOCUS_20010 9179 10912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 10955 11821 gene locus_tag LOCUS_20020 10955 11821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence097 362 1012 gene locus_tag LOCUS_20030 gene rpe 362 1012 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_20030 1130 1987 gene locus_tag LOCUS_20040 gene accD 1130 1987 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_20040 1974 3680 gene locus_tag LOCUS_20050 1974 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 3834 4982 gene locus_tag LOCUS_20060 3834 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 5429 6328 gene locus_tag LOCUS_20070 5429 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 6435 6593 gene locus_tag LOCUS_20080 6435 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 7106 8119 gene locus_tag LOCUS_20090 7106 8119 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_20090 8253 9167 gene locus_tag LOCUS_20100 8253 9167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 9164 9745 gene locus_tag LOCUS_20110 9164 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 9791 11062 gene locus_tag LOCUS_20120 9791 11062 CDS product putative sugar nucleotidyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256908.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence098 232 1056 gene locus_tag LOCUS_20130 232 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 1177 1641 gene locus_tag LOCUS_20140 gene greA 1177 1641 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948324.1 protein_id gnl|my_center|LOCUS_20140 3385 1652 gene locus_tag LOCUS_20150 3385 1652 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_20150 4215 3382 gene locus_tag LOCUS_20160 4215 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 4741 6420 gene locus_tag LOCUS_20170 4741 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 6676 9174 gene locus_tag LOCUS_20180 6676 9174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 9442 10413 gene locus_tag LOCUS_20190 9442 10413 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460655.1 protein_id gnl|my_center|LOCUS_20190 10416 10835 gene locus_tag LOCUS_20200 10416 10835 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899719.1 protein_id gnl|my_center|LOCUS_20200 11002 11679 gene locus_tag LOCUS_20210 11002 11679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence099 2005 458 gene locus_tag LOCUS_20220 2005 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2073 2795 gene locus_tag LOCUS_20230 gene truB 2073 2795 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258869.1 protein_id gnl|my_center|LOCUS_20230 3503 2826 gene locus_tag LOCUS_20240 3503 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 4336 3596 gene locus_tag LOCUS_20250 4336 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 4272 4973 gene locus_tag LOCUS_20260 4272 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 6099 5092 gene locus_tag LOCUS_20270 6099 5092 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546641.1 protein_id gnl|my_center|LOCUS_20270 6211 7023 gene locus_tag LOCUS_20280 gene proC 6211 7023 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_20280 7861 7073 gene locus_tag LOCUS_20290 7861 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 8703 7858 gene locus_tag LOCUS_20300 8703 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 9909 8722 gene locus_tag LOCUS_20310 9909 8722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 10913 9906 gene locus_tag LOCUS_20320 10913 9906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403950.1 protein_id gnl|my_center|LOCUS_20320 11024 11671 gene locus_tag LOCUS_20330 11024 11671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 >Feature sequence100 556 200 gene locus_tag LOCUS_20340 556 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 705 2129 gene locus_tag LOCUS_20350 705 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2414 4576 gene locus_tag LOCUS_20360 2414 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 4784 6169 gene locus_tag LOCUS_20370 4784 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 7056 6316 gene locus_tag LOCUS_20380 7056 6316 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817082.1 protein_id gnl|my_center|LOCUS_20380 7172 7492 gene locus_tag LOCUS_20390 7172 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 8595 8233 gene locus_tag LOCUS_20400 8595 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 8480 8686 gene locus_tag LOCUS_20410 8480 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 9808 8816 gene locus_tag LOCUS_20420 9808 8816 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392313.1 protein_id gnl|my_center|LOCUS_20420 11307 9808 gene locus_tag LOCUS_20430 11307 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence101 613 1329 gene locus_tag LOCUS_20440 613 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 2042 1398 gene locus_tag LOCUS_20450 2042 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2665 2039 gene locus_tag LOCUS_20460 gene hpt 2665 2039 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257905.1 protein_id gnl|my_center|LOCUS_20460 4258 2714 gene locus_tag LOCUS_20470 gene gatB 4258 2714 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122965.1 protein_id gnl|my_center|LOCUS_20470 4326 5378 gene locus_tag LOCUS_20480 4326 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 5375 6691 gene locus_tag LOCUS_20490 5375 6691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 6855 7589 gene locus_tag LOCUS_20500 6855 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 7870 7797 gene locus_tag LOCUS_t00350 7870 7797 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 8080 9018 gene locus_tag LOCUS_20510 8080 9018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 10482 9052 gene locus_tag LOCUS_20520 10482 9052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence102 2008 398 gene locus_tag LOCUS_20530 2008 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2448 2005 gene locus_tag LOCUS_20540 gene rbfA 2448 2005 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377505.1 protein_id gnl|my_center|LOCUS_20540 2630 2373 gene locus_tag LOCUS_20550 2630 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 5798 2697 gene locus_tag LOCUS_20560 5798 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 7301 5934 gene locus_tag LOCUS_20570 7301 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 9240 8194 gene locus_tag LOCUS_20580 9240 8194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 >Feature sequence103 