>Feature sequence01 300 4250 gene locus_tag LOCUS_00010 300 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 4243 5046 gene locus_tag LOCUS_00020 gene murI 4243 5046 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048400.1 protein_id gnl|my_center|LOCUS_00020 5101 5901 gene locus_tag LOCUS_00030 5101 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6108 5938 gene locus_tag LOCUS_00040 6108 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6243 6890 gene locus_tag LOCUS_00050 6243 6890 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263256.1 protein_id gnl|my_center|LOCUS_00050 6883 7452 gene locus_tag LOCUS_00060 6883 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7449 7850 gene locus_tag LOCUS_00070 7449 7850 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454481.1 protein_id gnl|my_center|LOCUS_00070 8253 7891 gene locus_tag LOCUS_00080 8253 7891 CDS product DUF1048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891986.1 protein_id gnl|my_center|LOCUS_00080 8578 8246 gene locus_tag LOCUS_00090 8578 8246 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429484.1 protein_id gnl|my_center|LOCUS_00090 8847 9401 gene locus_tag LOCUS_00100 8847 9401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9412 10359 gene locus_tag LOCUS_00110 9412 10359 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_00110 10356 10913 gene locus_tag LOCUS_00120 10356 10913 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_00120 10954 11487 gene locus_tag LOCUS_00130 10954 11487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11550 12986 gene locus_tag LOCUS_00140 gene potA 11550 12986 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762997.1 protein_id gnl|my_center|LOCUS_00140 12996 13784 gene locus_tag LOCUS_00150 12996 13784 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778456.1 protein_id gnl|my_center|LOCUS_00150 13781 14578 gene locus_tag LOCUS_00160 13781 14578 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993119.1 protein_id gnl|my_center|LOCUS_00160 14590 15990 gene locus_tag LOCUS_00170 14590 15990 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107690.1 protein_id gnl|my_center|LOCUS_00170 16012 16488 gene locus_tag LOCUS_00180 16012 16488 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258364.1 protein_id gnl|my_center|LOCUS_00180 16673 17965 gene locus_tag LOCUS_00190 16673 17965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 17958 19376 gene locus_tag LOCUS_00200 17958 19376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 19427 20707 gene locus_tag LOCUS_00210 19427 20707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 20772 22070 gene locus_tag LOCUS_00220 20772 22070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22142 23128 gene locus_tag LOCUS_00230 22142 23128 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_00230 23435 23238 gene locus_tag LOCUS_00240 23435 23238 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_00240 24486 23608 gene locus_tag LOCUS_00250 24486 23608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 25412 24489 gene locus_tag LOCUS_00260 25412 24489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 25592 26215 gene locus_tag LOCUS_00270 25592 26215 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889536.1 protein_id gnl|my_center|LOCUS_00270 26298 27839 gene locus_tag LOCUS_00280 26298 27839 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963421.1 protein_id gnl|my_center|LOCUS_00280 28020 29081 gene locus_tag LOCUS_00290 28020 29081 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234111.1 protein_id gnl|my_center|LOCUS_00290 29220 31592 gene locus_tag LOCUS_00300 29220 31592 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964652.1 protein_id gnl|my_center|LOCUS_00300 31801 32463 gene locus_tag LOCUS_00310 31801 32463 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991237.1 protein_id gnl|my_center|LOCUS_00310 32463 34079 gene locus_tag LOCUS_00320 32463 34079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 34073 34990 gene locus_tag LOCUS_00330 34073 34990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 34950 35735 gene locus_tag LOCUS_00340 34950 35735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 35909 36301 gene locus_tag LOCUS_00350 35909 36301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 36401 38452 gene locus_tag LOCUS_00360 36401 38452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 38480 43390 gene locus_tag LOCUS_00370 38480 43390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 45466 43436 gene locus_tag LOCUS_00380 45466 43436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 46155 45463 gene locus_tag LOCUS_00390 46155 45463 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454566.1 protein_id gnl|my_center|LOCUS_00390 46373 46993 gene locus_tag LOCUS_00400 46373 46993 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006874833.1 protein_id gnl|my_center|LOCUS_00400 47005 47490 gene locus_tag LOCUS_00410 47005 47490 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425085.1 protein_id gnl|my_center|LOCUS_00410 47487 47918 gene locus_tag LOCUS_00420 47487 47918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 48359 48021 gene locus_tag LOCUS_00430 48359 48021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 48515 48730 gene locus_tag LOCUS_00440 48515 48730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 48827 50161 gene locus_tag LOCUS_00450 gene aspS 48827 50161 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948698.1 protein_id gnl|my_center|LOCUS_00450 50217 50510 gene locus_tag LOCUS_00460 gene gatC 50217 50510 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_00460 50530 51978 gene locus_tag LOCUS_00470 gene gatA 50530 51978 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_00470 51975 53408 gene locus_tag LOCUS_00480 gene gatB 51975 53408 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812379.1 protein_id gnl|my_center|LOCUS_00480 53458 53799 gene locus_tag LOCUS_00490 53458 53799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 53919 55805 gene locus_tag LOCUS_00500 53919 55805 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289518.1 protein_id gnl|my_center|LOCUS_00500 55789 56748 gene locus_tag LOCUS_00510 55789 56748 CDS product beta-galactosidase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289516.1 protein_id gnl|my_center|LOCUS_00510 56766 57305 gene locus_tag LOCUS_00520 56766 57305 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_00520 57328 58686 gene locus_tag LOCUS_00530 57328 58686 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671452.1 protein_id gnl|my_center|LOCUS_00530 58932 60182 gene locus_tag LOCUS_00540 58932 60182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 60233 64018 gene locus_tag LOCUS_00550 60233 64018 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_00550 64068 64604 gene locus_tag LOCUS_00560 64068 64604 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_00560 64652 64724 gene locus_tag LOCUS_t00010 64652 64724 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 64921 65343 gene locus_tag LOCUS_00570 64921 65343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 65441 66319 gene locus_tag LOCUS_00580 65441 66319 CDS product STM4015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042080.1 protein_id gnl|my_center|LOCUS_00580 66319 67317 gene locus_tag LOCUS_00590 66319 67317 CDS product STM4014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631310.1 protein_id gnl|my_center|LOCUS_00590 67334 68131 gene locus_tag LOCUS_00600 67334 68131 CDS product STM4013/SEN3800 family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202626.1 protein_id gnl|my_center|LOCUS_00600 68178 69467 gene locus_tag LOCUS_00610 68178 69467 CDS product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058547.1 protein_id gnl|my_center|LOCUS_00610 69472 70323 gene locus_tag LOCUS_00620 69472 70323 CDS product STM4011 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681897.1 protein_id gnl|my_center|LOCUS_00620 70437 70510 gene locus_tag LOCUS_t00020 70437 70510 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 70615 72204 gene locus_tag LOCUS_00630 70615 72204 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_00630 72288 75056 gene locus_tag LOCUS_00640 72288 75056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 75262 76524 gene locus_tag LOCUS_00650 75262 76524 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_00650 76531 77187 gene locus_tag LOCUS_00660 76531 77187 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016982.1 protein_id gnl|my_center|LOCUS_00660 78113 77304 gene locus_tag LOCUS_00670 78113 77304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816588.1 protein_id gnl|my_center|LOCUS_00670 78802 78107 gene locus_tag LOCUS_00680 78802 78107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922088.1 protein_id gnl|my_center|LOCUS_00680 79195 78833 gene locus_tag LOCUS_00690 79195 78833 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816592.1 protein_id gnl|my_center|LOCUS_00690 79477 80448 gene locus_tag LOCUS_00700 gene abnA 79477 80448 CDS product arabinan endo-1,5-alpha-L-arabinosidase AbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229496.1 protein_id gnl|my_center|LOCUS_00700 80567 82090 gene locus_tag LOCUS_00710 80567 82090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 82120 82416 gene locus_tag LOCUS_00720 82120 82416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 82560 86087 gene locus_tag LOCUS_00730 gene nifJ 82560 86087 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427073.1 protein_id gnl|my_center|LOCUS_00730 86334 86729 gene locus_tag LOCUS_00740 86334 86729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 86918 89374 gene locus_tag LOCUS_00750 86918 89374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 89435 89917 gene locus_tag LOCUS_00760 gene greA 89435 89917 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_00760 89937 91856 gene locus_tag LOCUS_00770 gene lysS 89937 91856 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861998.1 protein_id gnl|my_center|LOCUS_00770 93428 92079 gene locus_tag LOCUS_00780 93428 92079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 93692 94819 gene locus_tag LOCUS_00790 93692 94819 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659021.1 protein_id gnl|my_center|LOCUS_00790 94813 95016 gene locus_tag LOCUS_00800 94813 95016 CDS product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562727.1 protein_id gnl|my_center|LOCUS_00800 95009 95914 gene locus_tag LOCUS_00810 95009 95914 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860718.1 protein_id gnl|my_center|LOCUS_00810 95911 96672 gene locus_tag LOCUS_00820 95911 96672 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147179.1 protein_id gnl|my_center|LOCUS_00820 96798 97841 gene locus_tag LOCUS_00830 96798 97841 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235612.1 protein_id gnl|my_center|LOCUS_00830 99405 97933 gene locus_tag LOCUS_00840 99405 97933 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964133.1 protein_id gnl|my_center|LOCUS_00840 99615 101798 gene locus_tag LOCUS_00850 99615 101798 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584017.1 protein_id gnl|my_center|LOCUS_00850 102493 101795 gene locus_tag LOCUS_00860 102493 101795 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413366.1 protein_id gnl|my_center|LOCUS_00860 103356 102568 gene locus_tag LOCUS_00870 103356 102568 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391588.1 protein_id gnl|my_center|LOCUS_00870 103496 103858 gene locus_tag LOCUS_00880 103496 103858 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_00880 103898 104116 gene locus_tag LOCUS_00890 103898 104116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00890 104142 106010 gene locus_tag LOCUS_00900 104142 106010 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00900 106166 107536 gene locus_tag LOCUS_00910 106166 107536 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108266.1 protein_id gnl|my_center|LOCUS_00910 107533 108324 gene locus_tag LOCUS_00920 107533 108324 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_00920 108340 109806 gene locus_tag LOCUS_00930 108340 109806 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_00930 109851 110576 gene locus_tag LOCUS_00940 109851 110576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 110707 111744 gene locus_tag LOCUS_00950 gene hrcA 110707 111744 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_00950 111813 112499 gene locus_tag LOCUS_00960 gene grpE 111813 112499 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_00960 112549 114435 gene locus_tag LOCUS_00970 gene dnaK 112549 114435 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430934.1 protein_id gnl|my_center|LOCUS_00970 114580 115698 gene locus_tag LOCUS_00980 gene dnaJ 114580 115698 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964595.1 protein_id gnl|my_center|LOCUS_00980 115695 116375 gene locus_tag LOCUS_00990 115695 116375 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005692076.1 protein_id gnl|my_center|LOCUS_00990 116365 117081 gene locus_tag LOCUS_01000 116365 117081 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_01000 117132 118430 gene locus_tag LOCUS_01010 gene eno 117132 118430 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_01010 123495 118570 gene locus_tag LOCUS_01020 123495 118570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 123952 123626 gene locus_tag LOCUS_01030 123952 123626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 124219 125544 gene locus_tag LOCUS_01040 124219 125544 CDS product DUF3887 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582879.1 protein_id gnl|my_center|LOCUS_01040 128132 125604 gene locus_tag LOCUS_01050 128132 125604 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_01050 128262 128795 gene locus_tag LOCUS_01060 gene ytaF 128262 128795 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393339.1 protein_id gnl|my_center|LOCUS_01060 129372 128761 gene locus_tag LOCUS_01070 129372 128761 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888175.1 protein_id gnl|my_center|LOCUS_01070 129511 130716 gene locus_tag LOCUS_01080 129511 130716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 130758 133166 gene locus_tag LOCUS_01090 gene leuS 130758 133166 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009455.1 protein_id gnl|my_center|LOCUS_01090 133185 135431 gene locus_tag LOCUS_01100 133185 135431 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195718935.1 protein_id gnl|my_center|LOCUS_01100 135441 137615 gene locus_tag LOCUS_01110 135441 137615 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195718935.1 protein_id gnl|my_center|LOCUS_01110 137612 139819 gene locus_tag LOCUS_01120 137612 139819 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195718935.1 protein_id gnl|my_center|LOCUS_01120 139824 141035 gene locus_tag LOCUS_01130 139824 141035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 141054 141530 gene locus_tag LOCUS_01140 141054 141530 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_01140 141619 142080 gene locus_tag LOCUS_01150 141619 142080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 142061 142342 gene locus_tag LOCUS_01160 142061 142342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 143104 142547 gene locus_tag LOCUS_01170 143104 142547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 143287 144279 gene locus_tag LOCUS_01180 143287 144279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 144569 148624 gene locus_tag LOCUS_01190 gene cas9 144569 148624 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681289.1 protein_id gnl|my_center|LOCUS_01190 148636 149493 gene locus_tag LOCUS_01200 gene cas1 148636 149493 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_01200 149498 149803 gene locus_tag LOCUS_01210 gene cas2 149498 149803 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666293.1 protein_id gnl|my_center|LOCUS_01210 149800 150471 gene locus_tag LOCUS_01220 gene csn2 149800 150471 CDS product type II-A CRISPR-associated protein Csn2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681294.1 protein_id gnl|my_center|LOCUS_01220 150523 153519 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttgagagtcttgttaatttagaagggtgtaaaac >Feature sequence02 1969 1757 gene locus_tag LOCUS_01230 1969 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 4688 2025 gene locus_tag LOCUS_01240 4688 2025 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892169.1 protein_id gnl|my_center|LOCUS_01240 5269 4769 gene locus_tag LOCUS_01250 gene tadA 5269 4769 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_01250 6193 5288 gene locus_tag LOCUS_01260 6193 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 6341 7384 gene locus_tag LOCUS_01270 gene trpS 6341 7384 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_01270 10426 7532 gene locus_tag LOCUS_01280 10426 7532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 10931 10419 gene locus_tag LOCUS_01290 10931 10419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 12053 10986 gene locus_tag LOCUS_01300 gene hydE 12053 10986 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_01300 12402 11962 gene locus_tag LOCUS_01310 12402 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 13554 12475 gene locus_tag LOCUS_01320 13554 12475 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_01320 14203 13655 gene locus_tag LOCUS_01330 14203 13655 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809539.1 protein_id gnl|my_center|LOCUS_01330 16045 14339 gene locus_tag LOCUS_01340 16045 14339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 18076 16049 gene locus_tag LOCUS_01350 18076 16049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 20080 18098 gene locus_tag LOCUS_01360 20080 18098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 20225 21898 gene locus_tag LOCUS_01370 20225 21898 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_01370 24306 21940 gene locus_tag LOCUS_01380 24306 21940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 25614 24331 gene locus_tag LOCUS_01390 25614 24331 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202935.1 protein_id gnl|my_center|LOCUS_01390 26723 25611 gene locus_tag LOCUS_01400 26723 25611 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202936.1 protein_id gnl|my_center|LOCUS_01400 27698 26748 gene locus_tag LOCUS_01410 27698 26748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 28011 29117 gene locus_tag LOCUS_01420 28011 29117 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986574.1 protein_id gnl|my_center|LOCUS_01420 29117 30091 gene locus_tag LOCUS_01430 29117 30091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 30092 31933 gene locus_tag LOCUS_01440 30092 31933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 31951 33159 gene locus_tag LOCUS_01450 31951 33159 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108800.1 protein_id gnl|my_center|LOCUS_01450 33192 34481 gene locus_tag LOCUS_01460 33192 34481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 34508 35380 gene locus_tag LOCUS_01470 34508 35380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 37156 35390 gene locus_tag LOCUS_01480 37156 35390 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068688.1 protein_id gnl|my_center|LOCUS_01480 37925 37176 gene locus_tag LOCUS_01490 37925 37176 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_01490 38728 37937 gene locus_tag LOCUS_01500 38728 37937 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_01500 39748 38750 gene locus_tag LOCUS_01510 39748 38750 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549884.1 protein_id gnl|my_center|LOCUS_01510 40890 39745 gene locus_tag LOCUS_01520 40890 39745 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242735.1 protein_id gnl|my_center|LOCUS_01520 42319 40883 gene locus_tag LOCUS_01530 42319 40883 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575762.1 protein_id gnl|my_center|LOCUS_01530 42447 43898 gene locus_tag LOCUS_01540 42447 43898 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_01540 45043 44027 gene locus_tag LOCUS_01550 45043 44027 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_01550 46210 45062 gene locus_tag LOCUS_01560 gene glf 46210 45062 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875983.1 protein_id gnl|my_center|LOCUS_01560 47575 46262 gene locus_tag LOCUS_01570 47575 46262 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289207.1 protein_id gnl|my_center|LOCUS_01570 47747 49279 gene locus_tag LOCUS_01580 gene putP 47747 49279 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_01580 50722 49370 gene locus_tag LOCUS_01590 50722 49370 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435635.1 protein_id gnl|my_center|LOCUS_01590 51523 50825 gene locus_tag LOCUS_01600 51523 50825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 52718 51633 gene locus_tag LOCUS_01610 52718 51633 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_01610 53143 52730 gene locus_tag LOCUS_01620 53143 52730 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262609.1 protein_id gnl|my_center|LOCUS_01620 54145 53159 gene locus_tag LOCUS_01630 54145 53159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 54752 54135 gene locus_tag LOCUS_01640 54752 54135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 54893 56317 gene locus_tag LOCUS_01650 54893 56317 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941270.1 protein_id gnl|my_center|LOCUS_01650 57477 56296 gene locus_tag LOCUS_01660 57477 56296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 57916 57488 gene locus_tag LOCUS_01670 57916 57488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 58326 57907 gene locus_tag LOCUS_01680 58326 57907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 59060 58347 gene locus_tag LOCUS_01690 59060 58347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 61188 59209 gene locus_tag LOCUS_01700 61188 59209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 61381 61208 gene locus_tag LOCUS_01710 61381 61208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 62754 61399 gene locus_tag LOCUS_01720 62754 61399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 63525 62776 gene locus_tag LOCUS_01730 63525 62776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 64757 63522 gene locus_tag LOCUS_01740 64757 63522 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_01740 65769 64729 gene locus_tag LOCUS_01750 65769 64729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 66454 66663 gene locus_tag LOCUS_01760 66454 66663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 67204 66725 gene locus_tag LOCUS_01770 67204 66725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 68644 67220 gene locus_tag LOCUS_01780 68644 67220 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_01780 71595 68641 gene locus_tag LOCUS_01790 71595 68641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 72775 71699 gene locus_tag LOCUS_01800 72775 71699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 72893 75037 gene locus_tag LOCUS_01810 72893 75037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 76164 75040 gene locus_tag LOCUS_01820 76164 75040 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066524.1 protein_id gnl|my_center|LOCUS_01820 77768 76260 gene locus_tag LOCUS_01830 77768 76260 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476089.1 protein_id gnl|my_center|LOCUS_01830 80211 77857 gene locus_tag LOCUS_01840 80211 77857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 80983 80222 gene locus_tag LOCUS_01850 80983 80222 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 protein_id gnl|my_center|LOCUS_01850 82238 81084 gene locus_tag LOCUS_01860 82238 81084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 82918 82235 gene locus_tag LOCUS_01870 82918 82235 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_01870 83105 84508 gene locus_tag LOCUS_01880 83105 84508 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094940979.1 protein_id gnl|my_center|LOCUS_01880 85450 84476 gene locus_tag LOCUS_01890 85450 84476 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446968.1 protein_id gnl|my_center|LOCUS_01890 86516 85452 gene locus_tag LOCUS_01900 86516 85452 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173990.1 protein_id gnl|my_center|LOCUS_01900 86948 86538 gene locus_tag LOCUS_01910 86948 86538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 87349 86945 gene locus_tag LOCUS_01920 87349 86945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 87855 87346 gene locus_tag LOCUS_01930 87855 87346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 88188 87874 gene locus_tag LOCUS_01940 88188 87874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 89259 88213 gene locus_tag LOCUS_01950 89259 88213 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965404.1 protein_id gnl|my_center|LOCUS_01950 90210 89323 gene locus_tag LOCUS_01960 90210 89323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 90421 90678 gene locus_tag LOCUS_01970 90421 90678 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815009.1 protein_id gnl|my_center|LOCUS_01970 91576 90731 gene locus_tag LOCUS_01980 gene rsmI 91576 90731 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_01980 92411 91662 gene locus_tag LOCUS_01990 92411 91662 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_01990 93315 92404 gene locus_tag LOCUS_02000 93315 92404 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 protein_id gnl|my_center|LOCUS_02000 94315 93329 gene locus_tag LOCUS_02010 94315 93329 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_02010 94793 94353 gene locus_tag LOCUS_02020 94793 94353 CDS product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816309.1 protein_id gnl|my_center|LOCUS_02020 95512 94901 gene locus_tag LOCUS_02030 95512 94901 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_02030 96946 95516 gene locus_tag LOCUS_02040 96946 95516 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393748.1 protein_id gnl|my_center|LOCUS_02040 97498 97049 gene locus_tag LOCUS_02050 97498 97049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 98421 97612 gene locus_tag LOCUS_02060 98421 97612 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680889.1 protein_id gnl|my_center|LOCUS_02060 98908 98525 gene locus_tag LOCUS_02070 98908 98525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 100392 98995 gene locus_tag LOCUS_02080 100392 98995 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_02080 100810 100409 gene locus_tag LOCUS_02090 100810 100409 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262221.1 protein_id gnl|my_center|LOCUS_02090 103274 100827 gene locus_tag LOCUS_02100 103274 100827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 103480 103878 gene locus_tag LOCUS_02110 103480 103878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 105357 103879 gene locus_tag LOCUS_02120 105357 103879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 105890 105471 gene locus_tag LOCUS_02130 105890 105471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 106849 105941 gene locus_tag LOCUS_02140 106849 105941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 107639 106824 gene locus_tag LOCUS_02150 107639 106824 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_02150 109028 107724 gene locus_tag LOCUS_02160 109028 107724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 109741 109034 gene locus_tag LOCUS_02170 gene rgaR 109741 109034 CDS product two-component system response regulator RgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432343.1 protein_id gnl|my_center|LOCUS_02170 110178 109822 gene locus_tag LOCUS_02180 110178 109822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 110483 110635 gene locus_tag LOCUS_02190 110483 110635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 110635 111219 gene locus_tag LOCUS_02200 110635 111219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 111481 111879 gene locus_tag LOCUS_02210 111481 111879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 111996 113114 gene locus_tag LOCUS_02220 111996 113114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 113128 114321 gene locus_tag LOCUS_02230 113128 114321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 114326 114994 gene locus_tag LOCUS_02240 114326 114994 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481692.1 protein_id gnl|my_center|LOCUS_02240 118929 115087 gene locus_tag LOCUS_02250 118929 115087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 120177 119095 gene locus_tag LOCUS_02260 120177 119095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 120333 120659 gene locus_tag LOCUS_02270 120333 120659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 121874 120681 gene locus_tag LOCUS_02280 121874 120681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 124260 122005 gene locus_tag LOCUS_02290 gene glgB 124260 122005 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_02290 126111 124375 gene locus_tag LOCUS_02300 126111 124375 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_02300 127542 126178 gene locus_tag LOCUS_02310 127542 126178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 128581 127598 gene locus_tag LOCUS_02320 128581 127598 CDS product CotS family spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986383.1 protein_id gnl|my_center|LOCUS_02320 128734 130464 gene locus_tag LOCUS_02330 128734 130464 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_02330 131981 130671 gene locus_tag LOCUS_02340 131981 130671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 134084 131994 gene locus_tag LOCUS_02350 134084 131994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 134396 135460 gene locus_tag LOCUS_02360 134396 135460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 135848 135450 gene locus_tag LOCUS_02370 135848 135450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02370 136628 135969 gene locus_tag LOCUS_02380 136628 135969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02380 137252 136830 gene locus_tag LOCUS_02390 137252 136830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 137494 139194 gene locus_tag LOCUS_02400 137494 139194 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262712.1 protein_id gnl|my_center|LOCUS_02400 139432 140034 gene locus_tag LOCUS_02410 139432 140034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941688.1 protein_id gnl|my_center|LOCUS_02410 141683 140118 gene locus_tag LOCUS_02420 141683 140118 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947967.1 protein_id gnl|my_center|LOCUS_02420 142106 141858 gene locus_tag LOCUS_02430 142106 141858 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126664.1 protein_id gnl|my_center|LOCUS_02430 143430 142237 gene locus_tag LOCUS_02440 gene coaBC 143430 142237 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_02440 143852 143460 gene locus_tag LOCUS_02450 143852 143460 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287876.1 protein_id gnl|my_center|LOCUS_02450 144718 143870 gene locus_tag LOCUS_02460 gene panC 144718 143870 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287875.1 protein_id gnl|my_center|LOCUS_02460 145563 144736 gene locus_tag LOCUS_02470 gene panB 145563 144736 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_02470 146410 145517 gene locus_tag LOCUS_02480 146410 145517 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002349114.1 protein_id gnl|my_center|LOCUS_02480 147044 146649 gene locus_tag LOCUS_02490 147044 146649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 149051 147081 gene locus_tag LOCUS_02500 gene metG 149051 147081 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_02500 151530 149182 gene locus_tag LOCUS_02510 151530 149182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 >Feature sequence03 179 1069 gene locus_tag LOCUS_02520 179 1069 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458873.1 protein_id gnl|my_center|LOCUS_02520 1378 1587 gene locus_tag LOCUS_02530 1378 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 2079 2483 gene locus_tag LOCUS_02540 2079 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 2598 2990 gene locus_tag LOCUS_02550 2598 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 3062 4174 gene locus_tag LOCUS_02560 3062 4174 CDS product HNH endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986608.1 protein_id gnl|my_center|LOCUS_02560 4834 4169 gene locus_tag LOCUS_02570 gene sfsA 4834 4169 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_02570 5154 5651 gene locus_tag LOCUS_02580 5154 5651 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464913.1 protein_id gnl|my_center|LOCUS_02580 5665 6210 gene locus_tag LOCUS_02590 5665 6210 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897366.1 protein_id gnl|my_center|LOCUS_02590 6445 7737 gene locus_tag LOCUS_02600 6445 7737 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674469.1 protein_id gnl|my_center|LOCUS_02600 7963 9471 gene locus_tag LOCUS_02610 7963 9471 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680067.1 protein_id gnl|my_center|LOCUS_02610 9490 11016 gene locus_tag LOCUS_02620 9490 11016 CDS product galactoside ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680065.1 protein_id gnl|my_center|LOCUS_02620 11164 12774 gene locus_tag LOCUS_02630 11164 12774 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304851.1 protein_id gnl|my_center|LOCUS_02630 12764 14629 gene locus_tag LOCUS_02640 12764 14629 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_02640 14626 15600 gene locus_tag LOCUS_02650 14626 15600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 15649 16701 gene locus_tag LOCUS_02660 gene mglB 15649 16701 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036947.1 protein_id gnl|my_center|LOCUS_02660 18180 16693 gene locus_tag LOCUS_02670 gene galT 18180 16693 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_02670 19325 18330 gene locus_tag LOCUS_02680 gene galE 19325 18330 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966243.1 protein_id gnl|my_center|LOCUS_02680 20700 19417 gene locus_tag LOCUS_02690 gene galK 20700 19417 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263235.1 protein_id gnl|my_center|LOCUS_02690 22206 20866 gene locus_tag LOCUS_02700 22206 20866 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446180.1 protein_id gnl|my_center|LOCUS_02700 22438 23280 gene locus_tag LOCUS_02710 22438 23280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 23952 23275 gene locus_tag LOCUS_02720 23952 23275 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989471.1 protein_id gnl|my_center|LOCUS_02720 24164 25069 gene locus_tag LOCUS_02730 24164 25069 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948563.1 protein_id gnl|my_center|LOCUS_02730 25126 25767 gene locus_tag LOCUS_02740 25126 25767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 25754 26428 gene locus_tag LOCUS_02750 25754 26428 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548076.1 protein_id gnl|my_center|LOCUS_02750 27167 26379 gene locus_tag LOCUS_02760 27167 26379 CDS product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254517.1 protein_id gnl|my_center|LOCUS_02760 27346 28683 gene locus_tag LOCUS_02770 27346 28683 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_02770 28721 29539 gene locus_tag LOCUS_02780 28721 29539 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775665.1 protein_id gnl|my_center|LOCUS_02780 29624 29893 gene locus_tag LOCUS_02790 29624 29893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 30045 30605 gene locus_tag LOCUS_02800 30045 30605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 30566 33499 gene locus_tag LOCUS_02810 30566 33499 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948376.1 protein_id gnl|my_center|LOCUS_02810 33510 33923 gene locus_tag LOCUS_02820 gene mutT 33510 33923 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_02820 33896 34684 gene locus_tag LOCUS_02830 33896 34684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 35252 34722 gene locus_tag LOCUS_02840 35252 34722 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140224180.1 protein_id gnl|my_center|LOCUS_02840 36302 35334 gene locus_tag LOCUS_02850 36302 35334 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170821.1 protein_id gnl|my_center|LOCUS_02850 36489 36797 gene locus_tag LOCUS_02860 36489 36797 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016687.1 protein_id gnl|my_center|LOCUS_02860 36821 37525 gene locus_tag LOCUS_02870 gene vanR 36821 37525 CDS product vancomycin resistance response regulator transcriptoin factor