>Feature sequence001 1516 164 gene locus_tag LOCUS_00010 1516 164 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939509.1 protein_id gnl|my_center|LOCUS_00010 1618 2505 gene locus_tag LOCUS_00020 1618 2505 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939508.1 protein_id gnl|my_center|LOCUS_00020 2997 2797 gene locus_tag LOCUS_00030 2997 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4437 3172 gene locus_tag LOCUS_00040 gene ftsZ 4437 3172 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939769.1 protein_id gnl|my_center|LOCUS_00040 6292 5054 gene locus_tag LOCUS_00050 gene ftsA 6292 5054 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939770.1 protein_id gnl|my_center|LOCUS_00050 7290 6352 gene locus_tag LOCUS_00060 7290 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8171 7287 gene locus_tag LOCUS_00070 gene murB 8171 7287 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939772.1 protein_id gnl|my_center|LOCUS_00070 9537 8164 gene locus_tag LOCUS_00080 gene murC 9537 8164 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939773.1 protein_id gnl|my_center|LOCUS_00080 10890 9820 gene locus_tag LOCUS_00090 gene murG 10890 9820 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939774.1 protein_id gnl|my_center|LOCUS_00090 12072 10897 gene locus_tag LOCUS_00100 gene ftsW 12072 10897 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791803.1 protein_id gnl|my_center|LOCUS_00100 13635 12319 gene locus_tag LOCUS_00110 gene murD 13635 12319 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939776.1 protein_id gnl|my_center|LOCUS_00110 15356 14280 gene locus_tag LOCUS_00120 gene mraY 15356 14280 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939777.1 protein_id gnl|my_center|LOCUS_00120 16762 15359 gene locus_tag LOCUS_00130 gene murF 16762 15359 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939778.1 protein_id gnl|my_center|LOCUS_00130 18219 16753 gene locus_tag LOCUS_00140 18219 16753 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939779.1 protein_id gnl|my_center|LOCUS_00140 20374 18221 gene locus_tag LOCUS_00150 20374 18221 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939780.1 protein_id gnl|my_center|LOCUS_00150 20802 20509 gene locus_tag LOCUS_00160 20802 20509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939781.1 protein_id gnl|my_center|LOCUS_00160 21833 20802 gene locus_tag LOCUS_00170 gene rsmH 21833 20802 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939782.1 protein_id gnl|my_center|LOCUS_00170 22401 23828 gene locus_tag LOCUS_00180 gene pyk 22401 23828 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939784.1 protein_id gnl|my_center|LOCUS_00180 23843 24886 gene locus_tag LOCUS_00190 23843 24886 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939785.1 protein_id gnl|my_center|LOCUS_00190 25053 26276 gene locus_tag LOCUS_00200 25053 26276 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096774.1 protein_id gnl|my_center|LOCUS_00200 26433 27350 gene locus_tag LOCUS_00210 26433 27350 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970135.1 protein_id gnl|my_center|LOCUS_00210 >Feature sequence002 2388 643 gene locus_tag LOCUS_00220 2388 643 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938738.1 protein_id gnl|my_center|LOCUS_00220 4329 2620 gene locus_tag LOCUS_00230 4329 2620 CDS product DUF3880 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938740.1 protein_id gnl|my_center|LOCUS_00230 5451 4333 gene locus_tag LOCUS_00240 5451 4333 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938741.1 protein_id gnl|my_center|LOCUS_00240 5904 5551 gene locus_tag LOCUS_00250 5904 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 6415 5936 gene locus_tag LOCUS_00260 gene dtd 6415 5936 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938745.1 protein_id gnl|my_center|LOCUS_00260 8129 6420 gene locus_tag LOCUS_00270 8129 6420 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792381.1 protein_id gnl|my_center|LOCUS_00270 9384 8197 gene locus_tag LOCUS_00280 gene ispD 9384 8197 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938747.1 protein_id gnl|my_center|LOCUS_00280 9657 10532 gene locus_tag LOCUS_00290 9657 10532 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938303.1 protein_id gnl|my_center|LOCUS_00290 10885 12975 gene locus_tag LOCUS_00300 10885 12975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 14719 13076 gene locus_tag LOCUS_00310 14719 13076 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938914.1 protein_id gnl|my_center|LOCUS_00310 14936 15748 gene locus_tag LOCUS_00320 14936 15748 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938913.1 protein_id gnl|my_center|LOCUS_00320 15759 16562 gene locus_tag LOCUS_00330 15759 16562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 16572 17345 gene locus_tag LOCUS_00340 16572 17345 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938748.1 protein_id gnl|my_center|LOCUS_00340 18935 18153 gene locus_tag LOCUS_00350 18935 18153 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114798.1 protein_id gnl|my_center|LOCUS_00350 19972 18935 gene locus_tag LOCUS_00360 19972 18935 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094902.1 protein_id gnl|my_center|LOCUS_00360 20030 21079 gene locus_tag LOCUS_00370 20030 21079 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121265.1 protein_id gnl|my_center|LOCUS_00370 21205 21495 gene locus_tag LOCUS_00380 21205 21495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 21557 22720 gene locus_tag LOCUS_00390 21557 22720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 22914 24068 gene locus_tag LOCUS_00400 22914 24068 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173094.1 protein_id gnl|my_center|LOCUS_00400 24077 26035 gene locus_tag LOCUS_00410 24077 26035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 >Feature sequence003 230 1633 gene locus_tag LOCUS_00420 230 1633 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940093.1 protein_id gnl|my_center|LOCUS_00420 1630 3858 gene locus_tag LOCUS_00430 gene clpA 1630 3858 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938893.1 protein_id gnl|my_center|LOCUS_00430 5247 4060 gene locus_tag LOCUS_00440 5247 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 5858 6052 gene locus_tag LOCUS_00450 5858 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 6223 5948 gene locus_tag LOCUS_00460 6223 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 7302 6325 gene locus_tag LOCUS_00470 gene galE 7302 6325 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615363.1 protein_id gnl|my_center|LOCUS_00470 7649 8899 gene locus_tag LOCUS_00480 7649 8899 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041161656.1 protein_id gnl|my_center|LOCUS_00480 8957 9427 gene locus_tag LOCUS_00490 8957 9427 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937834.1 protein_id gnl|my_center|LOCUS_00490 9442 10026 gene locus_tag LOCUS_00500 gene yedF 9442 10026 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938959.1 protein_id gnl|my_center|LOCUS_00500 12747 10174 gene locus_tag LOCUS_00510 12747 10174 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937463.1 protein_id gnl|my_center|LOCUS_00510 15450 12943 gene locus_tag LOCUS_00520 15450 12943 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937462.1 protein_id gnl|my_center|LOCUS_00520 15653 15949 gene locus_tag LOCUS_00530 15653 15949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 15968 17023 gene locus_tag LOCUS_00540 15968 17023 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937460.1 protein_id gnl|my_center|LOCUS_00540 17035 17625 gene locus_tag LOCUS_00550 17035 17625 CDS product DUF4881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937459.1 protein_id gnl|my_center|LOCUS_00550 17713 18114 gene locus_tag LOCUS_00560 17713 18114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 18385 20361 gene locus_tag LOCUS_00570 gene ftsH 18385 20361 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938574.1 protein_id gnl|my_center|LOCUS_00570 20892 21710 gene locus_tag LOCUS_00580 gene folP 20892 21710 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938575.1 protein_id gnl|my_center|LOCUS_00580 21703 22437 gene locus_tag LOCUS_00590 gene cdaA 21703 22437 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938576.1 protein_id gnl|my_center|LOCUS_00590 22424 23356 gene locus_tag LOCUS_00600 22424 23356 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938577.1 protein_id gnl|my_center|LOCUS_00600 23591 24943 gene locus_tag LOCUS_00610 gene glmM 23591 24943 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938578.1 protein_id gnl|my_center|LOCUS_00610 >Feature sequence004 112 1452 gene locus_tag LOCUS_00620 gene rimO 112 1452 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940409.1 protein_id gnl|my_center|LOCUS_00620 1472 3178 gene locus_tag LOCUS_00630 1472 3178 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792381.1 protein_id gnl|my_center|LOCUS_00630 3227 3547 gene locus_tag LOCUS_00640 3227 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 4602 3820 gene locus_tag LOCUS_00650 4602 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 6758 4599 gene locus_tag LOCUS_00660 6758 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 7517 6948 gene locus_tag LOCUS_00670 gene pyrE 7517 6948 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940203.1 protein_id gnl|my_center|LOCUS_00670 8970 7672 gene locus_tag LOCUS_00680 gene purB 8970 7672 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940202.1 protein_id gnl|my_center|LOCUS_00680 9370 8981 gene locus_tag LOCUS_00690 9370 8981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 9651 9532 gene locus_tag LOCUS_00700 9651 9532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 10673 9843 gene locus_tag LOCUS_00710 10673 9843 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940199.1 protein_id gnl|my_center|LOCUS_00710 11446 10667 gene locus_tag LOCUS_00720 gene hisF 11446 10667 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_00720 12090 11440 gene locus_tag LOCUS_00730 gene hisH 12090 11440 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937594.1 protein_id gnl|my_center|LOCUS_00730 12619 13974 gene locus_tag LOCUS_00740 12619 13974 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_00740 14044 14859 gene locus_tag LOCUS_00750 14044 14859 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294645.1 protein_id gnl|my_center|LOCUS_00750 14885 16159 gene locus_tag LOCUS_00760 14885 16159 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940058.1 protein_id gnl|my_center|LOCUS_00760 16152 17105 gene locus_tag LOCUS_00770 16152 17105 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940059.1 protein_id gnl|my_center|LOCUS_00770 17108 17683 gene locus_tag LOCUS_00780 17108 17683 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940060.1 protein_id gnl|my_center|LOCUS_00780 17694 18386 gene locus_tag LOCUS_00790 17694 18386 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940061.1 protein_id gnl|my_center|LOCUS_00790 18396 18971 gene locus_tag LOCUS_00800 18396 18971 CDS product RnfABCDGE type electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940062.1 protein_id gnl|my_center|LOCUS_00800 18988 19851 gene locus_tag LOCUS_00810 18988 19851 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940063.1 protein_id gnl|my_center|LOCUS_00810 19965 20987 gene locus_tag LOCUS_00820 19965 20987 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940064.1 protein_id gnl|my_center|LOCUS_00820 21379 21822 gene locus_tag LOCUS_00830 21379 21822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937830.1 protein_id gnl|my_center|LOCUS_00830 21853 22164 gene locus_tag LOCUS_00840 21853 22164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 >Feature sequence005 440 1675 gene locus_tag LOCUS_00850 440 1675 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038876.1 protein_id gnl|my_center|LOCUS_00850 1974 5648 gene locus_tag LOCUS_00860 1974 5648 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932819.1 protein_id gnl|my_center|LOCUS_00860 8831 5886 gene locus_tag LOCUS_00870 8831 5886 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939341.1 protein_id gnl|my_center|LOCUS_00870 12085 8828 gene locus_tag LOCUS_00880 12085 8828 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939340.1 protein_id gnl|my_center|LOCUS_00880 13400 12090 gene locus_tag LOCUS_00890 13400 12090 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939339.1 protein_id gnl|my_center|LOCUS_00890 14037 13492 gene locus_tag LOCUS_00900 14037 13492 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792111.1 protein_id gnl|my_center|LOCUS_00900 14317 15402 gene locus_tag LOCUS_00910 14317 15402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 15474 17417 gene locus_tag LOCUS_00920 gene metG 15474 17417 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_00920 17891 17706 gene locus_tag LOCUS_00930 17891 17706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 17990 18787 gene locus_tag LOCUS_00940 17990 18787 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938949.1 protein_id gnl|my_center|LOCUS_00940 18852 18928 gene locus_tag LOCUS_t00010 18852 18928 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19073 19149 gene locus_tag LOCUS_t00020 19073 19149 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19814 19302 gene locus_tag LOCUS_00950 19814 19302 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937136.1 protein_id gnl|my_center|LOCUS_00950 20835 19873 gene locus_tag LOCUS_00960 20835 19873 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063757.1 protein_id gnl|my_center|LOCUS_00960 >Feature sequence006 <1 1399 gene locus_tag LOCUS_00970 <1 1399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940210.1:glutamine--tRNA ligase/YqeY domain fusion protein 3626 1719 gene locus_tag LOCUS_00980 3626 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 3711 4121 gene locus_tag LOCUS_00990 3711 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 5540 4563 gene locus_tag LOCUS_01000 5540 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937807.1 protein_id gnl|my_center|LOCUS_01000 7783 5552 gene locus_tag LOCUS_01010 gene pnp 7783 5552 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937809.1 protein_id gnl|my_center|LOCUS_01010 8291 8022 gene locus_tag LOCUS_01020 gene rpsO 8291 8022 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409373.1 protein_id gnl|my_center|LOCUS_01020 9252 8317 gene locus_tag LOCUS_01030 gene truB 9252 8317 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792851.1 protein_id gnl|my_center|LOCUS_01030 10522 9296 gene locus_tag LOCUS_01040 10522 9296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 10828 10526 gene locus_tag LOCUS_01050 10828 