2408 111 gene locus_tag LOCUS_20590 2408 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 3393 2545 gene locus_tag LOCUS_20600 gene truA 3393 2545 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459121.1 protein_id gnl|my_center|LOCUS_20600 4548 3418 gene locus_tag LOCUS_20610 4548 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 5155 4634 gene locus_tag LOCUS_20620 gene ispF 5155 4634 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951155.1 protein_id gnl|my_center|LOCUS_20620 5279 5770 gene locus_tag LOCUS_20630 5279 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 7350 5956 gene locus_tag LOCUS_20640 gene murD 7350 5956 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_20640 8084 7347 gene locus_tag LOCUS_20650 8084 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 10676 8307 gene locus_tag LOCUS_20660 10676 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence104 1279 80 gene locus_tag LOCUS_20670 1279 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 2199 1276 gene locus_tag LOCUS_20680 2199 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 3099 2398 gene locus_tag LOCUS_20690 3099 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 4313 3102 gene locus_tag LOCUS_20700 4313 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 5664 4537 gene locus_tag LOCUS_20710 5664 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258901.1 protein_id gnl|my_center|LOCUS_20710 7746 5896 gene locus_tag LOCUS_20720 7746 5896 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_20720 7970 8260 gene locus_tag LOCUS_20730 7970 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 10387 8294 gene locus_tag LOCUS_20740 10387 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 10466 11086 gene locus_tag LOCUS_20750 10466 11086 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964325.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence105 2148 1264 gene locus_tag LOCUS_20760 2148 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 2274 2969 gene locus_tag LOCUS_20770 2274 2969 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193988.1 protein_id gnl|my_center|LOCUS_20770 2966 4177 gene locus_tag LOCUS_20780 2966 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 4192 4980 gene locus_tag LOCUS_20790 4192 4980 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_20790 4977 6488 gene locus_tag LOCUS_20800 4977 6488 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531459.1 protein_id gnl|my_center|LOCUS_20800 6485 7213 gene locus_tag LOCUS_20810 6485 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 8600 7206 gene locus_tag LOCUS_20820 8600 7206 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975254.1 protein_id gnl|my_center|LOCUS_20820 9783 8734 gene locus_tag LOCUS_20830 9783 8734 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_20830 10823 9780 gene locus_tag LOCUS_20840 gene pdhA 10823 9780 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596096.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence106 2 1075 gene locus_tag LOCUS_20850 2 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 3493 1202 gene locus_tag LOCUS_20860 3493 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 3841 4845 gene locus_tag LOCUS_20870 3841 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 4972 6744 gene locus_tag LOCUS_20880 4972 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 7790 6891 gene locus_tag LOCUS_20890 7790 6891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 8210 7908 gene locus_tag LOCUS_20900 8210 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 8933 8241 gene locus_tag LOCUS_20910 8933 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 <10711 8959 gene locus_tag LOCUS_20920 <10711 8959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942167.1:phenylalanine--tRNA ligase subunit beta >Feature sequence107 754 371 gene locus_tag LOCUS_20930 gene rplT 754 371 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965656.1 protein_id gnl|my_center|LOCUS_20930 1131 874 gene locus_tag LOCUS_20940 1131 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2397 1348 gene locus_tag LOCUS_20950 2397 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 3221 2394 gene locus_tag LOCUS_20960 3221 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 3593 4765 gene locus_tag LOCUS_20970 gene hpnH 3593 4765 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_20970 4908 6092 gene locus_tag LOCUS_20980 4908 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 6834 6193 gene locus_tag LOCUS_20990 6834 6193 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391172.1 protein_id gnl|my_center|LOCUS_20990 8141 6831 gene locus_tag LOCUS_21000 8141 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 8727 9884 gene locus_tag LOCUS_21010 gene citZ 8727 9884 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_21010 >Feature sequence108 284 601 gene locus_tag LOCUS_21020 284 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 1069 623 gene locus_tag LOCUS_21030 1069 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21030 2115 1120 gene locus_tag LOCUS_21040 2115 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21040 2612 2112 gene locus_tag LOCUS_21050 gene nrfH 2612 2112 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325128.1 protein_id gnl|my_center|LOCUS_21050 4901 2778 gene locus_tag LOCUS_21060 gene uvrB 4901 2778 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329492.1 protein_id gnl|my_center|LOCUS_21060 7517 4914 gene locus_tag LOCUS_21070 7517 4914 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_21070 8271 7465 gene locus_tag LOCUS_21080 8271 7465 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339558.1 protein_id gnl|my_center|LOCUS_21080 8674 8294 gene locus_tag LOCUS_21090 gene gcvH 8674 8294 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069578.1 protein_id gnl|my_center|LOCUS_21090 9200 10192 gene locus_tag LOCUS_21100 9200 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 >Feature sequence109 <1 1913 gene locus_tag LOCUS_21110 <1 1913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941209.1:DNA polymerase I 2015 2089 gene locus_tag LOCUS_t00360 2015 2089 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2747 2208 gene locus_tag LOCUS_21120 2747 2208 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408503.1 protein_id gnl|my_center|LOCUS_21120 2802 3137 gene locus_tag LOCUS_21130 2802 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 3957 3124 gene locus_tag LOCUS_21140 3957 