VanR-G-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436401.1 protein_id gnl|my_center|LOCUS_02870 37515 38636 gene locus_tag LOCUS_02880 37515 38636 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021367800.1 protein_id gnl|my_center|LOCUS_02880 39980 38715 gene locus_tag LOCUS_02890 39980 38715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 41176 40016 gene locus_tag LOCUS_02900 41176 40016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 41567 41640 gene locus_tag LOCUS_t00030 41567 41640 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 41932 42978 gene locus_tag LOCUS_02910 gene vanG 41932 42978 CDS product D-alanine--D-serine ligase VanG-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861276.1 protein_id gnl|my_center|LOCUS_02910 43005 43763 gene locus_tag LOCUS_02920 43005 43763 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436406.1 protein_id gnl|my_center|LOCUS_02920 43763 45919 gene locus_tag LOCUS_02930 gene vanT 43763 45919 CDS product serine racemase VanT catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893196.1 protein_id gnl|my_center|LOCUS_02930 46027 46584 gene locus_tag LOCUS_02940 46027 46584 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840007.1 protein_id gnl|my_center|LOCUS_02940 46581 47861 gene locus_tag LOCUS_02950 46581 47861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 47981 48634 gene locus_tag LOCUS_02960 47981 48634 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461502.1 protein_id gnl|my_center|LOCUS_02960 48711 49955 gene locus_tag LOCUS_02970 48711 49955 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888369.1 protein_id gnl|my_center|LOCUS_02970 50186 50001 gene locus_tag LOCUS_02980 50186 50001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 50304 51443 gene locus_tag LOCUS_02990 50304 51443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 51514 52854 gene locus_tag LOCUS_03000 51514 52854 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017864221.1 protein_id gnl|my_center|LOCUS_03000 52857 53597 gene locus_tag LOCUS_03010 52857 53597 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948617.1 protein_id gnl|my_center|LOCUS_03010 53773 53609 gene locus_tag LOCUS_03020 53773 53609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 54021 55952 gene locus_tag LOCUS_03030 54021 55952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 55965 58325 gene locus_tag LOCUS_03040 gene feoB 55965 58325 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_03040 58439 59041 gene locus_tag LOCUS_03050 gene thrH 58439 59041 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_03050 59094 59807 gene locus_tag LOCUS_03060 59094 59807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 60913 59810 gene locus_tag LOCUS_03070 60913 59810 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244100.1 protein_id gnl|my_center|LOCUS_03070 61156 61767 gene locus_tag LOCUS_03080 61156 61767 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_03080 61793 62098 gene locus_tag LOCUS_03090 61793 62098 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546290.1 protein_id gnl|my_center|LOCUS_03090 62098 63279 gene locus_tag LOCUS_03100 62098 63279 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582673.1 protein_id gnl|my_center|LOCUS_03100 63300 64241 gene locus_tag LOCUS_03110 63300 64241 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_03110 64248 65126 gene locus_tag LOCUS_03120 64248 65126 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700054.1 protein_id gnl|my_center|LOCUS_03120 65812 65222 gene locus_tag LOCUS_03130 gene clpP 65812 65222 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436212.1 protein_id gnl|my_center|LOCUS_03130 66225 65809 gene locus_tag LOCUS_03140 66225 65809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 67392 66313 gene locus_tag LOCUS_03150 67392 66313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 68517 67750 gene locus_tag LOCUS_03160 68517 67750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 68846 70114 gene locus_tag LOCUS_03170 68846 70114 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482604.1 protein_id gnl|my_center|LOCUS_03170 70163 70924 gene locus_tag LOCUS_03180 gene agaR 70163 70924 CDS product transcriptional repressor AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209875.1 protein_id gnl|my_center|LOCUS_03180 70996 72876 gene locus_tag LOCUS_03190 gene mtlA 70996 72876 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093287.1 protein_id gnl|my_center|LOCUS_03190 72894 73811 gene locus_tag LOCUS_03200 gene pfkB 72894 73811 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_03200 73838 74095 gene locus_tag LOCUS_03210 73838 74095 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_03210 74157 75803 gene locus_tag LOCUS_03220 gene ptsP 74157 75803 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_03220 76007 76915 gene locus_tag LOCUS_03230 76007 76915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 77065 79335 gene locus_tag LOCUS_03240 77065 79335 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_03240 79399 79722 gene locus_tag LOCUS_03250 79399 79722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 79776 80720 gene locus_tag LOCUS_03260 79776 80720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 80739 81077 gene locus_tag LOCUS_03270 80739 81077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 81043 81720 gene locus_tag LOCUS_03280 81043 81720 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861321.1 protein_id gnl|my_center|LOCUS_03280 81721 83100 gene locus_tag LOCUS_03290 81721 83100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 83248 83979 gene locus_tag LOCUS_03300 83248 83979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 84103 84330 gene locus_tag LOCUS_03310 84103 84330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 84488 86116 gene locus_tag LOCUS_03320 84488 86116 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005129586.1 protein_id gnl|my_center|LOCUS_03320 86140 86901 gene locus_tag LOCUS_03330 86140 86901 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_03330 86913 87587 gene locus_tag LOCUS_03340 86913 87587 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_03340 87589 88977 gene locus_tag LOCUS_03350 87589 88977 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110230.1 protein_id gnl|my_center|LOCUS_03350 89165 89827 gene locus_tag LOCUS_03360 89165 89827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 90621 89920 gene locus_tag LOCUS_03370 90621 89920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 90705 91235 gene locus_tag LOCUS_03380 90705 91235 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_03380 91256 92245 gene locus_tag LOCUS_03390 91256 92245 CDS product DUF4846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903242.1 protein_id gnl|my_center|LOCUS_03390 94229 92250 gene locus_tag LOCUS_03400 94229 92250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 94471 96114 gene locus_tag LOCUS_03410 94471 96114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 96111 96371 gene locus_tag LOCUS_03420 96111 96371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 96643 99636 gene locus_tag LOCUS_03430 96643 99636 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259688.1 protein_id gnl|my_center|LOCUS_03430 99640 100599 gene locus_tag LOCUS_03440 99640 100599 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259689.1 protein_id gnl|my_center|LOCUS_03440 100617 101486 gene locus_tag LOCUS_03450 100617 101486 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259690.1 protein_id gnl|my_center|LOCUS_03450 101656 103584 gene locus_tag LOCUS_03460 101656 103584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259691.1 protein_id gnl|my_center|LOCUS_03460 103574 105952 gene locus_tag LOCUS_03470 103574 105952 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259692.1 protein_id gnl|my_center|LOCUS_03470 105949 106971 gene locus_tag LOCUS_03480 105949 106971 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259693.1 protein_id gnl|my_center|LOCUS_03480 106937 107953 gene locus_tag LOCUS_03490 106937 107953 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909515.1 protein_id gnl|my_center|LOCUS_03490 108052 109635 gene locus_tag LOCUS_03500 108052 109635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 109744 110700 gene locus_tag LOCUS_03510 109744 110700 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 protein_id gnl|my_center|LOCUS_03510 110717 112231 gene locus_tag LOCUS_03520 gene abfB 110717 112231 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_03520 112233 112496 gene locus_tag LOCUS_03530 112233 112496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 114661 112568 gene locus_tag LOCUS_03540 114661 112568 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963897.1 protein_id gnl|my_center|LOCUS_03540 114873 116507 gene locus_tag LOCUS_03550 114873 116507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 116509 118605 gene locus_tag LOCUS_03560 116509 118605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 118750 120816 gene locus_tag LOCUS_03570 118750 120816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 120843 121940 gene locus_tag LOCUS_03580 120843 121940 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_03580 122007 123662 gene locus_tag LOCUS_03590 122007 123662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 123739 124788 gene locus_tag LOCUS_03600 gene hisC 123739 124788 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905826.1 protein_id gnl|my_center|LOCUS_03600 124785 125450 gene locus_tag LOCUS_03610 124785 125450 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202796158.1 protein_id gnl|my_center|LOCUS_03610 125584 126498 gene locus_tag LOCUS_03620 125584 126498 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004846624.1 protein_id gnl|my_center|LOCUS_03620 126491 127324 gene locus_tag LOCUS_03630 126491 127324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 127325 128206 gene locus_tag LOCUS_03640 127325 128206 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460597.1 protein_id gnl|my_center|LOCUS_03640 128314 128388 gene locus_tag LOCUS_t00040 128314 128388 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 128416 128486 gene locus_tag LOCUS_t00050 128416 128486 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence04 89 176 gene locus_tag LOCUS_t00060 89 176 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 231 1019 gene locus_tag LOCUS_03650 231 1019 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681592.1 protein_id gnl|my_center|LOCUS_03650 1037 1840 gene locus_tag LOCUS_03660 1037 1840 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956754.1 protein_id gnl|my_center|LOCUS_03660 1916 2704 gene locus_tag LOCUS_03670 1916 2704 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681582.1 protein_id gnl|my_center|LOCUS_03670 2803 3936 gene locus_tag LOCUS_03680 2803 3936 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247133.1 protein_id gnl|my_center|LOCUS_03680 4736 3966 gene locus_tag LOCUS_03690 4736 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 5870 4770 gene locus_tag LOCUS_03700 5870 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_03700 7321 5966 gene locus_tag LOCUS_03710 7321 5966 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_03710 8037 7408 gene locus_tag LOCUS_03720 8037 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 10157 8166 gene locus_tag LOCUS_03730 10157 8166 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_03730 10511 10586 gene locus_tag LOCUS_t00070 10511 10586 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11232 10627 gene locus_tag LOCUS_03740 11232 10627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 11554 11396 gene locus_tag LOCUS_03750 11554 11396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 12145 11768 gene locus_tag LOCUS_03760 12145 11768 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_03760 12322 12531 gene locus_tag LOCUS_03770 12322 12531 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_03770 12577 12795 gene locus_tag LOCUS_03780 12577 12795 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_03780 12888 15320 gene locus_tag LOCUS_03790 12888 15320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 15343 15486 gene locus_tag LOCUS_03800 15343 15486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 15610 16224 gene locus_tag LOCUS_03810 15610 16224 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603742.1 protein_id gnl|my_center|LOCUS_03810 16229 17581 gene locus_tag LOCUS_03820 16229 17581 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964346.1 protein_id gnl|my_center|LOCUS_03820 17610 19502 gene locus_tag LOCUS_03830 17610 19502 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948262.1 protein_id gnl|my_center|LOCUS_03830 19596 23300 gene locus_tag LOCUS_03840 19596 23300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 23348 24280 gene locus_tag LOCUS_03850 23348 24280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 24561 28196 gene locus_tag LOCUS_03860 24561 28196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 28431 30653 gene locus_tag LOCUS_03870 28431 30653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 32415 30805 gene locus_tag LOCUS_03880 32415 30805 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_03880 32639 34558 gene locus_tag LOCUS_03890 gene ftsH 32639 34558 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963922.1 protein_id gnl|my_center|LOCUS_03890 34558 35370 gene locus_tag LOCUS_03900 34558 35370 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201882.1 protein_id gnl|my_center|LOCUS_03900 35374 37236 gene locus_tag LOCUS_03910 gene uvrC 35374 37236 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436264.1 protein_id gnl|my_center|LOCUS_03910 37229 39058 gene locus_tag LOCUS_03920 37229 39058 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459965.1 protein_id gnl|my_center|LOCUS_03920 41636 39081 gene locus_tag LOCUS_03930 41636 39081 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880372.1 protein_id gnl|my_center|LOCUS_03930 41791 42447 gene locus_tag LOCUS_03940 41791 42447 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101145.1 protein_id gnl|my_center|LOCUS_03940 42458 43783 gene locus_tag LOCUS_03950 42458 43783 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_03950 43813 44040 gene locus_tag LOCUS_03960 43813 44040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 44108 44183 gene locus_tag LOCUS_t00080 44108 44183 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 44364 45278 gene locus_tag LOCUS_03970 gene nadA 44364 45278 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454668.1 protein_id gnl|my_center|LOCUS_03970 45310 46602 gene locus_tag LOCUS_03980 45310 46602 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016070.1 protein_id gnl|my_center|LOCUS_03980 46595 47470 gene locus_tag LOCUS_03990 gene nadC 46595 47470 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454666.1 protein_id gnl|my_center|LOCUS_03990 47464 47844 gene locus_tag LOCUS_04000 47464 47844 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_04000 49665 48109 gene locus_tag LOCUS_04010 49665 48109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 51017 49662 gene locus_tag LOCUS_04020 51017 49662 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_04020 51809 51030 gene locus_tag LOCUS_04030 51809 51030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 51690 52031 gene locus_tag LOCUS_04040 51690 52031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 51962 52462 gene locus_tag LOCUS_04050 51962 52462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 52462 54264 gene locus_tag LOCUS_04060 52462 54264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 54348 55589 gene locus_tag LOCUS_04070 54348 55589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 55717 56244 gene locus_tag LOCUS_04080 55717 56244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 56241 56981 gene locus_tag LOCUS_04090 gene truA 56241 56981 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294728.1 protein_id gnl|my_center|LOCUS_04090 57029 57259 gene locus_tag LOCUS_04100 57029 57259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 57292 58677 gene locus_tag LOCUS_04110 57292 58677 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_04110 58702 60297 gene locus_tag LOCUS_04120 58702 60297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 60495 61601 gene locus_tag LOCUS_04130 gene recA 60495 61601 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428218.1 protein_id gnl|my_center|LOCUS_04130 61603 62142 gene locus_tag LOCUS_04140 61603 62142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 62245 63645 gene locus_tag LOCUS_04150 gene glmM 62245 63645 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 protein_id gnl|my_center|LOCUS_04150 63656 64969 gene locus_tag LOCUS_04160 gene tig 63656 64969 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965929.1 protein_id gnl|my_center|LOCUS_04160 65004 65618 gene locus_tag LOCUS_04170 gene clpP 65004 65618 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_04170 65715 67022 gene locus_tag LOCUS_04180 gene clpX 65715 67022 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816893.1 protein_id gnl|my_center|LOCUS_04180 67049 69370 gene locus_tag LOCUS_04190 gene lon 67049 69370 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435613.1 protein_id gnl|my_center|LOCUS_04190 69378 69986 gene locus_tag LOCUS_04200 gene yihA 69378 69986 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_04200 70017 70649 gene locus_tag LOCUS_04210 gene nth 70017 70649 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895383.1 protein_id gnl|my_center|LOCUS_04210 70646 71152 gene locus_tag LOCUS_04220 70646 71152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 71585 71175 gene locus_tag LOCUS_04230 71585 71175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 71711 72946 gene locus_tag LOCUS_04240 71711 72946 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_04240 72985 75234 gene locus_tag LOCUS_04250 gene glgB 72985 75234 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_04250 75317 76501 gene locus_tag LOCUS_04260 gene nifS 75317 76501 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_04260 76504 76932 gene locus_tag LOCUS_04270 gene nifU 76504 76932 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_04270 76922 77998 gene locus_tag LOCUS_04280 gene mnmA 76922 77998 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_04280 77995 78891 gene locus_tag LOCUS_04290 77995 78891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 78927 79250 gene locus_tag LOCUS_04300 78927 79250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 79266 80012 gene locus_tag LOCUS_04310 79266 80012 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948252.1 protein_id gnl|my_center|LOCUS_04310 81436 80267 gene locus_tag LOCUS_04320 81436 80267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 83385 81451 gene locus_tag LOCUS_04330 83385 81451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 84860 83382 gene locus_tag LOCUS_04340 84860 83382 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_04340 85664 84873 gene locus_tag LOCUS_04350 85664 84873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 87467 85665 gene locus_tag LOCUS_04360 87467 85665 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583579.1 protein_id gnl|my_center|LOCUS_04360 87620 88750 gene locus_tag LOCUS_04370 87620 88750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 88792 89538 gene locus_tag LOCUS_04380 88792 89538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 89535 90386 gene locus_tag LOCUS_04390 89535 90386 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430304.1 protein_id gnl|my_center|LOCUS_04390 90524 91636 gene locus_tag LOCUS_04400 gene ugpC 90524 91636 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_04400 91786 92874 gene locus_tag LOCUS_04410 91786 92874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 92928 93644 gene locus_tag LOCUS_04420 gene ftsE 92928 93644 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815584.1 protein_id gnl|my_center|LOCUS_04420 93631 94542 gene locus_tag LOCUS_04430 93631 94542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 94555 95772 gene locus_tag LOCUS_04440 94555 95772 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_04440 95798 97024 gene locus_tag LOCUS_04450 95798 97024 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437815.1 protein_id gnl|my_center|LOCUS_04450 98912 97047 gene locus_tag LOCUS_04460 98912 97047 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860962.1 protein_id gnl|my_center|LOCUS_04460 >Feature sequence05 148 1254 gene locus_tag LOCUS_04470 gene rpsA 148 1254 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986222.1 protein_id gnl|my_center|LOCUS_04470 1261 2043 gene locus_tag LOCUS_04480 1261 2043 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460804.1 protein_id gnl|my_center|LOCUS_04480 2158 3162 gene locus_tag LOCUS_04490 gene plsX 2158 3162 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_04490 3178 3876 gene locus_tag LOCUS_04500 gene rnc 3178 3876 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_04500 3878 7441 gene locus_tag LOCUS_04510 gene smc 3878 7441 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_04510 7457 8383 gene locus_tag LOCUS_04520 gene ftsY 7457 8383 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393780.1 protein_id gnl|my_center|LOCUS_04520 8408 9625 gene locus_tag LOCUS_04530 gene ilvA 8408 9625 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_04530 9649 10887 gene locus_tag LOCUS_04540 9649 10887 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964253.1 protein_id gnl|my_center|LOCUS_04540 10916 11554 gene locus_tag LOCUS_04550 gene hisG 10916 11554 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436683.1 protein_id gnl|my_center|LOCUS_04550 11577 12887 gene locus_tag LOCUS_04560 gene hisD 11577 12887 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949111.1 protein_id gnl|my_center|LOCUS_04560 13038 13385 gene locus_tag LOCUS_04570 gene rplS 13038 13385 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419350.1 protein_id gnl|my_center|LOCUS_04570 13488 14108 gene locus_tag LOCUS_04580 gene lepB 13488 14108 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929024.1 protein_id gnl|my_center|LOCUS_04580 14110 14949 gene locus_tag LOCUS_04590 gene ylqF 14110 14949 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_04590 14975 15886 gene locus_tag LOCUS_04600 14975 15886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 15916 16389 gene locus_tag LOCUS_04610 15916 16389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 16469 17803 gene locus_tag LOCUS_04620 gene gdhA 16469 17803 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_04620 17966 18877 gene locus_tag LOCUS_04630 17966 18877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 19014 18942 gene locus_tag LOCUS_t00090 19014 18942 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19067 19951 gene locus_tag LOCUS_04640 gene hslO 19067 19951 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656372.1 protein_id gnl|my_center|LOCUS_04640 20040 20684 gene locus_tag LOCUS_04650 20040 20684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 20870 21547 gene locus_tag LOCUS_04660 20870 21547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 21544 23514 gene locus_tag LOCUS_04670 gene ligA 21544 23514 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_04670 25034 23544 gene locus_tag LOCUS_04680 25034 23544 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888874.1 protein_id gnl|my_center|LOCUS_04680 25154 27559 gene locus_tag LOCUS_04690 25154 27559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 27699 28886 gene locus_tag LOCUS_04700 gene nifS 27699 28886 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065651.1 protein_id gnl|my_center|LOCUS_04700 29716 28883 gene locus_tag LOCUS_04710 29716 28883 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_04710 31497 29713 gene locus_tag LOCUS_04720 31497 29713 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_04720 31651 32529 gene locus_tag LOCUS_04730 31651 32529 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_04730 32550 32798 gene locus_tag LOCUS_04740 32550 32798 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811866.1 protein_id gnl|my_center|LOCUS_04740 32805 33434 gene locus_tag LOCUS_04750 gene gmk 32805 33434 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257738.1 protein_id gnl|my_center|LOCUS_04750 33438 34040 gene locus_tag LOCUS_04760 gene lepB 33438 34040 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583882.1 protein_id gnl|my_center|LOCUS_04760 34097 34393 gene locus_tag LOCUS_04770 34097 34393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 34583 34909 gene locus_tag LOCUS_04780 34583 34909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 35052 37391 gene locus_tag LOCUS_04790 35052 37391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 38531 37470 gene locus_tag LOCUS_04800 38531 37470 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_04800 39099 38725 gene locus_tag LOCUS_04810 39099 38725 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_04810 40220 39288 gene locus_tag LOCUS_04820 40220 39288 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861614.1 protein_id gnl|my_center|LOCUS_04820 40702 40196 gene locus_tag LOCUS_04830 gene lspA 40702 40196 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358651.1 protein_id gnl|my_center|LOCUS_04830 41763 40702 gene locus_tag LOCUS_04840 41763 40702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 42549 41779 gene locus_tag LOCUS_04850 42549 41779 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358628.1 protein_id gnl|my_center|LOCUS_04850 43065 42556 gene locus_tag LOCUS_04860 43065 42556 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213920.1 protein_id gnl|my_center|LOCUS_04860 43787 43098 gene locus_tag LOCUS_04870 43787 43098 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_04870 45183 43810 gene locus_tag LOCUS_04880 45183 43810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 45263 45457 gene locus_tag LOCUS_04890 45263 45457 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964294.1 protein_id gnl|my_center|LOCUS_04890 45904 45506 gene locus_tag LOCUS_04900 gene mgsA 45904 45506 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_04900 47100 45928 gene locus_tag LOCUS_04910 gene rodA 47100 45928 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_04910 47413 47135 gene locus_tag LOCUS_04920 gene minE 47413 47135 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358099.1 protein_id gnl|my_center|LOCUS_04920 48216 47428 gene locus_tag LOCUS_04930 gene minD 48216 47428 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419057.1 protein_id gnl|my_center|LOCUS_04930 48935 48270 gene locus_tag LOCUS_04940 48935 48270 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902702.1 protein_id gnl|my_center|LOCUS_04940 51812 48951 gene locus_tag LOCUS_04950 51812 48951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 52324 51815 gene locus_tag LOCUS_04960 52324 51815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 53190 52321 gene locus_tag LOCUS_04970 53190 52321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 54204 53212 gene locus_tag LOCUS_04980 54204 53212 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356149.1 protein_id gnl|my_center|LOCUS_04980 54982 54275 gene locus_tag LOCUS_04990 gene radC 54982 54275 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360029.1 protein_id gnl|my_center|LOCUS_04990 56380 55091 gene locus_tag LOCUS_05000 56380 55091 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_05000 57321 56380 gene locus_tag LOCUS_05010 gene miaA 57321 56380 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_05010 59205 57358 gene locus_tag LOCUS_05020 gene mutL 59205 57358 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257019.1 protein_id gnl|my_center|LOCUS_05020 61841 59205 gene locus_tag LOCUS_05030 gene mutS 61841 59205 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_05030 62675 61872 gene locus_tag LOCUS_05040 62675 61872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 62860 63474 gene locus_tag LOCUS_05050 gene lexA 62860 63474 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_05050 63901 63545 gene locus_tag LOCUS_05060 gene rsfS 63901 63545 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_05060 65129 63861 gene locus_tag LOCUS_05070 65129 63861 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679466.1 protein_id gnl|my_center|LOCUS_05070 65448 65146 gene locus_tag LOCUS_05080 gene yhbY 65448 65146 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_05080 66766 65474 gene locus_tag LOCUS_05090 gene obgE 66766 65474 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_05090 67140 66853 gene locus_tag LOCUS_05100 gene rpmA 67140 66853 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_05100 67473 67153 gene locus_tag LOCUS_05110 67473 67153 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816543.1 protein_id gnl|my_center|LOCUS_05110 67795 67487 gene locus_tag LOCUS_05120 gene rplU 67795 67487 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640343.1 protein_id gnl|my_center|LOCUS_05120 69557 67980 gene locus_tag LOCUS_05130 69557 67980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 69833 69582 gene locus_tag LOCUS_05140 69833 69582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 70042 71310 gene locus_tag LOCUS_05150 70042 71310 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416818.1 protein_id gnl|my_center|LOCUS_05150 72506 71340 gene locus_tag LOCUS_05160 72506 71340 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438072.1 protein_id gnl|my_center|LOCUS_05160 73240 72503 gene locus_tag LOCUS_05170 73240 72503 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964567.1 protein_id gnl|my_center|LOCUS_05170 75114 73237 gene locus_tag LOCUS_05180 75114 73237 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099491.1 protein_id gnl|my_center|LOCUS_05180 75310 76176 gene locus_tag LOCUS_05190 75310 76176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 77747 76245 gene locus_tag LOCUS_05200 77747 76245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 79430 77760 gene locus_tag LOCUS_05210 79430 77760 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809743.1 protein_id gnl|my_center|LOCUS_05210 80352 79486 gene locus_tag LOCUS_05220 80352 79486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 81273 80365 gene locus_tag LOCUS_05230 81273 80365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 83831 81270 gene locus_tag LOCUS_05240 83831 81270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 84591 83935 gene locus_tag LOCUS_05250 84591 83935 CDS product ClpP family protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965117.1 protein_id gnl|my_center|LOCUS_05250 84714 85226 gene locus_tag LOCUS_05260 84714 85226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 87403 85310 gene locus_tag LOCUS_05270 gene pnp 87403 85310 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722460.1 protein_id gnl|my_center|LOCUS_05270 88394 87576 gene locus_tag LOCUS_05280 88394 87576 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223846944.