10526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 11673 10870 gene locus_tag LOCUS_01060 11673 10870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 12871 11840 gene locus_tag LOCUS_01070 12871 11840 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937812.1 protein_id gnl|my_center|LOCUS_01070 13160 12858 gene locus_tag LOCUS_01080 13160 12858 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937813.1 protein_id gnl|my_center|LOCUS_01080 16372 13346 gene locus_tag LOCUS_01090 16372 13346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 16664 16359 gene locus_tag LOCUS_01100 16664 16359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 17937 16600 gene locus_tag LOCUS_01110 gene nusA 17937 16600 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937816.1 protein_id gnl|my_center|LOCUS_01110 18828 18106 gene locus_tag LOCUS_01120 gene rimP 18828 18106 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937817.1 protein_id gnl|my_center|LOCUS_01120 19083 19158 gene locus_tag LOCUS_t00030 19083 19158 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 19173 19523 gene locus_tag LOCUS_01130 19173 19523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 >Feature sequence007 610 107 gene locus_tag LOCUS_01140 610 107 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879756.1 protein_id gnl|my_center|LOCUS_01140 1532 837 gene locus_tag LOCUS_01150 1532 837 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_01150 2323 1532 gene locus_tag LOCUS_01160 2323 1532 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939227.1 protein_id gnl|my_center|LOCUS_01160 2538 4145 gene locus_tag LOCUS_01170 gene glpA 2538 4145 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857238.1 protein_id gnl|my_center|LOCUS_01170 4129 5406 gene locus_tag LOCUS_01180 gene glpB 4129 5406 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903448.1 protein_id gnl|my_center|LOCUS_01180 5418 6623 gene locus_tag LOCUS_01190 gene glpC 5418 6623 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285727.1 protein_id gnl|my_center|LOCUS_01190 6922 7437 gene locus_tag LOCUS_01200 6922 7437 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524404.1 protein_id gnl|my_center|LOCUS_01200 7453 7944 gene locus_tag LOCUS_01210 7453 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 8080 10842 gene locus_tag LOCUS_01220 gene mutS 8080 10842 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938938.1 protein_id gnl|my_center|LOCUS_01220 10835 11266 gene locus_tag LOCUS_01230 10835 11266 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940617.1 protein_id gnl|my_center|LOCUS_01230 11263 12786 gene locus_tag LOCUS_01240 11263 12786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 12837 14303 gene locus_tag LOCUS_01250 12837 14303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 14526 15716 gene locus_tag LOCUS_01260 14526 15716 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937801.1 protein_id gnl|my_center|LOCUS_01260 15865 17049 gene locus_tag LOCUS_01270 15865 17049 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937800.1 protein_id gnl|my_center|LOCUS_01270 17131 17424 gene locus_tag LOCUS_01280 17131 17424 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937799.1 protein_id gnl|my_center|LOCUS_01280 17460 18518 gene locus_tag LOCUS_01290 gene argC 17460 18518 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937798.1 protein_id gnl|my_center|LOCUS_01290 18722 19849 gene locus_tag LOCUS_01300 gene hypD 18722 19849 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937632.1 protein_id gnl|my_center|LOCUS_01300 >Feature sequence008 1872 292 gene locus_tag LOCUS_01310 1872 292 CDS product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940541.1 protein_id gnl|my_center|LOCUS_01310 3603 2143 gene locus_tag LOCUS_01320 gene gatA 3603 2143 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938109.1 protein_id gnl|my_center|LOCUS_01320 4099 3809 gene locus_tag LOCUS_01330 gene gatC 4099 3809 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938110.1 protein_id gnl|my_center|LOCUS_01330 5699 4353 gene locus_tag LOCUS_01340 5699 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 6189 5959 gene locus_tag LOCUS_01350 6189 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 8444 6531 gene locus_tag LOCUS_01360 gene dnaK 8444 6531 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938112.1 protein_id gnl|my_center|LOCUS_01360 8671 9504 gene locus_tag LOCUS_01370 8671 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 11299 9677 gene locus_tag LOCUS_01380 gene hflX 11299 9677 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940494.1 protein_id gnl|my_center|LOCUS_01380 11951 11355 gene locus_tag LOCUS_01390 11951 11355 CDS product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940493.1 protein_id gnl|my_center|LOCUS_01390 12090 12896 gene locus_tag LOCUS_01400 12090 12896 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940517.1 protein_id gnl|my_center|LOCUS_01400 12909 16004 gene locus_tag LOCUS_01410 gene muxB 12909 16004 CDS product multidrug efflux RND transporter permease subunit MuxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089920.1 protein_id gnl|my_center|LOCUS_01410 16001 19204 gene locus_tag LOCUS_01420 gene mdtC 16001 19204 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667528.1 protein_id gnl|my_center|LOCUS_01420 >Feature sequence009 2481 175 gene locus_tag LOCUS_01430 gene pbpC 2481 175 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444434.1 protein_id gnl|my_center|LOCUS_01430 8195 2556 gene locus_tag LOCUS_01440 8195 2556 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947392.1 protein_id gnl|my_center|LOCUS_01440 10216 8303 gene locus_tag LOCUS_01450 10216 8303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 12251 10221 gene locus_tag LOCUS_01460 12251 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:complement(11844..11846),aa:Sec) note codon on position 136 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_01460 12817 12368 gene locus_tag LOCUS_01470 12817 12368 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970461.1 protein_id gnl|my_center|LOCUS_01470 13422 12814 gene locus_tag LOCUS_01480 13422 12814 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257085.1 protein_id gnl|my_center|LOCUS_01480 14587 13424 gene locus_tag LOCUS_01490 14587 13424 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870122.1 protein_id gnl|my_center|LOCUS_01490 15606 14569 gene locus_tag LOCUS_01500 15606 14569 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938844.1 protein_id gnl|my_center|LOCUS_01500 16750 15686 gene locus_tag LOCUS_01510 16750 15686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 17919 16747 gene locus_tag LOCUS_01520 17919 16747 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812866.1 protein_id gnl|my_center|LOCUS_01520 17830 18135 gene locus_tag LOCUS_01530 17830 18135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 18569 18111 gene locus_tag LOCUS_01540 18569 18111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 >Feature sequence010 482 724 gene locus_tag LOCUS_01550 482 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 994 2688 gene locus_tag LOCUS_01560 994 2688 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939722.1 protein_id gnl|my_center|LOCUS_01560 3097 2792 gene locus_tag LOCUS_01570 3097 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 4331 3159 gene locus_tag LOCUS_01580 gene mnmA 4331 3159 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938108.1 protein_id gnl|my_center|LOCUS_01580 4239 4457 gene locus_tag LOCUS_01590 4239 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 4609 5253 gene locus_tag LOCUS_01600 4609 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 5273 6751 gene locus_tag LOCUS_01610 5273 6751 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119251.1 protein_id gnl|my_center|LOCUS_01610 6900 6730 gene locus_tag LOCUS_01620 6900 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 7225 7971 gene locus_tag LOCUS_01630 7225 7971 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813022.1 protein_id gnl|my_center|LOCUS_01630 8023 9177 gene locus_tag LOCUS_01640 8023 9177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 9427 11340 gene locus_tag LOCUS_01650 9427 11340 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392246.1 protein_id gnl|my_center|LOCUS_01650 13112 11619 gene locus_tag LOCUS_01660 13112 11619 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_01660 14194 13100 gene locus_tag LOCUS_01670 14194 13100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 14922 14194 gene locus_tag LOCUS_01680 14922 14194 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938158.1 protein_id gnl|my_center|LOCUS_01680 15266 14919 gene locus_tag LOCUS_01690 15266 14919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 16161 15289 gene locus_tag LOCUS_01700 16161 15289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 16589 17365 gene locus_tag LOCUS_01710 16589 17365 CDS product DUF3298 and DUF4163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939888.1 protein_id gnl|my_center|LOCUS_01710 17362 17694 gene locus_tag LOCUS_01720 17362 17694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 >Feature sequence011 805 158 gene locus_tag LOCUS_01730 805 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 2419 977 gene locus_tag LOCUS_01740 gene putP 2419 977 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_01740 4735 2834 gene locus_tag LOCUS_01750 gene asnB 4735 2834 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_01750 6027 4723 gene locus_tag LOCUS_01760 6027 4723 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803854.1 protein_id gnl|my_center|LOCUS_01760 6974 6018 gene locus_tag LOCUS_01770 6974 6018 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703802.1 protein_id gnl|my_center|LOCUS_01770 8310 7003 gene locus_tag LOCUS_01780 8310 7003 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083269077.1 protein_id gnl|my_center|LOCUS_01780 9777 8461 gene locus_tag LOCUS_01790 9777 8461 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447772.1 protein_id gnl|my_center|LOCUS_01790 10064 13594 gene locus_tag LOCUS_01800 10064 13594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 13755 15218 gene locus_tag LOCUS_01810 13755 15218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 15221 16129 gene locus_tag LOCUS_01820 15221 16129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 16136 17557 gene locus_tag LOCUS_01830 16136 17557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 >Feature sequence012 2239 293 gene locus_tag LOCUS_01840 2239 293 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 protein_id gnl|my_center|LOCUS_01840 4017 2824 gene locus_tag LOCUS_01850 4017 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 4453 4010 gene locus_tag LOCUS_01860 gene hypA 4453 4010 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939567.1 protein_id gnl|my_center|LOCUS_01860 5542 4457 gene locus_tag LOCUS_01870 5542 4457 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939566.1 protein_id gnl|my_center|LOCUS_01870 6126 5539 gene locus_tag LOCUS_01880 6126 5539 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939565.1 protein_id gnl|my_center|LOCUS_01880 6739 6149 gene locus_tag LOCUS_01890 6739 6149 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939564.1 protein_id gnl|my_center|LOCUS_01890 7191 6742 gene locus_tag LOCUS_01900 gene nuoB 7191 6742 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939563.1 protein_id gnl|my_center|LOCUS_01900 8166 7204 gene locus_tag LOCUS_01910 8166 7204 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939562.1 protein_id gnl|my_center|LOCUS_01910 12160 8339 gene locus_tag LOCUS_01920 12160 8339 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939561.1 protein_id gnl|my_center|LOCUS_01920 13632 12634 gene locus_tag LOCUS_01930 13632 12634 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940417.1 protein_id gnl|my_center|LOCUS_01930 14992 13763 gene locus_tag LOCUS_01940 14992 13763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 15923 15216 gene locus_tag LOCUS_01950 15923 15216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01950 17335 15920 gene locus_tag LOCUS_01960 17335 15920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01960 >Feature sequence013 <1 602 gene locus_tag LOCUS_01970 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937658.1:NTP transferase domain-containing protein 607 1320 gene locus_tag LOCUS_01980 607 1320 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937657.1 protein_id gnl|my_center|LOCUS_01980 2730 1519 gene locus_tag LOCUS_01990 2730 1519 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939627.1 protein_id gnl|my_center|LOCUS_01990 3780 2968 gene locus_tag LOCUS_02000 gene tsaB 3780 2968 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938163.1 protein_id gnl|my_center|LOCUS_02000 4942 3800 gene locus_tag LOCUS_02010 gene rseP 4942 3800 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938164.1 protein_id gnl|my_center|LOCUS_02010 6261 4936 gene locus_tag LOCUS_02020 gene dxr 6261 4936 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938165.1 protein_id gnl|my_center|LOCUS_02020 7365 6556 gene locus_tag LOCUS_02030 7365 6556 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938167.1 protein_id gnl|my_center|LOCUS_02030 8089 7355 gene locus_tag LOCUS_02040 gene uppS 8089 7355 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938168.1 protein_id gnl|my_center|LOCUS_02040 8704 8144 gene locus_tag LOCUS_02050 gene frr 8704 8144 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_02050 9591 8878 gene locus_tag LOCUS_02060 gene pyrH 9591 8878 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938170.1 protein_id gnl|my_center|LOCUS_02060 9909 10661 gene locus_tag LOCUS_02070 9909 10661 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974659.1 protein_id gnl|my_center|LOCUS_02070 10841 11257 gene locus_tag LOCUS_02080 10841 11257 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792709.1 protein_id gnl|my_center|LOCUS_02080 11358 11951 gene locus_tag LOCUS_02090 11358 11951 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792710.1 protein_id gnl|my_center|LOCUS_02090 11948 12499 gene locus_tag LOCUS_02100 gene atpH 11948 12499 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938079.1 protein_id gnl|my_center|LOCUS_02100 12503 14011 gene locus_tag LOCUS_02110 gene atpA 12503 14011 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938078.1 protein_id gnl|my_center|LOCUS_02110 14027 14911 gene locus_tag LOCUS_02120 14027 14911 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938077.1 protein_id gnl|my_center|LOCUS_02120 14926 16344 gene locus_tag LOCUS_02130 gene atpD 14926 16344 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938076.1 