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 4263 4925 gene locus_tag LOCUS_21150 4263 4925 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030700.1 protein_id gnl|my_center|LOCUS_21150 4931 5650 gene locus_tag LOCUS_21160 4931 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 6275 5637 gene locus_tag LOCUS_21170 6275 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 7246 6311 gene locus_tag LOCUS_21180 7246 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 7311 8096 gene locus_tag LOCUS_21190 gene ubiE 7311 8096 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889031.1 protein_id gnl|my_center|LOCUS_21190 8325 9164 gene locus_tag LOCUS_21200 8325 9164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 9579 10160 gene locus_tag LOCUS_21210 gene sigW 9579 10160 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_21210 >Feature sequence110 1521 25 gene locus_tag LOCUS_21220 gene rho 1521 25 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179608.1 protein_id gnl|my_center|LOCUS_21220 2439 1762 gene locus_tag LOCUS_21230 gene coaE 2439 1762 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014305.1 protein_id gnl|my_center|LOCUS_21230 3445 2477 gene locus_tag LOCUS_21240 3445 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 3559 5169 gene locus_tag LOCUS_21250 gene proS 3559 5169 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921836.1 protein_id gnl|my_center|LOCUS_21250 6005 5334 gene locus_tag LOCUS_21260 6005 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 6280 6134 gene locus_tag LOCUS_21270 6280 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 6632 6249 gene locus_tag LOCUS_21280 6632 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 7497 8615 gene locus_tag LOCUS_21290 7497 8615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 8671 9141 gene locus_tag LOCUS_21300 8671 9141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 9274 9651 gene locus_tag LOCUS_21310 9274 9651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence111 1075 404 gene locus_tag LOCUS_21320 1075 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 1309 5715 gene locus_tag LOCUS_21330 1309 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 5779 6870 gene locus_tag LOCUS_21340 5779 6870 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922313.1 protein_id gnl|my_center|LOCUS_21340 6900 7772 gene locus_tag LOCUS_21350 6900 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 7769 8674 gene locus_tag LOCUS_21360 gene pssA 7769 8674 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616286.1 protein_id gnl|my_center|LOCUS_21360 8692 9876 gene locus_tag LOCUS_21370 gene trpB 8692 9876 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324127.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence112 2399 390 gene locus_tag LOCUS_21380 2399 390 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921313.1 protein_id gnl|my_center|LOCUS_21380 3381 2674 gene locus_tag LOCUS_21390 3381 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 3838 3482 gene locus_tag LOCUS_21400 3838 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 4134 3886 gene locus_tag LOCUS_21410 4134 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 4992 4207 gene locus_tag LOCUS_21420 4992 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 5091 5519 gene locus_tag LOCUS_21430 5091 5519 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124353.1 protein_id gnl|my_center|LOCUS_21430 6864 5506 gene locus_tag LOCUS_21440 6864 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 7868 6885 gene locus_tag LOCUS_21450 gene menC 7868 6885 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838743.1 protein_id gnl|my_center|LOCUS_21450 8776 7865 gene locus_tag LOCUS_21460 8776 7865 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902772.1 protein_id gnl|my_center|LOCUS_21460 9642 8773 gene locus_tag LOCUS_21470 gene menB 9642 8773 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098093.1 protein_id gnl|my_center|LOCUS_21470 >Feature sequence113 1439 1260 gene locus_tag LOCUS_21480 1439 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 2284 1646 gene locus_tag LOCUS_21490 2284 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 3497 2421 gene locus_tag LOCUS_21500 3497 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 3703 4770 gene locus_tag LOCUS_21510 gene trpD 3703 4770 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971800.1 protein_id gnl|my_center|LOCUS_21510 5808 5605 gene locus_tag LOCUS_21520 5808 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 7446 7285 gene locus_tag LOCUS_21530 7446 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 7851 7492 gene locus_tag LOCUS_21540 7851 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 9857 8247 gene locus_tag LOCUS_21550 9857 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence114 1187 525 gene locus_tag LOCUS_21560 1187 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2739 3059 gene locus_tag LOCUS_21570 gene rplU 2739 3059 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869646.1 protein_id gnl|my_center|LOCUS_21570 4092 3160 gene locus_tag LOCUS_21580 4092 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 5251 4076 gene locus_tag LOCUS_21590 5251 4076 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_21590 5356 6102 gene locus_tag LOCUS_21600 5356 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 8697 6205 gene locus_tag LOCUS_21610 8697 6205 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_21610 9056 9127 gene locus_tag LOCUS_t00370 9056 9127 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9664 9257 gene locus_tag LOCUS_21620 9664 9257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 >Feature sequence115 520 209 gene locus_tag LOCUS_21630 520 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 1152 706 gene locus_tag LOCUS_21640 1152 706 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674247.1 protein_id gnl|my_center|LOCUS_21640 3268 1289 gene locus_tag LOCUS_21650 3268 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 4654 3974 gene locus_tag LOCUS_21660 4654 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 4952 6058 gene locus_tag LOCUS_21670 4952 6058 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175517123.1 protein_id gnl|my_center|LOCUS_21670 6992 6063 gene locus_tag LOCUS_21680 6992 6063 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350720.1 protein_id gnl|my_center|LOCUS_21680 8840 7212 gene locus_tag LOCUS_21690 8840 7212 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544143.