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence06 1087 95 gene locus_tag LOCUS_05290 1087 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 3322 1151 gene locus_tag LOCUS_05300 3322 1151 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967776.1 protein_id gnl|my_center|LOCUS_05300 4332 3343 gene locus_tag LOCUS_05310 4332 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 5773 4346 gene locus_tag LOCUS_05320 5773 4346 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822542.1 protein_id gnl|my_center|LOCUS_05320 6458 5757 gene locus_tag LOCUS_05330 gene yycF 6458 5757 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357947.1 protein_id gnl|my_center|LOCUS_05330 7094 6474 gene locus_tag LOCUS_05340 7094 6474 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990138.1 protein_id gnl|my_center|LOCUS_05340 7629 7195 gene locus_tag LOCUS_05350 7629 7195 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966812.1 protein_id gnl|my_center|LOCUS_05350 8920 7745 gene locus_tag LOCUS_05360 8920 7745 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864195.1 protein_id gnl|my_center|LOCUS_05360 9834 8926 gene locus_tag LOCUS_05370 gene argB 9834 8926 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864194.1 protein_id gnl|my_center|LOCUS_05370 11081 9861 gene locus_tag LOCUS_05380 gene argJ 11081 9861 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082329.1 protein_id gnl|my_center|LOCUS_05380 12141 11101 gene locus_tag LOCUS_05390 gene argC 12141 11101 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_05390 12369 13589 gene locus_tag LOCUS_05400 12369 13589 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_05400 14599 13676 gene locus_tag LOCUS_05410 gene metA 14599 13676 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080711.1 protein_id gnl|my_center|LOCUS_05410 16781 14658 gene locus_tag LOCUS_05420 16781 14658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 17413 16859 gene locus_tag LOCUS_05430 17413 16859 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852949.1 protein_id gnl|my_center|LOCUS_05430 18611 17406 gene locus_tag LOCUS_05440 gene thiH 18611 17406 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_05440 19413 18601 gene locus_tag LOCUS_05450 19413 18601 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 protein_id gnl|my_center|LOCUS_05450 19662 19465 gene locus_tag LOCUS_05460 gene thiS 19662 19465 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814099.1 protein_id gnl|my_center|LOCUS_05460 20958 19849 gene locus_tag LOCUS_05470 20958 19849 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966652.1 protein_id gnl|my_center|LOCUS_05470 22787 21555 gene locus_tag LOCUS_05480 22787 21555 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913616.1 protein_id gnl|my_center|LOCUS_05480 22983 24212 gene locus_tag LOCUS_05490 22983 24212 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966655.1 protein_id gnl|my_center|LOCUS_05490 24240 25208 gene locus_tag LOCUS_05500 24240 25208 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966656.1 protein_id gnl|my_center|LOCUS_05500 26950 25205 gene locus_tag LOCUS_05510 26950 25205 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_05510 28860 26965 gene locus_tag LOCUS_05520 gene nuoF 28860 26965 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817338.1 protein_id gnl|my_center|LOCUS_05520 29335 28850 gene locus_tag LOCUS_05530 gene nuoE 29335 28850 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582933.1 protein_id gnl|my_center|LOCUS_05530 30814 29357 gene locus_tag LOCUS_05540 gene pap 30814 29357 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_05540 32326 30845 gene locus_tag LOCUS_05550 32326 30845 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963828.1 protein_id gnl|my_center|LOCUS_05550 33665 32253 gene locus_tag LOCUS_05560 33665 32253 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963827.1 protein_id gnl|my_center|LOCUS_05560 35884 33653 gene locus_tag LOCUS_05570 35884 33653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 36379 35975 gene locus_tag LOCUS_05580 36379 35975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 37132 36455 gene locus_tag LOCUS_05590 37132 36455 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_05590 38211 37210 gene locus_tag LOCUS_05600 gene ruvB 38211 37210 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_05600 38926 38306 gene locus_tag LOCUS_05610 gene ruvA 38926 38306 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_05610 40525 38936 gene locus_tag LOCUS_05620 gene cls 40525 38936 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 protein_id gnl|my_center|LOCUS_05620 40701 41795 gene locus_tag LOCUS_05630 40701 41795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 44455 41816 gene locus_tag LOCUS_05640 gene alaS 44455 41816 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986885.1 protein_id gnl|my_center|LOCUS_05640 46490 44541 gene locus_tag LOCUS_05650 46490 44541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 46993 46532 gene locus_tag LOCUS_05660 46993 46532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 47456 47031 gene locus_tag LOCUS_05670 47456 47031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 47646 47464 gene locus_tag LOCUS_05680 47646 47464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 48528 47683 gene locus_tag LOCUS_05690 48528 47683 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948004.1 protein_id gnl|my_center|LOCUS_05690 50222 48552 gene locus_tag LOCUS_05700 50222 48552 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 protein_id gnl|my_center|LOCUS_05700 51685 50336 gene locus_tag LOCUS_05710 51685 50336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 51921 51712 gene locus_tag LOCUS_05720 51921 51712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 53002 51893 gene locus_tag LOCUS_05730 53002 51893 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_05730 53705 53199 gene locus_tag LOCUS_05740 53705 53199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 54643 53873 gene locus_tag LOCUS_05750 54643 53873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 56131 54647 gene locus_tag LOCUS_05760 gene thrC 56131 54647 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263406.1 protein_id gnl|my_center|LOCUS_05760 56903 56238 gene locus_tag LOCUS_05770 56903 56238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 57104 57898 gene locus_tag LOCUS_05780 57104 57898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 58211 57882 gene locus_tag LOCUS_05790 58211 57882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 58720 58226 gene locus_tag LOCUS_05800 58720 58226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 61190 58752 gene locus_tag LOCUS_05810 gene pheT 61190 58752 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_05810 62227 61208 gene locus_tag LOCUS_05820 gene pheS 62227 61208 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_05820 63002 62688 gene locus_tag LOCUS_05830 63002 62688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 63721 63002 gene locus_tag LOCUS_05840 63721 63002 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906060.1 protein_id gnl|my_center|LOCUS_05840 63932 64807 gene locus_tag LOCUS_05850 63932 64807 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_05850 66530 64755 gene locus_tag LOCUS_05860 66530 64755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 67603 66629 gene locus_tag LOCUS_05870 67603 66629 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_05870 68329 67790 gene locus_tag LOCUS_05880 68329 67790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 68982 68320 gene locus_tag LOCUS_05890 68982 68320 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963967.1 protein_id gnl|my_center|LOCUS_05890 69793 68972 gene locus_tag LOCUS_05900 69793 68972 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_05900 70213 69806 gene locus_tag LOCUS_05910 70213 69806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386950.1 protein_id gnl|my_center|LOCUS_05910 71205 70306 gene locus_tag LOCUS_05920 71205 70306 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_05920 71436 72761 gene locus_tag LOCUS_05930 71436 72761 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921845.1 protein_id gnl|my_center|LOCUS_05930 72758 73285 gene locus_tag LOCUS_05940 72758 73285 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429542.1 protein_id gnl|my_center|LOCUS_05940 73451 73747 gene locus_tag LOCUS_05950 73451 73747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 74409 73888 gene locus_tag LOCUS_05960 74409 73888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 <74942 74427 gene locus_tag LOCUS_05970 <74942 74427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035889.1:AAA family ATPase >Feature sequence07 293 78 gene locus_tag LOCUS_05980 293 78 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_05980 423 1304 gene locus_tag LOCUS_05990 423 1304 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460731.1 protein_id gnl|my_center|LOCUS_05990 1335 3119 gene locus_tag LOCUS_06000 1335 3119 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945027.1 protein_id gnl|my_center|LOCUS_06000 3112 3702 gene locus_tag LOCUS_06010 gene cysC 3112 3702 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963430.1 protein_id gnl|my_center|LOCUS_06010 3728 5752 gene locus_tag LOCUS_06020 3728 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 6814 5786 gene locus_tag LOCUS_06030 6814 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 6891 7457 gene locus_tag LOCUS_06040 6891 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 7824 8894 gene locus_tag LOCUS_06050 7824 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 9038 10033 gene locus_tag LOCUS_06060 9038 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 10035 12815 gene locus_tag LOCUS_06070 10035 12815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 12817 13593 gene locus_tag LOCUS_06080 12817 13593 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029799.1 protein_id gnl|my_center|LOCUS_06080 13590 14525 gene locus_tag LOCUS_06090 13590 14525 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_06090 15128 14547 gene locus_tag LOCUS_06100 15128 14547 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949169.1 protein_id gnl|my_center|LOCUS_06100 15254 16549 gene locus_tag LOCUS_06110 15254 16549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 16708 17910 gene locus_tag LOCUS_06120 16708 17910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 17888 19204 gene locus_tag LOCUS_06130 17888 19204 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_06130 19326 19871 gene locus_tag LOCUS_06140 gene spoVT 19326 19871 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359411.1 protein_id gnl|my_center|LOCUS_06140 19967 20242 gene locus_tag LOCUS_06150 19967 20242 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421415.1 protein_id gnl|my_center|LOCUS_06150 20364 20603 gene locus_tag LOCUS_06160 20364 20603 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048379.1 protein_id gnl|my_center|LOCUS_06160 20740 21033 gene locus_tag LOCUS_06170 20740 21033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 21033 21431 gene locus_tag LOCUS_06180 21033 21431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 21490 21786 gene locus_tag LOCUS_06190 21490 21786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 22011 24350 gene locus_tag LOCUS_06200 gene spoIIE 22011 24350 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048377.1 protein_id gnl|my_center|LOCUS_06200 24460 25863 gene locus_tag LOCUS_06210 gene tilS 24460 25863 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434952.1 protein_id gnl|my_center|LOCUS_06210 25863 26393 gene locus_tag LOCUS_06220 gene hpt 25863 26393 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966479.1 protein_id gnl|my_center|LOCUS_06220 26422 28269 gene locus_tag LOCUS_06230 gene ftsH 26422 28269 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_06230 28510 30564 gene locus_tag LOCUS_06240 gene malZ 28510 30564 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482420.1 protein_id gnl|my_center|LOCUS_06240 30575 31399 gene locus_tag LOCUS_06250 30575 31399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 31489 31561 gene locus_tag LOCUS_t00100 31489 31561 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 31602 33398 gene locus_tag LOCUS_06260 31602 33398 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_06260 34030 33410 gene locus_tag LOCUS_06270 34030 33410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 34298 35878 gene locus_tag LOCUS_06280 34298 35878 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948022.1 protein_id gnl|my_center|LOCUS_06280 35896 36888 gene locus_tag LOCUS_06290 35896 36888 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_06290 36885 37373 gene locus_tag LOCUS_06300 36885 37373 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_06300 37370 38527 gene locus_tag LOCUS_06310 37370 38527 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_06310 38571 39041 gene locus_tag LOCUS_06320 38571 39041 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963906.1 protein_id gnl|my_center|LOCUS_06320 39133 39636 gene locus_tag LOCUS_06330 39133 39636 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_06330 39697 41223 gene locus_tag LOCUS_06340 39697 41223 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_06340 41244 42506 gene locus_tag LOCUS_06350 41244 42506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 42540 44039 gene locus_tag LOCUS_06360 42540 44039 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_06360 44111 45298 gene locus_tag LOCUS_06370 44111 45298 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392280.1 protein_id gnl|my_center|LOCUS_06370 45400 47718 gene locus_tag LOCUS_06380 45400 47718 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886602.1 protein_id gnl|my_center|LOCUS_06380 48994 47831 gene locus_tag LOCUS_06390 48994 47831 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_06390 50049 49048 gene locus_tag LOCUS_06400 50049 49048 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_06400 51183 50080 gene locus_tag LOCUS_06410 51183 50080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 52880 51498 gene locus_tag LOCUS_06420 gene murC 52880 51498 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_06420 53110 54387 gene locus_tag LOCUS_06430 53110 54387 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_06430 54384 55505 gene locus_tag LOCUS_06440 gene glgD 54384 55505 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_06440 55532 55813 gene locus_tag LOCUS_06450 gene spoVG 55532 55813 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_06450 55970 56701 gene locus_tag LOCUS_06460 55970 56701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 56774 57484 gene locus_tag LOCUS_06470 gene deoD 56774 57484 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829961.1 protein_id gnl|my_center|LOCUS_06470 57503 58438 gene locus_tag LOCUS_06480 57503 58438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 58584 59159 gene locus_tag LOCUS_06490 gene pth 58584 59159 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_06490 59167 62721 gene locus_tag LOCUS_06500 gene mfd 59167 62721 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_06500 62723 63724 gene locus_tag LOCUS_06510 62723 63724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 63748 65241 gene locus_tag LOCUS_06520 gene malQ 63748 65241 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_06520 66423 65254 gene locus_tag LOCUS_06530 66423 65254 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_06530 67070 66441 gene locus_tag LOCUS_06540 67070 66441 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530477.1 protein_id gnl|my_center|LOCUS_06540 67306 68331 gene locus_tag LOCUS_06550 67306 68331 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_06550 68508 70199 gene locus_tag LOCUS_06560 68508 70199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 70410 71468 gene locus_tag LOCUS_06570 70410 71468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 >Feature sequence08 67 618 gene locus_tag LOCUS_06580 67 618 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963446.1 protein_id gnl|my_center|LOCUS_06580 621 1964 gene locus_tag LOCUS_06590 621 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 2052 2405 gene locus_tag LOCUS_06600 2052 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 2439 2822 gene locus_tag LOCUS_06610 gene cheY 2439 2822 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211091957.1 protein_id gnl|my_center|LOCUS_06610 2852 5404 gene locus_tag LOCUS_06620 2852 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 5502 5574 gene locus_tag LOCUS_t00110 5502 5574 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5659 7050 gene locus_tag LOCUS_06630 gene asnS 5659 7050 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_06630 7076 8083 gene locus_tag LOCUS_06640 gene asnA 7076 8083 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_06640 8097 9275 gene locus_tag LOCUS_06650 8097 9275 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_06650 9299 10060 gene locus_tag LOCUS_06660 9299 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 10067 11125 gene locus_tag LOCUS_06670 gene mutY 10067 11125 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132598.1 protein_id gnl|my_center|LOCUS_06670 11266 13392 gene locus_tag LOCUS_06680 gene nrdD 11266 13392 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187799.1 protein_id gnl|my_center|LOCUS_06680 13413 13943 gene locus_tag LOCUS_06690 gene nrdG 13413 13943 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287943.1 protein_id gnl|my_center|LOCUS_06690 13956 14402 gene locus_tag LOCUS_06700 gene dut 13956 14402 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808844.1 protein_id gnl|my_center|LOCUS_06700 14468 15733 gene locus_tag LOCUS_06710 gene leuC 14468 15733 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_06710 15750 16241 gene locus_tag LOCUS_06720 gene leuD 15750 16241 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_06720 16345 17460 gene locus_tag LOCUS_06730 16345 17460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 17490 18047 gene locus_tag LOCUS_06740 17490 18047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 18040 18711 gene locus_tag LOCUS_06750 18040 18711 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044679.1 protein_id gnl|my_center|LOCUS_06750 18765 20342 gene locus_tag LOCUS_06760 18765 20342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 20424 21227 gene locus_tag LOCUS_06770 20424 21227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 21274 22182 gene locus_tag LOCUS_06780 21274 22182 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403172.1 protein_id gnl|my_center|LOCUS_06780 22204 24033 gene locus_tag LOCUS_06790 22204 24033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 24153 24761 gene locus_tag LOCUS_06800 gene hisH 24153 24761 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560360.1 protein_id gnl|my_center|LOCUS_06800 24813 25574 gene locus_tag LOCUS_06810 gene hisF 24813 25574 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_06810 25615 26289 gene locus_tag LOCUS_06820 25615 26289 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387025.1 protein_id gnl|my_center|LOCUS_06820 26432 28339 gene locus_tag LOCUS_06830 26432 28339 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_06830 28346 28696 gene locus_tag LOCUS_06840 28346 28696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 28719 30215 gene locus_tag LOCUS_06850 28719 30215 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033065833.1 protein_id gnl|my_center|LOCUS_06850 30225 31127 gene locus_tag LOCUS_06860 30225 31127 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964264.1 protein_id gnl|my_center|LOCUS_06860 31268 33598 gene locus_tag LOCUS_06870 31268 33598 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_06870 33621 34241 gene locus_tag LOCUS_06880 33621 34241 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442291.1 protein_id gnl|my_center|LOCUS_06880 34257 35699 gene locus_tag LOCUS_06890 34257 35699 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_06890 35701 36948 gene locus_tag LOCUS_06900 gene hisS 35701 36948 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964121.1 protein_id gnl|my_center|LOCUS_06900 36974 38764 gene locus_tag LOCUS_06910 gene aspS 36974 38764 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965567.1 protein_id gnl|my_center|LOCUS_06910 38761 39054 gene locus_tag LOCUS_06920 38761 39054 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889719.1 protein_id gnl|my_center|LOCUS_06920 39077 40114 gene locus_tag LOCUS_06930 39077 40114 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_06930 40342 40788 gene locus_tag LOCUS_06940 40342 40788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 41025 42332 gene locus_tag LOCUS_06950 gene thiC 41025 42332 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047970.1 protein_id gnl|my_center|LOCUS_06950 42421 43248 gene locus_tag LOCUS_06960 42421 43248 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948026.1 protein_id gnl|my_center|LOCUS_06960 43396 44100 gene locus_tag LOCUS_06970 43396 44100 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_06970 44180 45334 gene locus_tag LOCUS_06980 44180 45334 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963947.1 protein_id gnl|my_center|LOCUS_06980 46767 45439 gene locus_tag LOCUS_06990 46767 45439 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_06990 47002 47256 gene locus_tag LOCUS_07000 47002 47256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 47392 49302 gene locus_tag LOCUS_07010 47392 49302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 49535 50620 gene locus_tag LOCUS_07020 gene leuB 49535 50620 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940244.1 protein_id gnl|my_center|LOCUS_07020 50665 52323 gene locus_tag LOCUS_07030 gene ilvD 50665 52323 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_07030 52348 54039 gene locus_tag LOCUS_07040 gene ilvB 52348 54039 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_07040 54059 55141 gene locus_tag LOCUS_07050 gene serC 54059 55141 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_07050 55141 56304 gene locus_tag LOCUS_07060 55141 56304 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_07060 56445 56951 gene locus_tag LOCUS_07070 56445 56951 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437086.1 protein_id gnl|my_center|LOCUS_07070 56944 59499 gene locus_tag LOCUS_07080 56944 59499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 60161 59565 gene locus_tag LOCUS_07090 60161 59565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 61084 60191 gene locus_tag LOCUS_07100 61084 60191 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775269.1 protein_id gnl|my_center|LOCUS_07100 61306 65547 gene locus_tag LOCUS_07110 61306 65547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 65716 66297 gene locus_tag LOCUS_07120 65716 66297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence09 2044 662 gene locus_tag LOCUS_07130 gene clpX 2044 662 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700010.1 protein_id gnl|my_center|LOCUS_07130 3698 2124 gene locus_tag LOCUS_07140 3698 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 3965 5392 gene locus_tag LOCUS_07150 3965 5392 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_07150 6298 5444 gene locus_tag LOCUS_07160 6298 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 7416 6295 gene locus_tag LOCUS_07170 7416 6295 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606740.1 protein_id gnl|my_center|LOCUS_07170 8787 7417 gene locus_tag LOCUS_07180 8787 7417 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_07180 11249 8850 gene locus_tag LOCUS_07190 11249 8850 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459887.1 protein_id gnl|my_center|LOCUS_07190 11365 11871 gene locus_tag LOCUS_07200 11365 11871 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864755.1 protein_id gnl|my_center|LOCUS_07200 11891 13888 gene locus_tag LOCUS_07210 11891 13888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 13952 14332 gene locus_tag LOCUS_07220 13952 14332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 14615 14424 gene locus_tag LOCUS_07230 14615 14424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 16434 14629 gene locus_tag LOCUS_07240 16434 14629 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_07240 18027 16549 gene locus_tag LOCUS_07250 gene gltX 18027 16549 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_07250 18717 18106 gene locus_tag LOCUS_07260 18717 18106 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_07260 19575 18838 gene locus_tag LOCUS_07270 19575 18838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 19762 19677 gene locus_tag LOCUS_t00120 19762 19677 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21599 19842 gene locus_tag LOCUS_07280 21599 19842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 22087 21731 gene locus_tag LOCUS_07290 gene rplT 22087 21731 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429730.1 protein_id gnl|my_center|LOCUS_07290 22315 22112 gene locus_tag LOCUS_07300 gene rpmI 22315 22112 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_07300 22828 22334 gene locus_tag LOCUS_07310 gene infC 22828 22334 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860916.1 protein_id gnl|my_center|LOCUS_07310 25317 23098 gene locus_tag LOCUS_07320 25317 23098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 25583 25999 gene locus_tag LOCUS_07330 25583 25999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 26452 25979 gene locus_tag LOCUS_07340 26452 25979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 26771 26469 gene locus_tag LOCUS_07350 26771 26469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 28737 26773 gene locus_tag LOCUS_07360 gene thrS 28737 26773 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_07360 29190 29828 gene locus_tag LOCUS_07370 gene thyX 29190 29828 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393959.1 protein_id gnl|my_center|LOCUS_07370 31144 29936 gene locus_tag LOCUS_07380 31144 29936 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184189.1 protein_id gnl|my_center|LOCUS_07380 32585 31194 gene locus_tag LOCUS_07390 gene radA 32585 31194 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_07390 32751 33242 gene locus_tag LOCUS_07400 32751 33242 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_07400 33232 33828 gene locus_tag LOCUS_07410 33232 33828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 35490 33880 gene locus_tag LOCUS_07420 35490 33880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 37566 35632 gene locus_tag LOCUS_07430 37566 35632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 38946 37642 gene locus_tag LOCUS_07440 38946 37642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 39707 38973 gene locus_tag LOCUS_07450 gene rgbR 39707 38973 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_07450 41089 39740 gene locus_tag LOCUS_07460 41089 39740 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584076.1 protein_id gnl|my_center|LOCUS_07460 42696 41200 gene locus_tag LOCUS_07470 gene araA 42696 41200 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229499.1 protein_id gnl|my_center|LOCUS_07470 43045 42857 gene locus_tag LOCUS_07480 43045 42857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 43787 43101 gene locus_tag LOCUS_07490 43787 43101 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_07490 44407 43802 gene locus_tag LOCUS_07500 44407 43802 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970322.1 protein_id gnl|my_center|LOCUS_07500 46886 44418 gene locus_tag LOCUS_07510 46886 44418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 48012 46876 gene locus_tag LOCUS_07520 48012 46876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 48951 48025 gene locus_tag LOCUS_07530 48951 48025 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989474.1 protein_id gnl|my_center|LOCUS_07530 50371 49118 gene locus_tag LOCUS_07540 50371 49118 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_07540 50525 50397 gene locus_tag LOCUS_07550 50525 50397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 51104 50532 gene locus_tag LOCUS_07560 51104 50532 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840898.1 protein_id gnl|my_center|LOCUS_07560 52513 51119 gene locus_tag LOCUS_07570 52513 51119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 55066 52940 gene locus_tag LOCUS_07580 55066 52940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 56441 55116 gene locus_tag LOCUS_07590 56441 55116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 59235 56545 gene locus_tag LOCUS_07600 59235 56545 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963848.1 protein_id gnl|my_center|LOCUS_07600 59915 59232 gene locus_tag LOCUS_07610 59915 59232 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963847.1 protein_id gnl|my_center|LOCUS_07610 61498 60221 gene locus_tag LOCUS_07620 61498 60221 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860746.1 protein_id gnl|my_center|LOCUS_07620 61822 61580 gene locus_tag LOCUS_07630 61822 61580 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814511.1 protein_id gnl|my_center|LOCUS_07630 63781 62273 gene locus_tag LOCUS_07640 63781 62273 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001347.1 protein_id gnl|my_center|LOCUS_07640 64426 63797 gene locus_tag LOCUS_07650 64426 63797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 64897 64511 gene locus_tag LOCUS_07660 64897 64511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence10 59 141 gene locus_tag LOCUS_t00130 59 141 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 168 243 gene locus_tag LOCUS_t00140 168 243 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 274 346 gene locus_tag LOCUS_t00150 274 346 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 370 444 gene locus_tag LOCUS_t00160 370 444 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1389 601 gene locus_tag LOCUS_07670 1389 601 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922199.1 protein_id gnl|my_center|LOCUS_07670 1546 1947 gene locus_tag LOCUS_07680 1546 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 2147 2536 gene locus_tag LOCUS_07690 2147 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901504.1 protein_id gnl|my_center|LOCUS_07690 2545 2730 gene locus_tag LOCUS_07700 2545 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 2732 4069 gene locus_tag LOCUS_07710 2732 4069 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861032.1 protein_id gnl|my_center|LOCUS_07710 4086 4580 gene locus_tag LOCUS_07720 4086 4580 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429851.1 protein_id gnl|my_center|LOCUS_07720 4623 5054 gene locus_tag LOCUS_07730 4623 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 5238 7328 gene locus_tag LOCUS_07740 5238 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 7328 8059 gene locus_tag LOCUS_07750 7328 8059 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398548.1 protein_id gnl|my_center|LOCUS_07750 8071 9609 gene locus_tag LOCUS_07760 8071 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 9602 9925 gene locus_tag LOCUS_07770 9602 9925 CDS product DUF2577 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817292.1 protein_id gnl|my_center|LOCUS_07770 9922 10371 gene locus_tag LOCUS_07780 9922 10371 CDS product DUF2634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861039.1 protein_id gnl|my_center|LOCUS_07780 10371 11591 gene locus_tag LOCUS_07790 10371 11591 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861040.1 protein_id gnl|my_center|LOCUS_07790 11584 12126 gene locus_tag LOCUS_07800 11584 12126 CDS product YmfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229941.1 protein_id gnl|my_center|LOCUS_07800 12123 13463 gene locus_tag LOCUS_07810 12123 13463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 13565 14281 gene locus_tag LOCUS_07820 13565 14281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 15131 14349 gene locus_tag LOCUS_07830 15131 14349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 16351 15221 gene locus_tag LOCUS_07840 16351 15221 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_07840 16691 16506 gene locus_tag LOCUS_07850 16691 16506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 16811 16966 gene locus_tag LOCUS_07860 16811 16966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 16959 17816 gene locus_tag LOCUS_07870 16959 17816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 17848 18567 gene locus_tag LOCUS_07880 17848 18567 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_07880 18560 20014 gene locus_tag LOCUS_07890 18560 20014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 20175 20873 gene locus_tag LOCUS_07900 20175 20873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 20877 21782 gene locus_tag LOCUS_07910 20877 21782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 21871 22431 gene locus_tag LOCUS_07920 21871 22431 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213184.1 protein_id gnl|my_center|LOCUS_07920 22428 22949 gene locus_tag LOCUS_07930 22428 22949 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963792.1 protein_id gnl|my_center|LOCUS_07930 23072 23413 gene locus_tag LOCUS_07940 23072 23413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 23415 24674 gene locus_tag LOCUS_07950 23415 24674 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447888.1 protein_id gnl|my_center|LOCUS_07950 24849 24715 gene locus_tag LOCUS_07960 24849 24715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 25570 26292 gene locus_tag LOCUS_07970 25570 26292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 26455 27681 gene locus_tag LOCUS_07980 26455 27681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 28506 27739 gene locus_tag LOCUS_07990 gene hag 28506 27739 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_07990 28707 29282 gene locus_tag LOCUS_08000 28707 29282 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924525.1 protein_id gnl|my_center|LOCUS_08000 29284 29796 gene locus_tag LOCUS_08010 29284 29796 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941234.1 protein_id gnl|my_center|LOCUS_08010 30011 30514 gene locus_tag LOCUS_08020 30011 30514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 30655 31578 gene locus_tag LOCUS_08030 30655 31578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 31609 32997 gene locus_tag LOCUS_08040 31609 32997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 33029 34768 gene locus_tag LOCUS_08050 gene iorA 33029 34768 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_08050 34771 35340 gene locus_tag LOCUS_08060 34771 35340 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_08060 35337 36161 gene locus_tag LOCUS_08070 35337 36161 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_08070 36392 36222 gene locus_tag LOCUS_08080 36392 36222 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363046.1 protein_id gnl|my_center|LOCUS_08080 36594 36806 gene locus_tag LOCUS_08090 36594 36806 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_08090 38527 37721 gene locus_tag LOCUS_08100 38527 37721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 38886 39146 gene locus_tag LOCUS_08110 38886 39146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 39169 39327 gene locus_tag LOCUS_08120 39169 39327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 39756 39301 gene locus_tag LOCUS_08130 39756 39301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 40542 39799 gene locus_tag LOCUS_08140 40542 39799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 41399 40560 gene locus_tag LOCUS_08150 41399 40560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 42161 41667 gene locus_tag LOCUS_08160 42161 41667 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_08160 42517 42248 gene locus_tag LOCUS_08170 42517 42248 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_08170 42672 44072 gene locus_tag LOCUS_08180 42672 44072 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_08180 45333 44122 gene locus_tag LOCUS_08190 gene hydF 45333 44122 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_08190 45725 45357 gene locus_tag LOCUS_08200 45725 45357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 45872 46024 gene locus_tag LOCUS_08210 45872 46024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 46928 46053 gene locus_tag LOCUS_08220 46928 46053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 46927 47064 gene locus_tag LOCUS_08230 46927 47064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 47722 47456 gene locus_tag LOCUS_08240 47722 47456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 48767 47904 gene locus_tag LOCUS_08250 gene ispE 48767 47904 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 protein_id gnl|my_center|LOCUS_08250 49038 49574 gene locus_tag LOCUS_08260 49038 49574 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_08260 49580 51298 gene locus_tag LOCUS_08270 49580 51298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 53675 51306 gene locus_tag LOCUS_08280 53675 51306 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_08280 53901 54851 gene locus_tag LOCUS_08290 53901 54851 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_08290 54993 58319 gene locus_tag LOCUS_08300 54993 58319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 58592 60244 gene locus_tag LOCUS_08310 gene rlmD 58592 60244 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_08310 60386 60571 gene locus_tag LOCUS_08320 60386 60571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 60610 61287 gene locus_tag LOCUS_08330 60610 61287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 61394 62257 gene locus_tag LOCUS_08340 61394 62257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 62257 63219 gene locus_tag LOCUS_08350 62257 63219 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108052.1 protein_id gnl|my_center|LOCUS_08350 63257 63394 gene locus_tag LOCUS_08360 63257 63394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence11 881 60 gene locus_tag LOCUS_08370 881 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 2328 1081 gene locus_tag LOCUS_08380 2328 1081 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_08380 2753 2400 gene locus_tag LOCUS_08390 gene spoVAE 2753 2400 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_08390 3819 2755 gene locus_tag LOCUS_08400 gene spoVAD 3819 2755 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_08400 4954 3884 gene locus_tag LOCUS_08410 4954 3884 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061358.1 protein_id gnl|my_center|LOCUS_08410 6043 5309 gene locus_tag LOCUS_08420 6043 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 6978 6082 gene locus_tag LOCUS_08430 6978 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 8171 7116 gene locus_tag LOCUS_08440 8171 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 10321 8306 gene locus_tag LOCUS_08450 10321 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 11173 10466 gene locus_tag LOCUS_08460 11173 10466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 11699 11160 gene locus_tag LOCUS_08470 11699 11160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 12367 11864 gene locus_tag LOCUS_08480 gene spoVAC 12367 11864 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965602.1 protein_id gnl|my_center|LOCUS_08480 12801 12385 gene locus_tag LOCUS_08490 gene spoVAB 12801 12385 CDS product stage V sporulation protein SpoVAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230463.1 protein_id gnl|my_center|LOCUS_08490 13420 12788 gene locus_tag LOCUS_08500 13420 12788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 13578 13399 gene locus_tag LOCUS_08510 13578 13399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 14348 13635 gene locus_tag LOCUS_08520 gene sigF 14348 13635 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860953.1 protein_id gnl|my_center|LOCUS_08520 14801 14361 gene locus_tag LOCUS_08530 gene spoIIAB 14801 14361 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418415.1 protein_id gnl|my_center|LOCUS_08530 15127 14798 gene locus_tag LOCUS_08540 gene spoIIAA 15127 14798 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_08540 16670 15240 gene locus_tag LOCUS_08550 16670 15240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 16842 16699 gene locus_tag LOCUS_08560 16842 16699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 19659 16978 gene locus_tag LOCUS_08570 19659 16978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 20595 19720 gene locus_tag LOCUS_08580 20595 19720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 23266 20615 gene locus_tag LOCUS_08590 23266 20615 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_08590 28594 23597 gene locus_tag LOCUS_08600 28594 23597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 28880 29743 gene locus_tag LOCUS_08610 28880 29743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 31945 29822 gene locus_tag LOCUS_08620 31945 29822 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435700.1 protein_id gnl|my_center|LOCUS_08620 33543 31945 gene locus_tag LOCUS_08630 33543 31945 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_08630 34577 33579 gene locus_tag LOCUS_08640 gene galE 34577 33579 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_08640 35150 34599 gene locus_tag LOCUS_08650 35150 34599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 35419 35147 gene locus_tag LOCUS_08660 gene yajC 35419 35147 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426573.1 protein_id gnl|my_center|LOCUS_08660 36576 35440 gene locus_tag LOCUS_08670 gene tgt 36576 35440 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_08670 38690 36735 gene locus_tag LOCUS_08680 38690 36735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 38806 39252 gene locus_tag LOCUS_08690 38806 39252 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965763.1 protein_id gnl|my_center|LOCUS_08690 39319 39390 gene locus_tag LOCUS_t00170 39319 39390 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 40952 40062 gene locus_tag LOCUS_08700 40952 40062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 41326 40949 gene locus_tag LOCUS_08710 41326 40949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 41840 41316 gene locus_tag LOCUS_08720 41840 41316 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784022.1 protein_id gnl|my_center|LOCUS_08720 43548 41962 gene locus_tag LOCUS_08730 43548 41962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 44824 43580 gene locus_tag LOCUS_08740 44824 43580 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709916.1 protein_id gnl|my_center|LOCUS_08740 44862 45044 gene locus_tag LOCUS_08750 44862 45044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 45080 45586 gene locus_tag LOCUS_08760 45080 45586 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359469.1 protein_id gnl|my_center|LOCUS_08760 46151 45624 gene locus_tag LOCUS_08770 46151 45624 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_08770 46995 46144 gene locus_tag LOCUS_08780 gene metF 46995 46144 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_08780 48010 47036 gene locus_tag LOCUS_08790 gene pta 48010 47036 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243393.1 protein_id gnl|my_center|LOCUS_08790 49816 48134 gene locus_tag LOCUS_08800 49816 48134 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_08800 51181 49985 gene locus_tag LOCUS_08810 51181 49985 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948693.1 protein_id gnl|my_center|LOCUS_08810 52519 51209 gene locus_tag LOCUS_08820 52519 51209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 53340 52546 gene locus_tag LOCUS_08830 gene thiD 53340 52546 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_08830 53960 53379 gene locus_tag LOCUS_08840 53960 53379 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_08840 55046 54102 gene locus_tag LOCUS_08850 55046 54102 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966723.1 protein_id gnl|my_center|LOCUS_08850 55819 55043 gene locus_tag LOCUS_08860 55819 55043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 57202 55829 gene locus_tag LOCUS_08870 57202 55829 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966615.1 protein_id gnl|my_center|LOCUS_08870 58660 57290 gene locus_tag LOCUS_08880 58660 57290 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_08880 58734 59174 gene locus_tag LOCUS_08890 58734 59174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 59098 59424 gene locus_tag LOCUS_08900 59098 59424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 59430 59588 gene locus_tag LOCUS_08910 59430 59588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 60352 59915 gene locus_tag LOCUS_08920 60352 59915 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022471380.