protein_id gnl|my_center|LOCUS_02130 16354 16755 gene locus_tag LOCUS_02140 16354 16755 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_02140 >Feature sequence014 1463 132 gene locus_tag LOCUS_02150 1463 132 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791400.1 protein_id gnl|my_center|LOCUS_02150 1743 2816 gene locus_tag LOCUS_02160 gene cobT 1743 2816 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940537.1 protein_id gnl|my_center|LOCUS_02160 2807 3811 gene locus_tag LOCUS_02170 2807 3811 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968088.1 protein_id gnl|my_center|LOCUS_02170 5742 4000 gene locus_tag LOCUS_02180 5742 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 6079 7386 gene locus_tag LOCUS_02190 gene trmD 6079 7386 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938137.1 protein_id gnl|my_center|LOCUS_02190 7440 7787 gene locus_tag LOCUS_02200 gene rplS 7440 7787 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938136.1 protein_id gnl|my_center|LOCUS_02200 7967 8659 gene locus_tag LOCUS_02210 7967 8659 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938135.1 protein_id gnl|my_center|LOCUS_02210 8659 9129 gene locus_tag LOCUS_02220 8659 9129 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938134.1 protein_id gnl|my_center|LOCUS_02220 9062 9901 gene locus_tag LOCUS_02230 gene rsmI 9062 9901 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938133.1 protein_id gnl|my_center|LOCUS_02230 10090 10833 gene locus_tag LOCUS_02240 10090 10833 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938132.1 protein_id gnl|my_center|LOCUS_02240 11237 11527 gene locus_tag LOCUS_02250 11237 11527 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792685.1 protein_id gnl|my_center|LOCUS_02250 11530 13299 gene locus_tag LOCUS_02260 gene ptsP 11530 13299 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938130.1 protein_id gnl|my_center|LOCUS_02260 13292 13750 gene locus_tag LOCUS_02270 gene smpB 13292 13750 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938129.1 protein_id gnl|my_center|LOCUS_02270 13766 16393 gene locus_tag LOCUS_02280 13766 16393 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940515.1 protein_id gnl|my_center|LOCUS_02280 >Feature sequence015 1962 688 gene locus_tag LOCUS_02290 gene thiC 1962 688 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938704.1 protein_id gnl|my_center|LOCUS_02290 1961 2233 gene locus_tag LOCUS_02300 1961 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 2303 3667 gene locus_tag LOCUS_02310 2303 3667 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937720.1 protein_id gnl|my_center|LOCUS_02310 3789 5504 gene locus_tag LOCUS_02320 3789 5504 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940408.1 protein_id gnl|my_center|LOCUS_02320 5723 6937 gene locus_tag LOCUS_02330 5723 6937 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 protein_id gnl|my_center|LOCUS_02330 7202 8458 gene locus_tag LOCUS_02340 gene nspC 7202 8458 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937726.1 protein_id gnl|my_center|LOCUS_02340 8855 9625 gene locus_tag LOCUS_02350 8855 9625 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940035.1 protein_id gnl|my_center|LOCUS_02350 9826 10461 gene locus_tag LOCUS_02360 gene cbiM 9826 10461 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938357.1 protein_id gnl|my_center|LOCUS_02360 10458 11111 gene locus_tag LOCUS_02370 10458 11111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938371.1 protein_id gnl|my_center|LOCUS_02370 11121 11876 gene locus_tag LOCUS_02380 gene cbiQ 11121 11876 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938356.1 protein_id gnl|my_center|LOCUS_02380 11876 12628 gene locus_tag LOCUS_02390 11876 12628 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938355.1 protein_id gnl|my_center|LOCUS_02390 12906 13775 gene locus_tag LOCUS_02400 12906 13775 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938071.1 protein_id gnl|my_center|LOCUS_02400 13878 14702 gene locus_tag LOCUS_02410 gene murI 13878 14702 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938069.1 protein_id gnl|my_center|LOCUS_02410 15133 15408 gene locus_tag LOCUS_02420 15133 15408 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938065.1 protein_id gnl|my_center|LOCUS_02420 15445 15534 gene locus_tag LOCUS_t00040 15445 15534 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15613 15951 gene locus_tag LOCUS_02430 15613 15951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 15870 16175 gene locus_tag LOCUS_02440 15870 16175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02440 >Feature sequence016 2492 81 gene locus_tag LOCUS_02450 2492 81 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938876.1 protein_id gnl|my_center|LOCUS_02450 2702 3772 gene locus_tag LOCUS_02460 2702 3772 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_02460 3774 5489 gene locus_tag LOCUS_02470 3774 5489 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938874.1 protein_id gnl|my_center|LOCUS_02470 5486 6280 gene locus_tag LOCUS_02480 5486 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938873.1 protein_id gnl|my_center|LOCUS_02480 6434 6871 gene locus_tag LOCUS_02490 gene rpiB 6434 6871 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938871.1 protein_id gnl|my_center|LOCUS_02490 6895 8346 gene locus_tag LOCUS_02500 gene cysS 6895 8346 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938870.1 protein_id gnl|my_center|LOCUS_02500 8556 9968 gene locus_tag LOCUS_02510 8556 9968 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938869.1 protein_id gnl|my_center|LOCUS_02510 9970 10509 gene locus_tag LOCUS_02520 gene hslV 9970 10509 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938868.1 protein_id gnl|my_center|LOCUS_02520 10506 11426 gene locus_tag LOCUS_02530 gene ispE 10506 11426 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938867.1 protein_id gnl|my_center|LOCUS_02530 11406 11480 gene locus_tag LOCUS_t00050 11406 11480 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 11508 12455 gene locus_tag LOCUS_02540 11508 12455 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938866.1 protein_id gnl|my_center|LOCUS_02540 12869 13471 gene locus_tag LOCUS_02550 12869 13471 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938865.1 protein_id gnl|my_center|LOCUS_02550 13546 14412 gene locus_tag LOCUS_02560 13546 14412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 14503 15102 gene locus_tag LOCUS_02570 gene pth 14503 15102 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938864.1 protein_id gnl|my_center|LOCUS_02570 15829 16341 gene locus_tag LOCUS_02580 15829 16341 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_02580 >Feature sequence017 1380 103 gene locus_tag LOCUS_02590 1380 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 1586 3088 gene locus_tag LOCUS_02600 1586 3088 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937722.1 protein_id gnl|my_center|LOCUS_02600 3089 4612 gene locus_tag LOCUS_02610 gene cobA 3089 4612 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_02610 4957 5637 gene locus_tag LOCUS_02620 gene purN 4957 5637 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938037.1 protein_id gnl|my_center|LOCUS_02620 7105 6092 gene locus_tag LOCUS_02630 7105 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 8567 7452 gene locus_tag LOCUS_02640 8567 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 9634 8582 gene locus_tag LOCUS_02650 9634 8582 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791853.1 protein_id gnl|my_center|LOCUS_02650 11079 9631 gene locus_tag LOCUS_02660 11079 9631 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939673.1 protein_id gnl|my_center|LOCUS_02660 13028 11067 gene locus_tag LOCUS_02670 13028 11067 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939674.1 protein_id gnl|my_center|LOCUS_02670 13954 13025 gene locus_tag LOCUS_02680 13954 13025 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939675.1 protein_id gnl|my_center|LOCUS_02680 14535 13951 gene locus_tag LOCUS_02690 14535 13951 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939676.1 protein_id gnl|my_center|LOCUS_02690 15080 14631 gene locus_tag LOCUS_02700 gene aroQ 15080 14631 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173409.1 protein_id gnl|my_center|LOCUS_02700 16187 15354 gene locus_tag LOCUS_02710 gene aroE 16187 15354 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937426.1 protein_id gnl|my_center|LOCUS_02710 >Feature sequence018 1718 93 gene locus_tag LOCUS_02720 1718 93 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020142.1 protein_id gnl|my_center|LOCUS_02720 2491 1697 gene locus_tag LOCUS_02730 2491 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 4685 2544 gene locus_tag LOCUS_02740 gene ppk1 4685 2544 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870306.1 protein_id gnl|my_center|LOCUS_02740 4908 5606 gene locus_tag LOCUS_02750 4908 5606 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937640.1 protein_id gnl|my_center|LOCUS_02750 5575 6489 gene locus_tag LOCUS_02760 5575 6489 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937641.1 protein_id gnl|my_center|LOCUS_02760 6751 7062 gene locus_tag LOCUS_02770 6751 7062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 7062 8180 gene locus_tag LOCUS_02780 gene hflK 7062 8180 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409358.1 protein_id gnl|my_center|LOCUS_02780 8180 9037 gene locus_tag LOCUS_02790 8180 9037 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937986.1 protein_id gnl|my_center|LOCUS_02790 9117 9812 gene locus_tag LOCUS_02800 9117 9812 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792760.1 protein_id gnl|my_center|LOCUS_02800 9809 10918 gene locus_tag LOCUS_02810 9809 10918 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937980.1 protein_id gnl|my_center|LOCUS_02810 11506 11694 gene locus_tag LOCUS_02820 11506 11694 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_02820 11904 12575 gene locus_tag LOCUS_02830 11904 12575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940532.1 protein_id gnl|my_center|LOCUS_02830 12664 13065 gene locus_tag LOCUS_02840 12664 13065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940531.1 protein_id gnl|my_center|LOCUS_02840 13062 13685 gene locus_tag LOCUS_02850 13062 13685 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940530.1 protein_id gnl|my_center|LOCUS_02850 15334 14060 gene locus_tag LOCUS_02860 gene serS 15334 14060 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937547.1 protein_id gnl|my_center|LOCUS_02860 15509 16090 gene locus_tag LOCUS_02870 15509 16090 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938062.1 protein_id gnl|my_center|LOCUS_02870 >Feature sequence019 2013 79 gene locus_tag LOCUS_02880 gene dxs 2013 79 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938645.1 protein_id gnl|my_center|LOCUS_02880 2904 2014 gene locus_tag LOCUS_02890 2904 2014 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792441.1 protein_id gnl|my_center|LOCUS_02890 3173 2901 gene locus_tag LOCUS_02900 3173 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 4096 3227 gene locus_tag LOCUS_02910 4096 3227 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792442.1 protein_id gnl|my_center|LOCUS_02910 5513 4080 gene locus_tag LOCUS_02920 gene xseA 5513 4080 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938641.1 protein_id gnl|my_center|LOCUS_02920 7075 5552 gene locus_tag LOCUS_02930 7075 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 7859 7089 gene locus_tag LOCUS_02940 7859 7089 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169737.1 protein_id gnl|my_center|LOCUS_02940 10165 8435 gene locus_tag LOCUS_02950 10165 8435 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938640.1 protein_id gnl|my_center|LOCUS_02950 11240 10167 gene locus_tag LOCUS_02960 gene ispG 11240 10167 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629734.1 protein_id gnl|my_center|LOCUS_02960 11999 12652 gene locus_tag LOCUS_02970 11999 12652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 12669 12950 gene locus_tag LOCUS_02980 12669 12950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 12961 13590 gene locus_tag LOCUS_02990 12961 13590 CDS product FlgO family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938633.1 protein_id gnl|my_center|LOCUS_02990 13995 15095 gene locus_tag LOCUS_03000 gene ychF 13995 15095 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938722.1 protein_id gnl|my_center|LOCUS_03000 >Feature sequence020 895 2 gene locus_tag LOCUS_03010 895 2 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939824.1 protein_id gnl|my_center|LOCUS_03010 2428 1022 gene locus_tag LOCUS_03020 2428 1022 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939825.1 protein_id gnl|my_center|LOCUS_03020 3934 2654 gene locus_tag LOCUS_03030 gene lysA 3934 2654 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939836.1 protein_id gnl|my_center|LOCUS_03030 4255 4677 gene locus_tag LOCUS_03040 4255 4677 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939839.1 protein_id gnl|my_center|LOCUS_03040 4836 7025 gene locus_tag LOCUS_03050 4836 7025 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_03050 7311 8741 gene locus_tag LOCUS_03060 7311 8741 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937772.1 protein_id gnl|my_center|LOCUS_03060 8722 10308 gene locus_tag LOCUS_03070 8722 10308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 10298 11092 gene locus_tag LOCUS_03080 10298 11092 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937775.1 protein_id gnl|my_center|LOCUS_03080 11200 11811 gene locus_tag LOCUS_03090 11200 11811 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_03090 12113 13249 gene locus_tag LOCUS_03100 gene trpB 12113 13249 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937777.1 protein_id gnl|my_center|LOCUS_03100 13668 14435 gene locus_tag LOCUS_03110 gene trpA 13668 14435 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937778.1 protein_id gnl|my_center|LOCUS_03110 >Feature sequence021 463 149 gene locus_tag LOCUS_03120 463 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 1071 490 gene locus_tag LOCUS_03130 1071 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 3207 1240 gene locus_tag LOCUS_03140 3207 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 3753 3217 gene locus_tag LOCUS_03150 3753 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 4451 3753 gene locus_tag LOCUS_03160 4451 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 4975 4454 gene locus_tag LOCUS_03170 4975 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 6177 5140 gene locus_tag LOCUS_03180 6177 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 7129 6188 gene locus_tag LOCUS_03190 