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence116 495 2471 gene locus_tag LOCUS_21700 495 2471 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120638.1 protein_id gnl|my_center|LOCUS_21700 2699 2902 gene locus_tag LOCUS_21710 2699 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 4490 3399 gene locus_tag LOCUS_21720 4490 3399 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922132.1 protein_id gnl|my_center|LOCUS_21720 5388 4948 gene locus_tag LOCUS_21730 5388 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 6130 5411 gene locus_tag LOCUS_21740 6130 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 6545 7291 gene locus_tag LOCUS_21750 6545 7291 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331377.1 protein_id gnl|my_center|LOCUS_21750 8076 7372 gene locus_tag LOCUS_21760 8076 7372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 8314 8850 gene locus_tag LOCUS_21770 8314 8850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence117 3251 2346 gene locus_tag LOCUS_21780 3251 2346 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615371.1 protein_id gnl|my_center|LOCUS_21780 3786 3241 gene locus_tag LOCUS_21790 3786 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 5510 3783 gene locus_tag LOCUS_21800 5510 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 6191 5511 gene locus_tag LOCUS_21810 6191 5511 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120870.1 protein_id gnl|my_center|LOCUS_21810 6390 6184 gene locus_tag LOCUS_21820 6390 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 8687 6387 gene locus_tag LOCUS_21830 gene ccoN 8687 6387 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615370.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence118 4378 2357 gene locus_tag LOCUS_21840 4378 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 4513 6405 gene locus_tag LOCUS_21850 4513 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 8286 6430 gene locus_tag LOCUS_21860 8286 6430 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_21860 <9201 8279 gene locus_tag LOCUS_21870 <9201 8279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043552510.1:ABC transporter ATP-binding protein >Feature sequence119 58 1062 gene locus_tag LOCUS_21880 58 1062 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563288.1 protein_id gnl|my_center|LOCUS_21880 2026 1838 gene locus_tag LOCUS_21890 2026 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 2200 3441 gene locus_tag LOCUS_21900 gene hemW 2200 3441 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_21900 3709 4710 gene locus_tag LOCUS_21910 3709 4710 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_21910 4719 6080 gene locus_tag LOCUS_21920 4719 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 6725 6222 gene locus_tag LOCUS_21930 6725 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 6786 8081 gene locus_tag LOCUS_21940 6786 8081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 8722 8192 gene locus_tag LOCUS_21950 8722 8192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence120 763 2676 gene locus_tag LOCUS_21960 763 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 2819 5461 gene locus_tag LOCUS_21970 2819 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 5458 5961 gene locus_tag LOCUS_21980 5458 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 5961 6914 gene locus_tag LOCUS_21990 5961 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 6931 8577 gene locus_tag LOCUS_22000 6931 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 8586 9011 gene locus_tag LOCUS_22010 8586 9011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence121 152 1141 gene locus_tag LOCUS_22020 152 1141 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085059.1 protein_id gnl|my_center|LOCUS_22020 1222 2499 gene locus_tag LOCUS_22030 1222 2499 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_22030 3297 2650 gene locus_tag LOCUS_22040 3297 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 4634 3507 gene locus_tag LOCUS_22050 4634 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 4793 5833 gene locus_tag LOCUS_22060 4793 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 6947 5844 gene locus_tag LOCUS_22070 6947 5844 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_22070 7286 7002 gene locus_tag LOCUS_22080 7286 7002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 8500 7397 gene locus_tag LOCUS_22090 8500 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence122 1072 347 gene locus_tag LOCUS_22100 1072 347 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082798.1 protein_id gnl|my_center|LOCUS_22100 1094 1993 gene locus_tag LOCUS_22110 gene metF 1094 1993 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933036.1 protein_id gnl|my_center|LOCUS_22110 2408 2052 gene locus_tag LOCUS_22120 2408 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 6608 2526 gene locus_tag LOCUS_22130 6608 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 7240 6605 gene locus_tag LOCUS_22140 7240 6605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 8096 7347 gene locus_tag LOCUS_22150 8096 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 >Feature sequence123 2164 242 gene locus_tag LOCUS_22160 2164 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 3311 2157 gene locus_tag LOCUS_22170 3311 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 4027 3383 gene locus_tag LOCUS_22180 4027 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 4120 4371 gene locus_tag LOCUS_22190 4120 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 4426 4650 gene locus_tag LOCUS_22200 4426 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 5123 4665 gene locus_tag LOCUS_22210 5123 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 7076 5325 gene locus_tag LOCUS_22220 7076 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 8192 7104 gene locus_tag LOCUS_22230 8192 7104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 >Feature sequence124 1270 230 gene locus_tag LOCUS_22240 1270 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 1427 2611 gene locus_tag LOCUS_22250 1427 2611 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210864.1 protein_id gnl|my_center|LOCUS_22250 4412 2634 gene locus_tag LOCUS_22260 4412 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 4715 5032 gene locus_tag LOCUS_22270 4715 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 5085 5582 gene locus_tag LOCUS_22280 5085 