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence12 290 925 gene locus_tag LOCUS_08930 290 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 1889 1011 gene locus_tag LOCUS_08940 1889 1011 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_08940 2053 2526 gene locus_tag LOCUS_08950 2053 2526 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_08950 2550 4586 gene locus_tag LOCUS_08960 2550 4586 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068658.1 protein_id gnl|my_center|LOCUS_08960 5507 4719 gene locus_tag LOCUS_08970 5507 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 5670 6734 gene locus_tag LOCUS_08980 gene rsmH 5670 6734 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_08980 6809 7393 gene locus_tag LOCUS_08990 6809 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 7479 8324 gene locus_tag LOCUS_09000 7479 8324 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892675.1 protein_id gnl|my_center|LOCUS_09000 8346 10151 gene locus_tag LOCUS_09010 8346 10151 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015263574.1 protein_id gnl|my_center|LOCUS_09010 10267 10416 gene locus_tag LOCUS_09020 gene scfA 10267 10416 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_09020 10593 11987 gene locus_tag LOCUS_09030 gene scfB 10593 11987 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_09030 12108 13109 gene locus_tag LOCUS_09040 12108 13109 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356149.1 protein_id gnl|my_center|LOCUS_09040 13150 13929 gene locus_tag LOCUS_09050 gene flgF 13150 13929 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392318.1 protein_id gnl|my_center|LOCUS_09050 13969 14778 gene locus_tag LOCUS_09060 gene flgG 13969 14778 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_09060 14800 15162 gene locus_tag LOCUS_09070 14800 15162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 15253 17484 gene locus_tag LOCUS_09080 15253 17484 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_09080 17587 18303 gene locus_tag LOCUS_09090 17587 18303 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083041.1 protein_id gnl|my_center|LOCUS_09090 18320 18733 gene locus_tag LOCUS_09100 18320 18733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 19628 18771 gene locus_tag LOCUS_09110 19628 18771 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986367.1 protein_id gnl|my_center|LOCUS_09110 19807 20187 gene locus_tag LOCUS_09120 19807 20187 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_09120 20530 20204 gene locus_tag LOCUS_09130 20530 20204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 20819 20625 gene locus_tag LOCUS_09140 20819 20625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 21130 22587 gene locus_tag LOCUS_09150 21130 22587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 22981 23508 gene locus_tag LOCUS_09160 gene raiA 22981 23508 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_09160 23702 26266 gene locus_tag LOCUS_09170 gene secA 23702 26266 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966131.1 protein_id gnl|my_center|LOCUS_09170 26422 27405 gene locus_tag LOCUS_09180 gene prfB 26422 27405 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226186.1 protein_id gnl|my_center|LOCUS_09180 27425 27898 gene locus_tag LOCUS_09190 27425 27898 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200285.1 protein_id gnl|my_center|LOCUS_09190 27891 29096 gene locus_tag LOCUS_09200 27891 29096 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_09200 29581 29222 gene locus_tag LOCUS_09210 29581 29222 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 protein_id gnl|my_center|LOCUS_09210 30468 29599 gene locus_tag LOCUS_09220 30468 29599 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942263.1 protein_id gnl|my_center|LOCUS_09220 30551 31657 gene locus_tag LOCUS_09230 gene aroC 30551 31657 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_09230 31692 31874 gene locus_tag LOCUS_09240 31692 31874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 33170 31941 gene locus_tag LOCUS_09250 33170 31941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 34111 33167 gene locus_tag LOCUS_09260 34111 33167 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058115.1 protein_id gnl|my_center|LOCUS_09260 34581 34327 gene locus_tag LOCUS_09270 34581 34327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 34775 36055 gene locus_tag LOCUS_09280 gene nagZ 34775 36055 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_09280 36075 37535 gene locus_tag LOCUS_09290 gene purF 36075 37535 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_09290 37580 39034 gene locus_tag LOCUS_09300 gene purB 37580 39034 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_09300 39061 39927 gene locus_tag LOCUS_09310 39061 39927 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_09310 39934 40206 gene locus_tag LOCUS_09320 39934 40206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 40216 40614 gene locus_tag LOCUS_09330 40216 40614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 41028 41348 gene locus_tag LOCUS_09340 gene rpsJ 41028 41348 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860633.1 protein_id gnl|my_center|LOCUS_09340 41535 42164 gene locus_tag LOCUS_09350 gene rplC 41535 42164 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_09350 42190 42810 gene locus_tag LOCUS_09360 gene rplD 42190 42810 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966411.1 protein_id gnl|my_center|LOCUS_09360 42810 43109 gene locus_tag LOCUS_09370 gene rplW 42810 43109 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_09370 43200 44045 gene locus_tag LOCUS_09380 gene rplB 43200 44045 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_09380 44082 44354 gene locus_tag LOCUS_09390 gene rpsS 44082 44354 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638064.1 protein_id gnl|my_center|LOCUS_09390 44375 44761 gene locus_tag LOCUS_09400 gene rplV 44375 44761 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549029.1 protein_id gnl|my_center|LOCUS_09400 44777 45457 gene locus_tag LOCUS_09410 gene rpsC 44777 45457 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_09410 45457 45894 gene locus_tag LOCUS_09420 gene rplP 45457 45894 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_09420 45884 46093 gene locus_tag LOCUS_09430 gene rpmC 45884 46093 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701313.1 protein_id gnl|my_center|LOCUS_09430 46117 46371 gene locus_tag LOCUS_09440 gene rpsQ 46117 46371 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_09440 46440 46808 gene locus_tag LOCUS_09450 gene rplN 46440 46808 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403649.1 protein_id gnl|my_center|LOCUS_09450 46823 47131 gene locus_tag LOCUS_09460 gene rplX 46823 47131 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390427.1 protein_id gnl|my_center|LOCUS_09460 47155 47694 gene locus_tag LOCUS_09470 gene rplE 47155 47694 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_09470 47710 47895 gene locus_tag LOCUS_09480 47710 47895 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_09480 47911 48312 gene locus_tag LOCUS_09490 gene rpsH 47911 48312 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_09490 48413 48955 gene locus_tag LOCUS_09500 gene rplF 48413 48955 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_09500 48972 49340 gene locus_tag LOCUS_09510 gene rplR 48972 49340 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_09510 49356 49865 gene locus_tag LOCUS_09520 gene rpsE 49356 49865 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421138.1 protein_id gnl|my_center|LOCUS_09520 49879 50061 gene locus_tag LOCUS_09530 gene rpmD 49879 50061 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096577.1 protein_id gnl|my_center|LOCUS_09530 50079 50519 gene locus_tag LOCUS_09540 gene rplO 50079 50519 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966393.1 protein_id gnl|my_center|LOCUS_09540 50519 51853 gene locus_tag LOCUS_09550 gene secY 50519 51853 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_09550 51964 52608 gene locus_tag LOCUS_09560 51964 52608 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_09560 52611 53366 gene locus_tag LOCUS_09570 gene map 52611 53366 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_09570 53389 53607 gene locus_tag LOCUS_09580 gene infA 53389 53607 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_09580 54247 54615 gene locus_tag LOCUS_09590 gene rpsM 54247 54615 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_09590 54634 55029 gene locus_tag LOCUS_09600 gene rpsK 54634 55029 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_09600 55118 55711 gene locus_tag LOCUS_09610 gene rpsD 55118 55711 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_09610 55741 56706 gene locus_tag LOCUS_09620 55741 56706 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_09620 56731 57267 gene locus_tag LOCUS_09630 56731 57267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 57333 58199 gene locus_tag LOCUS_09640 57333 58199 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_09640 58196 59047 gene locus_tag LOCUS_09650 58196 59047 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_09650 59051 59857 gene locus_tag LOCUS_09660 59051 59857 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_09660 59872 60618 gene locus_tag LOCUS_09670 gene truA 59872 60618 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence13 2801 3994 gene locus_tag LOCUS_09680 2801 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 4076 4279 gene locus_tag LOCUS_09690 4076 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 4798 4604 gene locus_tag LOCUS_09700 4798 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 4824 5201 gene locus_tag LOCUS_09710 4824 5201 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_09710 5201 5536 gene locus_tag LOCUS_09720 5201 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 5538 5906 gene locus_tag LOCUS_09730 5538 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 5910 6320 gene locus_tag LOCUS_09740 5910 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 6317 6514 gene locus_tag LOCUS_09750 6317 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 6652 8532 gene locus_tag LOCUS_09760 6652 8532 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031832.1 protein_id gnl|my_center|LOCUS_09760 8533 10230 gene locus_tag LOCUS_09770 8533 10230 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031832.1 protein_id gnl|my_center|LOCUS_09770 10361 11785 gene locus_tag LOCUS_09780 gene cysS 10361 11785 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_09780 11806 12177 gene locus_tag LOCUS_09790 11806 12177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 12404 14995 gene locus_tag LOCUS_09800 12404 14995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 16030 15056 gene locus_tag LOCUS_09810 16030 15056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 16246 17277 gene locus_tag LOCUS_09820 gene purM 16246 17277 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262439.1 protein_id gnl|my_center|LOCUS_09820 17271 17912 gene locus_tag LOCUS_09830 gene purN 17271 17912 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_09830 17909 19180 gene locus_tag LOCUS_09840 gene purD 17909 19180 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436062.1 protein_id gnl|my_center|LOCUS_09840 19199 20437 gene locus_tag LOCUS_09850 19199 20437 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_09850 20538 21626 gene locus_tag LOCUS_09860 20538 21626 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_09860 21616 22308 gene locus_tag LOCUS_09870 21616 22308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 22314 22961 gene locus_tag LOCUS_09880 22314 22961 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964931.1 protein_id gnl|my_center|LOCUS_09880 22964 25003 gene locus_tag LOCUS_09890 22964 25003 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_09890 25000 25854 gene locus_tag LOCUS_09900 25000 25854 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_09900 25851 26876 gene locus_tag LOCUS_09910 25851 26876 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 protein_id gnl|my_center|LOCUS_09910 27029 27205 gene locus_tag LOCUS_09920 27029 27205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 27362 27619 gene locus_tag LOCUS_09930 27362 27619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 27636 28871 gene locus_tag LOCUS_09940 27636 28871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 28876 29937 gene locus_tag LOCUS_09950 28876 29937 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_09950 29934 30431 gene locus_tag LOCUS_09960 gene ybeY 29934 30431 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047996.1 protein_id gnl|my_center|LOCUS_09960 30454 31572 gene locus_tag LOCUS_09970 30454 31572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 31580 33247 gene locus_tag LOCUS_09980 31580 33247 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_09980 33350 34102 gene locus_tag LOCUS_09990 33350 34102 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_09990 34096 34758 gene locus_tag LOCUS_10000 34096 34758 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_10000 34769 36160 gene locus_tag LOCUS_10010 34769 36160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 36696 36265 gene locus_tag LOCUS_10020 36696 36265 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_10020 37613 36684 gene locus_tag LOCUS_10030 gene pyrB 37613 36684 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_10030 37824 40109 gene locus_tag LOCUS_10040 37824 40109 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593936.1 protein_id gnl|my_center|LOCUS_10040 40303 40680 gene locus_tag LOCUS_10050 40303 40680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 40665 41204 gene locus_tag LOCUS_10060 40665 41204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 41322 42332 gene locus_tag LOCUS_10070 41322 42332 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_10070 42359 44113 gene locus_tag LOCUS_10080 gene dnaG 42359 44113 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_10080 44129 45262 gene locus_tag LOCUS_10090 gene rpoD 44129 45262 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_10090 45262 45975 gene locus_tag LOCUS_10100 45262 45975 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964614.1 protein_id gnl|my_center|LOCUS_10100 45998 47647 gene locus_tag LOCUS_10110 45998 47647 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080960.1 protein_id gnl|my_center|LOCUS_10110 48035 50011 gene locus_tag LOCUS_10120 48035 50011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 50027 50539 gene locus_tag LOCUS_10130 gene purE 50027 50539 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_10130 51878 50682 gene locus_tag LOCUS_10140 gene dacF 51878 50682 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_10140 52105 54099 gene locus_tag LOCUS_10150 52105 54099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 54134 54964 gene locus_tag LOCUS_10160 54134 54964 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888897.1 protein_id gnl|my_center|LOCUS_10160 55076 56491 gene locus_tag LOCUS_10170 55076 56491 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_10170 56527 57675 gene locus_tag LOCUS_10180 56527 57675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence14 154 570 gene locus_tag LOCUS_10190 154 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 567 1580 gene locus_tag LOCUS_10200 567 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1605 2486 gene locus_tag LOCUS_10210 gene cdaA 1605 2486 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 protein_id gnl|my_center|LOCUS_10210 2464 3723 gene locus_tag LOCUS_10220 gene cdaR 2464 3723 CDS product CdaA regulatory protein CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234947.1 protein_id gnl|my_center|LOCUS_10220 5354 3846 gene locus_tag LOCUS_10230 5354 3846 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_10230 5556 6368 gene locus_tag LOCUS_10240 5556 6368 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181141871.1 protein_id gnl|my_center|LOCUS_10240 6381 7133 gene locus_tag LOCUS_10250 6381 7133 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_10250 7163 7555 gene locus_tag LOCUS_10260 gene tagD 7163 7555 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643222.1 protein_id gnl|my_center|LOCUS_10260 7560 8675 gene locus_tag LOCUS_10270 7560 8675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 8740 10272 gene locus_tag LOCUS_10280 gene cps4A 8740 10272 CDS product capsular polysaccharide biosynthesis protein Cps4A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091050.1 protein_id gnl|my_center|LOCUS_10280 10337 11584 gene locus_tag LOCUS_10290 10337 11584 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609547.1 protein_id gnl|my_center|LOCUS_10290 11556 12239 gene locus_tag LOCUS_10300 11556 12239 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922186.1 protein_id gnl|my_center|LOCUS_10300 12241 13743 gene locus_tag LOCUS_10310 12241 13743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 13740 15263 gene locus_tag LOCUS_10320 13740 15263 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905675.1 protein_id gnl|my_center|LOCUS_10320 15330 16814 gene locus_tag LOCUS_10330 15330 16814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484949.1 protein_id gnl|my_center|LOCUS_10330 19815 16909 gene locus_tag LOCUS_10340 19815 16909 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721496.1 protein_id gnl|my_center|LOCUS_10340 20038 22875 gene locus_tag LOCUS_10350 20038 22875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 22862 23905 gene locus_tag LOCUS_10360 22862 23905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 25402 23915 gene locus_tag LOCUS_10370 25402 23915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 25639 26592 gene locus_tag LOCUS_10380 25639 26592 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_10380 27537 26602 gene locus_tag LOCUS_10390 27537 26602 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_10390 28092 27553 gene locus_tag LOCUS_10400 28092 27553 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464126.1 protein_id gnl|my_center|LOCUS_10400 28450 28109 gene locus_tag LOCUS_10410 28450 28109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 28802 28443 gene locus_tag LOCUS_10420 28802 28443 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805125.1 protein_id gnl|my_center|LOCUS_10420 29955 28825 gene locus_tag LOCUS_10430 gene rffA 29955 28825 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612044.1 protein_id gnl|my_center|LOCUS_10430 31579 31992 gene locus_tag LOCUS_10440 31579 31992 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343395.1 protein_id gnl|my_center|LOCUS_10440 31997 32938 gene locus_tag LOCUS_10450 31997 32938 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771391.1 protein_id gnl|my_center|LOCUS_10450 32935 33462 gene locus_tag LOCUS_10460 gene speG 32935 33462 CDS product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422431.1 protein_id gnl|my_center|LOCUS_10460 33485 34579 gene locus_tag LOCUS_10470 33485 34579 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_10470 34648 35808 gene locus_tag LOCUS_10480 34648 35808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 35828 37396 gene locus_tag LOCUS_10490 35828 37396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 37406 37927 gene locus_tag LOCUS_10500 37406 37927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 37993 38703 gene locus_tag LOCUS_10510 37993 38703 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721503.1 protein_id gnl|my_center|LOCUS_10510 38740 39765 gene locus_tag LOCUS_10520 38740 39765 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610180.1 protein_id gnl|my_center|LOCUS_10520 39781 41256 gene locus_tag LOCUS_10530 39781 41256 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968267.1 protein_id gnl|my_center|LOCUS_10530 41237 42427 gene locus_tag LOCUS_10540 41237 42427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 43002 42496 gene locus_tag LOCUS_10550 gene kdsC 43002 42496 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369496.1 protein_id gnl|my_center|LOCUS_10550 44627 42999 gene locus_tag LOCUS_10560 44627 42999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 45358 44624 gene locus_tag LOCUS_10570 gene kdsB 45358 44624 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_10570 46628 45363 gene locus_tag LOCUS_10580 46628 45363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 46771 47745 gene locus_tag LOCUS_10590 46771 47745 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_10590 47717 48199 gene locus_tag LOCUS_10600 47717 48199 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_10600 49316 48216 gene locus_tag LOCUS_10610 49316 48216 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016893.1 protein_id gnl|my_center|LOCUS_10610 49440 50498 gene locus_tag LOCUS_10620 49440 50498 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096185.1 protein_id gnl|my_center|LOCUS_10620 50479 51360 gene locus_tag LOCUS_10630 50479 51360 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061983.1 protein_id gnl|my_center|LOCUS_10630 51373 52257 gene locus_tag LOCUS_10640 51373 52257 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061983.1 protein_id gnl|my_center|LOCUS_10640 52289 54226 gene locus_tag LOCUS_10650 52289 54226 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_10650 54226 55206 gene locus_tag LOCUS_10660 54226 55206 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964711.1 protein_id gnl|my_center|LOCUS_10660 <57020 55173 gene locus_tag LOCUS_10670 <57020 55173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986883.1:translational GTPase TypA >Feature sequence15 <1 515 gene locus_tag LOCUS_10680 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000911797.1:SDR family oxidoreductase 512 2497 gene locus_tag LOCUS_10690 512 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 2518 3606 gene locus_tag LOCUS_10700 2518 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 3593 4873 gene locus_tag LOCUS_10710 3593 4873 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942610.1 protein_id gnl|my_center|LOCUS_10710 4903 6534 gene locus_tag LOCUS_10720 4903 6534 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986975.1 protein_id gnl|my_center|LOCUS_10720 6550 7602 gene locus_tag LOCUS_10730 6550 7602 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986974.1 protein_id gnl|my_center|LOCUS_10730 8596 7604 gene locus_tag LOCUS_10740 8596 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 8759 9946 gene locus_tag LOCUS_10750 8759 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 11317 10022 gene locus_tag LOCUS_10760 gene aepX 11317 10022 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202933.1 protein_id gnl|my_center|LOCUS_10760 12478 11360 gene locus_tag LOCUS_10770 gene aepY 12478 11360 CDS product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679014.1 protein_id gnl|my_center|LOCUS_10770 13188 12475 gene locus_tag LOCUS_10780 13188 12475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 14366 13212 gene locus_tag LOCUS_10790 14366 13212 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202611.1 protein_id gnl|my_center|LOCUS_10790 16309 14399 gene locus_tag LOCUS_10800 16309 14399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 18675 16342 gene locus_tag LOCUS_10810 18675 16342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 19645 18830 gene locus_tag LOCUS_10820 19645 18830 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987022.1 protein_id gnl|my_center|LOCUS_10820 20339 19845 gene locus_tag LOCUS_10830 20339 19845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 20737 20360 gene locus_tag LOCUS_10840 gene fliS 20737 20360 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 protein_id gnl|my_center|LOCUS_10840 22844 20790 gene locus_tag LOCUS_10850 22844 20790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 23279 22857 gene locus_tag LOCUS_10860 23279 22857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 23617 23396 gene locus_tag LOCUS_10870 gene csrA 23617 23396 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667708.1 protein_id gnl|my_center|LOCUS_10870 24074 23622 gene locus_tag LOCUS_10880 gene fliW 24074 23622 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987029.1 protein_id gnl|my_center|LOCUS_10880 25608 24103 gene locus_tag LOCUS_10890 25608 24103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 27538 25640 gene locus_tag LOCUS_10900 27538 25640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 29371 27551 gene locus_tag LOCUS_10910 29371 27551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 29944 29429 gene locus_tag LOCUS_10920 29944 29429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 30257 29988 gene locus_tag LOCUS_10930 30257 29988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 30397 30254 gene locus_tag LOCUS_10940 30397 30254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 32672 30399 gene locus_tag LOCUS_10950 gene gyrA 32672 30399 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_10950 34622 32688 gene locus_tag LOCUS_10960 gene gyrB 34622 32688 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_10960 36040 34748 gene locus_tag LOCUS_10970 36040 34748 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943646.1 protein_id gnl|my_center|LOCUS_10970 36744 36034 gene locus_tag LOCUS_10980 36744 36034 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461247.1 protein_id gnl|my_center|LOCUS_10980 38195 36756 gene locus_tag LOCUS_10990 38195 36756 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794794.1 protein_id gnl|my_center|LOCUS_10990 39275 38403 gene locus_tag LOCUS_11000 39275 38403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 39758 39354 gene locus_tag LOCUS_11010 39758 39354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 40736 39786 gene locus_tag LOCUS_11020 gene dusB 40736 39786 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_11020 41538 40762 gene locus_tag LOCUS_11030 41538 40762 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814936.1 protein_id gnl|my_center|LOCUS_11030 41897 41541 gene locus_tag LOCUS_11040 41897 41541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 43272 41902 gene locus_tag LOCUS_11050 43272 41902 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_11050 44278 43295 gene locus_tag LOCUS_11060 gene argF 44278 43295 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_11060 45247 44297 gene locus_tag LOCUS_11070 45247 44297 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_11070 45752 45318 gene locus_tag LOCUS_11080 45752 45318 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080739.1 protein_id gnl|my_center|LOCUS_11080 46683 45874 gene locus_tag LOCUS_11090 46683 45874 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_11090 48046 46664 gene locus_tag LOCUS_11100 48046 46664 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582535.1 protein_id gnl|my_center|LOCUS_11100 48491 48069 gene locus_tag LOCUS_11110 48491 48069 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367049.1 protein_id gnl|my_center|LOCUS_11110 49681 48605 gene locus_tag LOCUS_11120 gene prfA 49681 48605 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_11120 50517 49681 gene locus_tag LOCUS_11130 gene prmC 50517 49681 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_11130 51578 50514 gene locus_tag LOCUS_11140 51578 50514 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947980.1 protein_id gnl|my_center|LOCUS_11140 51868 51668 gene locus_tag LOCUS_11150 gene rpmE 51868 51668 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence16 2075 60 gene locus_tag LOCUS_11160 2075 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 2605 2411 gene locus_tag LOCUS_11170 2605 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 3146 2595 gene locus_tag LOCUS_11180 3146 2595 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869257.1 protein_id gnl|my_center|LOCUS_11180 3457 3284 gene locus_tag LOCUS_11190 3457 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 4889 3441 gene locus_tag LOCUS_11200 4889 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 5430 4861 gene locus_tag LOCUS_11210 5430 4861 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_11210 6772 5471 gene locus_tag LOCUS_11220 6772 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 7709 6804 gene locus_tag LOCUS_11230 gene cysK 7709 6804 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_11230 8096 7725 gene locus_tag LOCUS_11240 8096 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 9031 8204 gene locus_tag LOCUS_11250 9031 8204 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860835.1 protein_id gnl|my_center|LOCUS_11250 10797 9064 gene locus_tag LOCUS_11260 10797 9064 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_11260 12534 10798 gene locus_tag LOCUS_11270 12534 10798 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_11270 13239 12625 gene locus_tag LOCUS_11280 13239 12625 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048232.1 protein_id gnl|my_center|LOCUS_11280 15297 13279 gene locus_tag LOCUS_11290 15297 13279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 17406 15328 gene locus_tag LOCUS_11300 17406 15328 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_11300 17790 17611 gene locus_tag LOCUS_11310 17790 17611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 18139 17807 gene locus_tag LOCUS_11320 18139 17807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 18329 18021 gene locus_tag LOCUS_11330 18329 18021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 21872 18468 gene locus_tag LOCUS_11340 21872 18468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 23623 22091 gene locus_tag LOCUS_11350 23623 22091 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104950.1 protein_id gnl|my_center|LOCUS_11350 23713 24633 gene locus_tag LOCUS_11360 23713 24633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 27004 24644 gene locus_tag LOCUS_11370 27004 24644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 28046 26991 gene locus_tag LOCUS_11380 28046 26991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 29006 28077 gene locus_tag LOCUS_11390 29006 28077 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_11390 31324 29078 gene locus_tag LOCUS_11400 gene glgP 31324 29078 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950158.1 protein_id gnl|my_center|LOCUS_11400 31655 31440 gene locus_tag LOCUS_11410 31655 31440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 31935 31657 gene locus_tag LOCUS_11420 31935 31657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 33265 31910 gene locus_tag LOCUS_11430 33265 31910 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_11430 34690 33281 gene locus_tag LOCUS_11440 gene pyk 34690 33281 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_11440 35855 34728 gene locus_tag LOCUS_11450 35855 34728 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793731.1 protein_id gnl|my_center|LOCUS_11450 37568 36093 gene locus_tag LOCUS_11460 gene spoIVA 37568 36093 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_11460 38302 37658 gene locus_tag LOCUS_11470 38302 37658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 40854 38353 gene locus_tag LOCUS_11480 40854 38353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 42104 40971 gene locus_tag LOCUS_11490 42104 40971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 43235 42228 gene locus_tag LOCUS_11500 43235 42228 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_11500 43931 43251 gene locus_tag LOCUS_11510 gene plsY 43931 43251 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_11510 45260 43935 gene locus_tag LOCUS_11520 gene der 45260 43935 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_11520 45686 45327 gene locus_tag LOCUS_11530 45686 45327 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546712.1 protein_id gnl|my_center|LOCUS_11530 45986 45696 gene locus_tag LOCUS_11540 45986 45696 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392518.1 protein_id gnl|my_center|LOCUS_11540 46767 45940 gene locus_tag LOCUS_11550 46767 45940 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_11550 49557 46786 gene locus_tag LOCUS_11560 49557 46786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 50261 49572 gene locus_tag LOCUS_11570 50261 49572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence17 765 46 gene locus_tag LOCUS_11580 765 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1751 918 gene locus_tag LOCUS_11590 1751 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 2346 1933 gene locus_tag LOCUS_11600 2346 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4987 2507 gene locus_tag LOCUS_11610 gene clpC 4987 2507 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 protein_id gnl|my_center|LOCUS_11610 6269 4965 gene locus_tag LOCUS_11620 6269 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 8166 6283 gene locus_tag LOCUS_11630 8166 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 8917 8156 gene locus_tag LOCUS_11640 8917 8156 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229973.1 protein_id gnl|my_center|LOCUS_11640 12537 8944 gene locus_tag LOCUS_11650 gene addA 12537 8944 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233100.1 protein_id gnl|my_center|LOCUS_11650 15925 12512 gene locus_tag LOCUS_11660 gene addB 15925 12512 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_11660 15996 16445 gene locus_tag LOCUS_11670 15996 