7129 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 7381 7154 gene locus_tag LOCUS_03200 7381 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 9495 7378 gene locus_tag LOCUS_03210 9495 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 9968 9492 gene locus_tag LOCUS_03220 9968 9492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 10237 9971 gene locus_tag LOCUS_03230 10237 9971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 10848 10237 gene locus_tag LOCUS_03240 10848 10237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 10999 11268 gene locus_tag LOCUS_03250 10999 11268 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680062.1 protein_id gnl|my_center|LOCUS_03250 11265 11606 gene locus_tag LOCUS_03260 11265 11606 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 protein_id gnl|my_center|LOCUS_03260 11833 11603 gene locus_tag LOCUS_03270 11833 11603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 12485 11835 gene locus_tag LOCUS_03280 12485 11835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 13882 12488 gene locus_tag LOCUS_03290 gene terL 13882 12488 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697216.1 protein_id gnl|my_center|LOCUS_03290 14439 13879 gene locus_tag LOCUS_03300 14439 13879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 14838 14596 gene locus_tag LOCUS_03310 14838 14596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 >Feature sequence022 135 521 gene locus_tag LOCUS_03320 135 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 590 4594 gene locus_tag LOCUS_03330 590 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 4909 5850 gene locus_tag LOCUS_03340 4909 5850 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175407.1 protein_id gnl|my_center|LOCUS_03340 6158 8020 gene locus_tag LOCUS_03350 6158 8020 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_03350 8291 9088 gene locus_tag LOCUS_03360 8291 9088 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937767.1 protein_id gnl|my_center|LOCUS_03360 9075 10073 gene locus_tag LOCUS_03370 9075 10073 CDS product 3-dehydroquinate synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937768.1 protein_id gnl|my_center|LOCUS_03370 10077 11267 gene locus_tag LOCUS_03380 gene pheA 10077 11267 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937769.1 protein_id gnl|my_center|LOCUS_03380 11260 12675 gene locus_tag LOCUS_03390 11260 12675 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937770.1 protein_id gnl|my_center|LOCUS_03390 12672 13541 gene locus_tag LOCUS_03400 12672 13541 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792876.1 protein_id gnl|my_center|LOCUS_03400 13790 14791 gene locus_tag LOCUS_03410 gene ilvC 13790 14791 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_03410 >Feature sequence023 2072 1296 gene locus_tag LOCUS_03420 2072 1296 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939811.1 protein_id gnl|my_center|LOCUS_03420 2623 4266 gene locus_tag LOCUS_03430 gene hcp 2623 4266 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791786.1 protein_id gnl|my_center|LOCUS_03430 4572 5270 gene locus_tag LOCUS_03440 4572 5270 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175285932.1 protein_id gnl|my_center|LOCUS_03440 5275 5856 gene locus_tag LOCUS_03450 5275 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 8137 6287 gene locus_tag LOCUS_03460 gene uvrC 8137 6287 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524276.1 protein_id gnl|my_center|LOCUS_03460 8534 8139 gene locus_tag LOCUS_03470 8534 8139 CDS product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210416.1 protein_id gnl|my_center|LOCUS_03470 10165 8666 gene locus_tag LOCUS_03480 10165 8666 CDS product outer membrane homotrimeric porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938100.1 protein_id gnl|my_center|LOCUS_03480 11247 10225 gene locus_tag LOCUS_03490 11247 10225 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937626.1 protein_id gnl|my_center|LOCUS_03490 11547 12725 gene locus_tag LOCUS_03500 11547 12725 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937635.1 protein_id gnl|my_center|LOCUS_03500 12750 14099 gene locus_tag LOCUS_03510 12750 14099 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793001.1 protein_id gnl|my_center|LOCUS_03510 >Feature sequence024 1431 259 gene locus_tag LOCUS_03520 1431 259 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939799.1 protein_id gnl|my_center|LOCUS_03520 3047 1434 gene locus_tag LOCUS_03530 3047 1434 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_03530 3214 3290 gene locus_tag LOCUS_t00060 3214 3290 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3580 5526 gene locus_tag LOCUS_03540 gene thrS 3580 5526 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939808.1 protein_id gnl|my_center|LOCUS_03540 5546 6058 gene locus_tag LOCUS_03550 gene infC 5546 6058 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939807.1 protein_id gnl|my_center|LOCUS_03550 6211 6408 gene locus_tag LOCUS_03560 gene rpmI 6211 6408 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939806.1 protein_id gnl|my_center|LOCUS_03560 6580 6933 gene locus_tag LOCUS_03570 gene rplT 6580 6933 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939805.1 protein_id gnl|my_center|LOCUS_03570 7135 8172 gene locus_tag LOCUS_03580 gene pheS 7135 8172 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939804.1 protein_id gnl|my_center|LOCUS_03580 8175 8537 gene locus_tag LOCUS_03590 8175 8537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 8766 11168 gene locus_tag LOCUS_03600 gene pheT 8766 11168 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939803.1 protein_id gnl|my_center|LOCUS_03600 11182 11523 gene locus_tag LOCUS_03610 11182 11523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 11628 12335 gene locus_tag LOCUS_03620 gene rpe 11628 12335 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939801.1 protein_id gnl|my_center|LOCUS_03620 12371 14365 gene locus_tag LOCUS_03630 gene tkt 12371 14365 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939800.1 protein_id gnl|my_center|LOCUS_03630 >Feature sequence025 1366 152 gene locus_tag LOCUS_03640 1366 152 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940289.1 protein_id gnl|my_center|LOCUS_03640 3900 1801 gene locus_tag LOCUS_03650 gene pta 3900 1801 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_03650 7598 4056 gene locus_tag LOCUS_03660 gene nifJ 7598 4056 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940284.1 protein_id gnl|my_center|LOCUS_03660 9790 8081 gene locus_tag LOCUS_03670 9790 8081 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940470.1 protein_id gnl|my_center|LOCUS_03670 11924 9993 gene locus_tag LOCUS_03680 gene selB 11924 9993 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937806.1 protein_id gnl|my_center|LOCUS_03680 14070 12529 gene locus_tag LOCUS_03690 14070 12529 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_03690 >Feature sequence026 116 1717 gene locus_tag LOCUS_03700 116 1717 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_03700 3067 1997 gene locus_tag LOCUS_03710 3067 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 4733 3105 gene locus_tag LOCUS_03720 4733 3105 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545407.1 protein_id gnl|my_center|LOCUS_03720 5827 4721 gene locus_tag LOCUS_03730 5827 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545929.1 protein_id gnl|my_center|LOCUS_03730 7535 6309 gene locus_tag LOCUS_03740 7535 6309 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_03740 8511 7654 gene locus_tag LOCUS_03750 gene dapF 8511 7654 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_03750 11089 8918 gene locus_tag LOCUS_03760 11089 8918 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_03760 11981 13141 gene locus_tag LOCUS_03770 11981 13141 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108945.1 protein_id gnl|my_center|LOCUS_03770 13162 13749 gene locus_tag LOCUS_03780 13162 13749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 >Feature sequence027 462 52 gene locus_tag LOCUS_03790 462 52 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937904.1 protein_id gnl|my_center|LOCUS_03790 1621 587 gene locus_tag LOCUS_03800 1621 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 2451 1648 gene locus_tag LOCUS_03810 2451 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 2543 2896 gene locus_tag LOCUS_03820 2543 2896 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939601.1 protein_id gnl|my_center|LOCUS_03820 2919 3587 gene locus_tag LOCUS_03830 gene hypB 2919 3587 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939602.1 protein_id gnl|my_center|LOCUS_03830 5125 4316 gene locus_tag LOCUS_03840 gene proC 5125 4316 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939605.1 protein_id gnl|my_center|LOCUS_03840 6637 5243 gene locus_tag LOCUS_03850 6637 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 8342 7059 gene locus_tag LOCUS_03860 8342 7059 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939609.1 protein_id gnl|my_center|LOCUS_03860 9927 8548 gene locus_tag LOCUS_03870 gene hydG 9927 8548 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939053.1 protein_id gnl|my_center|LOCUS_03870 10356 11381 gene locus_tag LOCUS_03880 10356 11381 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869312.1 protein_id gnl|my_center|LOCUS_03880 11446 12105 gene locus_tag LOCUS_03890 11446 12105 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439746.1 protein_id gnl|my_center|LOCUS_03890 <13602 12322 gene locus_tag LOCUS_03900 <13602 12322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021984.1:chemotaxis protein CheB >Feature sequence028 1287 229 gene locus_tag LOCUS_03910 1287 229 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109299.1 protein_id gnl|my_center|LOCUS_03910 1419 1495 gene locus_tag LOCUS_t00070 1419 1495 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1934 2779 gene locus_tag LOCUS_03920 1934 2779 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671202.1 protein_id gnl|my_center|LOCUS_03920 2791 3357 gene locus_tag LOCUS_03930 2791 3357 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393765.1 protein_id gnl|my_center|LOCUS_03930 3493 4227 gene locus_tag LOCUS_03940 3493 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 4227 5132 gene locus_tag LOCUS_03950 4227 5132 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972005.1 protein_id gnl|my_center|LOCUS_03950 5348 6202 gene locus_tag LOCUS_03960 5348 6202 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970135.1 protein_id gnl|my_center|LOCUS_03960 7113 6295 gene locus_tag LOCUS_03970 7113 6295 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_03970 7667 7077 gene locus_tag LOCUS_03980 7667 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 8296 7670 gene locus_tag LOCUS_03990 8296 7670 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940031.1 protein_id gnl|my_center|LOCUS_03990 8607 10994 gene locus_tag LOCUS_04000 8607 10994 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791682.1 protein_id gnl|my_center|LOCUS_04000 11190 12149 gene locus_tag LOCUS_04010 11190 12149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 <13438 12500 gene locus_tag LOCUS_04020 <13438 12500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939362.1:DEAD/DEAH box helicase >Feature sequence029 1178 60 gene locus_tag LOCUS_04030 1178 60 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940226.1 protein_id gnl|my_center|LOCUS_04030 1942 1460 gene locus_tag LOCUS_04040 1942 1460 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940225.1 protein_id gnl|my_center|LOCUS_04040 2644 1985 gene locus_tag LOCUS_04050 2644 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 3021 2641 gene locus_tag LOCUS_04060 3021 2641 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940222.1 protein_id gnl|my_center|LOCUS_04060 4757 3021 gene locus_tag LOCUS_04070 4757 3021 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940221.1 protein_id gnl|my_center|LOCUS_04070 5590 5153 gene locus_tag LOCUS_04080 5590 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940218.1 protein_id gnl|my_center|LOCUS_04080 6751 5672 gene locus_tag LOCUS_04090 6751 5672 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940217.1 protein_id gnl|my_center|LOCUS_04090 7911 7243 gene locus_tag LOCUS_04100 7911 7243 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_04100 9287 7926 gene locus_tag LOCUS_04110 gene mgtE 9287 7926 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939093.1 protein_id gnl|my_center|LOCUS_04110 9450 10349 gene locus_tag LOCUS_04120 gene nadC 9450 10349 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939094.1 protein_id gnl|my_center|LOCUS_04120 10352 11404 gene locus_tag LOCUS_04130 gene nadA 10352 11404 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939095.1 protein_id gnl|my_center|LOCUS_04130 11589 13196 gene locus_tag LOCUS_04140 gene nadB 11589 13196 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939096.1 protein_id gnl|my_center|LOCUS_04140 >Feature sequence030 133 1113 gene locus_tag LOCUS_04150 133 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 2078 1533 gene locus_tag LOCUS_04160 2078 1533 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940603.1 protein_id gnl|my_center|LOCUS_04160 2880 2086 gene locus_tag LOCUS_04170 2880 2086 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940604.1 protein_id gnl|my_center|LOCUS_04170 4001 2877 gene locus_tag LOCUS_04180 4001 2877 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940605.1 protein_id gnl|my_center|LOCUS_04180 4225 3998 gene locus_tag LOCUS_04190 4225 3998 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940606.1 protein_id gnl|my_center|LOCUS_04190 5455 4355 gene locus_tag LOCUS_04200 gene queA 5455 4355 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940607.1 protein_id gnl|my_center|LOCUS_04200 5664 6284 gene locus_tag LOCUS_04210 5664 6284 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940608.1 protein_id gnl|my_center|LOCUS_04210 6281 7531 gene locus_tag LOCUS_04220 gene coaBC 6281 7531 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940609.1 protein_id gnl|my_center|LOCUS_04220 7513 8304 gene locus_tag LOCUS_04230 7513 8304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 8383 9204 gene locus_tag LOCUS_04240 8383 9204 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940171.1 protein_id gnl|my_center|LOCUS_04240 9436 9648 gene locus_tag LOCUS_04250 gene rpmE 9436 9648 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940172.1 protein_id gnl|my_center|LOCUS_04250 9852 10886 gene locus_tag LOCUS_04260 9852 10886 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940173.1 protein_id gnl|my_center|LOCUS_04260 11003 12079 gene locus_tag LOCUS_04270 gene prfA 