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 6089 5637 gene locus_tag LOCUS_22290 6089 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 7697 6198 gene locus_tag LOCUS_22300 7697 6198 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_22300 7971 7762 gene locus_tag LOCUS_22310 7971 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence125 3607 245 gene locus_tag LOCUS_22320 3607 245 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_22320 4331 3717 gene locus_tag LOCUS_22330 4331 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 5004 6197 gene locus_tag LOCUS_22340 gene carA 5004 6197 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_22340 >Feature sequence126 704 1870 gene locus_tag LOCUS_22350 704 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 1897 5706 gene locus_tag LOCUS_22360 1897 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 6362 5835 gene locus_tag LOCUS_22370 6362 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 7208 6999 gene locus_tag LOCUS_22380 7208 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 7318 8055 gene locus_tag LOCUS_22390 7318 8055 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038925.1 protein_id gnl|my_center|LOCUS_22390 >Feature sequence127 2049 385 gene locus_tag LOCUS_22400 2049 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 3980 2244 gene locus_tag LOCUS_22410 gene gspE 3980 2244 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070564.1 protein_id gnl|my_center|LOCUS_22410 5323 4160 gene locus_tag LOCUS_22420 5323 4160 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122678.1 protein_id gnl|my_center|LOCUS_22420 5529 7010 gene locus_tag LOCUS_22430 gene guaB 5529 7010 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325011.1 protein_id gnl|my_center|LOCUS_22430 <8330 7029 gene locus_tag LOCUS_22440 <8330 7029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120961.1:DUF1501 domain-containing protein >Feature sequence128 41 904 gene locus_tag LOCUS_22450 41 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 1096 1770 gene locus_tag LOCUS_22460 1096 1770 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_22460 2457 5213 gene locus_tag LOCUS_22470 2457 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence129 525 184 gene locus_tag LOCUS_22480 525 184 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883059.1 protein_id gnl|my_center|LOCUS_22480 846 1145 gene locus_tag LOCUS_22490 846 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 2249 1179 gene locus_tag LOCUS_22500 gene lpxK 2249 1179 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121336.1 protein_id gnl|my_center|LOCUS_22500 2736 2254 gene locus_tag LOCUS_22510 2736 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 3560 2733 gene locus_tag LOCUS_22520 3560 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 3844 5157 gene locus_tag LOCUS_22530 3844 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 5672 5211 gene locus_tag LOCUS_22540 5672 5211 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855793.1 protein_id gnl|my_center|LOCUS_22540 6458 7387 gene locus_tag LOCUS_22550 6458 7387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 >Feature sequence130 694 1281 gene locus_tag LOCUS_22560 694 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 1327 3396 gene locus_tag LOCUS_22570 1327 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 4017 3445 gene locus_tag LOCUS_22580 4017 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 4121 4873 gene locus_tag LOCUS_22590 4121 4873 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460200.1 protein_id gnl|my_center|LOCUS_22590 4877 6277 gene locus_tag LOCUS_22600 4877 6277 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899946.1 protein_id gnl|my_center|LOCUS_22600 6277 6684 gene locus_tag LOCUS_22610 6277 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 7402 6632 gene locus_tag LOCUS_22620 7402 6632 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_22620 8012 7464 gene locus_tag LOCUS_22630 8012 7464 CDS product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765559.1 protein_id gnl|my_center|LOCUS_22630 >Feature sequence131 353 1057 gene locus_tag LOCUS_22640 353 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 1506 1135 gene locus_tag LOCUS_22650 1506 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2118 4031 gene locus_tag LOCUS_22660 2118 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 4055 5338 gene locus_tag LOCUS_22670 4055 5338 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence132 1753 947 gene locus_tag LOCUS_22680 1753 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 2405 1746 gene locus_tag LOCUS_22690 gene rsmD 2405 1746 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017073.1 protein_id gnl|my_center|LOCUS_22690 3763 2495 gene locus_tag LOCUS_22700 3763 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 4087 3830 gene locus_tag LOCUS_22710 4087 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 4235 3981 gene locus_tag LOCUS_22720 4235 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 7485 4321 gene locus_tag LOCUS_22730 7485 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 >Feature sequence133 561 178 gene locus_tag LOCUS_22740 561 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 1388 711 gene locus_tag LOCUS_22750 1388 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 2213 1398 gene locus_tag LOCUS_22760 2213 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 3480 6119 gene locus_tag LOCUS_22770 3480 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 6920 6195 gene locus_tag LOCUS_22780 6920 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence134 223 609 gene locus_tag LOCUS_22790 223 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 734 2707 gene locus_tag LOCUS_22800 734 2707 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326708.1 protein_id gnl|my_center|LOCUS_22800 2707 2970 gene locus_tag LOCUS_22810 2707 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 3185 6634 gene locus_tag LOCUS_22820 3185 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 7507 6722 gene locus_tag LOCUS_22830 7507 6722 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791123.