16445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 18359 16416 gene locus_tag LOCUS_11680 18359 16416 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_11680 20168 18711 gene locus_tag LOCUS_11690 20168 18711 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943962.1 protein_id gnl|my_center|LOCUS_11690 20872 20183 gene locus_tag LOCUS_11700 20872 20183 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459569.1 protein_id gnl|my_center|LOCUS_11700 21080 21793 gene locus_tag LOCUS_11710 21080 21793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 22674 21880 gene locus_tag LOCUS_11720 22674 21880 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_11720 23268 22693 gene locus_tag LOCUS_11730 gene rsxA 23268 22693 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_11730 23909 23268 gene locus_tag LOCUS_11740 23909 23268 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948148.1 protein_id gnl|my_center|LOCUS_11740 24556 23909 gene locus_tag LOCUS_11750 24556 23909 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_11750 25550 24549 gene locus_tag LOCUS_11760 25550 24549 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_11760 26906 25581 gene locus_tag LOCUS_11770 gene rsxC 26906 25581 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_11770 28465 27083 gene locus_tag LOCUS_11780 28465 27083 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_11780 31164 28483 gene locus_tag LOCUS_11790 31164 28483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 32333 31161 gene locus_tag LOCUS_11800 32333 31161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 32736 32455 gene locus_tag LOCUS_11810 gene spoIIID 32736 32455 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_11810 32950 33408 gene locus_tag LOCUS_11820 32950 33408 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963521.1 protein_id gnl|my_center|LOCUS_11820 33412 34071 gene locus_tag LOCUS_11830 33412 34071 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_11830 34868 34068 gene locus_tag LOCUS_11840 gene thiM 34868 34068 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_11840 35207 34893 gene locus_tag LOCUS_11850 35207 34893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 37010 35391 gene locus_tag LOCUS_11860 37010 35391 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_11860 38085 37126 gene locus_tag LOCUS_11870 38085 37126 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_11870 39883 38180 gene locus_tag LOCUS_11880 39883 38180 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_11880 41099 39912 gene locus_tag LOCUS_11890 41099 39912 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020474.1 protein_id gnl|my_center|LOCUS_11890 41803 41153 gene locus_tag LOCUS_11900 41803 41153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 42946 41810 gene locus_tag LOCUS_11910 42946 41810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 47987 42930 gene locus_tag LOCUS_11920 47987 42930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 49342 48302 gene locus_tag LOCUS_11930 49342 48302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence18 357 268 gene locus_tag LOCUS_t00180 357 268 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2009 468 gene locus_tag LOCUS_11940 2009 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 2746 2177 gene locus_tag LOCUS_11950 2746 2177 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158303423.1 protein_id gnl|my_center|LOCUS_11950 3588 2746 gene locus_tag LOCUS_11960 3588 2746 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_11960 6121 3575 gene locus_tag LOCUS_11970 gene gyrA 6121 3575 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_11970 8072 6147 gene locus_tag LOCUS_11980 gene gyrB 8072 6147 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_11980 9188 8100 gene locus_tag LOCUS_11990 gene recF 9188 8100 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_11990 9397 9185 gene locus_tag LOCUS_12000 gene yaaA 9397 9185 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701414.1 protein_id gnl|my_center|LOCUS_12000 10518 9418 gene locus_tag LOCUS_12010 gene dnaN 10518 9418 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_12010 12155 10782 gene locus_tag LOCUS_12020 gene dnaA 12155 10782 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_12020 12373 12507 gene locus_tag LOCUS_12030 12373 12507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 12553 12882 gene locus_tag LOCUS_12040 gene rnpA 12553 12882 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_12040 13125 14126 gene locus_tag LOCUS_12050 13125 14126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 14142 14873 gene locus_tag LOCUS_12060 14142 14873 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966995.1 protein_id gnl|my_center|LOCUS_12060 14981 16366 gene locus_tag LOCUS_12070 gene mnmE 14981 16366 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 protein_id gnl|my_center|LOCUS_12070 16401 18290 gene locus_tag LOCUS_12080 gene mnmG 16401 18290 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_12080 18298 19002 gene locus_tag LOCUS_12090 gene rsmG 18298 19002 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462328.1 protein_id gnl|my_center|LOCUS_12090 19232 19999 gene locus_tag LOCUS_12100 19232 19999 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_12100 19999 20883 gene locus_tag LOCUS_12110 19999 20883 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_12110 20913 21416 gene locus_tag LOCUS_12120 20913 21416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 21578 21505 gene locus_tag LOCUS_t00190 21578 21505 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 21673 22836 gene locus_tag LOCUS_12130 21673 22836 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359094.1 protein_id gnl|my_center|LOCUS_12130 23657 23010 gene locus_tag LOCUS_12140 gene trmB 23657 23010 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723580.1 protein_id gnl|my_center|LOCUS_12140 23815 25221 gene locus_tag LOCUS_12150 23815 25221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 26525 25305 gene locus_tag LOCUS_12160 gene tyrS 26525 25305 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_12160 28696 26546 gene locus_tag LOCUS_12170 28696 26546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 29332 28889 gene locus_tag LOCUS_12180 29332 28889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 30070 29345 gene locus_tag LOCUS_12190 30070 29345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 30282 31361 gene locus_tag LOCUS_12200 30282 31361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 31599 31772 gene locus_tag LOCUS_12210 31599 31772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 31899 31827 gene locus_tag LOCUS_t00200 31899 31827 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 33128 31947 gene locus_tag LOCUS_12220 gene metK 33128 31947 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163127.1 protein_id gnl|my_center|LOCUS_12220 33458 34444 gene locus_tag LOCUS_12230 33458 34444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 34449 35153 gene locus_tag LOCUS_12240 34449 35153 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_12240 35244 36242 gene locus_tag LOCUS_12250 gene ytvI 35244 36242 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440267.1 protein_id gnl|my_center|LOCUS_12250 36684 36244 gene locus_tag LOCUS_12260 36684 36244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 38623 36689 gene locus_tag LOCUS_12270 38623 36689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 39070 38645 gene locus_tag LOCUS_12280 39070 38645 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966530.1 protein_id gnl|my_center|LOCUS_12280 39270 39094 gene locus_tag LOCUS_12290 39270 39094 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405297.1 protein_id gnl|my_center|LOCUS_12290 39393 40811 gene locus_tag LOCUS_12300 gene spoVAF 39393 40811 CDS product spore germination protein SpoVAF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230471.1 protein_id gnl|my_center|LOCUS_12300 41681 40818 gene locus_tag LOCUS_12310 41681 40818 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967756.1 protein_id gnl|my_center|LOCUS_12310 41932 43983 gene locus_tag LOCUS_12320 41932 43983 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575935.1 protein_id gnl|my_center|LOCUS_12320 44131 44982 gene locus_tag LOCUS_12330 44131 44982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 44997 45680 gene locus_tag LOCUS_12340 44997 45680 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761471.1 protein_id gnl|my_center|LOCUS_12340 45886 45731 gene locus_tag LOCUS_12350 45886 45731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 46038 46580 gene locus_tag LOCUS_12360 46038 46580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 47389 46604 gene locus_tag LOCUS_12370 47389 46604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence19 152 1045 gene locus_tag LOCUS_12380 152 1045 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722230.1 protein_id gnl|my_center|LOCUS_12380 2166 1063 gene locus_tag LOCUS_12390 2166 1063 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989842.1 protein_id gnl|my_center|LOCUS_12390 2380 4554 gene locus_tag LOCUS_12400 2380 4554 CDS product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944118.1 protein_id gnl|my_center|LOCUS_12400 5295 4564 gene locus_tag LOCUS_12410 5295 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 5508 7412 gene locus_tag LOCUS_12420 5508 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 11747 7494 gene locus_tag LOCUS_12430 11747 7494 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484061.1 protein_id gnl|my_center|LOCUS_12430 11967 12584 gene locus_tag LOCUS_12440 11967 12584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 12691 13617 gene locus_tag LOCUS_12450 12691 13617 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054371.1 protein_id gnl|my_center|LOCUS_12450 13690 14583 gene locus_tag LOCUS_12460 13690 14583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 14627 17851 gene locus_tag LOCUS_12470 14627 17851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 17888 19273 gene locus_tag LOCUS_12480 17888 19273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 19330 19686 gene locus_tag LOCUS_12490 19330 19686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 19691 20545 gene locus_tag LOCUS_12500 19691 20545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 20545 20937 gene locus_tag LOCUS_12510 20545 20937 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461818.1 protein_id gnl|my_center|LOCUS_12510 21127 21312 gene locus_tag LOCUS_12520 gene rpmB 21127 21312 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416297.1 protein_id gnl|my_center|LOCUS_12520 21687 22799 gene locus_tag LOCUS_12530 gene ribD 21687 22799 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905672.1 protein_id gnl|my_center|LOCUS_12530 22781 23431 gene locus_tag LOCUS_12540 22781 23431 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_12540 23502 24710 gene locus_tag LOCUS_12550 23502 24710 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456640.1 protein_id gnl|my_center|LOCUS_12550 24725 25186 gene locus_tag LOCUS_12560 gene ribE 24725 25186 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963913.1 protein_id gnl|my_center|LOCUS_12560 25285 25650 gene locus_tag LOCUS_12570 25285 25650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 26639 25722 gene locus_tag LOCUS_12580 26639 25722 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_12580 27160 28626 gene locus_tag LOCUS_12590 27160 28626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 29516 28731 gene locus_tag LOCUS_12600 gene erm(A) 29516 28731 CDS product 23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072201.1 protein_id gnl|my_center|LOCUS_12600 29857 30375 gene locus_tag LOCUS_12610 29857 30375 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002273839.1 protein_id gnl|my_center|LOCUS_12610 30465 31838 gene locus_tag LOCUS_12620 30465 31838 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_12620 31835 32680 gene locus_tag LOCUS_12630 gene yidA 31835 32680 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963948.1 protein_id gnl|my_center|LOCUS_12630 32699 33679 gene locus_tag LOCUS_12640 32699 33679 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_12640 33884 34669 gene locus_tag LOCUS_12650 33884 34669 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722576.1 protein_id gnl|my_center|LOCUS_12650 34686 36749 gene locus_tag LOCUS_12660 34686 36749 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905656.1 protein_id gnl|my_center|LOCUS_12660 38739 36760 gene locus_tag LOCUS_12670 38739 36760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 38939 39364 gene locus_tag LOCUS_12680 38939 39364 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_12680 39421 39873 gene locus_tag LOCUS_12690 39421 39873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 40122 40835 gene locus_tag LOCUS_12700 40122 40835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 40867 42045 gene locus_tag LOCUS_12710 40867 42045 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788311.1 protein_id gnl|my_center|LOCUS_12710 42156 43112 gene locus_tag LOCUS_12720 gene bioB 42156 43112 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_12720 43288 43512 gene locus_tag LOCUS_12730 43288 43512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 43697 44437 gene locus_tag LOCUS_12740 43697 44437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 44646 45575 gene locus_tag LOCUS_12750 44646 45575 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775527.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence20 230 1597 gene locus_tag LOCUS_12760 gene melB 230 1597 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028072.1 protein_id gnl|my_center|LOCUS_12760 1720 2682 gene locus_tag LOCUS_12770 1720 2682 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965544.1 protein_id gnl|my_center|LOCUS_12770 2734 3336 gene locus_tag LOCUS_12780 2734 3336 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293710.1 protein_id gnl|my_center|LOCUS_12780 3333 4154 gene locus_tag LOCUS_12790 3333 4154 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213640.1 protein_id gnl|my_center|LOCUS_12790 4353 5018 gene locus_tag LOCUS_12800 4353 5018 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021652.1 protein_id gnl|my_center|LOCUS_12800 5672 7006 gene locus_tag LOCUS_12810 5672 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 7003 7839 gene locus_tag LOCUS_12820 7003 7839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 8178 9239 gene locus_tag LOCUS_12830 8178 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 9232 9744 gene locus_tag LOCUS_12840 9232 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 10235 9960 gene locus_tag LOCUS_12850 10235 9960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 10659 11702 gene locus_tag LOCUS_12860 10659 11702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 11674 12270 gene locus_tag LOCUS_12870 11674 12270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 12272 12595 gene locus_tag LOCUS_12880 12272 12595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 12624 14027 gene locus_tag LOCUS_12890 12624 14027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 14037 14723 gene locus_tag LOCUS_12900 14037 14723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 14891 18223 gene locus_tag LOCUS_12910 14891 18223 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459255.1 protein_id gnl|my_center|LOCUS_12910 18506 20335 gene locus_tag LOCUS_12920 18506 20335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 20481 20951 gene locus_tag LOCUS_12930 20481 20951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 21414 21662 gene locus_tag LOCUS_12940 21414 21662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 21601 22815 gene locus_tag LOCUS_12950 21601 22815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12950 23113 24921 gene locus_tag LOCUS_12960 23113 24921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 24926 27232 gene locus_tag LOCUS_12970 24926 27232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 27245 31447 gene locus_tag LOCUS_12980 27245 31447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 31452 33599 gene locus_tag LOCUS_12990 31452 33599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 33615 35081 gene locus_tag LOCUS_13000 33615 35081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 35078 35278 gene locus_tag LOCUS_13010 35078 35278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 35290 36417 gene locus_tag LOCUS_13020 gene nifS 35290 36417 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066396.1 protein_id gnl|my_center|LOCUS_13020 36999 38294 gene locus_tag LOCUS_13030 36999 38294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 38302 38541 gene locus_tag LOCUS_13040 38302 38541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 38657 39370 gene locus_tag LOCUS_13050 38657 39370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 39662 39859 gene locus_tag LOCUS_13060 39662 39859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 40282 40605 gene locus_tag LOCUS_13070 40282 40605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13070 40602 40787 gene locus_tag LOCUS_13080 40602 40787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13080 40871 42199 gene locus_tag LOCUS_13090 40871 42199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 42376 43269 gene locus_tag LOCUS_13100 42376 43269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 43263 44816 gene locus_tag LOCUS_13110 43263 44816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 45342 45133 gene locus_tag LOCUS_13120 45342 45133 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885335.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence21 538 2523 gene locus_tag LOCUS_13130 gene uvrB 538 2523 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_13130 2545 5373 gene locus_tag LOCUS_13140 gene uvrA 2545 5373 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_13140 5397 5981 gene locus_tag LOCUS_13150 gene yfbR 5397 5981 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098110.1 protein_id gnl|my_center|LOCUS_13150 6633 6052 gene locus_tag LOCUS_13160 6633 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 7185 6745 gene locus_tag LOCUS_13170 gene dtd 7185 6745 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071581519.1 protein_id gnl|my_center|LOCUS_13170 7411 9363 gene locus_tag LOCUS_13180 7411 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 10757 9453 gene locus_tag LOCUS_13190 10757 9453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 11742 10879 gene locus_tag LOCUS_13200 11742 10879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 12606 12962 gene locus_tag LOCUS_13210 12606 12962 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_13210 13002 14816 gene locus_tag LOCUS_13220 13002 14816 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028485.1 protein_id gnl|my_center|LOCUS_13220 14826 15695 gene locus_tag LOCUS_13230 14826 15695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 15796 17466 gene locus_tag LOCUS_13240 15796 17466 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_13240 17967 17650 gene locus_tag LOCUS_13250 17967 17650 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023310.1 protein_id gnl|my_center|LOCUS_13250 18147 19211 gene locus_tag LOCUS_13260 18147 19211 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815048.1 protein_id gnl|my_center|LOCUS_13260 19261 20214 gene locus_tag LOCUS_13270 19261 20214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 20322 21527 gene locus_tag LOCUS_13280 20322 21527 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_13280 21615 21860 gene locus_tag LOCUS_13290 21615 21860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 21842 22039 gene locus_tag LOCUS_13300 21842 22039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 22058 22519 gene locus_tag LOCUS_13310 22058 22519 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023561.1 protein_id gnl|my_center|LOCUS_13310 22534 23325 gene locus_tag LOCUS_13320 gene srtB 22534 23325 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095595.1 protein_id gnl|my_center|LOCUS_13320 23328 26072 gene locus_tag LOCUS_13330 23328 26072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 26193 27953 gene locus_tag LOCUS_13340 26193 27953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 28061 28495 gene locus_tag LOCUS_13350 28061 28495 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419409.1 protein_id gnl|my_center|LOCUS_13350 28613 29542 gene locus_tag LOCUS_13360 gene cysK 28613 29542 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_13360 30763 29600 gene locus_tag LOCUS_13370 30763 29600 CDS product DUF4317 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964047.1 protein_id gnl|my_center|LOCUS_13370 30952 32310 gene locus_tag LOCUS_13380 30952 32310 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_13380 32322 32948 gene locus_tag LOCUS_13390 32322 32948 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 protein_id gnl|my_center|LOCUS_13390 32954 33514 gene locus_tag LOCUS_13400 32954 33514 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942088.1 protein_id gnl|my_center|LOCUS_13400 34885 33605 gene locus_tag LOCUS_13410 34885 33605 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899653.1 protein_id gnl|my_center|LOCUS_13410 35078 35497 gene locus_tag LOCUS_13420 35078 35497 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460033.1 protein_id gnl|my_center|LOCUS_13420 35506 37575 gene locus_tag LOCUS_13430 35506 37575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 39396 37681 gene locus_tag LOCUS_13440 39396 37681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 39588 39893 gene locus_tag LOCUS_13450 39588 39893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 39911 40828 gene locus_tag LOCUS_13460 gene trxB 39911 40828 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_13460 40851 42188 gene locus_tag LOCUS_13470 40851 42188 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_13470 42198 43592 gene locus_tag LOCUS_13480 42198 43592 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891654.1 protein_id gnl|my_center|LOCUS_13480 43625 44500 gene locus_tag LOCUS_13490 43625 44500 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048407.1 protein_id gnl|my_center|LOCUS_13490 44520 45191 gene locus_tag LOCUS_13500 44520 45191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence22 1345 227 gene locus_tag LOCUS_13510 1345 227 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_13510 1800 1411 gene locus_tag LOCUS_13520 1800 1411 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_13520 2185 1820 gene locus_tag LOCUS_13530 2185 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 3569 2193 gene locus_tag LOCUS_13540 3569 2193 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_13540 3737 4960 gene locus_tag LOCUS_13550 3737 4960 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541694.1 protein_id gnl|my_center|LOCUS_13550 5079 4858 gene locus_tag LOCUS_13560 5079 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 5139 7250 gene locus_tag LOCUS_13570 5139 7250 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_13570 7801 7223 gene locus_tag LOCUS_13580 7801 7223 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000363049.1 protein_id gnl|my_center|LOCUS_13580 8375 7809 gene locus_tag LOCUS_13590 8375 7809 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_13590 9670 8372 gene locus_tag LOCUS_13600 9670 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 10404 9667 gene locus_tag LOCUS_13610 10404 9667 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861321.1 protein_id gnl|my_center|LOCUS_13610 11092 10442 gene locus_tag LOCUS_13620 11092 10442 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701906.1 protein_id gnl|my_center|LOCUS_13620 12561 11161 gene locus_tag LOCUS_13630 12561 11161 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049163295.1 protein_id gnl|my_center|LOCUS_13630 12737 14128 gene locus_tag LOCUS_13640 gene trkA 12737 14128 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_13640 14191 15669 gene locus_tag LOCUS_13650 14191 15669 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_13650 17499 15703 gene locus_tag LOCUS_13660 17499 15703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360293.1 protein_id gnl|my_center|LOCUS_13660 19294 17492 gene locus_tag LOCUS_13670 19294 17492 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161615.1 protein_id gnl|my_center|LOCUS_13670 19713 19300 gene locus_tag LOCUS_13680 19713 19300 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721534.1 protein_id gnl|my_center|LOCUS_13680 21555 20188 gene locus_tag LOCUS_13690 21555 20188 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895854.1 protein_id gnl|my_center|LOCUS_13690 22363 21614 gene locus_tag LOCUS_13700 22363 21614 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680890.1 protein_id gnl|my_center|LOCUS_13700 23106 22378 gene locus_tag LOCUS_13710 23106 22378 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_13710 23761 23081 gene locus_tag LOCUS_13720 23761 23081 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582846.1 protein_id gnl|my_center|LOCUS_13720 23923 24447 gene locus_tag LOCUS_13730 23923 24447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 25290 24469 gene locus_tag LOCUS_13740 25290 24469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 27321 25432 gene locus_tag LOCUS_13750 27321 25432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680887.1 protein_id gnl|my_center|LOCUS_13750 29161 27314 gene locus_tag LOCUS_13760 29161 27314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682372.1 protein_id gnl|my_center|LOCUS_13760 29984 29274 gene locus_tag LOCUS_13770 29984 29274 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680890.1 protein_id gnl|my_center|LOCUS_13770 30703 29981 gene locus_tag LOCUS_13780 gene rgbR 30703 29981 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_13780 31335 30727 gene locus_tag LOCUS_13790 31335 30727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 33758 31368 gene locus_tag LOCUS_13800 33758 31368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 36090 33787 gene locus_tag LOCUS_13810 36090 33787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 38797 36179 gene locus_tag LOCUS_13820 38797 36179 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_13820 40976 38961 gene locus_tag LOCUS_13830 40976 38961 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986325.1 protein_id gnl|my_center|LOCUS_13830 41323 41571 gene locus_tag LOCUS_13840 41323 41571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 41707 43410 gene locus_tag LOCUS_13850 41707 43410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 43828 43502 gene locus_tag LOCUS_13860 43828 43502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence23 284 3508 gene locus_tag LOCUS_13870 gene carB 284 3508 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_13870 5667 3613 gene locus_tag LOCUS_13880 gene htpG 5667 3613 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_13880 6290 5853 gene locus_tag LOCUS_13890 6290 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 6368 6565 gene locus_tag LOCUS_13900 6368 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 8400 6562 gene locus_tag LOCUS_13910 8400 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 8647 10257 gene locus_tag LOCUS_13920 8647 10257 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633861.1 protein_id gnl|my_center|LOCUS_13920 10361 11674 gene locus_tag LOCUS_13930 10361 11674 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_13930 15729 11692 gene locus_tag LOCUS_13940 15729 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 16124 15750 gene locus_tag LOCUS_13950 16124 15750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 16456 16139 gene locus_tag LOCUS_13960 16456 16139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 16899 16468 gene locus_tag LOCUS_13970 16899 16468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 18315 17023 gene locus_tag LOCUS_13980 18315 17023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 19367 18318 gene locus_tag LOCUS_13990 19367 18318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 21150 19384 gene locus_tag LOCUS_14000 21150 19384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 21994 21170 gene locus_tag LOCUS_14010 21994 21170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 22923 22246 gene locus_tag LOCUS_14020 gene pyrE 22923 22246 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_14020 24254 23346 gene locus_tag LOCUS_14030 24254 23346 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 protein_id gnl|my_center|LOCUS_14030 25062 24271 gene locus_tag LOCUS_14040 25062 24271 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989827.1 protein_id gnl|my_center|LOCUS_14040 26039 25122 gene locus_tag LOCUS_14050 gene pyrF 26039 25122 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_14050 27342 26041 gene locus_tag LOCUS_14060 gene pyrC 27342 26041 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108375.1 protein_id gnl|my_center|LOCUS_14060 27810 27361 gene locus_tag LOCUS_14070 27810 27361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 28930 27845 gene locus_tag LOCUS_14080 gene asd 28930 27845 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_14080 30911 29046 gene locus_tag LOCUS_14090 30911 29046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 31276 30908 gene locus_tag LOCUS_14100 31276 30908 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814133.1 protein_id gnl|my_center|LOCUS_14100 32239 31370 gene locus_tag LOCUS_14110 32239 31370 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389847.1 protein_id gnl|my_center|LOCUS_14110 36714 32296 gene locus_tag LOCUS_14120 36714 32296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 37420 36707 gene locus_tag LOCUS_14130 37420 36707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 39031 37427 gene locus_tag LOCUS_14140 39031 37427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 40063 39086 gene locus_tag LOCUS_14150 40063 39086 CDS product DUF2220 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233576.1 protein_id gnl|my_center|LOCUS_14150 41970 40096 gene locus_tag LOCUS_14160 41970 40096 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387654.1 protein_id gnl|my_center|LOCUS_14160 43043 42048 gene locus_tag LOCUS_14170 gene add 43043 42048 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548323.1 protein_id gnl|my_center|LOCUS_14170 43244 43110 gene locus_tag LOCUS_14180 43244 43110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence24 1586 777 gene locus_tag LOCUS_14190 1586 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 2515 1670 gene locus_tag LOCUS_14200 2515 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 3959 2487 gene locus_tag LOCUS_14210 3959 2487 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964815.1 protein_id gnl|my_center|LOCUS_14210 4627 3956 gene locus_tag LOCUS_14220 4627 3956 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_14220 4920 4624 gene locus_tag LOCUS_14230 4920 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 5822 4917 gene locus_tag LOCUS_14240 5822 4917 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014849.1 protein_id gnl|my_center|LOCUS_14240 6733 5819 gene locus_tag LOCUS_14250 6733 5819 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812720.1 protein_id gnl|my_center|LOCUS_14250 7441 6797 gene locus_tag LOCUS_14260 7441 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 8250 7444 gene locus_tag LOCUS_14270 8250 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 9887 8340 gene locus_tag LOCUS_14280 gene gpmI 9887 8340 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964031.1 protein_id gnl|my_center|LOCUS_14280 11544 9970 gene locus_tag LOCUS_14290 11544 9970 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461066.1 protein_id gnl|my_center|LOCUS_14290 13242 11608 gene locus_tag LOCUS_14300 13242 11608 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_14300 13942 13283 gene locus_tag LOCUS_14310 13942 13283 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_14310 14733 13939 gene locus_tag LOCUS_14320 14733 13939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 15551 14814 gene locus_tag LOCUS_14330 15551 14814 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_14330 16016 15552 gene locus_tag LOCUS_14340 gene argR 16016 15552 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810957.1 protein_id gnl|my_center|LOCUS_14340 16882 16037 gene locus_tag LOCUS_14350 16882 16037 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_14350 17715 16897 gene locus_tag LOCUS_14360 17715 16897 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965376.1 protein_id gnl|my_center|LOCUS_14360 19583 17712 gene locus_tag LOCUS_14370 gene dxs 19583 17712 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_14370 20496 19597 gene locus_tag LOCUS_14380 20496 19597 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_14380 20683 20489 gene locus_tag LOCUS_14390 20683 20489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 21903 20683 gene locus_tag LOCUS_14400 gene xseA 21903 20683 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_14400 22294 21896 gene locus_tag LOCUS_14410 gene nusB 22294 21896 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_14410 22701 22324 gene locus_tag LOCUS_14420 22701 22324 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_14420 23443 22769 gene locus_tag LOCUS_14430 23443 22769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 23979 23440 gene locus_tag LOCUS_14440 23979 23440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 24199 23960 gene locus_tag LOCUS_14450 24199 23960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 25403 24270 gene locus_tag LOCUS_14460 25403 24270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 25855 25475 gene locus_tag LOCUS_14470 gene spoIIIAD 25855 25475 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230228.1 protein_id gnl|my_center|LOCUS_14470 26078 25884 gene locus_tag LOCUS_14480 26078 25884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 26612 26100 gene locus_tag LOCUS_14490 gene spoIIIAB 26612 26100 CDS product stage III sporulation protein SpoIIIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965392.1 protein_id gnl|my_center|LOCUS_14490 27523 26609 gene locus_tag LOCUS_14500 gene spoIIIAA 27523 26609 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358945.1 protein_id gnl|my_center|LOCUS_14500 28109 27699 gene locus_tag LOCUS_14510 28109 27699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 28385 28458 gene locus_tag LOCUS_t00210 28385 28458 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 28573 29343 gene locus_tag LOCUS_14520 gene aroE 28573 29343 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439416.1 protein_id gnl|my_center|LOCUS_14520 29455 31305 gene locus_tag LOCUS_14530 gene asnB 29455 31305 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333979.1 protein_id gnl|my_center|LOCUS_14530 32173 31412 gene locus_tag LOCUS_14540 32173 31412 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896901.1 protein_id gnl|my_center|LOCUS_14540 33720 32239 gene locus_tag LOCUS_14550 33720 32239 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_14550 34133 33822 gene locus_tag LOCUS_14560 34133 33822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 35618 34305 gene locus_tag LOCUS_14570 35618 34305 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861322.1 protein_id gnl|my_center|LOCUS_14570 36330 35620 gene locus_tag LOCUS_14580 36330 35620 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861321.1 protein_id gnl|my_center|LOCUS_14580 36511 37848 gene locus_tag LOCUS_14590 36511 37848 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_14590 39084 37873 gene locus_tag LOCUS_14600 39084 37873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 40177 39086 gene locus_tag LOCUS_14610 gene pepQ 40177 39086 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411056.1 protein_id gnl|my_center|LOCUS_14610 40692 40132 gene locus_tag LOCUS_14620 40692 40132 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583237.1 protein_id gnl|my_center|LOCUS_14620 42021 40711 gene locus_tag LOCUS_14630 42021 40711 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence25 <1 544 gene locus_tag LOCUS_14640 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000162279.1:ATP-binding protein 636 2240 gene locus_tag LOCUS_14650 636 2240 