11003 12079 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940174.1 protein_id gnl|my_center|LOCUS_04270 12327 12803 gene locus_tag LOCUS_04280 12327 12803 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_04280 >Feature sequence031 2577 67 gene locus_tag LOCUS_04290 gene hrpB 2577 67 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968081.1 protein_id gnl|my_center|LOCUS_04290 2723 3859 gene locus_tag LOCUS_04300 2723 3859 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940154.1 protein_id gnl|my_center|LOCUS_04300 3975 6587 gene locus_tag LOCUS_04310 3975 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 6982 7743 gene locus_tag LOCUS_04320 6982 7743 CDS product DUF4851 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939767.1 protein_id gnl|my_center|LOCUS_04320 7878 8276 gene locus_tag LOCUS_04330 7878 8276 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939797.1 protein_id gnl|my_center|LOCUS_04330 8405 9358 gene locus_tag LOCUS_04340 gene bioB 8405 9358 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791775.1 protein_id gnl|my_center|LOCUS_04340 9355 11454 gene locus_tag LOCUS_04350 9355 11454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 11772 12107 gene locus_tag LOCUS_04360 11772 12107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 >Feature sequence032 1764 241 gene locus_tag LOCUS_04370 1764 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 4120 2021 gene locus_tag LOCUS_04380 4120 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 5413 4205 gene locus_tag LOCUS_04390 5413 4205 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940160.1 protein_id gnl|my_center|LOCUS_04390 6623 5757 gene locus_tag LOCUS_04400 6623 5757 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791673.1 protein_id gnl|my_center|LOCUS_04400 7533 9881 gene locus_tag LOCUS_04410 7533 9881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 10018 10554 gene locus_tag LOCUS_04420 10018 10554 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939643.1 protein_id gnl|my_center|LOCUS_04420 10739 11203 gene locus_tag LOCUS_04430 gene fabZ 10739 11203 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939641.1 protein_id gnl|my_center|LOCUS_04430 12346 11261 gene locus_tag LOCUS_04440 gene tilS 12346 11261 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792378.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence033 1731 214 gene locus_tag LOCUS_04450 gene pap 1731 214 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_04450 3446 1947 gene locus_tag LOCUS_04460 3446 1947 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938119.1 protein_id gnl|my_center|LOCUS_04460 3883 3446 gene locus_tag LOCUS_04470 gene tadA 3883 3446 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938820.1 protein_id gnl|my_center|LOCUS_04470 4623 3955 gene locus_tag LOCUS_04480 4623 3955 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938821.1 protein_id gnl|my_center|LOCUS_04480 4976 6592 gene locus_tag LOCUS_04490 4976 6592 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_04490 6670 7224 gene locus_tag LOCUS_04500 gene rsmD 6670 7224 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938823.1 protein_id gnl|my_center|LOCUS_04500 7221 7763 gene locus_tag LOCUS_04510 gene coaD 7221 7763 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938824.1 protein_id gnl|my_center|LOCUS_04510 7766 8680 gene locus_tag LOCUS_04520 gene miaA 7766 8680 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938825.1 protein_id gnl|my_center|LOCUS_04520 9252 8899 gene locus_tag LOCUS_04530 9252 8899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 10425 9364 gene locus_tag LOCUS_04540 10425 9364 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937434.1 protein_id gnl|my_center|LOCUS_04540 11120 12298 gene locus_tag LOCUS_04550 11120 12298 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129649887.1 protein_id gnl|my_center|LOCUS_04550 >Feature sequence034 4047 3250 gene locus_tag LOCUS_04560 4047 3250 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939121.1 protein_id gnl|my_center|LOCUS_04560 4080 5207 gene locus_tag LOCUS_04570 4080 5207 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939122.1 protein_id gnl|my_center|LOCUS_04570 5926 5408 gene locus_tag LOCUS_04580 5926 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 7320 5995 gene locus_tag LOCUS_04590 7320 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 7802 7353 gene locus_tag LOCUS_04600 gene ybeY 7802 7353 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939169.1 protein_id gnl|my_center|LOCUS_04600 10268 8085 gene locus_tag LOCUS_04610 10268 8085 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629711.1 protein_id gnl|my_center|LOCUS_04610 11274 10276 gene locus_tag LOCUS_04620 11274 10276 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_04620 >Feature sequence035 1538 93 gene locus_tag LOCUS_04630 gene thrC 1538 93 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791440.1 protein_id gnl|my_center|LOCUS_04630 4101 1789 gene locus_tag LOCUS_04640 4101 1789 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_04640 4813 4151 gene locus_tag LOCUS_04650 4813 4151 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230026.1 protein_id gnl|my_center|LOCUS_04650 6005 4866 gene locus_tag LOCUS_04660 gene icd 6005 4866 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937784.1 protein_id gnl|my_center|LOCUS_04660 7925 6102 gene locus_tag LOCUS_04670 7925 6102 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937705.1 protein_id gnl|my_center|LOCUS_04670 8084 10192 gene locus_tag LOCUS_04680 8084 10192 CDS product ribonuclease catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940465.1 protein_id gnl|my_center|LOCUS_04680 10218 10814 gene locus_tag LOCUS_04690 10218 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 11982 11521 gene locus_tag LOCUS_04700 11982 11521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 >Feature sequence036 231 572 gene locus_tag LOCUS_04710 231 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 928 3552 gene locus_tag LOCUS_04720 928 3552 CDS product putative virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390901.1 protein_id gnl|my_center|LOCUS_04720 3559 4764 gene locus_tag LOCUS_04730 3559 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 4819 6786 gene locus_tag LOCUS_04740 4819 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 7063 7824 gene locus_tag LOCUS_04750 gene tagT 7063 7824 CDS product type IV secretion associated ABC transporter ATP-binding protein TagT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114657.1 protein_id gnl|my_center|LOCUS_04750 7826 9103 gene locus_tag LOCUS_04760 gene tagS 7826 9103 CDS product type IV secretion associated ABC transporter permease TagS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083634.1 protein_id gnl|my_center|LOCUS_04760 9096 10955 gene locus_tag LOCUS_04770 gene tagR 9096 10955 CDS product type VI secretion system-associated regulator TagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106615.1 protein_id gnl|my_center|LOCUS_04770 10968 11978 gene locus_tag LOCUS_04780 10968 11978 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 protein_id gnl|my_center|LOCUS_04780 >Feature sequence037 1361 87 gene locus_tag LOCUS_04790 gene hemL 1361 87 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940426.1 protein_id gnl|my_center|LOCUS_04790 2185 1706 gene locus_tag LOCUS_04800 gene ahbB 2185 1706 CDS product siroheme decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940425.1 protein_id gnl|my_center|LOCUS_04800 2963 2409 gene locus_tag LOCUS_04810 2963 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791841.1 protein_id gnl|my_center|LOCUS_04810 4265 3126 gene locus_tag LOCUS_04820 gene alr 4265 3126 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938254.1 protein_id gnl|my_center|LOCUS_04820 6773 4719 gene locus_tag LOCUS_04830 6773 4719 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937911.1 protein_id gnl|my_center|LOCUS_04830 6984 8024 gene locus_tag LOCUS_04840 gene tgt 6984 8024 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938027.1 protein_id gnl|my_center|LOCUS_04840 9864 9121 gene locus_tag LOCUS_04850 9864 9121 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294689.1 protein_id gnl|my_center|LOCUS_04850 10255 11760 gene locus_tag LOCUS_04860 10255 11760 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937352.1 protein_id gnl|my_center|LOCUS_04860 >Feature sequence038 237 710 gene locus_tag LOCUS_04870 237 710 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938498.1 protein_id gnl|my_center|LOCUS_04870 703 1845 gene locus_tag LOCUS_04880 gene ribD 703 1845 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938497.1 protein_id gnl|my_center|LOCUS_04880 1845 2510 gene locus_tag LOCUS_04890 1845 2510 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938496.1 protein_id gnl|my_center|LOCUS_04890 2523 2993 gene locus_tag LOCUS_04900 gene ribE 2523 2993 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938494.1 protein_id gnl|my_center|LOCUS_04900 2997 3485 gene locus_tag LOCUS_04910 gene nusB 2997 3485 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938493.1 protein_id gnl|my_center|LOCUS_04910 4233 6764 gene locus_tag LOCUS_04920 gene leuS 4233 6764 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938492.1 protein_id gnl|my_center|LOCUS_04920 7469 8449 gene locus_tag LOCUS_04930 7469 8449 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792509.1 protein_id gnl|my_center|LOCUS_04930 8523 9245 gene locus_tag LOCUS_04940 gene radC 8523 9245 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938489.1 protein_id gnl|my_center|LOCUS_04940 9378 11819 gene locus_tag LOCUS_04950 gene lon 9378 11819 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938487.1 protein_id gnl|my_center|LOCUS_04950 >Feature sequence039 1746 151 gene locus_tag LOCUS_04960 1746 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 2833 2183 gene locus_tag LOCUS_04970 2833 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04970 4441 2984 gene locus_tag LOCUS_04980 4441 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 5590 4442 gene locus_tag LOCUS_04990 5590 4442 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937386.1 protein_id gnl|my_center|LOCUS_04990 6450 5797 gene locus_tag LOCUS_05000 gene rdgB 6450 5797 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940412.1 protein_id gnl|my_center|LOCUS_05000 7372 6473 gene locus_tag LOCUS_05010 7372 6473 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938246.1 protein_id gnl|my_center|LOCUS_05010 7544 8614 gene locus_tag LOCUS_05020 7544 8614 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937656.1 protein_id gnl|my_center|LOCUS_05020 8943 8644 gene locus_tag LOCUS_05030 8943 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 8942 10717 gene locus_tag LOCUS_05040 8942 10717 CDS product LIC12162 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792989.1 protein_id gnl|my_center|LOCUS_05040 10728 11732 gene locus_tag LOCUS_05050 10728 11732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 >Feature sequence040 401 66 gene locus_tag LOCUS_05060 401 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 1702 407 gene locus_tag LOCUS_05070 gene hemA 1702 407 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938754.1 protein_id gnl|my_center|LOCUS_05070 2531 1704 gene locus_tag LOCUS_05080 gene ccsA 2531 1704 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792376.1 protein_id gnl|my_center|LOCUS_05080 3201 2518 gene locus_tag LOCUS_05090 3201 2518 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938756.1 protein_id gnl|my_center|LOCUS_05090 3415 4644 gene locus_tag LOCUS_05100 3415 4644 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938757.1 protein_id gnl|my_center|LOCUS_05100 4644 5927 gene locus_tag LOCUS_05110 4644 5927 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938758.1 protein_id gnl|my_center|LOCUS_05110 7153 6032 gene locus_tag LOCUS_05120 7153 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 7297 8505 gene locus_tag LOCUS_05130 7297 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 8507 9814 gene locus_tag LOCUS_05140 8507 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 9811 10791 gene locus_tag LOCUS_05150 gene xerD 9811 10791 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389683.1 protein_id gnl|my_center|LOCUS_05150 10805 11215 gene locus_tag LOCUS_05160 10805 11215 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_05160 >Feature sequence041 1096 386 gene locus_tag LOCUS_05170 1096 386 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939878.1 protein_id gnl|my_center|LOCUS_05170 2054 1209 gene locus_tag LOCUS_05180 gene motA 2054 1209 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939877.1 protein_id gnl|my_center|LOCUS_05180 2327 3976 gene locus_tag LOCUS_05190 2327 3976 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938117.1 protein_id gnl|my_center|LOCUS_05190 4138 4974 gene locus_tag LOCUS_05200 4138 4974 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938046.1 protein_id gnl|my_center|LOCUS_05200 5138 5851 gene locus_tag LOCUS_05210 5138 5851 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792728.1 protein_id gnl|my_center|LOCUS_05210 5848 6483 gene locus_tag LOCUS_05220 5848 6483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938048.1 protein_id gnl|my_center|LOCUS_05220 7298 6576 gene locus_tag LOCUS_05230 7298 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 7799 9046 gene locus_tag LOCUS_05240 7799 9046 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545855.1 protein_id gnl|my_center|LOCUS_05240 9378 11348 gene locus_tag LOCUS_05250 9378 11348 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940249.1 protein_id gnl|my_center|LOCUS_05250 >Feature sequence042 1970 870 gene locus_tag LOCUS_05260 1970 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 4945 1973 gene locus_tag LOCUS_05270 gene icmB 4945 1973 CDS product type IVB secretion system protein IcmB/DotO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946205.1 protein_id gnl|my_center|LOCUS_05270 5675 4947 gene locus_tag LOCUS_05280 5675 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 6056 5688 gene locus_tag LOCUS_05290 6056 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 6571 6065 gene locus_tag LOCUS_05300 gene icmC 6571 6065 CDS product type IVB secretion system protein IcmC/DotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946202.1 protein_id gnl|my_center|LOCUS_05300 7679 6576 gene locus_tag LOCUS_05310 7679 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 8727 7672 gene locus_tag LOCUS_05320 8727 7672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 9140 8724 gene locus_tag LOCUS_05330 9140 8724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 