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence135 2289 739 gene locus_tag LOCUS_22840 2289 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 2656 2300 gene locus_tag LOCUS_22850 2656 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2846 4441 gene locus_tag LOCUS_22860 2846 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 5670 4483 gene locus_tag LOCUS_22870 5670 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 5698 6984 gene locus_tag LOCUS_22880 5698 6984 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228553.1 protein_id gnl|my_center|LOCUS_22880 <7639 7019 gene locus_tag LOCUS_22890 <7639 7019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037861.1:sensor domain-containing diguanylate cyclase >Feature sequence136 204 1997 gene locus_tag LOCUS_22900 204 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 2315 2004 gene locus_tag LOCUS_22910 2315 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 2437 3765 gene locus_tag LOCUS_22920 2437 3765 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_22920 4355 3756 gene locus_tag LOCUS_22930 4355 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 5914 4352 gene locus_tag LOCUS_22940 5914 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 6002 6370 gene locus_tag LOCUS_22950 6002 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 6415 6903 gene locus_tag LOCUS_22960 6415 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 <7625 7034 gene locus_tag LOCUS_22970 <7625 7034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002371476.1:tRNA (guanosine(46)-N7)-methyltransferase TrmB >Feature sequence137 663 1679 gene locus_tag LOCUS_22980 663 1679 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616128.1 protein_id gnl|my_center|LOCUS_22980 4042 1796 gene locus_tag LOCUS_22990 4042 1796 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072577.1 protein_id gnl|my_center|LOCUS_22990 4403 4182 gene locus_tag LOCUS_23000 4403 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 6870 4432 gene locus_tag LOCUS_23010 6870 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 <7597 6949 gene locus_tag LOCUS_23020 <7597 6949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258936.1:DEAD/DEAH box helicase >Feature sequence138 65 799 gene locus_tag LOCUS_23030 65 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 911 1978 gene locus_tag LOCUS_23040 911 1978 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_23040 2070 2564 gene locus_tag LOCUS_23050 2070 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 5105 2541 gene locus_tag LOCUS_23060 gene pulA 5105 2541 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082389.1 protein_id gnl|my_center|LOCUS_23060 5187 6356 gene locus_tag LOCUS_23070 5187 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 >Feature sequence139 274 1203 gene locus_tag LOCUS_23080 274 1203 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122799.1 protein_id gnl|my_center|LOCUS_23080 1208 1891 gene locus_tag LOCUS_23090 gene queC 1208 1891 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941151.1 protein_id gnl|my_center|LOCUS_23090 2073 3008 gene locus_tag LOCUS_23100 2073 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 3132 4463 gene locus_tag LOCUS_23110 3132 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 <7175 4590 gene locus_tag LOCUS_23120 <7175 4590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387765.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence140 3675 1012 gene locus_tag LOCUS_23130 3675 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 4221 3682 gene locus_tag LOCUS_23140 4221 3682 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_23140 6775 4442 gene locus_tag LOCUS_23150 6775 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 >Feature sequence141 248 332 gene locus_tag LOCUS_t00380 248 332 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1115 411 gene locus_tag LOCUS_23160 gene queE 1115 411 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120697.1 protein_id gnl|my_center|LOCUS_23160 1947 1129 gene locus_tag LOCUS_23170 1947 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 2231 1944 gene locus_tag LOCUS_23180 2231 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 2256 4028 gene locus_tag LOCUS_23190 2256 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 4025 6427 gene locus_tag LOCUS_23200 4025 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence142 478 1032 gene locus_tag LOCUS_23210 gene efp 478 1032 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722482.1 protein_id gnl|my_center|LOCUS_23210 1877 1128 gene locus_tag LOCUS_23220 1877 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 2085 2663 gene locus_tag LOCUS_23230 2085 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 3428 2700 gene locus_tag LOCUS_23240 3428 2700 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649034.1 protein_id gnl|my_center|LOCUS_23240 6923 3492 gene locus_tag LOCUS_23250 6923 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence143 227 793 gene locus_tag LOCUS_23260 227 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 3210 919 gene locus_tag LOCUS_23270 3210 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 3833 3207 gene locus_tag LOCUS_23280 3833 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 6869 4050 gene locus_tag LOCUS_23290 gene mutS 6869 4050 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121304.1 protein_id gnl|my_center|LOCUS_23290 5636 5565 gene locus_tag LOCUS_t00390 5636 5565 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence144 2066 1077 gene locus_tag LOCUS_23300 2066 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 2546 3064 gene locus_tag LOCUS_23310 2546 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 3113 3412 gene locus_tag LOCUS_23320 gene rpmA 3113 3412 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933172.1 protein_id gnl|my_center|LOCUS_23320 3541 4575 gene locus_tag LOCUS_23330 gene obgE 3541 4575 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_23330 <6449 4709 gene locus_tag LOCUS_23340 <6449 4709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002556922.1:VWA domain-containing protein >Feature sequence145 1423 332 gene locus_tag LOCUS_23350 1423 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 2194 1985 gene locus_tag LOCUS_23360 2194 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 2163 4850 gene locus_tag LOCUS_23370 2163 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 5364 4891 gene locus_tag LOCUS_23380 5364 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 >Feature sequence146 2793 916 gene locus_tag LOCUS_23390 gene lepA 2793 916 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047207.1 protein_id gnl|my_center|LOCUS_23390 3040 2801 gene locus_tag LOCUS_23400 3040 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 4067 3081 gene