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288004.1 protein_id gnl|my_center|LOCUS_14650 2254 3696 gene locus_tag LOCUS_14660 2254 3696 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288002.1 protein_id gnl|my_center|LOCUS_14660 3864 4910 gene locus_tag LOCUS_14670 3864 4910 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223212.1 protein_id gnl|my_center|LOCUS_14670 5063 6577 gene locus_tag LOCUS_14680 5063 6577 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_14680 6579 7658 gene locus_tag LOCUS_14690 6579 7658 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_14690 7660 8715 gene locus_tag LOCUS_14700 gene yjfF 7660 8715 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_14700 8747 9805 gene locus_tag LOCUS_14710 8747 9805 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_14710 9878 10525 gene locus_tag LOCUS_14720 gene sigK 9878 10525 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964996.1 protein_id gnl|my_center|LOCUS_14720 10518 12239 gene locus_tag LOCUS_14730 10518 12239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 12441 15026 gene locus_tag LOCUS_14740 12441 15026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 15067 16041 gene locus_tag LOCUS_14750 15067 16041 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016207.1 protein_id gnl|my_center|LOCUS_14750 16210 17106 gene locus_tag LOCUS_14760 16210 17106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 17138 17920 gene locus_tag LOCUS_14770 17138 17920 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_14770 18029 19177 gene locus_tag LOCUS_14780 gene fucO 18029 19177 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766959.1 protein_id gnl|my_center|LOCUS_14780 19174 20811 gene locus_tag LOCUS_14790 19174 20811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 20986 22674 gene locus_tag LOCUS_14800 20986 22674 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_14800 22963 24399 gene locus_tag LOCUS_14810 22963 24399 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898068.1 protein_id gnl|my_center|LOCUS_14810 24526 25146 gene locus_tag LOCUS_14820 24526 25146 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_14820 25238 27625 gene locus_tag LOCUS_14830 25238 27625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 27639 28499 gene locus_tag LOCUS_14840 27639 28499 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101955.1 protein_id gnl|my_center|LOCUS_14840 28512 29696 gene locus_tag LOCUS_14850 28512 29696 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101954.1 protein_id gnl|my_center|LOCUS_14850 30202 29675 gene locus_tag LOCUS_14860 30202 29675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 30767 30285 gene locus_tag LOCUS_14870 30767 30285 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_14870 34004 30792 gene locus_tag LOCUS_14880 34004 30792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 34502 34242 gene locus_tag LOCUS_14890 gene rpsT 34502 34242 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902954.1 protein_id gnl|my_center|LOCUS_14890 34707 35615 gene locus_tag LOCUS_14900 gene gpr 34707 35615 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430954.1 protein_id gnl|my_center|LOCUS_14900 35677 36831 gene locus_tag LOCUS_14910 35677 36831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 37258 36875 gene locus_tag LOCUS_14920 37258 36875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 37529 37849 gene locus_tag LOCUS_14930 37529 37849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence26 168 824 gene locus_tag LOCUS_14940 168 824 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227889.1 protein_id gnl|my_center|LOCUS_14940 925 1503 gene locus_tag LOCUS_14950 925 1503 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357086.1 protein_id gnl|my_center|LOCUS_14950 1496 2626 gene locus_tag LOCUS_14960 1496 2626 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986549.1 protein_id gnl|my_center|LOCUS_14960 2784 5201 gene locus_tag LOCUS_14970 2784 5201 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938876.1 protein_id gnl|my_center|LOCUS_14970 5202 6131 gene locus_tag LOCUS_14980 gene rfbN 5202 6131 CDS product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_14980 6139 7059 gene locus_tag LOCUS_14990 6139 7059 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003836797.1 protein_id gnl|my_center|LOCUS_14990 7090 8118 gene locus_tag LOCUS_15000 7090 8118 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454115.1 protein_id gnl|my_center|LOCUS_15000 8180 8680 gene locus_tag LOCUS_15010 gene ilvN 8180 8680 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_15010 8761 9783 gene locus_tag LOCUS_15020 gene ilvC 8761 9783 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_15020 9932 10729 gene locus_tag LOCUS_15030 9932 10729 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464970.1 protein_id gnl|my_center|LOCUS_15030 10939 11613 gene locus_tag LOCUS_15040 10939 11613 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422086.1 protein_id gnl|my_center|LOCUS_15040 11669 12163 gene locus_tag LOCUS_15050 gene cobO 11669 12163 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812021.1 protein_id gnl|my_center|LOCUS_15050 12461 13351 gene locus_tag LOCUS_15060 gene dapA 12461 13351 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422063.1 protein_id gnl|my_center|LOCUS_15060 13385 14146 gene locus_tag LOCUS_15070 gene dapB 13385 14146 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_15070 14177 15580 gene locus_tag LOCUS_15080 14177 15580 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272578.1 protein_id gnl|my_center|LOCUS_15080 15585 17825 gene locus_tag LOCUS_15090 gene priA 15585 17825 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_15090 17871 18356 gene locus_tag LOCUS_15100 gene def 17871 18356 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 protein_id gnl|my_center|LOCUS_15100 18389 19324 gene locus_tag LOCUS_15110 gene fmt 18389 19324 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_15110 19315 20040 gene locus_tag LOCUS_15120 19315 20040 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416253.1 protein_id gnl|my_center|LOCUS_15120 20037 21347 gene locus_tag LOCUS_15130 gene rsmB 20037 21347 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440956.1 protein_id gnl|my_center|LOCUS_15130 21356 22423 gene locus_tag LOCUS_15140 gene rlmN 21356 22423 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_15140 22420 23142 gene locus_tag LOCUS_15150 22420 23142 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723065.1 protein_id gnl|my_center|LOCUS_15150 23157 25217 gene locus_tag LOCUS_15160 gene pknB 23157 25217 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 protein_id gnl|my_center|LOCUS_15160 25217 26116 gene locus_tag LOCUS_15170 gene rsgA 25217 26116 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_15170 26113 26772 gene locus_tag LOCUS_15180 gene rpe 26113 26772 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965037.1 protein_id gnl|my_center|LOCUS_15180 26794 27849 gene locus_tag LOCUS_15190 26794 27849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 27867 28787 gene locus_tag LOCUS_15200 27867 28787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 28823 30373 gene locus_tag LOCUS_15210 28823 30373 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256246.1 protein_id gnl|my_center|LOCUS_15210 30373 31923 gene locus_tag LOCUS_15220 30373 31923 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256247.1 protein_id gnl|my_center|LOCUS_15220 32009 32566 gene locus_tag LOCUS_15230 gene efp 32009 32566 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_15230 32576 33253 gene locus_tag LOCUS_15240 gene tsaA 32576 33253 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_15240 33255 33767 gene locus_tag LOCUS_15250 33255 33767 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_15250 34599 33823 gene locus_tag LOCUS_15260 34599 33823 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963754.1 protein_id gnl|my_center|LOCUS_15260 34764 35069 gene locus_tag LOCUS_15270 34764 35069 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_15270 35134 37686 gene locus_tag LOCUS_15280 35134 37686 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence27 1386 142 gene locus_tag LOCUS_15290 1386 142 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_15290 1554 2708 gene locus_tag LOCUS_15300 1554 2708 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_15300 2701 3690 gene locus_tag LOCUS_15310 2701 3690 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_15310 3662 4192 gene locus_tag LOCUS_15320 3662 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 4542 4237 gene locus_tag LOCUS_15330 4542 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 5140 4586 gene locus_tag LOCUS_15340 5140 4586 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_15340 6005 5148 gene locus_tag LOCUS_15350 6005 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 7002 6118 gene locus_tag LOCUS_15360 7002 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 7133 8509 gene locus_tag LOCUS_15370 gene argH 7133 8509 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_15370 9671 8529 gene locus_tag LOCUS_15380 9671 8529 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964048.1 protein_id gnl|my_center|LOCUS_15380 10061 9687 gene locus_tag LOCUS_15390 10061 9687 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903552.1 protein_id gnl|my_center|LOCUS_15390 14351 10188 gene locus_tag LOCUS_15400 14351 10188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 15266 14493 gene locus_tag LOCUS_15410 15266 14493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 16806 15388 gene locus_tag LOCUS_15420 16806 15388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 17476 16808 gene locus_tag LOCUS_15430 17476 16808 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_15430 19499 17526 gene locus_tag LOCUS_15440 19499 17526 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460118.1 protein_id gnl|my_center|LOCUS_15440 20764 19496 gene locus_tag LOCUS_15450 20764 19496 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965885.1 protein_id gnl|my_center|LOCUS_15450 21656 21039 gene locus_tag LOCUS_15460 21656 21039 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_15460 22218 21739 gene locus_tag LOCUS_15470 22218 21739 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_15470 24526 22583 gene locus_tag LOCUS_15480 24526 22583 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962335.1 protein_id gnl|my_center|LOCUS_15480 26005 24740 gene locus_tag LOCUS_15490 26005 24740 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610375.1 protein_id gnl|my_center|LOCUS_15490 26210 25980 gene locus_tag LOCUS_15500 26210 25980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 26497 26303 gene locus_tag LOCUS_15510 26497 26303 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004613735.1 protein_id gnl|my_center|LOCUS_15510 26889 26500 gene locus_tag LOCUS_15520 26889 26500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 28589 27048 gene locus_tag LOCUS_15530 28589 27048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 28798 28589 gene locus_tag LOCUS_15540 28798 28589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 29132 28791 gene locus_tag LOCUS_15550 29132 28791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 30586 29192 gene locus_tag LOCUS_15560 30586 29192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 32271 30598 gene locus_tag LOCUS_15570 32271 30598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence28 530 117 gene locus_tag LOCUS_15580 530 117 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836803.1 protein_id gnl|my_center|LOCUS_15580 1103 594 gene locus_tag LOCUS_15590 1103 594 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016850.1 protein_id gnl|my_center|LOCUS_15590 1340 2962 gene locus_tag LOCUS_15600 1340 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 3405 2977 gene locus_tag LOCUS_15610 gene mscL 3405 2977 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928676.1 protein_id gnl|my_center|LOCUS_15610 4594 3497 gene locus_tag LOCUS_15620 4594 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 5170 4712 gene locus_tag LOCUS_15630 5170 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 5300 5917 gene locus_tag LOCUS_15640 5300 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 5961 6701 gene locus_tag LOCUS_15650 5961 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 6682 7173 gene locus_tag LOCUS_15660 6682 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 7294 8754 gene locus_tag LOCUS_15670 7294 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 9776 8772 gene locus_tag LOCUS_15680 9776 8772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 9933 11120 gene locus_tag LOCUS_15690 9933 11120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 12559 11186 gene locus_tag LOCUS_15700 12559 11186 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459600.1 protein_id gnl|my_center|LOCUS_15700 15662 12552 gene locus_tag LOCUS_15710 15662 12552 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288607.1 protein_id gnl|my_center|LOCUS_15710 16149 16940 gene locus_tag LOCUS_15720 16149 16940 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286852.1 protein_id gnl|my_center|LOCUS_15720 17018 18589 gene locus_tag LOCUS_15730 gene rny 17018 18589 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_15730 18686 19339 gene locus_tag LOCUS_15740 18686 19339 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_15740 19296 20267 gene locus_tag LOCUS_15750 gene hemB 19296 20267 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460178.1 protein_id gnl|my_center|LOCUS_15750 20272 21546 gene locus_tag LOCUS_15760 gene hemL 20272 21546 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941005.1 protein_id gnl|my_center|LOCUS_15760 21600 22523 gene locus_tag LOCUS_15770 21600 22523 CDS product 4Fe-4S-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430299.1 protein_id gnl|my_center|LOCUS_15770 22526 23803 gene locus_tag LOCUS_15780 gene hemA 22526 23803 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460182.1 protein_id gnl|my_center|LOCUS_15780 23800 26175 gene locus_tag LOCUS_15790 23800 26175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 26177 26845 gene locus_tag LOCUS_15800 26177 26845 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963845.1 protein_id gnl|my_center|LOCUS_15800 26862 27887 gene locus_tag LOCUS_15810 26862 27887 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434897.1 protein_id gnl|my_center|LOCUS_15810 27941 29209 gene locus_tag LOCUS_15820 27941 29209 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_15820 29199 29354 gene locus_tag LOCUS_15830 29199 29354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 29620 29477 gene locus_tag LOCUS_15840 29620 29477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 29831 30025 gene locus_tag LOCUS_15850 29831 30025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 30087 30218 gene locus_tag LOCUS_15860 30087 30218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 30322 30813 gene locus_tag LOCUS_15870 30322 30813 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172426.1 protein_id gnl|my_center|LOCUS_15870 32228 31611 gene locus_tag LOCUS_15880 32228 31611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence29 335 57 gene locus_tag LOCUS_15890 335 57 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613391.1 protein_id gnl|my_center|LOCUS_15890 609 319 gene locus_tag LOCUS_15900 609 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 976 767 gene locus_tag LOCUS_15910 976 767 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_15910 1779 1135 gene locus_tag LOCUS_15920 1779 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 2246 1818 gene locus_tag LOCUS_15930 2246 1818 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010708068.1 protein_id gnl|my_center|LOCUS_15930 2680 2252 gene locus_tag LOCUS_15940 2680 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 2822 3058 gene locus_tag LOCUS_15950 2822 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 3100 3267 gene locus_tag LOCUS_15960 3100 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 3945 3238 gene locus_tag LOCUS_15970 3945 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 4382 4218 gene locus_tag LOCUS_15980 4382 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 5272 4736 gene locus_tag LOCUS_15990 5272 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 5366 5557 gene locus_tag LOCUS_16000 5366 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 5749 5943 gene locus_tag LOCUS_16010 5749 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 6079 5924 gene locus_tag LOCUS_16020 6079 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 6406 6525 gene locus_tag LOCUS_16030 6406 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 6560 6709 gene locus_tag LOCUS_16040 6560 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 6878 7159 gene locus_tag LOCUS_16050 6878 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 7225 7719 gene locus_tag LOCUS_16060 7225 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 7716 8942 gene locus_tag LOCUS_16070 7716 8942 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 protein_id gnl|my_center|LOCUS_16070 8939 9730 gene locus_tag LOCUS_16080 8939 9730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 9727 11691 gene locus_tag LOCUS_16090 9727 11691 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_16090 11696 14137 gene locus_tag LOCUS_16100 11696 14137 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714181.1 protein_id gnl|my_center|LOCUS_16100 14399 14725 gene locus_tag LOCUS_16110 14399 14725 CDS product VRR-NUC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714182.1 protein_id gnl|my_center|LOCUS_16110 14722 16098 gene locus_tag LOCUS_16120 14722 16098 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 protein_id gnl|my_center|LOCUS_16120 16101 17693 gene locus_tag LOCUS_16130 16101 17693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 17745 18134 gene locus_tag LOCUS_16140 17745 18134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 18159 18629 gene locus_tag LOCUS_16150 18159 18629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 18820 18939 gene locus_tag LOCUS_16160 18820 18939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 19094 19276 gene locus_tag LOCUS_16170 19094 19276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 19289 19468 gene locus_tag LOCUS_16180 19289 19468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 19557 20540 gene locus_tag LOCUS_16190 19557 20540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 20567 21214 gene locus_tag LOCUS_16200 20567 21214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 21269 22060 gene locus_tag LOCUS_16210 21269 22060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 22095 23330 gene locus_tag LOCUS_16220 22095 23330 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_16220 23327 24781 gene locus_tag LOCUS_16230 23327 24781 CDS product DUF1073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113499.1 protein_id gnl|my_center|LOCUS_16230 24778 26355 gene locus_tag LOCUS_16240 24778 26355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 26355 26600 gene locus_tag LOCUS_16250 26355 26600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 26657 27880 gene locus_tag LOCUS_16260 26657 27880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 27881 28402 gene locus_tag LOCUS_16270 27881 28402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 28413 29456 gene locus_tag LOCUS_16280 28413 29456 CDS product DUF2184 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627464.1 protein_id gnl|my_center|LOCUS_16280 29467 29769 gene locus_tag LOCUS_16290 29467 29769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 29787 30326 gene locus_tag LOCUS_16300 29787 30326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 30323 30727 gene locus_tag LOCUS_16310 30323 30727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 30732 31244 gene locus_tag LOCUS_16320 30732 31244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 31241 31696 gene locus_tag LOCUS_16330 31241 31696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817307.1 protein_id gnl|my_center|LOCUS_16330 31680 31886 gene locus_tag LOCUS_16340 31680 31886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence30 206 1411 gene locus_tag LOCUS_16350 206 1411 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461660.1 protein_id gnl|my_center|LOCUS_16350 1983 1477 gene locus_tag LOCUS_16360 1983 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 2214 2462 gene locus_tag LOCUS_16370 2214 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 3537 2560 gene locus_tag LOCUS_16380 gene pfkA 3537 2560 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_16380 7055 3594 gene locus_tag LOCUS_16390 7055 3594 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_16390 7453 7205 gene locus_tag LOCUS_16400 7453 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 8418 7498 gene locus_tag LOCUS_16410 gene whiA 8418 7498 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963835.1 protein_id gnl|my_center|LOCUS_16410 9290 8397 gene locus_tag LOCUS_16420 gene rapZ 9290 8397 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_16420 10339 9449 gene locus_tag LOCUS_16430 gene murB 10339 9449 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_16430 11294 10371 gene locus_tag LOCUS_16440 11294 10371 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_16440 12266 11343 gene locus_tag LOCUS_16450 gene hprK 12266 11343 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_16450 13580 12339 gene locus_tag LOCUS_16460 13580 12339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 13926 13564 gene locus_tag LOCUS_16470 13926 13564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 14135 14956 gene locus_tag LOCUS_16480 14135 14956 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_16480 14973 15614 gene locus_tag LOCUS_16490 14973 15614 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_16490 16081 15644 gene locus_tag LOCUS_16500 16081 15644 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430905.1 protein_id gnl|my_center|LOCUS_16500 16603 16100 gene locus_tag LOCUS_16510 gene greA 16603 16100 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003488762.1 protein_id gnl|my_center|LOCUS_16510 17804 16608 gene locus_tag LOCUS_16520 17804 16608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 20168 17907 gene locus_tag LOCUS_16530 gene secDF 20168 17907 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_16530 20943 20401 gene locus_tag LOCUS_16540 20943 20401 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_16540 21394 21008 gene locus_tag LOCUS_16550 21394 21008 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460706.1 protein_id gnl|my_center|LOCUS_16550 22322 21552 gene locus_tag LOCUS_16560 22322 21552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 22502 23872 gene locus_tag LOCUS_16570 22502 23872 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986297.1 protein_id gnl|my_center|LOCUS_16570 23986 24204 gene locus_tag LOCUS_16580 23986 24204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 24204 24470 gene locus_tag LOCUS_16590 24204 24470 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454698.1 protein_id gnl|my_center|LOCUS_16590 24470 24694 gene locus_tag LOCUS_16600 24470 24694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 26651 25029 gene locus_tag LOCUS_16610 26651 25029 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861938.1 protein_id gnl|my_center|LOCUS_16610 27218 26883 gene locus_tag LOCUS_16620 27218 26883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 27744 27487 gene locus_tag LOCUS_16630 27744 27487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 28206 27826 gene locus_tag LOCUS_16640 28206 27826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16640 29338 28745 gene locus_tag LOCUS_16650 29338 28745 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582354.1 protein_id gnl|my_center|LOCUS_16650 29650 29402 gene locus_tag LOCUS_16660 29650 29402 CDS product DUF3781 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861913.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence31 <1 1210 gene locus_tag LOCUS_16670 <1 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_050752960.1:non-ribosomal peptide synthetase 1229 1456 gene locus_tag LOCUS_16680 gene acpP 1229 1456 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631656.1 protein_id gnl|my_center|LOCUS_16680 1471 2997 gene locus_tag LOCUS_16690 1471 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 3138 4595 gene locus_tag LOCUS_16700 gene guaB 3138 4595 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048242.1 protein_id gnl|my_center|LOCUS_16700 4627 5277 gene locus_tag LOCUS_16710 4627 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 5394 7877 gene locus_tag LOCUS_16720 5394 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 8703 7882 gene locus_tag LOCUS_16730 8703 7882 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895974.1 protein_id gnl|my_center|LOCUS_16730 8837 10177 gene locus_tag LOCUS_16740 gene cdeA 8837 10177 CDS product multidrug efflux MATE transporter CdeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902537.1 protein_id gnl|my_center|LOCUS_16740 10301 11017 gene locus_tag LOCUS_16750 10301 11017 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_16750 11014 12378 gene locus_tag LOCUS_16760 11014 12378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 12458 12937 gene locus_tag LOCUS_16770 12458 12937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 13053 13643 gene locus_tag LOCUS_16780 13053 13643 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896761.1 protein_id gnl|my_center|LOCUS_16780 13787 14551 gene locus_tag LOCUS_16790 13787 14551 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614984.1 protein_id gnl|my_center|LOCUS_16790 14554 15432 gene locus_tag LOCUS_16800 14554 15432 CDS product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258500.1 protein_id gnl|my_center|LOCUS_16800 15445 15708 gene locus_tag LOCUS_16810 15445 15708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 15926 16855 gene locus_tag LOCUS_16820 15926 16855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 17051 17827 gene locus_tag LOCUS_16830 17051 17827 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_16830 17882 19276 gene locus_tag LOCUS_16840 17882 19276 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964890.1 protein_id gnl|my_center|LOCUS_16840 19273 20358 gene locus_tag LOCUS_16850 19273 20358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 20355 20669 gene locus_tag LOCUS_16860 20355 20669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 20797 21987 gene locus_tag LOCUS_16870 gene deoB 20797 21987 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 protein_id gnl|my_center|LOCUS_16870 23215 23697 gene locus_tag LOCUS_16880 23215 23697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 23763 25664 gene locus_tag LOCUS_16890 23763 25664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 25746 27140 gene locus_tag LOCUS_16900 25746 27140 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_16900 27207 27551 gene locus_tag LOCUS_16910 27207 27551 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964238.1 protein_id gnl|my_center|LOCUS_16910 27548 28234 gene locus_tag LOCUS_16920 27548 28234 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence32 232 945 gene locus_tag LOCUS_16930 gene pyrH 232 945 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810668.1 protein_id gnl|my_center|LOCUS_16930 1009 1557 gene locus_tag LOCUS_16940 gene frr 1009 1557 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_16940 1662 2375 gene locus_tag LOCUS_16950 1662 2375 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_16950 2417 3229 gene locus_tag LOCUS_16960 2417 3229 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_16960 3252 4403 gene locus_tag LOCUS_16970 3252 4403 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_16970 4434 5573 gene locus_tag LOCUS_16980 gene rseP 4434 5573 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_16980 5727 6845 gene locus_tag LOCUS_16990 gene ispG 5727 6845 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_16990 6858 11258 gene locus_tag LOCUS_17000 gene polC 6858 11258 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966712.1 protein_id gnl|my_center|LOCUS_17000 11478 11260 gene locus_tag LOCUS_17010 11478 11260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 11756 12967 gene locus_tag LOCUS_17020 11756 12967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 13136 13735 gene locus_tag LOCUS_17030 13136 13735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 13781 14953 gene locus_tag LOCUS_17040 13781 14953 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_17040 14941 16602 gene locus_tag LOCUS_17050 14941 16602 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048336.1 protein_id gnl|my_center|LOCUS_17050 16580 17410 gene locus_tag LOCUS_17060 gene proB 16580 17410 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287451.1 protein_id gnl|my_center|LOCUS_17060 17431 17640 gene locus_tag LOCUS_17070 17431 17640 CDS product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939394.1 protein_id gnl|my_center|LOCUS_17070 17637 18224 gene locus_tag LOCUS_17080 17637 18224 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_17080 18350 19600 gene locus_tag LOCUS_17090 18350 19600 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_17090 19612 20331 gene locus_tag LOCUS_17100 19612 20331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 20535 20819 gene locus_tag LOCUS_17110 20535 20819 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_17110 20842 22467 gene locus_tag LOCUS_17120 gene groL 20842 22467 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435012.1 protein_id gnl|my_center|LOCUS_17120 22667 23179 gene locus_tag LOCUS_17130 22667 23179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 23194 23616 gene locus_tag LOCUS_17140 23194 23616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 23762 24328 gene locus_tag LOCUS_17150 23762 24328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 24318 24641 gene locus_tag LOCUS_17160 24318 24641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 24667 25614 gene locus_tag LOCUS_17170 24667 25614 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289735.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence33 2861 426 gene locus_tag LOCUS_17180 2861 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 4006 2864 gene locus_tag LOCUS_17190 4006 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 4754 4044 gene locus_tag LOCUS_17200 4754 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 6435 4756 gene locus_tag LOCUS_17210 6435 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 7309 6533 gene locus_tag LOCUS_17220 7309 6533 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_17220 7846 7337 gene locus_tag LOCUS_17230 7846 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 8423 7911 gene locus_tag LOCUS_17240 8423 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 10314 8638 gene locus_tag LOCUS_17250 10314 8638 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_17250 11571 10354 gene locus_tag LOCUS_17260 11571 10354 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_17260 12644 11589 gene locus_tag LOCUS_17270 12644 11589 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_17270 14377 12677 gene locus_tag LOCUS_17280 14377 12677 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460315.1 protein_id gnl|my_center|LOCUS_17280 14534 14388 gene locus_tag LOCUS_17290 14534 14388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 15806 14565 gene locus_tag LOCUS_17300 15806 14565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 16435 15848 gene locus_tag LOCUS_17310 gene hisB 16435 15848 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964256.1 protein_id gnl|my_center|LOCUS_17310 17237 16515 gene locus_tag LOCUS_17320 gene trmD 17237 16515 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_17320 17782 17234 gene locus_tag LOCUS_17330 gene rimM 17782 17234 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_17330 18112 17885 gene locus_tag LOCUS_17340 18112 17885 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419342.1 protein_id gnl|my_center|LOCUS_17340 18394 18149 gene locus_tag LOCUS_17350 gene rpsP 18394 18149 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_17350 19813 18467 gene locus_tag LOCUS_17360 gene ffh 19813 18467 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362591.1 protein_id gnl|my_center|LOCUS_17360 20193 19837 gene locus_tag LOCUS_17370 20193 19837 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891062.1 protein_id gnl|my_center|LOCUS_17370 20511 20293 gene locus_tag LOCUS_17380 20511 20293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 22707 20656 gene locus_tag LOCUS_17390 22707 20656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 23868 22726 gene locus_tag LOCUS_17400 23868 22726 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_17400 25394 23985 gene locus_tag LOCUS_17410 25394 23985 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence34 190 2127 gene locus_tag LOCUS_17420 190 2127 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_17420 3612 2206 gene locus_tag LOCUS_17430 3612 2206 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262172.1 protein_id gnl|my_center|LOCUS_17430 4767 3649 gene locus_tag LOCUS_17440 gene hemW 4767 3649 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454756.1 protein_id gnl|my_center|LOCUS_17440 6595 4778 gene locus_tag LOCUS_17450 gene lepA 6595 4778 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416556.1 protein_id gnl|my_center|LOCUS_17450 6776 7552 gene locus_tag LOCUS_17460 6776 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 7649 8860 gene locus_tag LOCUS_17470 7649 8860 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_17470 9930 8968 gene locus_tag LOCUS_17480 9930 8968 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 protein_id gnl|my_center|LOCUS_17480 10432 10271 gene locus_tag LOCUS_17490 10432 10271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 10809 10420 gene locus_tag LOCUS_17500 10809 10420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 11964 10954 gene locus_tag LOCUS_17510 11964 10954 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_17510 12694 11984 gene locus_tag LOCUS_17520 12694 11984 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_17520 13455 12790 gene locus_tag LOCUS_17530 13455 12790 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_17530 15381 13531 gene locus_tag LOCUS_17540 15381 13531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 15935 15381 gene locus_tag LOCUS_17550 15935 15381 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761174.1 protein_id gnl|my_center|LOCUS_17550 17065 15953 gene locus_tag LOCUS_17560 gene aroB 17065 15953 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420740.1 protein_id gnl|my_center|LOCUS_17560 19321 17267 gene locus_tag LOCUS_17570 19321 17267 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964908.1 protein_id gnl|my_center|LOCUS_17570 20437 19376 gene locus_tag LOCUS_17580 20437 19376 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_17580 20995 22815 gene locus_tag LOCUS_17590 gene glmS 20995 22815 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_17590 24815 22911 gene locus_tag LOCUS_17600 24815 22911 CDS product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095164.