10053 9133 gene locus_tag LOCUS_05340 10053 9133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 11062 10046 gene locus_tag LOCUS_05350 11062 10046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 >Feature sequence043 <1 887 gene locus_tag LOCUS_05360 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437032.1:sensor domain-containing diguanylate cyclase 1168 1791 gene locus_tag LOCUS_05370 1168 1791 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_05370 3197 1917 gene locus_tag LOCUS_05380 3197 1917 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 protein_id gnl|my_center|LOCUS_05380 3309 4292 gene locus_tag LOCUS_05390 3309 4292 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940449.1 protein_id gnl|my_center|LOCUS_05390 4414 5781 gene locus_tag LOCUS_05400 gene der 4414 5781 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940452.1 protein_id gnl|my_center|LOCUS_05400 6105 7235 gene locus_tag LOCUS_05410 6105 7235 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937853.1 protein_id gnl|my_center|LOCUS_05410 7315 8220 gene locus_tag LOCUS_05420 7315 8220 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937854.1 protein_id gnl|my_center|LOCUS_05420 8270 9463 gene locus_tag LOCUS_05430 gene livM 8270 9463 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937855.1 protein_id gnl|my_center|LOCUS_05430 9460 10326 gene locus_tag LOCUS_05440 9460 10326 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937856.1 protein_id gnl|my_center|LOCUS_05440 10319 11023 gene locus_tag LOCUS_05450 10319 11023 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937857.1 protein_id gnl|my_center|LOCUS_05450 >Feature sequence044 3 188 gene locus_tag LOCUS_05460 3 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 931 221 gene locus_tag LOCUS_05470 931 221 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938017.1 protein_id gnl|my_center|LOCUS_05470 1702 932 gene locus_tag LOCUS_05480 1702 932 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_05480 2703 1699 gene locus_tag LOCUS_05490 2703 1699 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938015.1 protein_id gnl|my_center|LOCUS_05490 3605 2700 gene locus_tag LOCUS_05500 3605 2700 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938014.1 protein_id gnl|my_center|LOCUS_05500 4915 3794 gene locus_tag LOCUS_05510 4915 3794 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938013.1 protein_id gnl|my_center|LOCUS_05510 5675 5070 gene locus_tag LOCUS_05520 5675 5070 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939236.1 protein_id gnl|my_center|LOCUS_05520 7692 5842 gene locus_tag LOCUS_05530 gene iorA 7692 5842 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939237.1 protein_id gnl|my_center|LOCUS_05530 8453 7782 gene locus_tag LOCUS_05540 8453 7782 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939238.1 protein_id gnl|my_center|LOCUS_05540 8661 9920 gene locus_tag LOCUS_05550 8661 9920 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939239.1 protein_id gnl|my_center|LOCUS_05550 9921 10694 gene locus_tag LOCUS_05560 gene nadD 9921 10694 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939240.1 protein_id gnl|my_center|LOCUS_05560 >Feature sequence045 1517 243 gene locus_tag LOCUS_05570 1517 243 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791443.1 protein_id gnl|my_center|LOCUS_05570 1783 2166 gene locus_tag LOCUS_05580 1783 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 2301 3584 gene locus_tag LOCUS_05590 2301 3584 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940462.1 protein_id gnl|my_center|LOCUS_05590 3771 3592 gene locus_tag LOCUS_05600 3771 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 3770 4669 gene locus_tag LOCUS_05610 3770 4669 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940461.1 protein_id gnl|my_center|LOCUS_05610 8378 5271 gene locus_tag LOCUS_05620 8378 5271 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937745.1 protein_id gnl|my_center|LOCUS_05620 9566 8475 gene locus_tag LOCUS_05630 9566 8475 CDS product CobD/CbiB family cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939512.1 protein_id gnl|my_center|LOCUS_05630 10072 9563 gene locus_tag LOCUS_05640 10072 9563 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629306.1 protein_id gnl|my_center|LOCUS_05640 >Feature sequence046 992 273 gene locus_tag LOCUS_05650 992 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938151.1 protein_id gnl|my_center|LOCUS_05650 2258 1080 gene locus_tag LOCUS_05660 gene qmoC 2258 1080 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938150.1 protein_id gnl|my_center|LOCUS_05660 4533 2272 gene locus_tag LOCUS_05670 4533 2272 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938149.1 protein_id gnl|my_center|LOCUS_05670 5775 4540 gene locus_tag LOCUS_05680 5775 4540 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938148.1 protein_id gnl|my_center|LOCUS_05680 7984 5996 gene locus_tag LOCUS_05690 gene aprA 7984 5996 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938147.1 protein_id gnl|my_center|LOCUS_05690 8498 8022 gene locus_tag LOCUS_05700 gene aprB 8498 8022 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938146.1 protein_id gnl|my_center|LOCUS_05700 8900 10609 gene locus_tag LOCUS_05710 8900 10609 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938144.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence047 381 1376 gene locus_tag LOCUS_05720 381 1376 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938971.1 protein_id gnl|my_center|LOCUS_05720 1391 2413 gene locus_tag LOCUS_05730 1391 2413 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938970.1 protein_id gnl|my_center|LOCUS_05730 2668 3498 gene locus_tag LOCUS_05740 2668 3498 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938969.1 protein_id gnl|my_center|LOCUS_05740 3983 3384 gene locus_tag LOCUS_05750 3983 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 3982 5211 gene locus_tag LOCUS_05760 3982 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 5326 5706 gene locus_tag LOCUS_05770 gene secG 5326 5706 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938965.1 protein_id gnl|my_center|LOCUS_05770 5833 6759 gene locus_tag LOCUS_05780 5833 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 7202 7603 gene locus_tag LOCUS_05790 7202 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 7686 7934 gene locus_tag LOCUS_05800 7686 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 8115 9110 gene locus_tag LOCUS_05810 8115 9110 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937952.1 protein_id gnl|my_center|LOCUS_05810 9331 10185 gene locus_tag LOCUS_05820 9331 10185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937951.1 protein_id gnl|my_center|LOCUS_05820 10136 10975 gene locus_tag LOCUS_05830 10136 10975 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792785.1 protein_id gnl|my_center|LOCUS_05830 >Feature sequence048 381 67 gene locus_tag LOCUS_05840 381 67 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939161.1 protein_id gnl|my_center|LOCUS_05840 1463 528 gene locus_tag LOCUS_05850 1463 528 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_05850 2852 1752 gene locus_tag LOCUS_05860 gene secF 2852 1752 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939105.1 protein_id gnl|my_center|LOCUS_05860 4456 2870 gene locus_tag LOCUS_05870 gene secD 4456 2870 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939106.1 protein_id gnl|my_center|LOCUS_05870 4917 4567 gene locus_tag LOCUS_05880 gene yajC 4917 4567 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939107.1 protein_id gnl|my_center|LOCUS_05880 5785 4988 gene locus_tag LOCUS_05890 5785 4988 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939111.1 protein_id gnl|my_center|LOCUS_05890 5860 7176 gene locus_tag LOCUS_05900 5860 7176 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 protein_id gnl|my_center|LOCUS_05900 7317 7580 gene locus_tag LOCUS_05910 7317 7580 CDS product PxxKW family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939113.1 protein_id gnl|my_center|LOCUS_05910 7719 8951 gene locus_tag LOCUS_05920 7719 8951 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939114.1 protein_id gnl|my_center|LOCUS_05920 8929 10878 gene locus_tag LOCUS_05930 gene mnmG 8929 10878 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939115.1 protein_id gnl|my_center|LOCUS_05930 >Feature sequence049 994 77 gene locus_tag LOCUS_05940 994 77 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212340732.1 protein_id gnl|my_center|LOCUS_05940 2613 1081 gene locus_tag LOCUS_05950 2613 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 3648 2683 gene locus_tag LOCUS_05960 gene moaA 3648 2683 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937883.1 protein_id gnl|my_center|LOCUS_05960 3728 4006 gene locus_tag LOCUS_05970 3728 4006 CDS product DUF5334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937878.1 protein_id gnl|my_center|LOCUS_05970 4786 4223 gene locus_tag LOCUS_05980 4786 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938473.1 protein_id gnl|my_center|LOCUS_05980 4965 5339 gene locus_tag LOCUS_05990 4965 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938471.1 protein_id gnl|my_center|LOCUS_05990 5343 6695 gene locus_tag LOCUS_06000 gene miaB 5343 6695 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938283.1 protein_id gnl|my_center|LOCUS_06000 6689 7276 gene locus_tag LOCUS_06010 6689 7276 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938282.1 protein_id gnl|my_center|LOCUS_06010 7284 8684 gene locus_tag LOCUS_06020 7284 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 8982 10349 gene locus_tag LOCUS_06030 8982 10349 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948912.1 protein_id gnl|my_center|LOCUS_06030 >Feature sequence050 568 131 gene locus_tag LOCUS_06040 568 131 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937805.1 protein_id gnl|my_center|LOCUS_06040 2188 872 gene locus_tag LOCUS_06050 2188 872 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938189.1 protein_id gnl|my_center|LOCUS_06050 3374 2169 gene locus_tag LOCUS_06060 3374 2169 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938190.1 protein_id gnl|my_center|LOCUS_06060 3533 4588 gene locus_tag LOCUS_06070 gene mtnA 3533 4588 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937395.1 protein_id gnl|my_center|LOCUS_06070 4638 6557 gene locus_tag LOCUS_06080 4638 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294621.1 protein_id gnl|my_center|LOCUS_06080 6636 8531 gene locus_tag LOCUS_06090 6636 8531 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_06090 8859 10685 gene locus_tag LOCUS_06100 gene glmS 8859 10685 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940414.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence051 1162 77 gene locus_tag LOCUS_06110 1162 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 1811 1167 gene locus_tag LOCUS_06120 1811 1167 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937645.1 protein_id gnl|my_center|LOCUS_06120 2475 1870 gene locus_tag LOCUS_06130 2475 1870 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937647.1 protein_id gnl|my_center|LOCUS_06130 3248 2472 gene locus_tag LOCUS_06140 3248 2472 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937648.1 protein_id gnl|my_center|LOCUS_06140 4243 3329 gene locus_tag LOCUS_06150 4243 3329 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937649.1 protein_id gnl|my_center|LOCUS_06150 5047 4265 gene locus_tag LOCUS_06160 5047 4265 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937650.1 protein_id gnl|my_center|LOCUS_06160 5947 6969 gene locus_tag LOCUS_06170 5947 6969 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940050.1 protein_id gnl|my_center|LOCUS_06170 8179 7457 gene locus_tag LOCUS_06180 8179 7457 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937821.1 protein_id gnl|my_center|LOCUS_06180 9733 8444 gene locus_tag LOCUS_06190 9733 8444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 10592 9807 gene locus_tag LOCUS_06200 gene flgG 10592 9807 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937819.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence052 1241 573 gene locus_tag LOCUS_06210 1241 573 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183717771.1 protein_id gnl|my_center|LOCUS_06210 1388 1834 gene locus_tag LOCUS_06220 1388 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 1853 2134 gene locus_tag LOCUS_06230 1853 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 2240 2866 gene locus_tag LOCUS_06240 2240 2866 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448965.1 protein_id gnl|my_center|LOCUS_06240 3053 3580 gene locus_tag LOCUS_06250 3053 3580 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938506.1 protein_id gnl|my_center|LOCUS_06250 3713 3895 gene locus_tag LOCUS_06260 gene rpmF 3713 3895 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938505.1 protein_id gnl|my_center|LOCUS_06260 3895 4929 gene locus_tag LOCUS_06270 gene plsX 3895 4929 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938504.1 protein_id gnl|my_center|LOCUS_06270 5092 6081 gene locus_tag LOCUS_06280 5092 6081 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938503.1 protein_id gnl|my_center|LOCUS_06280 6323 6408 gene locus_tag LOCUS_t00080 6323 6408 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 6515 6600 gene locus_tag LOCUS_t00090 6515 6600 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 6707 6792 gene locus_tag LOCUS_t00100 6707 6792 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 6818 7561 gene locus_tag LOCUS_06290 gene fabG 6818 7561 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938502.1 protein_id gnl|my_center|LOCUS_06290 7637 7873 gene locus_tag LOCUS_06300 gene acpP 7637 7873 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938501.1 protein_id gnl|my_center|LOCUS_06300 7958 9205 gene locus_tag LOCUS_06310 gene fabF 7958 9205 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938500.1 protein_id gnl|my_center|LOCUS_06310 9547 10785 gene locus_tag LOCUS_06320 9547 10785 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938499.1 protein_id gnl|my_center|LOCUS_06320 >Feature sequence053 <1 818 gene locus_tag LOCUS_06330 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940078.1:formate dehydrogenase-N subunit alpha 870 1535 gene locus_tag LOCUS_06340 870 1535 CDS product formate dehydrogenase 2 subunit beta (cytochrome c-553) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940077.1 protein_id gnl|my_center|LOCUS_06340 1583 2515 gene locus_tag LOCUS_06350 1583 2515 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940076.1 protein_id gnl|my_center|LOCUS_06350 1948 2027 gene locus_tag LOCUS_t00110 1948 2027 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2578 