locus_tag LOCUS_23410 4067 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 5601 4087 gene locus_tag LOCUS_23420 gene rimO 5601 4087 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198793.1 protein_id gnl|my_center|LOCUS_23420 <6321 5660 gene locus_tag LOCUS_23430 <6321 5660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398676.1:nicotinate-nucleotide adenylyltransferase >Feature sequence147 195 1715 gene locus_tag LOCUS_23440 195 1715 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 protein_id gnl|my_center|LOCUS_23440 2657 1863 gene locus_tag LOCUS_23450 2657 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 3156 3971 gene locus_tag LOCUS_23460 3156 3971 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458997.1 protein_id gnl|my_center|LOCUS_23460 5409 4150 gene locus_tag LOCUS_23470 5409 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence148 1997 1398 gene locus_tag LOCUS_23480 1997 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 3636 5954 gene locus_tag LOCUS_23490 3636 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence149 <1 595 gene locus_tag LOCUS_23500 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964215.1:efflux RND transporter periplasmic adaptor subunit 588 1424 gene locus_tag LOCUS_23510 588 1424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_23510 1418 2659 gene locus_tag LOCUS_23520 1418 2659 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339253.1 protein_id gnl|my_center|LOCUS_23520 2662 4422 gene locus_tag LOCUS_23530 2662 4422 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942254.1 protein_id gnl|my_center|LOCUS_23530 4854 4465 gene locus_tag LOCUS_23540 4854 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 5685 4954 gene locus_tag LOCUS_23550 5685 4954 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_23550 >Feature sequence150 303 602 gene locus_tag LOCUS_23560 gene fliE 303 602 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870080.1 protein_id gnl|my_center|LOCUS_23560 1015 2673 gene locus_tag LOCUS_23570 gene fliF 1015 2673 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106531.1 protein_id gnl|my_center|LOCUS_23570 2705 3745 gene locus_tag LOCUS_23580 gene fliG 2705 3745 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 protein_id gnl|my_center|LOCUS_23580 3855 4637 gene locus_tag LOCUS_23590 3855 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 >Feature sequence151 1162 2031 gene locus_tag LOCUS_23600 1162 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 2032 2868 gene locus_tag LOCUS_23610 2032 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 2865 3794 gene locus_tag LOCUS_23620 2865 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 5057 3798 gene locus_tag LOCUS_23630 5057 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence152 2384 3733 gene locus_tag LOCUS_23640 2384 3733 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958129.1 protein_id gnl|my_center|LOCUS_23640 5266 3776 gene locus_tag LOCUS_23650 5266 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence153 1765 491 gene locus_tag LOCUS_23660 1765 491 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_23660 2802 1885 gene locus_tag LOCUS_23670 2802 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 5179 2900 gene locus_tag LOCUS_23680 5179 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence154 434 556 gene locus_tag LOCUS_23690 434 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 1213 557 gene locus_tag LOCUS_23700 1213 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 1371 2810 gene locus_tag LOCUS_23710 1371 2810 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_23710 2991 3164 gene locus_tag LOCUS_23720 2991 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 3266 3913 gene locus_tag LOCUS_23730 3266 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 <5546 3959 gene locus_tag LOCUS_23740 <5546 3959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941039.1:glycosyltransferase family 1 protein >Feature sequence155 195 10 gene locus_tag LOCUS_23750 195 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 >Feature sequence156 <1 558 gene locus_tag LOCUS_23760 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007336412.1:ECF-type sigma factor 632 3769 gene locus_tag LOCUS_23770 632 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 5212 3845 gene locus_tag LOCUS_23780 5212 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 >Feature sequence157 168 890 gene locus_tag LOCUS_23790 168 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 2896 1199 gene locus_tag LOCUS_23800 gene flgK 2896 1199 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851396.1 protein_id gnl|my_center|LOCUS_23800 3530 2979 gene locus_tag LOCUS_23810 3530 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 3997 3527 gene locus_tag LOCUS_23820 3997 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 5028 3994 gene locus_tag LOCUS_23830 5028 3994 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123602.1 protein_id gnl|my_center|LOCUS_23830 >Feature sequence158 866 1513 gene locus_tag LOCUS_23840 866 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 1622 2803 gene locus_tag LOCUS_23850 1622 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 3362 2844 gene locus_tag LOCUS_23860 3362 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 >Feature sequence159 413 1699 gene locus_tag LOCUS_23870 413 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 2095 3900 gene locus_tag LOCUS_23880 2095 3900 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324371.