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence35 1307 57 gene locus_tag LOCUS_17610 1307 57 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_17610 1829 1323 gene locus_tag LOCUS_17620 1829 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 2310 1834 gene locus_tag LOCUS_17630 2310 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 2856 2311 gene locus_tag LOCUS_17640 gene pgsA 2856 2311 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362543.1 protein_id gnl|my_center|LOCUS_17640 4193 2853 gene locus_tag LOCUS_17650 gene rimO 4193 2853 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_17650 5029 4190 gene locus_tag LOCUS_17660 gene folD 5029 4190 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722487.1 protein_id gnl|my_center|LOCUS_17660 5195 5473 gene locus_tag LOCUS_17670 5195 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 5507 9271 gene locus_tag LOCUS_17680 5507 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 9357 9548 gene locus_tag LOCUS_17690 9357 9548 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393332.1 protein_id gnl|my_center|LOCUS_17690 10386 9628 gene locus_tag LOCUS_17700 10386 9628 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764454.1 protein_id gnl|my_center|LOCUS_17700 11844 10402 gene locus_tag LOCUS_17710 11844 10402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 12028 13335 gene locus_tag LOCUS_17720 12028 13335 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_17720 13423 13683 gene locus_tag LOCUS_17730 13423 13683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 15774 13789 gene locus_tag LOCUS_17740 15774 13789 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226188.1 protein_id gnl|my_center|LOCUS_17740 16847 15798 gene locus_tag LOCUS_17750 16847 15798 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_17750 17461 16844 gene locus_tag LOCUS_17760 17461 16844 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_17760 18309 17488 gene locus_tag LOCUS_17770 gene pgeF 18309 17488 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_17770 18418 18287 gene locus_tag LOCUS_17780 18418 18287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 18408 19232 gene locus_tag LOCUS_17790 18408 19232 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678767.1 protein_id gnl|my_center|LOCUS_17790 19878 19249 gene locus_tag LOCUS_17800 19878 19249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 20968 19886 gene locus_tag LOCUS_17810 20968 19886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 24843 21109 gene locus_tag LOCUS_17820 24843 21109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence36 476 231 gene locus_tag LOCUS_17830 476 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 1198 539 gene locus_tag LOCUS_17840 1198 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2290 1286 gene locus_tag LOCUS_17850 2290 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 2384 2241 gene locus_tag LOCUS_17860 2384 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3773 2844 gene locus_tag LOCUS_17870 gene tsf 3773 2844 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384678.1 protein_id gnl|my_center|LOCUS_17870 4583 3843 gene locus_tag LOCUS_17880 gene rpsB 4583 3843 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_17880 5289 4765 gene locus_tag LOCUS_17890 5289 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 6116 5286 gene locus_tag LOCUS_17900 6116 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 6445 6140 gene locus_tag LOCUS_17910 6445 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 8067 6469 gene locus_tag LOCUS_17920 8067 6469 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870047.1 protein_id gnl|my_center|LOCUS_17920 8854 8090 gene locus_tag LOCUS_17930 gene whiG 8854 8090 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_17930 9212 8871 gene locus_tag LOCUS_17940 9212 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 9722 9237 gene locus_tag LOCUS_17950 9722 9237 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541375.1 protein_id gnl|my_center|LOCUS_17950 10186 9719 gene locus_tag LOCUS_17960 10186 9719 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_17960 12312 10198 gene locus_tag LOCUS_17970 gene cheA 12312 10198 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245734.1 protein_id gnl|my_center|LOCUS_17970 13410 12325 gene locus_tag LOCUS_17980 gene cheB 13410 12325 CDS product protein-glutamate O-methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245823.1 protein_id gnl|my_center|LOCUS_17980 14167 13415 gene locus_tag LOCUS_17990 14167 13415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 15090 14194 gene locus_tag LOCUS_18000 15090 14194 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073096.1 protein_id gnl|my_center|LOCUS_18000 16367 15111 gene locus_tag LOCUS_18010 gene flhF 16367 15111 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965445.1 protein_id gnl|my_center|LOCUS_18010 18400 16364 gene locus_tag LOCUS_18020 gene flhA 18400 16364 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_18020 19570 18464 gene locus_tag LOCUS_18030 gene flhB 19570 18464 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_18030 20364 19594 gene locus_tag LOCUS_18040 gene fliR 20364 19594 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_18040 20639 20367 gene locus_tag LOCUS_18050 gene fliQ 20639 20367 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435976.1 protein_id gnl|my_center|LOCUS_18050 21512 20655 gene locus_tag LOCUS_18060 21512 20655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 21878 21528 gene locus_tag LOCUS_18070 21878 21528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 22243 21881 gene locus_tag LOCUS_18080 22243 21881 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816218.1 protein_id gnl|my_center|LOCUS_18080 23445 22264 gene locus_tag LOCUS_18090 23445 22264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 24430 23450 gene locus_tag LOCUS_18100 gene fliM 24430 23450 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183958.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence37 231 725 gene locus_tag LOCUS_18110 231 725 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_18110 793 1890 gene locus_tag LOCUS_18120 793 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 1932 2195 gene locus_tag LOCUS_18130 1932 2195 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419469.1 protein_id gnl|my_center|LOCUS_18130 2206 2547 gene locus_tag LOCUS_18140 2206 2547 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357860.1 protein_id gnl|my_center|LOCUS_18140 2525 5272 gene locus_tag LOCUS_18150 2525 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 5269 5640 gene locus_tag LOCUS_18160 gene rbfA 5269 5640 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_18160 5675 6649 gene locus_tag LOCUS_18170 5675 6649 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986790.1 protein_id gnl|my_center|LOCUS_18170 6667 7572 gene locus_tag LOCUS_18180 gene truB 6667 7572 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294474.1 protein_id gnl|my_center|LOCUS_18180 7582 8478 gene locus_tag LOCUS_18190 7582 8478 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012163110.1 protein_id gnl|my_center|LOCUS_18190 9905 8499 gene locus_tag LOCUS_18200 9905 8499 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348025.1 protein_id gnl|my_center|LOCUS_18200 9987 11783 gene locus_tag LOCUS_18210 9987 11783 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_18210 11906 13801 gene locus_tag LOCUS_18220 11906 13801 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680888.1 protein_id gnl|my_center|LOCUS_18220 13779 15647 gene locus_tag LOCUS_18230 13779 15647 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680887.1 protein_id gnl|my_center|LOCUS_18230 15772 17667 gene locus_tag LOCUS_18240 15772 17667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 17664 18281 gene locus_tag LOCUS_18250 17664 18281 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_18250 18786 18361 gene locus_tag LOCUS_18260 18786 18361 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963521.1 protein_id gnl|my_center|LOCUS_18260 20172 18820 gene locus_tag LOCUS_18270 20172 18820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 20442 21668 gene locus_tag LOCUS_18280 20442 21668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 21805 22734 gene locus_tag LOCUS_18290 21805 22734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence38 1294 98 gene locus_tag LOCUS_18300 1294 98 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_18300 2475 1459 gene locus_tag LOCUS_18310 gene gap 2475 1459 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_18310 4099 2663 gene locus_tag LOCUS_18320 gene glgA 4099 2663 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860977.1 protein_id gnl|my_center|LOCUS_18320 5611 4229 gene locus_tag LOCUS_18330 5611 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 7077 5641 gene locus_tag LOCUS_18340 7077 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 7703 7197 gene locus_tag LOCUS_18350 7703 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 9159 7705 gene locus_tag LOCUS_18360 9159 7705 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964815.1 protein_id gnl|my_center|LOCUS_18360 9814 9143 gene locus_tag LOCUS_18370 9814 9143 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_18370 10618 9827 gene locus_tag LOCUS_18380 gene spo0A 10618 9827 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_18380 12955 10853 gene locus_tag LOCUS_18390 12955 10853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 14344 13100 gene locus_tag LOCUS_18400 gene spoIVB 14344 13100 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_18400 16098 14425 gene locus_tag LOCUS_18410 gene recN 16098 14425 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699855.1 protein_id gnl|my_center|LOCUS_18410 20311 16169 gene locus_tag LOCUS_18420 20311 16169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 20491 21135 gene locus_tag LOCUS_18430 20491 21135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 23170 21197 gene locus_tag LOCUS_18440 23170 21197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 >Feature sequence39 1885 116 gene locus_tag LOCUS_18450 gene argS 1885 116 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_18450 3264 1918 gene locus_tag LOCUS_18460 gene aroA 3264 1918 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332883.1 protein_id gnl|my_center|LOCUS_18460 4356 3415 gene locus_tag LOCUS_18470 4356 3415 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_18470 5180 4344 gene locus_tag LOCUS_18480 5180 4344 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_18480 5850 5197 gene locus_tag LOCUS_18490 gene fsa 5850 5197 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722103.1 protein_id gnl|my_center|LOCUS_18490 7514 5952 gene locus_tag LOCUS_18500 7514 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 9292 7511 gene locus_tag LOCUS_18510 9292 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 10931 9327 gene locus_tag LOCUS_18520 10931 9327 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_18520 11202 12131 gene locus_tag LOCUS_18530 gene arcC 11202 12131 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037992.1 protein_id gnl|my_center|LOCUS_18530 13839 12235 gene locus_tag LOCUS_18540 13839 12235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 15274 13865 gene locus_tag LOCUS_18550 15274 13865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 15655 15386 gene locus_tag LOCUS_18560 15655 15386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 16250 16104 gene locus_tag LOCUS_18570 16250 16104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 17231 16497 gene locus_tag LOCUS_18580 17231 16497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 18010 17270 gene locus_tag LOCUS_18590 18010 17270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 20065 18029 gene locus_tag LOCUS_18600 20065 18029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 21310 20105 gene locus_tag LOCUS_18610 21310 20105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence40 85 1506 gene locus_tag LOCUS_18620 gene hydG 85 1506 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_18620 1520 2218 gene locus_tag LOCUS_18630 gene vanR 1520 2218 CDS product vancomycin resistance response regulator transcriptoin factor VanR-G-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436401.1 protein_id gnl|my_center|LOCUS_18630 2211 3185 gene locus_tag LOCUS_18640 2211 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 3362 3538 gene locus_tag LOCUS_18650 3362 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 3519 4130 gene locus_tag LOCUS_18660 3519 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 4363 4803 gene locus_tag LOCUS_18670 4363 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 4821 5294 gene locus_tag LOCUS_18680 4821 5294 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816021.1 protein_id gnl|my_center|LOCUS_18680 5296 6087 gene locus_tag LOCUS_18690 5296 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 6119 7501 gene locus_tag LOCUS_18700 6119 7501 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_18700 7510 8127 gene locus_tag LOCUS_18710 7510 8127 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_18710 8460 8263 gene locus_tag LOCUS_18720 gene cspC 8460 8263 CDS product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001990088.1 protein_id gnl|my_center|LOCUS_18720 8680 11601 gene locus_tag LOCUS_18730 8680 11601 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_18730 11636 12538 gene locus_tag LOCUS_18740 gene era 11636 12538 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047995.1 protein_id gnl|my_center|LOCUS_18740 12671 12856 gene locus_tag LOCUS_18750 12671 12856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 12822 13568 gene locus_tag LOCUS_18760 12822 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 14312 13590 gene locus_tag LOCUS_18770 14312 13590 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948330.1 protein_id gnl|my_center|LOCUS_18770 14775 14314 gene locus_tag LOCUS_18780 14775 14314 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948329.1 protein_id gnl|my_center|LOCUS_18780 15008 16921 gene locus_tag LOCUS_18790 15008 16921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 16985 18376 gene locus_tag LOCUS_18800 16985 18376 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_18800 18414 19349 gene locus_tag LOCUS_18810 18414 19349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 19407 20270 gene locus_tag LOCUS_18820 19407 20270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 21116 20277 gene locus_tag LOCUS_18830 21116 20277 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837508.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence41 30 206 gene locus_tag LOCUS_18840 30 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 867 1253 gene locus_tag LOCUS_18850 867 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 1798 2328 gene locus_tag LOCUS_18860 1798 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 2368 3963 gene locus_tag LOCUS_18870 2368 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18870 4171 4563 gene locus_tag LOCUS_18880 4171 4563 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358764.1 protein_id gnl|my_center|LOCUS_18880 4894 5343 gene locus_tag LOCUS_18890 4894 5343 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458819.1 protein_id gnl|my_center|LOCUS_18890 5407 5754 gene locus_tag LOCUS_18900 5407 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 5855 6598 gene locus_tag LOCUS_18910 5855 6598 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780022.1 protein_id gnl|my_center|LOCUS_18910 6696 7121 gene locus_tag LOCUS_18920 6696 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 7686 7384 gene locus_tag LOCUS_18930 7686 7384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 8107 8637 gene locus_tag LOCUS_18940 8107 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18940 8865 9365 gene locus_tag LOCUS_18950 8865 9365 CDS product CatA-like O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021707.1 protein_id gnl|my_center|LOCUS_18950 9343 9696 gene locus_tag LOCUS_18960 9343 9696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 9767 10054 gene locus_tag LOCUS_18970 9767 10054 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922237.1 protein_id gnl|my_center|LOCUS_18970 10252 12423 gene locus_tag LOCUS_18980 10252 12423 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966127.1 protein_id gnl|my_center|LOCUS_18980 12457 13629 gene locus_tag LOCUS_18990 12457 13629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 15754 13622 gene locus_tag LOCUS_19000 15754 13622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 15884 16354 gene locus_tag LOCUS_19010 15884 16354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 16347 16826 gene locus_tag LOCUS_19020 gene tsaE 16347 16826 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_19020 16823 17545 gene locus_tag LOCUS_19030 gene tsaB 16823 17545 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966124.1 protein_id gnl|my_center|LOCUS_19030 17634 17861 gene locus_tag LOCUS_19040 17634 17861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 18031 18399 gene locus_tag LOCUS_19050 18031 18399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 18473 19393 gene locus_tag LOCUS_19060 18473 19393 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_19060 19408 20031 gene locus_tag LOCUS_19070 19408 20031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 20085 21113 gene locus_tag LOCUS_19080 gene tsaD 20085 21113 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_19080 21198 21285 gene locus_tag LOCUS_t00220 21198 21285 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 21328 21418 gene locus_tag LOCUS_t00230 21328 21418 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence42 568 840 gene locus_tag LOCUS_19090 568 840 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416105.1 protein_id gnl|my_center|LOCUS_19090 938 1399 gene locus_tag LOCUS_19100 gene nrdR 938 1399 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_19100 1469 2998 gene locus_tag LOCUS_19110 1469 2998 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_19110 2995 4119 gene locus_tag LOCUS_19120 gene dprA 2995 4119 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_19120 4250 6316 gene locus_tag LOCUS_19130 gene topA 4250 6316 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_19130 6377 7156 gene locus_tag LOCUS_19140 gene codY 6377 7156 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438268.1 protein_id gnl|my_center|LOCUS_19140 7256 7645 gene locus_tag LOCUS_19150 gene flgB 7256 7645 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214564.1 protein_id gnl|my_center|LOCUS_19150 7691 8128 gene locus_tag LOCUS_19160 gene flgC 7691 8128 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245521.1 protein_id gnl|my_center|LOCUS_19160 8146 8469 gene locus_tag LOCUS_19170 gene fliE 8146 8469 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301376.1 protein_id gnl|my_center|LOCUS_19170 8503 10146 gene locus_tag LOCUS_19180 8503 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 10147 11166 gene locus_tag LOCUS_19190 gene fliG 10147 11166 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932791.1 protein_id gnl|my_center|LOCUS_19190 11159 11959 gene locus_tag LOCUS_19200 11159 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 12011 13348 gene locus_tag LOCUS_19210 gene fliI 12011 13348 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082899.1 protein_id gnl|my_center|LOCUS_19210 13359 13811 gene locus_tag LOCUS_19220 13359 13811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 13832 14590 gene locus_tag LOCUS_19230 13832 14590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 14698 16056 gene locus_tag LOCUS_19240 14698 16056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 16071 16889 gene locus_tag LOCUS_19250 16071 16889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 16908 17288 gene locus_tag LOCUS_19260 16908 17288 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392299.1 protein_id gnl|my_center|LOCUS_19260 17375 18871 gene locus_tag LOCUS_19270 17375 18871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 19013 19201 gene locus_tag LOCUS_19280 19013 19201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 19214 20026 gene locus_tag LOCUS_19290 19214 20026 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870068.1 protein_id gnl|my_center|LOCUS_19290 20026 20889 gene locus_tag LOCUS_19300 20026 20889 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435983.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence43 218 1267 gene locus_tag LOCUS_19310 218 1267 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947984.1 protein_id gnl|my_center|LOCUS_19310 1281 1730 gene locus_tag LOCUS_19320 1281 1730 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697334.1 protein_id gnl|my_center|LOCUS_19320 1735 2160 gene locus_tag LOCUS_19330 gene rpiB 1735 2160 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966164.1 protein_id gnl|my_center|LOCUS_19330 2172 2963 gene locus_tag LOCUS_19340 gene proC 2172 2963 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 protein_id gnl|my_center|LOCUS_19340 2975 3274 gene locus_tag LOCUS_19350 2975 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 3246 3662 gene locus_tag LOCUS_19360 3246 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 3770 4417 gene locus_tag LOCUS_19370 gene atpB 3770 4417 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_19370 4480 4731 gene locus_tag LOCUS_19380 4480 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 4774 5295 gene locus_tag LOCUS_19390 4774 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 5283 5846 gene locus_tag LOCUS_19400 5283 5846 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_19400 5925 7439 gene locus_tag LOCUS_19410 gene atpA 5925 7439 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462231.1 protein_id gnl|my_center|LOCUS_19410 7454 8350 gene locus_tag LOCUS_19420 gene atpG 7454 8350 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_19420 8397 9812 gene locus_tag LOCUS_19430 gene atpD 8397 9812 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_19430 9855 10265 gene locus_tag LOCUS_19440 9855 10265 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966148.1 protein_id gnl|my_center|LOCUS_19440 10462 10941 gene locus_tag LOCUS_19450 10462 10941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 11433 10990 gene locus_tag LOCUS_19460 11433 10990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 11603 12235 gene locus_tag LOCUS_19470 gene spoIIR 11603 12235 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947973.1 protein_id gnl|my_center|LOCUS_19470 12410 13501 gene locus_tag LOCUS_19480 12410 13501 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_19480 13519 13944 gene locus_tag LOCUS_19490 13519 13944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 13955 14794 gene locus_tag LOCUS_19500 gene dapF 13955 14794 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077385.1 protein_id gnl|my_center|LOCUS_19500 14791 15564 gene locus_tag LOCUS_19510 14791 15564 CDS product DUF4253 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016498.1 protein_id gnl|my_center|LOCUS_19510 15658 16365 gene locus_tag LOCUS_19520 15658 16365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 17316 16369 gene locus_tag LOCUS_19530 17316 16369 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599434.1 protein_id gnl|my_center|LOCUS_19530 17530 18225 gene locus_tag LOCUS_19540 17530 18225 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 protein_id gnl|my_center|LOCUS_19540 18197 18955 gene locus_tag LOCUS_19550 18197 18955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 19977 18952 gene locus_tag LOCUS_19560 19977 18952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 19943 20086 gene locus_tag LOCUS_19570 19943 20086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 20083 20217 gene locus_tag LOCUS_19580 20083 20217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 20370 20924 gene locus_tag LOCUS_19590 20370 20924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 >Feature sequence44 107 178 gene locus_tag LOCUS_t00240 107 178 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 309 584 gene locus_tag LOCUS_19600 309 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 697 1560 gene locus_tag LOCUS_19610 gene fba 697 1560 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_19610 1655 1864 gene locus_tag LOCUS_19620 1655 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 2053 2376 gene locus_tag LOCUS_19630 2053 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 2446 3615 gene locus_tag LOCUS_19640 2446 3615 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423769.1 protein_id gnl|my_center|LOCUS_19640 3612 4214 gene locus_tag LOCUS_19650 gene rdgB 3612 4214 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940412.1 protein_id gnl|my_center|LOCUS_19650 4211 4714 gene locus_tag LOCUS_19660 4211 4714 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775449.1 protein_id gnl|my_center|LOCUS_19660 5214 4738 gene locus_tag LOCUS_19670 5214 4738 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_19670 5378 5788 gene locus_tag LOCUS_19680 gene ytrA 5378 5788 CDS product GntR family transcriptional regulator YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229121.1 protein_id gnl|my_center|LOCUS_19680 5763 6662 gene locus_tag LOCUS_19690 5763 6662 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_19690 6655 7743 gene locus_tag LOCUS_19700 6655 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 7746 8786 gene locus_tag LOCUS_19710 7746 8786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 9239 12394 gene locus_tag LOCUS_19720 gene ileS 9239 12394 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986028.1 protein_id gnl|my_center|LOCUS_19720 12418 14880 gene locus_tag LOCUS_19730 12418 14880 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_19730 14925 15641 gene locus_tag LOCUS_19740 14925 15641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 15797 16429 gene locus_tag LOCUS_19750 15797 16429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 16937 16413 gene locus_tag LOCUS_19760 16937 16413 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817206.1 protein_id gnl|my_center|LOCUS_19760 17359 16952 gene locus_tag LOCUS_19770 17359 16952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 17613 17762 gene locus_tag LOCUS_19780 gene rpmG 17613 17762 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_19780 17798 18001 gene locus_tag LOCUS_19790 17798 18001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 18011 18529 gene locus_tag LOCUS_19800 gene nusG 18011 18529 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966426.1 protein_id gnl|my_center|LOCUS_19800 18551 18976 gene locus_tag LOCUS_19810 gene rplK 18551 18976 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_19810 19163 19855 gene locus_tag LOCUS_19820 gene rplA 19163 19855 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence45 194 352 gene locus_tag LOCUS_19830 194 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 698 1021 gene locus_tag LOCUS_19840 698 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1109 1471 gene locus_tag LOCUS_19850 1109 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 1493 2758 gene locus_tag LOCUS_19860 1493 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2880 3581 gene locus_tag LOCUS_19870 2880 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 3683 4426 gene locus_tag LOCUS_19880 3683 4426 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_19880 4428 5591 gene locus_tag LOCUS_19890 4428 5591 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_19890 5611 6792 gene locus_tag LOCUS_19900 gene thiI 5611 6792 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_19900 7143 6910 gene locus_tag LOCUS_19910 7143 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 7311 8612 gene locus_tag LOCUS_19920 gene mtaB 7311 8612 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964598.1 protein_id gnl|my_center|LOCUS_19920 8681 8980 gene locus_tag LOCUS_19930 8681 8980 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025772973.1 protein_id gnl|my_center|LOCUS_19930 8987 9406 gene locus_tag LOCUS_19940 gene ruvX 8987 9406 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810863.1 protein_id gnl|my_center|LOCUS_19940 9430 9696 gene locus_tag LOCUS_19950 9430 9696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 9732 11405 gene locus_tag LOCUS_19960 9732 11405 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_19960 11409 11771 gene locus_tag LOCUS_19970 11409 11771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 11799 12470 gene locus_tag LOCUS_19980 11799 12470 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288107.1 protein_id gnl|my_center|LOCUS_19980 12457 13692 gene locus_tag LOCUS_19990 12457 13692 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_19990 13689 14687 gene locus_tag LOCUS_20000 13689 14687 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_20000 14706 15977 gene locus_tag LOCUS_20010 gene hflX 14706 15977 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895824.1 protein_id gnl|my_center|LOCUS_20010 16010 17320 gene locus_tag LOCUS_20020 16010 17320 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_20020 19044 17374 gene locus_tag LOCUS_20030 19044 17374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence46 1053 22 gene locus_tag LOCUS_20040 gene queA 1053 22 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_20040 2650 1100 gene locus_tag LOCUS_20050 2650 1100 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_20050 2841 4349 gene locus_tag LOCUS_20060 2841 4349 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814148.1 protein_id gnl|my_center|LOCUS_20060 4402 6489 gene locus_tag LOCUS_20070 4402 6489 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_20070 7079 6429 gene locus_tag LOCUS_20080 7079 6429 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889235.1 protein_id gnl|my_center|LOCUS_20080 7805 7095 gene locus_tag LOCUS_20090 7805 7095 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234916.1 protein_id gnl|my_center|LOCUS_20090 7880 8464 gene locus_tag LOCUS_20100 7880 8464 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886565.1 protein_id gnl|my_center|LOCUS_20100 9315 8467 gene locus_tag LOCUS_20110 9315 8467 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_20110 9461 10183 gene locus_tag LOCUS_20120 9461 10183 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964798.1 protein_id gnl|my_center|LOCUS_20120 10173 11219 gene locus_tag LOCUS_20130 10173 11219 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890975.1 protein_id gnl|my_center|LOCUS_20130 11255 11878 gene locus_tag LOCUS_20140 11255 11878 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964116.1 protein_id gnl|my_center|LOCUS_20140 11888 12766 gene locus_tag LOCUS_20150 11888 12766 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964117.1 protein_id gnl|my_center|LOCUS_20150 14862 12904 gene locus_tag LOCUS_20160 14862 12904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 16471 15776 gene locus_tag LOCUS_20170 16471 15776 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433732.1 protein_id gnl|my_center|LOCUS_20170 18442 16490 gene locus_tag LOCUS_20180 18442 16490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 18897 18529 gene locus_tag LOCUS_20190 18897 18529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 >Feature sequence47 567 13 gene locus_tag LOCUS_20200 567 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 1117 575 gene locus_tag LOCUS_20210 1117 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 2087 1305 gene locus_tag LOCUS_20220 gene trpA 2087 1305 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_20220 3270 2080 gene locus_tag LOCUS_20230 gene trpB 3270 2080 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_20230 4114 3308 gene locus_tag LOCUS_20240 gene trpC 4114 3308 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_20240 5142 4111 gene locus_tag LOCUS_20250 gene trpD 5142 4111 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_20250 5754 5182 gene locus_tag LOCUS_20260 5754 5182 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966439.1 protein_id gnl|my_center|LOCUS_20260 7217 5751 gene locus_tag LOCUS_20270 gene trpE 7217 5751 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_20270 7528 7310 gene locus_tag LOCUS_20280 7528 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 7944 7654 gene locus_tag LOCUS_20290 7944 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 8449 8066 gene locus_tag LOCUS_20300 8449 8066 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811644.1 protein_id gnl|my_center|LOCUS_20300 11565 8476 gene locus_tag LOCUS_20310 11565 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 12546 11584 gene locus_tag LOCUS_20320 12546 11584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 13296 12952 gene locus_tag LOCUS_20330 13296 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 13526 13888 gene locus_tag LOCUS_20340 13526 13888 CDS product Imm51 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787134.1 protein_id gnl|my_center|LOCUS_20340 14457 13999 gene locus_tag LOCUS_20350 14457 13999 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094613.1 protein_id gnl|my_center|LOCUS_20350 15209 14493 gene locus_tag LOCUS_20360 gene trpA 15209 14493 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640398.1 protein_id gnl|my_center|LOCUS_20360 16373 15225 gene locus_tag LOCUS_20370 16373 15225 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_20370 17173 16385 gene locus_tag LOCUS_20380 17173 16385 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257265.1 protein_id gnl|my_center|LOCUS_20380 17939 17181 gene locus_tag LOCUS_20390 17939 17181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence48 249 3095 gene locus_tag LOCUS_20400 249 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 3098 3541 gene locus_tag LOCUS_20410 3098 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 5700 3637 gene locus_tag LOCUS_20420 5700 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 5644 5850 gene locus_tag LOCUS_20430 5644 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 5918 6736 gene locus_tag LOCUS_20440 5918 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 6894 6822 gene locus_tag LOCUS_t00250 6894 6822 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 7255 7184 gene locus_tag LOCUS_t00260 7255 7184 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9084 7354 gene locus_tag LOCUS_20450 9084 7354 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_20450 9316 10098 gene locus_tag LOCUS_20460 9316 10098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 10240 10154 gene locus_tag LOCUS_t00270 10240 10154 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10401 10526 gene locus_tag LOCUS_20470 10401 10526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 10652 11689 gene locus_tag LOCUS_20480 gene bsh 10652 11689 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723950.1 protein_id gnl|my_center|LOCUS_20480 11860 12381 gene locus_tag LOCUS_20490 11860 12381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 12518 13030 gene locus_tag LOCUS_20500 12518 13030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 13043 13453 gene locus_tag LOCUS_20510 13043 13453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 13547 13957 gene locus_tag LOCUS_20520 13547 13957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 14099 14569 gene locus_tag LOCUS_20530 14099 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 14791 15147 gene locus_tag LOCUS_20540 14791 15147 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356722.1 protein_id gnl|my_center|LOCUS_20540 15134 16150 gene locus_tag LOCUS_20550 15134 16150 CDS product permease prefix domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387089.1 protein_id gnl|my_center|LOCUS_20550 16150 16920 gene locus_tag LOCUS_20560 16150 16920 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279626.1 protein_id gnl|my_center|LOCUS_20560 17882 16932 gene locus_tag LOCUS_20570 gene prmA 17882 16932 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861555.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence49 49 255 gene locus_tag LOCUS_20580 49 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 466 2718 gene locus_tag LOCUS_20590 gene pflB 466 2718 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_20590 2731 3486 gene locus_tag LOCUS_20600 gene pflA 2731 3486 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_20600 3486 4220 gene locus_tag LOCUS_20610 3486 4220 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 protein_id gnl|my_center|LOCUS_20610 4498 5787 gene locus_tag LOCUS_20620 4498 5787 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_20620 5808 7085 gene locus_tag LOCUS_20630 5808 7085 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_20630 7182 7730 gene locus_tag LOCUS_20640 gene folE 7182 7730 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380915.1 protein_id gnl|my_center|LOCUS_20640 7886 9175 gene locus_tag LOCUS_20650 7886 9175 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007785170.1 protein_id gnl|my_center|LOCUS_20650 9205 10014 gene locus_tag LOCUS_20660 gene folP 9205 10014 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966209.1 protein_id gnl|my_center|LOCUS_20660 10035 10859 gene locus_tag LOCUS_20670 gene folK 10035 10859 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016121.1 protein_id gnl|my_center|LOCUS_20670 10856 11983 gene locus_tag LOCUS_20680 gene pheA 10856 11983 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_20680 12117 13292 gene locus_tag LOCUS_20690 gene htrB 12117 13292 CDS product serine protease Do-like protein HtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228534.1 protein_id gnl|my_center|LOCUS_20690 13411 14856 gene locus_tag LOCUS_20700 gene miaB 13411 14856 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_20700 15479 14955 gene locus_tag LOCUS_20710 15479 14955 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_20710 15710 16501 gene locus_tag LOCUS_20720 gene spoIIGA 15710 16501 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232163.1 protein_id gnl|my_center|LOCUS_20720 16522 17268 gene locus_tag LOCUS_20730 gene sigE 16522 17268 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774280.