2997 gene locus_tag LOCUS_06360 2578 2997 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940075.1 protein_id gnl|my_center|LOCUS_06360 4582 3698 gene locus_tag LOCUS_06370 gene pstA 4582 3698 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939749.1 protein_id gnl|my_center|LOCUS_06370 5490 4606 gene locus_tag LOCUS_06380 gene pstC 5490 4606 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791822.1 protein_id gnl|my_center|LOCUS_06380 6478 5663 gene locus_tag LOCUS_06390 6478 5663 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939747.1 protein_id gnl|my_center|LOCUS_06390 6740 7420 gene locus_tag LOCUS_06400 6740 7420 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_06400 7492 9327 gene locus_tag LOCUS_06410 7492 9327 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937324.1 protein_id gnl|my_center|LOCUS_06410 8847 8753 gene locus_tag LOCUS_t00120 8847 8753 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 9324 10079 gene locus_tag LOCUS_06420 gene pstB 9324 10079 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938383.1 protein_id gnl|my_center|LOCUS_06420 10079 10765 gene locus_tag LOCUS_06430 gene phoU 10079 10765 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938384.1 protein_id gnl|my_center|LOCUS_06430 >Feature sequence054 2433 379 gene locus_tag LOCUS_06440 2433 379 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938180.1 protein_id gnl|my_center|LOCUS_06440 2664 3212 gene locus_tag LOCUS_06450 2664 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 4713 3556 gene locus_tag LOCUS_06460 4713 3556 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858689.1 protein_id gnl|my_center|LOCUS_06460 5007 4717 gene locus_tag LOCUS_06470 5007 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 7245 5176 gene locus_tag LOCUS_06480 7245 5176 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939143.1 protein_id gnl|my_center|LOCUS_06480 8018 7581 gene locus_tag LOCUS_06490 8018 7581 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 protein_id gnl|my_center|LOCUS_06490 8178 9185 gene locus_tag LOCUS_06500 8178 9185 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938186.1 protein_id gnl|my_center|LOCUS_06500 9736 9639 gene locus_tag LOCUS_t00130 9736 9639 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 10556 9714 gene locus_tag LOCUS_06510 10556 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 >Feature sequence055 614 108 gene locus_tag LOCUS_06520 614 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938331.1 protein_id gnl|my_center|LOCUS_06520 989 1450 gene locus_tag LOCUS_06530 989 1450 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938329.1 protein_id gnl|my_center|LOCUS_06530 1583 2734 gene locus_tag LOCUS_06540 gene hisC 1583 2734 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938328.1 protein_id gnl|my_center|LOCUS_06540 3008 3709 gene locus_tag LOCUS_06550 gene cmk 3008 3709 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938327.1 protein_id gnl|my_center|LOCUS_06550 4136 4699 gene locus_tag LOCUS_06560 4136 4699 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937625.1 protein_id gnl|my_center|LOCUS_06560 5285 6361 gene locus_tag LOCUS_06570 5285 6361 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940489.1 protein_id gnl|my_center|LOCUS_06570 6413 7225 gene locus_tag LOCUS_06580 6413 7225 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791427.1 protein_id gnl|my_center|LOCUS_06580 7281 8069 gene locus_tag LOCUS_06590 7281 8069 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940487.1 protein_id gnl|my_center|LOCUS_06590 8104 8484 gene locus_tag LOCUS_06600 8104 8484 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940486.1 protein_id gnl|my_center|LOCUS_06600 8848 9534 gene locus_tag LOCUS_06610 8848 9534 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940485.1 protein_id gnl|my_center|LOCUS_06610 9717 10052 gene locus_tag LOCUS_06620 9717 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 10049 10480 gene locus_tag LOCUS_06630 10049 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940483.1 protein_id gnl|my_center|LOCUS_06630 >Feature sequence056 1324 224 gene locus_tag LOCUS_06640 gene prfB 1324 224 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939147.1 protein_id gnl|my_center|LOCUS_06640 2925 1321 gene locus_tag LOCUS_06650 gene lnt 2925 1321 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939146.1 protein_id gnl|my_center|LOCUS_06650 3898 3050 gene locus_tag LOCUS_06660 3898 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 4150 5607 gene locus_tag LOCUS_06670 4150 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 6075 5857 gene locus_tag LOCUS_06680 6075 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 6791 6192 gene locus_tag LOCUS_06690 6791 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 7056 7532 gene locus_tag LOCUS_06700 7056 7532 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436793.1 protein_id gnl|my_center|LOCUS_06700 7828 9372 gene locus_tag LOCUS_06710 7828 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 10423 9467 gene locus_tag LOCUS_06720 10423 9467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 >Feature sequence057 1117 113 gene locus_tag LOCUS_06730 1117 113 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939581.1 protein_id gnl|my_center|LOCUS_06730 1736 1110 gene locus_tag LOCUS_06740 1736 1110 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939580.1 protein_id gnl|my_center|LOCUS_06740 2969 1977 gene locus_tag LOCUS_06750 2969 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 4131 2962 gene locus_tag LOCUS_06760 4131 2962 CDS product GAK system CofD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938386.1 protein_id gnl|my_center|LOCUS_06760 4742 4128 gene locus_tag LOCUS_06770 4742 4128 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524311.1 protein_id gnl|my_center|LOCUS_06770 6239 4848 gene locus_tag LOCUS_06780 gene mnmE 6239 4848 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938378.1 protein_id gnl|my_center|LOCUS_06780 7333 6239 gene locus_tag LOCUS_06790 7333 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 9152 7506 gene locus_tag LOCUS_06800 gene yidC 9152 7506 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938376.1 protein_id gnl|my_center|LOCUS_06800 9415 9161 gene locus_tag LOCUS_06810 gene yidD 9415 9161 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938375.1 protein_id gnl|my_center|LOCUS_06810 9967 9554 gene locus_tag LOCUS_06820 gene rnpA 9967 9554 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524309.1 protein_id gnl|my_center|LOCUS_06820 10104 9970 gene locus_tag LOCUS_06830 10104 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 >Feature sequence058 505 687 gene locus_tag LOCUS_06840 505 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 2782 1220 gene locus_tag LOCUS_06850 2782 1220 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939733.1 protein_id gnl|my_center|LOCUS_06850 3624 2788 gene locus_tag LOCUS_06860 3624 2788 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939732.1 protein_id gnl|my_center|LOCUS_06860 4666 3626 gene locus_tag LOCUS_06870 4666 3626 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939731.1 protein_id gnl|my_center|LOCUS_06870 5197 4670 gene locus_tag LOCUS_06880 5197 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791831.1 protein_id gnl|my_center|LOCUS_06880 5975 5355 gene locus_tag LOCUS_06890 gene rdgC 5975 5355 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939729.1 protein_id gnl|my_center|LOCUS_06890 9093 6469 gene locus_tag LOCUS_06900 9093 6469 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940472.1 protein_id gnl|my_center|LOCUS_06900 9475 9098 gene locus_tag LOCUS_06910 9475 9098 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940473.1 protein_id gnl|my_center|LOCUS_06910 10465 9533 gene locus_tag LOCUS_06920 10465 9533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 >Feature sequence059 114 1541 gene locus_tag LOCUS_06930 114 1541 CDS product NlpC/P60 family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524287.1 protein_id gnl|my_center|LOCUS_06930 1543 3147 gene locus_tag LOCUS_06940 gene coaE 1543 3147 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938323.1 protein_id gnl|my_center|LOCUS_06940 3144 3629 gene locus_tag LOCUS_06950 gene ybaK 3144 3629 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815307.1 protein_id gnl|my_center|LOCUS_06950 4173 3985 gene locus_tag LOCUS_06960 4173 3985 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940352.1 protein_id gnl|my_center|LOCUS_06960 4647 4246 gene locus_tag LOCUS_06970 4647 4246 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_06970 4846 6264 gene locus_tag LOCUS_06980 gene hydG 4846 6264 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939053.1 protein_id gnl|my_center|LOCUS_06980 6315 7751 gene locus_tag LOCUS_06990 6315 7751 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678778.1 protein_id gnl|my_center|LOCUS_06990 8098 9087 gene locus_tag LOCUS_07000 gene hydE 8098 9087 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081428999.1 protein_id gnl|my_center|LOCUS_07000 9084 10358 gene locus_tag LOCUS_07010 gene hydF 9084 10358 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939056.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence060 2325 79 gene locus_tag LOCUS_07020 2325 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 3294 2365 gene locus_tag LOCUS_07030 3294 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 5183 3579 gene locus_tag LOCUS_07040 5183 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 5791 5291 gene locus_tag LOCUS_07050 gene queF 5791 5291 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938262.1 protein_id gnl|my_center|LOCUS_07050 6032 6802 gene locus_tag LOCUS_07060 6032 6802 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938270.1 protein_id gnl|my_center|LOCUS_07060 6807 7688 gene locus_tag LOCUS_07070 gene ubiA 6807 7688 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792606.1 protein_id gnl|my_center|LOCUS_07070 7678 8220 gene locus_tag LOCUS_07080 gene yjgA 7678 8220 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101581.1 protein_id gnl|my_center|LOCUS_07080 8340 8415 gene locus_tag LOCUS_t00140 8340 8415 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8433 8831 gene locus_tag LOCUS_07090 8433 8831 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940209.1 protein_id gnl|my_center|LOCUS_07090 8838 9602 gene locus_tag LOCUS_07100 8838 9602 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706235.1 protein_id gnl|my_center|LOCUS_07100 9691 10344 gene locus_tag LOCUS_07110 9691 10344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence061 1131 151 gene locus_tag LOCUS_07120 gene fliM 1131 151 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938209.1 protein_id gnl|my_center|LOCUS_07120 1482 3110 gene locus_tag LOCUS_07130 1482 3110 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792640.1 protein_id gnl|my_center|LOCUS_07130 3146 4750 gene locus_tag LOCUS_07140 3146 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 4871 7132 gene locus_tag LOCUS_07150 4871 7132 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164561900.1 protein_id gnl|my_center|LOCUS_07150 7411 7932 gene locus_tag LOCUS_07160 7411 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 7946 8845 gene locus_tag LOCUS_07170 7946 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 10036 9161 gene locus_tag LOCUS_07180 gene metF 10036 9161 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938296.1 protein_id gnl|my_center|LOCUS_07180 10300 10225 gene locus_tag LOCUS_t00150 10300 10225 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence062 1438 392 gene locus_tag LOCUS_07190 1438 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 2198 1476 gene locus_tag LOCUS_07200 2198 1476 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940624.1 protein_id gnl|my_center|LOCUS_07200 3435 2242 gene locus_tag LOCUS_07210 3435 2242 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267808.1 protein_id gnl|my_center|LOCUS_07210 4849 3632 gene locus_tag LOCUS_07220 4849 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 6205 4964 gene locus_tag LOCUS_07230 6205 4964 CDS product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940554.1 protein_id gnl|my_center|LOCUS_07230 6369 8054 gene locus_tag LOCUS_07240 gene ettA 6369 8054 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939856.1 protein_id gnl|my_center|LOCUS_07240 8523 10187 gene locus_tag LOCUS_07250 8523 10187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence063 6765 4504 gene locus_tag LOCUS_07260 6765 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 7416 6772 gene locus_tag LOCUS_07270 7416 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939001.1 protein_id gnl|my_center|LOCUS_07270 9497 7416 gene locus_tag LOCUS_07280 9497 7416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939002.1 protein_id gnl|my_center|LOCUS_07280 10054 9497 gene locus_tag LOCUS_07290 10054 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939003.