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence160 4577 4080 gene locus_tag LOCUS_23890 4577 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence161 976 272 gene locus_tag LOCUS_23900 976 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 3101 1005 gene locus_tag LOCUS_23910 3101 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 4312 3098 gene locus_tag LOCUS_23920 4312 3098 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence162 233 991 gene locus_tag LOCUS_23930 233 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2293 1097 gene locus_tag LOCUS_23940 gene hppD 2293 1097 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838760.1 protein_id gnl|my_center|LOCUS_23940 2373 2639 gene locus_tag LOCUS_23950 2373 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 3191 2667 gene locus_tag LOCUS_23960 3191 2667 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401881.1 protein_id gnl|my_center|LOCUS_23960 3274 3573 gene locus_tag LOCUS_23970 3274 3573 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330019.1 protein_id gnl|my_center|LOCUS_23970 >Feature sequence163 313 1830 gene locus_tag LOCUS_23980 313 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 1973 4648 gene locus_tag LOCUS_23990 1973 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 >Feature sequence164 3761 4486 gene locus_tag LOCUS_24000 3761 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 >Feature sequence165 3580 1289 gene locus_tag LOCUS_24010 3580 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence166 309 220 gene locus_tag LOCUS_t00400 309 220 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 917 420 gene locus_tag LOCUS_24020 917 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 2237 1014 gene locus_tag LOCUS_24030 2237 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 4026 2554 gene locus_tag LOCUS_24040 4026 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence167 1059 466 gene locus_tag LOCUS_24050 1059 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 1734 2429 gene locus_tag LOCUS_24060 1734 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 2716 3654 gene locus_tag LOCUS_24070 2716 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 >Feature sequence168 1161 37 gene locus_tag LOCUS_24080 1161 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 2396 1158 gene locus_tag LOCUS_24090 2396 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence169 141 1559 gene locus_tag LOCUS_24100 gene murC 141 1559 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_24100 1556 2497 gene locus_tag LOCUS_24110 gene murB 1556 2497 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089340.1 protein_id gnl|my_center|LOCUS_24110 2487 3485 gene locus_tag LOCUS_24120 2487 3485 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence170 <1 2537 gene locus_tag LOCUS_24130 <1 2537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_113630057.1:DUF262 domain-containing protein 3191 2550 gene locus_tag LOCUS_24140 3191 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 <4278 3430 gene locus_tag LOCUS_24150 <4278 3430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326690.1:beta-ketoacyl-[acyl-carrier-protein] synthase family protein >Feature sequence171 483 812 gene locus_tag LOCUS_24160 483 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 809 1810 gene locus_tag LOCUS_24170 809 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 1991 3088 gene locus_tag LOCUS_24180 1991 3088 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838116.1 protein_id gnl|my_center|LOCUS_24180 >Feature sequence172 242 168 gene locus_tag LOCUS_t00410 242 168 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1633 365 gene locus_tag LOCUS_24190 1633 365 CDS product aminoacetone oxidase family FAD-binding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120592.1 protein_id gnl|my_center|LOCUS_24190 3465 1630 gene locus_tag LOCUS_24200 3465 1630 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_24200 >Feature sequence173 1207 119 gene locus_tag LOCUS_24210 1207 119 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705342.1 protein_id gnl|my_center|LOCUS_24210 1899 1204 gene locus_tag LOCUS_24220 1899 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 >Feature sequence174 2522 822 gene locus_tag LOCUS_24230 2522 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 3612 2770 gene locus_tag LOCUS_24240 3612 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence175 698 150 gene locus_tag LOCUS_24250 698 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 >Feature sequence176 1848 652 gene locus_tag LOCUS_24260 1848 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 2600 1899 gene locus_tag LOCUS_24270 2600 1899 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_24270 <3552 2597 gene locus_tag LOCUS_24280 <3552 2597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003408441.1:(d)CMP kinase >Feature sequence177 1540 740 gene locus_tag LOCUS_24290 1540 740 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_24290 1623 1711 gene locus_tag LOCUS_t00420 1623 1711 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3288 1807 gene locus_tag LOCUS_24300 3288 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 3420 3493 gene locus_tag LOCUS_t00430 3420 3493 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence178 258 3290 gene locus_tag LOCUS_24310 258 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 >Feature sequence179 51 1052 gene locus_tag LOCUS_24320 51 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 3294 1099 gene locus_tag LOCUS_24330 3294 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 >Feature sequence180 151 1359 gene locus_tag LOCUS_24340 151 1359 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_24340 1864 3174 gene locus_tag LOCUS_24350 1864 3174 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478319.1 protein_id gnl|my_center|LOCUS_24350 >Feature sequence181 <1 1053 gene locus_tag LOCUS_24360 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337521.1:pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase 2297 1065 gene locus_tag LOCUS_24370 2297 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 2971 2294 gene locus_tag LOCUS_24380 2971 2294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037424.1 protein_id gnl|my_center|LOCUS_24380 >Feature sequence182 175 2436 gene locus_tag LOCUS_24390 175 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 3106 2495 gene locus_tag LOCUS_24400 3106 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 >Feature sequence183 140 1057 gene locus_tag LOCUS_24410 140 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 1091 2926 gene locus_tag LOCUS_24420 gene muiA 1091 2926 CDS product mucoidy inhibitor MuiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence184 654 2096 gene locus_tag LOCUS_24430 gene dacB 654 2096 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 protein_id gnl|my_center|LOCUS_24430 >Feature sequence185 >Feature sequence186 844 1965 gene locus_tag LOCUS_24440 844 1965 CDS product glycosyltransferase family 61 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190897490.1 protein_id gnl|my_center|LOCUS_24440 2298 2026 gene locus_tag LOCUS_24450 2298 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 >Feature sequence187 1517 168 gene locus_tag LOCUS_24460 1517 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 2368 1517 gene locus_tag LOCUS_24470 2368 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470