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence50 851 108 gene locus_tag LOCUS_20740 gene fabG 851 108 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_20740 1802 867 gene locus_tag LOCUS_20750 gene fabD 1802 867 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_20750 2163 1933 gene locus_tag LOCUS_20760 gene acpP 2163 1933 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965054.1 protein_id gnl|my_center|LOCUS_20760 3752 2328 gene locus_tag LOCUS_20770 3752 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 4401 3853 gene locus_tag LOCUS_20780 4401 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 4589 7150 gene locus_tag LOCUS_20790 4589 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 7152 7988 gene locus_tag LOCUS_20800 7152 7988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 8222 8986 gene locus_tag LOCUS_20810 8222 8986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 8958 10016 gene locus_tag LOCUS_20820 8958 10016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 10143 10388 gene locus_tag LOCUS_20830 10143 10388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 10393 10917 gene locus_tag LOCUS_20840 10393 10917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 10972 11241 gene locus_tag LOCUS_20850 10972 11241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 11241 11381 gene locus_tag LOCUS_20860 11241 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 12517 11915 gene locus_tag LOCUS_20870 12517 11915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 13223 12621 gene locus_tag LOCUS_20880 13223 12621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 13929 13327 gene locus_tag LOCUS_20890 13929 13327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 14635 14033 gene locus_tag LOCUS_20900 14635 14033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence51 138 1478 gene locus_tag LOCUS_20910 138 1478 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944264.1 protein_id gnl|my_center|LOCUS_20910 4377 1582 gene locus_tag LOCUS_20920 4377 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 4720 4538 gene locus_tag LOCUS_20930 gene rpmF 4720 4538 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_20930 5987 4797 gene locus_tag LOCUS_20940 5987 4797 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_20940 7034 6123 gene locus_tag LOCUS_20950 7034 6123 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_20950 7944 7063 gene locus_tag LOCUS_20960 7944 7063 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_20960 8082 8975 gene locus_tag LOCUS_20970 gene ylbJ 8082 8975 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965047.1 protein_id gnl|my_center|LOCUS_20970 9629 8958 gene locus_tag LOCUS_20980 9629 8958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 10220 9666 gene locus_tag LOCUS_20990 gene rsmD 10220 9666 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_20990 12359 10323 gene locus_tag LOCUS_21000 gene recG 12359 10323 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_21000 12866 12503 gene locus_tag LOCUS_tm00010 12866 12503 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 13451 12984 gene locus_tag LOCUS_21010 gene smpB 13451 12984 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421925.1 protein_id gnl|my_center|LOCUS_21010 15601 13427 gene locus_tag LOCUS_21020 gene rnr 15601 13427 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_21020 15988 15743 gene locus_tag LOCUS_21030 15988 15743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 <17021 15994 gene locus_tag LOCUS_21040 <17021 15994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965000.1:cell division protein FtsZ >Feature sequence52 260 2317 gene locus_tag LOCUS_21050 260 2317 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_21050 2314 2760 gene locus_tag LOCUS_21060 gene rplI 2314 2760 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_21060 2804 4153 gene locus_tag LOCUS_21070 gene dnaB 2804 4153 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_21070 4284 4889 gene locus_tag LOCUS_21080 4284 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 4901 5341 gene locus_tag LOCUS_21090 4901 5341 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293091.1 protein_id gnl|my_center|LOCUS_21090 5365 6162 gene locus_tag LOCUS_21100 gene rlmB 5365 6162 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200237.1 protein_id gnl|my_center|LOCUS_21100 6155 6778 gene locus_tag LOCUS_21110 gene sigH 6155 6778 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966312.1 protein_id gnl|my_center|LOCUS_21110 6832 6760 gene locus_tag LOCUS_t00280 6832 6760 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6938 9106 gene locus_tag LOCUS_21120 6938 9106 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948921.1 protein_id gnl|my_center|LOCUS_21120 9568 9089 gene locus_tag LOCUS_21130 gene ispF 9568 9089 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_21130 9708 9633 gene locus_tag LOCUS_t00290 9708 9633 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9848 9774 gene locus_tag LOCUS_t00300 9848 9774 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11041 10016 gene locus_tag LOCUS_21140 gene rbsR 11041 10016 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703923.1 protein_id gnl|my_center|LOCUS_21140 11850 11068 gene locus_tag LOCUS_21150 11850 11068 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963435.1 protein_id gnl|my_center|LOCUS_21150 12629 11847 gene locus_tag LOCUS_21160 12629 11847 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963434.1 protein_id gnl|my_center|LOCUS_21160 13599 12604 gene locus_tag LOCUS_21170 13599 12604 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963433.1 protein_id gnl|my_center|LOCUS_21170 14579 13827 gene locus_tag LOCUS_21180 14579 13827 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292113.1 protein_id gnl|my_center|LOCUS_21180 15273 14563 gene locus_tag LOCUS_21190 15273 14563 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_21190 16215 15316 gene locus_tag LOCUS_21200 16215 15316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence53 76 663 gene locus_tag LOCUS_21210 76 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 897 5462 gene locus_tag LOCUS_21220 gene gltB 897 5462 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_21220 5515 6996 gene locus_tag LOCUS_21230 5515 6996 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_21230 7028 8335 gene locus_tag LOCUS_21240 gene glnA 7028 8335 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_21240 8368 8895 gene locus_tag LOCUS_21250 8368 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 9011 10144 gene locus_tag LOCUS_21260 gene carA 9011 10144 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105665.1 protein_id gnl|my_center|LOCUS_21260 10137 13367 gene locus_tag LOCUS_21270 gene carB 10137 13367 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_21270 13367 13576 gene locus_tag LOCUS_21280 13367 13576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 13503 13769 gene locus_tag LOCUS_21290 gene rpsO 13503 13769 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_21290 13850 14320 gene locus_tag LOCUS_21300 13850 14320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 14494 16242 gene locus_tag LOCUS_21310 14494 16242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence54 2186 18 gene locus_tag LOCUS_21320 2186 18 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963445.1 protein_id gnl|my_center|LOCUS_21320 2619 2227 gene locus_tag LOCUS_21330 2619 2227 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940036.1 protein_id gnl|my_center|LOCUS_21330 3660 2632 gene locus_tag LOCUS_21340 3660 2632 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096064.1 protein_id gnl|my_center|LOCUS_21340 4482 3664 gene locus_tag LOCUS_21350 4482 3664 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963448.1 protein_id gnl|my_center|LOCUS_21350 5598 4537 gene locus_tag LOCUS_21360 5598 4537 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280537.1 protein_id gnl|my_center|LOCUS_21360 7039 5603 gene locus_tag LOCUS_21370 7039 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 8279 7197 gene locus_tag LOCUS_21380 8279 7197 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_21380 10308 8380 gene locus_tag LOCUS_21390 10308 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 13849 10457 gene locus_tag LOCUS_21400 13849 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 14702 13956 gene locus_tag LOCUS_21410 gene tpiA 14702 13956 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence55 338 970 gene locus_tag LOCUS_21420 338 970 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_21420 1006 1611 gene locus_tag LOCUS_21430 1006 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 1608 1967 gene locus_tag LOCUS_21440 gene acpS 1608 1967 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963811.1 protein_id gnl|my_center|LOCUS_21440 1993 3480 gene locus_tag LOCUS_21450 1993 3480 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_21450 3477 4604 gene locus_tag LOCUS_21460 gene alr 3477 4604 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_21460 4720 5067 gene locus_tag LOCUS_21470 gene ndoA 4720 5067 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 protein_id gnl|my_center|LOCUS_21470 5424 5903 gene locus_tag LOCUS_21480 gene rlmH 5424 5903 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966801.1 protein_id gnl|my_center|LOCUS_21480 5951 6421 gene locus_tag LOCUS_21490 5951 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 6696 6612 gene locus_tag LOCUS_t00310 6696 6612 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6821 9520 gene locus_tag LOCUS_21500 gene polA 6821 9520 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896068.1 protein_id gnl|my_center|LOCUS_21500 9534 10115 gene locus_tag LOCUS_21510 gene coaE 9534 10115 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257771.1 protein_id gnl|my_center|LOCUS_21510 10156 12327 gene locus_tag LOCUS_21520 10156 12327 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964331.1 protein_id gnl|my_center|LOCUS_21520 12377 14128 gene locus_tag LOCUS_21530 12377 14128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence56 478 846 gene locus_tag LOCUS_21540 gene rplL 478 846 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357259.1 protein_id gnl|my_center|LOCUS_21540 1027 4311 gene locus_tag LOCUS_21550 1027 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 4555 8352 gene locus_tag LOCUS_21560 gene rpoB 4555 8352 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436174.1 protein_id gnl|my_center|LOCUS_21560 8372 12109 gene locus_tag LOCUS_21570 gene rpoC 8372 12109 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048356.1 protein_id gnl|my_center|LOCUS_21570 12251 13945 gene locus_tag LOCUS_21580 12251 13945 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence57 1191 169 gene locus_tag LOCUS_21590 1191 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 1832 1179 gene locus_tag LOCUS_21600 1832 1179 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460834.1 protein_id gnl|my_center|LOCUS_21600 2732 1887 gene locus_tag LOCUS_21610 2732 1887 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047578.1 protein_id gnl|my_center|LOCUS_21610 4143 2749 gene locus_tag LOCUS_21620 gene uxaC 4143 2749 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303177.1 protein_id gnl|my_center|LOCUS_21620 5210 4140 gene locus_tag LOCUS_21630 gene uxuA 5210 4140 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244855.1 protein_id gnl|my_center|LOCUS_21630 7003 5231 gene locus_tag LOCUS_21640 7003 5231 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775581.1 protein_id gnl|my_center|LOCUS_21640 7857 6997 gene locus_tag LOCUS_21650 7857 6997 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228638.1 protein_id gnl|my_center|LOCUS_21650 9262 7847 gene locus_tag LOCUS_21660 9262 7847 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289668.1 protein_id gnl|my_center|LOCUS_21660 10118 9582 gene locus_tag LOCUS_21670 10118 9582 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947779.1 protein_id gnl|my_center|LOCUS_21670 10930 10325 gene locus_tag LOCUS_21680 10930 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 11206 11003 gene locus_tag LOCUS_21690 11206 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 11393 11767 gene locus_tag LOCUS_21700 11393 11767 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_21700 11947 12558 gene locus_tag LOCUS_21710 11947 12558 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356883.1 protein_id gnl|my_center|LOCUS_21710 12444 12677 gene locus_tag LOCUS_21720 12444 12677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 12682 13710 gene locus_tag LOCUS_21730 12682 13710 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458821.1 protein_id gnl|my_center|LOCUS_21730 13716 13895 gene locus_tag LOCUS_21740 13716 13895 CDS product cysteine-rich KTR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012962334.1 protein_id gnl|my_center|LOCUS_21740 >Feature sequence58 <1 2492 gene locus_tag LOCUS_21750 <1 2492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003233171.1:subtilisin AprE 2489 3622 gene locus_tag LOCUS_21760 2489 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 3879 4229 gene locus_tag LOCUS_21770 3879 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 4231 4974 gene locus_tag LOCUS_21780 4231 4974 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_21780 4976 6229 gene locus_tag LOCUS_21790 4976 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 7300 7629 gene locus_tag LOCUS_21800 7300 7629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 7809 9296 gene locus_tag LOCUS_21810 7809 9296 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_21810 9342 10808 gene locus_tag LOCUS_21820 gene xylB 9342 10808 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_21820 10844 11839 gene locus_tag LOCUS_21830 10844 11839 CDS product 3-oxoacyl-ACP synthase III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964132.1 protein_id gnl|my_center|LOCUS_21830 11852 13396 gene locus_tag LOCUS_21840 11852 13396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 13950 13621 gene locus_tag LOCUS_21850 13950 13621 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965858.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence59 1757 1287 gene locus_tag LOCUS_21860 gene rpsG 1757 1287 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421180.1 protein_id gnl|my_center|LOCUS_21860 2314 1895 gene locus_tag LOCUS_21870 gene rpsL 2314 1895 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_21870 2540 3718 gene locus_tag LOCUS_21880 2540 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 3758 4285 gene locus_tag LOCUS_21890 3758 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 5227 4331 gene locus_tag LOCUS_21900 5227 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 5407 5991 gene locus_tag LOCUS_21910 gene yyaC 5407 5991 CDS product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243890.1 protein_id gnl|my_center|LOCUS_21910 6555 5956 gene locus_tag LOCUS_21920 gene recR 6555 5956 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_21920 6905 6555 gene locus_tag LOCUS_21930 6905 6555 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_21930 8500 6929 gene locus_tag LOCUS_21940 gene dnaX 8500 6929 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421622.1 protein_id gnl|my_center|LOCUS_21940 9586 8504 gene locus_tag LOCUS_21950 9586 8504 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_21950 10975 9629 gene locus_tag LOCUS_21960 10975 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 11186 11359 gene locus_tag LOCUS_21970 11186 11359 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_21970 11510 11797 gene locus_tag LOCUS_21980 gene rpsF 11510 11797 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966984.1 protein_id gnl|my_center|LOCUS_21980 11816 12265 gene locus_tag LOCUS_21990 11816 12265 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902513.1 protein_id gnl|my_center|LOCUS_21990 12353 12616 gene locus_tag LOCUS_22000 gene rpsR 12353 12616 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420527.1 protein_id gnl|my_center|LOCUS_22000 13642 12728 gene locus_tag LOCUS_22010 13642 12728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence60 102 737 gene locus_tag LOCUS_22020 102 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 792 1763 gene locus_tag LOCUS_22030 792 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 2198 2329 gene locus_tag LOCUS_22040 2198 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 2431 5724 gene locus_tag LOCUS_22050 2431 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 5903 7261 gene locus_tag LOCUS_22060 5903 7261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 7258 8028 gene locus_tag LOCUS_22070 7258 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 8018 9802 gene locus_tag LOCUS_22080 8018 9802 CDS product DUF6094 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267037.1 protein_id gnl|my_center|LOCUS_22080 9799 10170 gene locus_tag LOCUS_22090 9799 10170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 10182 10754 gene locus_tag LOCUS_22100 10182 10754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 10751 11410 gene locus_tag LOCUS_22110 10751 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 11410 11631 gene locus_tag LOCUS_22120 11410 11631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 11656 12489 gene locus_tag LOCUS_22130 11656 12489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 >Feature sequence61 131 2707 gene locus_tag LOCUS_22140 gene clpB 131 2707 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_22140 2790 3452 gene locus_tag LOCUS_22150 2790 3452 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_22150 3455 4843 gene locus_tag LOCUS_22160 3455 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 4948 6519 gene locus_tag LOCUS_22170 4948 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 6522 7142 gene locus_tag LOCUS_22180 6522 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 7135 8022 gene locus_tag LOCUS_22190 7135 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 8076 8705 gene locus_tag LOCUS_22200 8076 8705 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 protein_id gnl|my_center|LOCUS_22200 8764 10695 gene locus_tag LOCUS_22210 8764 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 10743 11603 gene locus_tag LOCUS_22220 10743 11603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 <12563 11944 gene locus_tag LOCUS_22230 <12563 11944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886573.1:site-specific DNA recombinase SpoIVCA >Feature sequence62 154 1890 gene locus_tag LOCUS_22240 gene proS 154 1890 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231918.1 protein_id gnl|my_center|LOCUS_22240 1921 3087 gene locus_tag LOCUS_22250 1921 3087 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_22250 3697 3173 gene locus_tag LOCUS_22260 3697 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 4493 3855 gene locus_tag LOCUS_22270 4493 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 5341 4490 gene locus_tag LOCUS_22280 5341 4490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_22280 5714 5325 gene locus_tag LOCUS_22290 5714 5325 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047976.1 protein_id gnl|my_center|LOCUS_22290 6928 5885 gene locus_tag LOCUS_22300 6928 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 7674 6928 gene locus_tag LOCUS_22310 7674 6928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811475.1 protein_id gnl|my_center|LOCUS_22310 8138 7671 gene locus_tag LOCUS_22320 8138 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 9535 8171 gene locus_tag LOCUS_22330 9535 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 9907 9560 gene locus_tag LOCUS_22340 9907 9560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 10490 10065 gene locus_tag LOCUS_22350 gene fabZ 10490 10065 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048424.1 protein_id gnl|my_center|LOCUS_22350 11738 10506 gene locus_tag LOCUS_22360 gene fabF 11738 10506 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence63 296 15 gene locus_tag LOCUS_22370 296 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 1244 444 gene locus_tag LOCUS_22380 1244 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2528 1260 gene locus_tag LOCUS_22390 gene murA 2528 1260 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_22390 3716 2580 gene locus_tag LOCUS_22400 gene spoVE 3716 2580 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_22400 5083 3755 gene locus_tag LOCUS_22410 gene murD 5083 3755 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_22410 6086 5109 gene locus_tag LOCUS_22420 gene mraY 6086 5109 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_22420 7889 6168 gene locus_tag LOCUS_22430 7889 6168 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_22430 9778 7940 gene locus_tag LOCUS_22440 9778 7940 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_22440 10258 9797 gene locus_tag LOCUS_22450 10258 9797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 11238 10297 gene locus_tag LOCUS_22460 gene rsmH 11238 10297 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_22460 11681 11253 gene locus_tag LOCUS_22470 gene mraZ 11681 11253 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358778.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence64 305 1333 gene locus_tag LOCUS_22480 305 1333 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546727.1 protein_id gnl|my_center|LOCUS_22480 1416 2702 gene locus_tag LOCUS_22490 gene serS 1416 2702 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_22490 3047 4009 gene locus_tag LOCUS_22500 3047 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 5322 4045 gene locus_tag LOCUS_22510 5322 4045 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027623.1 protein_id gnl|my_center|LOCUS_22510 5525 6910 gene locus_tag LOCUS_22520 5525 6910 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_22520 7010 7576 gene locus_tag LOCUS_22530 7010 7576 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410764.1 protein_id gnl|my_center|LOCUS_22530 7609 8814 gene locus_tag LOCUS_22540 7609 8814 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_22540 8857 10395 gene locus_tag LOCUS_22550 gene guaA 8857 10395 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_22550 10632 10757 gene locus_tag LOCUS_22560 10632 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 <11825 10912 gene locus_tag LOCUS_22570 <11825 10912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047593.1:site-specific integrase >Feature sequence65 177 680 gene locus_tag LOCUS_22580 gene coaD 177 680 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_22580 726 1910 gene locus_tag LOCUS_22590 726 1910 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_22590 2032 2823 gene locus_tag LOCUS_22600 2032 2823 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 protein_id gnl|my_center|LOCUS_22600 2854 3696 gene locus_tag LOCUS_22610 2854 3696 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 protein_id gnl|my_center|LOCUS_22610 3757 4908 gene locus_tag LOCUS_22620 3757 4908 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_22620 4920 5702 gene locus_tag LOCUS_22630 4920 5702 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888867.1 protein_id gnl|my_center|LOCUS_22630 5750 6787 gene locus_tag LOCUS_22640 5750 6787 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 protein_id gnl|my_center|LOCUS_22640 6973 7569 gene locus_tag LOCUS_22650 6973 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 7604 8890 gene locus_tag LOCUS_22660 7604 8890 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965471.1 protein_id gnl|my_center|LOCUS_22660 8883 9869 gene locus_tag LOCUS_22670 8883 9869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 10050 10700 gene locus_tag LOCUS_22680 10050 10700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence66 292 711 gene locus_tag LOCUS_22690 292 711 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384928.1 protein_id gnl|my_center|LOCUS_22690 1572 763 gene locus_tag LOCUS_22700 1572 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 2339 1569 gene locus_tag LOCUS_22710 2339 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 3031 2327 gene locus_tag LOCUS_22720 3031 2327 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 protein_id gnl|my_center|LOCUS_22720 3618 3028 gene locus_tag LOCUS_22730 3618 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 4423 3608 gene locus_tag LOCUS_22740 4423 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 5029 4553 gene locus_tag LOCUS_22750 5029 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 6165 5164 gene locus_tag LOCUS_22760 6165 5164 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303627.1 protein_id gnl|my_center|LOCUS_22760 6723 6235 gene locus_tag LOCUS_22770 6723 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 7400 6720 gene locus_tag LOCUS_22780 7400 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 8010 7420 gene locus_tag LOCUS_22790 gene prfH 8010 7420 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107793.1 protein_id gnl|my_center|LOCUS_22790 9174 8050 gene locus_tag LOCUS_22800 9174 8050 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_22800 10105 9197 gene locus_tag LOCUS_22810 10105 9197 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967658.1 protein_id gnl|my_center|LOCUS_22810 11383 10169 gene locus_tag LOCUS_22820 11383 10169 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence67 177 800 gene locus_tag LOCUS_22830 177 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 1152 2690 gene locus_tag LOCUS_22840 1152 2690 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837092.1 protein_id gnl|my_center|LOCUS_22840 2890 3552 gene locus_tag LOCUS_22850 2890 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 3539 4276 gene locus_tag LOCUS_22860 3539 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 5578 4364 gene locus_tag LOCUS_22870 5578 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 5792 6223 gene locus_tag LOCUS_22880 5792 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22880 6284 6754 gene locus_tag LOCUS_22890 6284 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22890 6789 7394 gene locus_tag LOCUS_22900 6789 7394 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_22900 7457 8005 gene locus_tag LOCUS_22910 7457 8005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 8090 8428 gene locus_tag LOCUS_22920 8090 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 8444 9865 gene locus_tag LOCUS_22930 8444 9865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 <11410 10310 gene locus_tag LOCUS_22940 <11410 10310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000163000.1:IS30-like element ISSmi1 family transposase note possible pseudo, internal stop codon >Feature sequence68 242 3808 gene locus_tag LOCUS_22950 242 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 3836 5035 gene locus_tag LOCUS_22960 3836 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 5058 5825 gene locus_tag LOCUS_22970 5058 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 5841 7058 gene locus_tag LOCUS_22980 5841 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 7090 7719 gene locus_tag LOCUS_22990 gene thiE 7090 7719 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_22990 8539 7694 gene locus_tag LOCUS_23000 8539 7694 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870266.1 protein_id gnl|my_center|LOCUS_23000 8680 9051 gene locus_tag LOCUS_23010 8680 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 9197 11071 gene locus_tag LOCUS_23020 9197 11071 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015263574.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence69 417 698 gene locus_tag LOCUS_23030 417 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 939 1355 gene locus_tag LOCUS_23040 939 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 1448 2227 gene locus_tag LOCUS_23050 1448 2227 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706646.1 protein_id gnl|my_center|LOCUS_23050 2307 2699 gene locus_tag LOCUS_23060 2307 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2748 3209 gene locus_tag LOCUS_23070 2748 3209 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138156903.1 protein_id gnl|my_center|LOCUS_23070 3272 4420 gene locus_tag LOCUS_23080 3272 4420 CDS product NgoFVII family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687776.1 protein_id gnl|my_center|LOCUS_23080 4407 6260 gene locus_tag LOCUS_23090 4407 6260 CDS product Z1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687775.1 protein_id gnl|my_center|LOCUS_23090 6291 7247 gene locus_tag LOCUS_23100 6291 7247 CDS product NgoFVII family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280501.1 protein_id gnl|my_center|LOCUS_23100 8348 7284 gene locus_tag LOCUS_23110 8348 7284 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869708.1 protein_id gnl|my_center|LOCUS_23110 8697 8338 gene locus_tag LOCUS_23120 8697 8338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence70 226 498 gene locus_tag LOCUS_23130 226 498 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_23130 508 1872 gene locus_tag LOCUS_23140 508 1872 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_23140 1884 2417 gene locus_tag LOCUS_23150 1884 2417 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194850.1 protein_id gnl|my_center|LOCUS_23150 2495 3055 gene locus_tag LOCUS_23160 2495 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 4094 3066 gene locus_tag LOCUS_23170 4094 3066 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_23170 4250 5206 gene locus_tag LOCUS_23180 4250 5206 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_23180 5190 6083 gene locus_tag LOCUS_23190 5190 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 6097 7608 gene locus_tag LOCUS_23200 6097 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 7608 8654 gene locus_tag LOCUS_23210 7608 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 8693 8953 gene locus_tag LOCUS_23220 8693 8953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 >Feature sequence71 194 1297 gene locus_tag LOCUS_23230 194 1297 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861645.1 protein_id gnl|my_center|LOCUS_23230 2902 1283 gene locus_tag LOCUS_23240 2902 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 3594 2899 gene locus_tag LOCUS_23250 3594 2899 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461254.1 protein_id gnl|my_center|LOCUS_23250 5002 3728 gene locus_tag LOCUS_23260 5002 3728 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721679.1 protein_id gnl|my_center|LOCUS_23260 6068 5097 gene locus_tag LOCUS_23270 6068 5097 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_23270 7860 6070 gene locus_tag LOCUS_23280 gene recJ 7860 6070 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence72 450 52 gene locus_tag LOCUS_23290 450 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 1798 467 gene locus_tag LOCUS_23300 1798 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 2528 1812 gene locus_tag LOCUS_23310 2528 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 2965 2525 gene locus_tag LOCUS_23320 2965 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 3228 3064 gene locus_tag LOCUS_23330 3228 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 3602 3225 gene locus_tag LOCUS_23340 3602 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 4220 3618 gene locus_tag LOCUS_23350 4220 3618 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905720.1 protein_id gnl|my_center|LOCUS_23350 4543 4226 gene locus_tag LOCUS_23360 4543 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 4926 4540 gene locus_tag LOCUS_23370 4926 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 5524 4931 gene locus_tag LOCUS_23380 5524 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 6434 5631 gene locus_tag LOCUS_23390 6434 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 7183 6497 gene locus_tag LOCUS_23400 7183 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence73 <1 1128 gene locus_tag LOCUS_23410 <1 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763773.1:O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase 1159 1977 gene locus_tag LOCUS_23420 gene thiF 1159 1977 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821634.1 protein_id gnl|my_center|LOCUS_23420 2031 2681 gene locus_tag LOCUS_23430 2031 2681 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_23430 2703 3557 gene locus_tag LOCUS_23440 2703 3557 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416734.1 protein_id gnl|my_center|LOCUS_23440 3588 3663 gene locus_tag LOCUS_t00320 3588 3663 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3615 4391 gene locus_tag LOCUS_23450 gene dpsA 3615 4391 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439770.1 protein_id gnl|my_center|LOCUS_23450 4396 4983 gene locus_tag LOCUS_23460 4396 4983 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429956.1 protein_id gnl|my_center|LOCUS_23460 5214 7214 gene locus_tag LOCUS_23470 5214 7214 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272794.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence74 1410 25 gene locus_tag LOCUS_23480 1410 25 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_23480 2505 1528 gene locus_tag LOCUS_23490 2505 1528 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051219.1 protein_id gnl|my_center|LOCUS_23490 2667 3071 gene locus_tag LOCUS_23500 2667 3071 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051407.1 protein_id gnl|my_center|LOCUS_23500 3277 3104 gene locus_tag LOCUS_23510 3277 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 5493 3304 gene locus_tag LOCUS_23520 5493 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence75 80 2203 gene locus_tag LOCUS_23530 80 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 2257 4116 gene locus_tag LOCUS_23540 2257 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 4135 5244 gene locus_tag LOCUS_23550 4135 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence76 <1 897 gene locus_tag LOCUS_23560 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020472.1:alpha/beta hydrolase 997 1557 gene locus_tag LOCUS_23570 997 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 1906 3048 gene locus_tag LOCUS_23580 1906 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 3084 4436 gene locus_tag LOCUS_23590 3084 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038124.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence77 2702 1329 gene locus_tag LOCUS_23600 2702 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 3849 2722 gene locus_tag LOCUS_23610 3849 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 4368 4219 gene locus_tag LOCUS_23620 4368 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence78 1481 1873 gene locus_tag LOCUS_23630 1481 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 2093 4012 gene locus_tag LOCUS_23640 2093 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 >Feature sequence79 1906 182 gene locus_tag LOCUS_23650 1906 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 2601 1987 gene locus_tag LOCUS_23660 gene scpB 2601 1987 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402814.1 protein_id gnl|my_center|LOCUS_23660 3391 2630 gene locus_tag LOCUS_23670 3391 2630 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965361.1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence80 2209 629 gene locus_tag LOCUS_23680 2209 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence81 2620 620 gene locus_tag LOCUS_23690 2620 620 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102176.1 protein_id gnl|my_center|LOCUS_23690