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence064 167 562 gene locus_tag LOCUS_07300 167 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07300 604 945 gene locus_tag LOCUS_07310 604 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 2291 1020 gene locus_tag LOCUS_07320 2291 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 5071 2951 gene locus_tag LOCUS_07330 gene flhA 5071 2951 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940490.1 protein_id gnl|my_center|LOCUS_07330 5284 6735 gene locus_tag LOCUS_07340 5284 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 6867 7955 gene locus_tag LOCUS_07350 gene flhB 6867 7955 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940491.1 protein_id gnl|my_center|LOCUS_07350 8263 9444 gene locus_tag LOCUS_07360 8263 9444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence065 339 719 gene locus_tag LOCUS_07370 gene gcvH 339 719 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938719.1 protein_id gnl|my_center|LOCUS_07370 948 2279 gene locus_tag LOCUS_07380 gene gcvPA 948 2279 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938718.1 protein_id gnl|my_center|LOCUS_07380 2276 3733 gene locus_tag LOCUS_07390 gene gcvPB 2276 3733 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938717.1 protein_id gnl|my_center|LOCUS_07390 3916 4377 gene locus_tag LOCUS_07400 3916 4377 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939688.1 protein_id gnl|my_center|LOCUS_07400 4615 6000 gene locus_tag LOCUS_07410 4615 6000 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940286.1 protein_id gnl|my_center|LOCUS_07410 6019 7317 gene locus_tag LOCUS_07420 6019 7317 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791554.1 protein_id gnl|my_center|LOCUS_07420 7438 8067 gene locus_tag LOCUS_07430 7438 8067 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940291.1 protein_id gnl|my_center|LOCUS_07430 8074 10224 gene locus_tag LOCUS_07440 8074 10224 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940292.1 protein_id gnl|my_center|LOCUS_07440 >Feature sequence066 722 150 gene locus_tag LOCUS_07450 gene cobU 722 150 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938306.1 protein_id gnl|my_center|LOCUS_07450 2320 719 gene locus_tag LOCUS_07460 2320 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 2467 2391 gene locus_tag LOCUS_t00160 2467 2391 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3123 2599 gene locus_tag LOCUS_07470 gene pyrR 3123 2599 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938679.1 protein_id gnl|my_center|LOCUS_07470 3306 3623 gene locus_tag LOCUS_07480 3306 3623 CDS product IscA/HesB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938677.1 protein_id gnl|my_center|LOCUS_07480 3645 3995 gene locus_tag LOCUS_07490 3645 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 4214 3876 gene locus_tag LOCUS_07500 4214 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 4502 7960 gene locus_tag LOCUS_07510 gene mfd 4502 7960 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792158.1 protein_id gnl|my_center|LOCUS_07510 7954 8943 gene locus_tag LOCUS_07520 7954 8943 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792159.1 protein_id gnl|my_center|LOCUS_07520 9198 10133 gene locus_tag LOCUS_07530 9198 10133 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294672.1 protein_id gnl|my_center|LOCUS_07530 >Feature sequence067 2075 51 gene locus_tag LOCUS_07540 gene fusA 2075 51 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939087.1 protein_id gnl|my_center|LOCUS_07540 3052 2084 gene locus_tag LOCUS_07550 3052 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940655.1 protein_id gnl|my_center|LOCUS_07550 4260 3769 gene locus_tag LOCUS_07560 4260 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 5652 4261 gene locus_tag LOCUS_07570 gene argH 5652 4261 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938393.1 protein_id gnl|my_center|LOCUS_07570 7034 5826 gene locus_tag LOCUS_07580 7034 5826 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938394.1 protein_id gnl|my_center|LOCUS_07580 >Feature sequence068 678 151 gene locus_tag LOCUS_07590 gene rfbC 678 151 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261024.1 protein_id gnl|my_center|LOCUS_07590 2153 747 gene locus_tag LOCUS_07600 gene gltX 2153 747 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939822.1 protein_id gnl|my_center|LOCUS_07600 2152 2454 gene locus_tag LOCUS_07610 2152 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 2521 3414 gene locus_tag LOCUS_07620 2521 3414 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_07620 6351 3643 gene locus_tag LOCUS_07630 6351 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 6427 7551 gene locus_tag LOCUS_07640 6427 7551 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_07640 7554 8327 gene locus_tag LOCUS_07650 7554 8327 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_07650 8446 9393 gene locus_tag LOCUS_07660 8446 9393 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390200.1 protein_id gnl|my_center|LOCUS_07660 9390 10007 gene locus_tag LOCUS_07670 9390 10007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence069 3659 3147 gene locus_tag LOCUS_07680 3659 3147 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939592.1 protein_id gnl|my_center|LOCUS_07680 3876 4508 gene locus_tag LOCUS_07690 3876 4508 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939589.1 protein_id gnl|my_center|LOCUS_07690 4546 5043 gene locus_tag LOCUS_07700 4546 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 6244 5537 gene locus_tag LOCUS_07710 6244 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 6722 6360 gene locus_tag LOCUS_07720 6722 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 8622 6847 gene locus_tag LOCUS_07730 8622 6847 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963431.1 protein_id gnl|my_center|LOCUS_07730 <10137 9020 gene locus_tag LOCUS_07740 <10137 9020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815196.1:DASS family sodium-coupled anion symporter >Feature sequence070 1514 93 gene locus_tag LOCUS_07750 1514 93 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938761.1 protein_id gnl|my_center|LOCUS_07750 3070 1598 gene locus_tag LOCUS_07760 3070 1598 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938762.1 protein_id gnl|my_center|LOCUS_07760 4433 3228 gene locus_tag LOCUS_07770 4433 3228 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179295.1 protein_id gnl|my_center|LOCUS_07770 4725 5678 gene locus_tag LOCUS_07780 4725 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 6503 5877 gene locus_tag LOCUS_07790 gene upp 6503 5877 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938324.1 protein_id gnl|my_center|LOCUS_07790 6887 8524 gene locus_tag LOCUS_07800 gene pgm 6887 8524 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938721.1 protein_id gnl|my_center|LOCUS_07800 8651 9334 gene locus_tag LOCUS_07810 8651 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 >Feature sequence071 1583 294 gene locus_tag LOCUS_07820 1583 294 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766478.1 protein_id gnl|my_center|LOCUS_07820 2779 1580 gene locus_tag LOCUS_07830 2779 1580 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948034.1 protein_id gnl|my_center|LOCUS_07830 3062 4003 gene locus_tag LOCUS_07840 3062 4003 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285055.1 protein_id gnl|my_center|LOCUS_07840 4684 4208 gene locus_tag LOCUS_07850 4684 4208 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_07850 5476 4706 gene locus_tag LOCUS_07860 5476 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 6364 5504 gene locus_tag LOCUS_07870 6364 5504 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_07870 6580 6780 gene locus_tag LOCUS_07880 6580 6780 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937959.1 protein_id gnl|my_center|LOCUS_07880 6780 7340 gene locus_tag LOCUS_07890 gene yfcE 6780 7340 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937963.1 protein_id gnl|my_center|LOCUS_07890 7337 7972 gene locus_tag LOCUS_07900 7337 7972 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937833.1 protein_id gnl|my_center|LOCUS_07900 8107 9789 gene locus_tag LOCUS_07910 gene ilvD 8107 9789 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940628.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence072 1051 137 gene locus_tag LOCUS_07920 1051 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 1104 2450 gene locus_tag LOCUS_07930 1104 2450 CDS product MiaB/RimO family radical SAM methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938196.1 protein_id gnl|my_center|LOCUS_07930 2691 2975 gene locus_tag LOCUS_07940 2691 2975 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792597.1 protein_id gnl|my_center|LOCUS_07940 3214 4095 gene locus_tag LOCUS_07950 3214 4095 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938197.1 protein_id gnl|my_center|LOCUS_07950 4099 4353 gene locus_tag LOCUS_07960 4099 4353 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938198.1 protein_id gnl|my_center|LOCUS_07960 4353 4967 gene locus_tag LOCUS_07970 gene gmk 4353 4967 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938199.1 protein_id gnl|my_center|LOCUS_07970 4964 5674 gene locus_tag LOCUS_07980 gene pyrF 4964 5674 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938200.1 protein_id gnl|my_center|LOCUS_07980 5978 7318 gene locus_tag LOCUS_07990 5978 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 7991 9715 gene locus_tag LOCUS_08000 gene recJ 7991 9715 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938203.1 protein_id gnl|my_center|LOCUS_08000 >Feature sequence073 1140 808 gene locus_tag LOCUS_08010 1140 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 1506 2510 gene locus_tag LOCUS_08020 1506 2510 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294587.1 protein_id gnl|my_center|LOCUS_08020 3368 5467 gene locus_tag LOCUS_08030 3368 5467 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 protein_id gnl|my_center|LOCUS_08030 5468 6916 gene locus_tag LOCUS_08040 5468 6916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 6920 8407 gene locus_tag LOCUS_08050 6920 8407 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_08050 8721 9569 gene locus_tag LOCUS_08060 8721 9569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence074 106 576 gene locus_tag LOCUS_08070 106 576 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937348.1 protein_id gnl|my_center|LOCUS_08070 698 1702 gene locus_tag LOCUS_08080 698 1702 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693870.1 protein_id gnl|my_center|LOCUS_08080 1810 2364 gene locus_tag LOCUS_08090 1810 2364 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259757.1 protein_id gnl|my_center|LOCUS_08090 2368 3648 gene locus_tag LOCUS_08100 2368 3648 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974961.1 protein_id gnl|my_center|LOCUS_08100 3801 5084 gene locus_tag LOCUS_08110 3801 5084 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937381.1 protein_id gnl|my_center|LOCUS_08110 5085 9044 gene locus_tag LOCUS_08120 5085 9044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 9140 9577 gene locus_tag LOCUS_08130 9140 9577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence075 55 1005 gene locus_tag LOCUS_08140 gene trbB 55 1005 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015633597.1 protein_id gnl|my_center|LOCUS_08140 986 1222 gene locus_tag LOCUS_08150 986 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 1197 1532 gene locus_tag LOCUS_08160 1197 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1532 1819 gene locus_tag LOCUS_08170 1532 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1825 3033 gene locus_tag LOCUS_08180 1825 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 3037 3591 gene locus_tag LOCUS_08190 3037 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 3588 3974 gene locus_tag LOCUS_08200 3588 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 3971 5536 gene locus_tag LOCUS_08210 3971 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 5539 6831 gene locus_tag LOCUS_08220 5539 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 6821 7486 gene locus_tag LOCUS_08230 6821 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 7490 9145 gene locus_tag LOCUS_08240 7490 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence076 430 738 gene locus_tag LOCUS_08250 430 738 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 protein_id gnl|my_center|LOCUS_08250 776 1048 gene locus_tag LOCUS_08260 776 1048 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739893.1 protein_id gnl|my_center|LOCUS_08260 2061 1267 gene locus_tag LOCUS_08270 2061 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 2415 2251 gene locus_tag LOCUS_08280 2415 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 3454 2846 gene locus_tag LOCUS_08290 gene recR 3454 2846 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940458.1 protein_id gnl|my_center|LOCUS_08290 3701 3949 gene locus_tag LOCUS_08300 3701 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 4354 4043 gene locus_tag LOCUS_08310 4354 4043 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940457.1 protein_id gnl|my_center|LOCUS_08310 6318 4516 gene locus_tag LOCUS_08320 gene dnaX 6318 4516 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940456.1 protein_id gnl|my_center|LOCUS_08320 7370 6450 gene locus_tag LOCUS_08330 7370 6450 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791450.1 protein_id gnl|my_center|LOCUS_08330 7532 9289 gene locus_tag LOCUS_08340 7532 9289 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939515.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence077 <1 936 gene locus_tag LOCUS_08350 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869387.1:ABC transporter substrate-binding protein 1084 1977 gene locus_tag LOCUS_08360 1084 1977 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869388.1 protein_id gnl|my_center|LOCUS_08360 1977 3026 gene locus_tag LOCUS_08370 1977 3026 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869389.1 protein_id gnl|my_center|LOCUS_08370 3023 3823 gene locus_tag LOCUS_08380 3023 3823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925352.1 protein_id gnl|my_center|LOCUS_08380 3816 4541 gene locus_tag LOCUS_08390 3816 4541 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869391.1 protein_id gnl|my_center|LOCUS_08390 4848 7502 gene locus_tag LOCUS_08400 4848 7502 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_08400 7809 8267 gene locus_tag LOCUS_08410 gene tnpA 7809 8267 CDS product IS200/IS605-like element IS200C family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526135.1 protein_id gnl|my_center|LOCUS_08410 8543 9094 gene locus_tag LOCUS_08420 8543 9094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 >Feature sequence078 17 251 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttgtagttgcctgtccagattgatcctgctaaact 364 1266 gene locus_tag LOCUS_08430 gene cas1 364 1266 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_08430 1779 1414 gene locus_tag LOCUS_08440 gene cas2 1779 1414 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_08440 5182 1754 gene locus_tag LOCUS_08450 5182 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 5524 5267 gene locus_tag LOCUS_08460 5524 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 5468 5989 gene locus_tag LOCUS_08470 5468 5989 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940563.1 protein_id gnl|my_center|LOCUS_08470 6171 7241 gene locus_tag LOCUS_08480 6171 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence079 967 53 gene locus_tag LOCUS_08490 967 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 1187 2974 gene locus_tag LOCUS_08500 1187 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 2968 3843 gene locus_tag LOCUS_08510 2968 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 3904 4953 gene locus_tag LOCUS_08520 3904 4953 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546361.1 protein_id gnl|my_center|LOCUS_08520 5474 6397 gene locus_tag LOCUS_08530 5474 6397 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287342.1 protein_id gnl|my_center|LOCUS_08530 6384 7229 gene locus_tag LOCUS_08540 6384 7229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227948.1 protein_id gnl|my_center|LOCUS_08540 7236 8102 gene locus_tag LOCUS_08550 7236 8102 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101257.1 protein_id gnl|my_center|LOCUS_08550 8129 9208 gene locus_tag LOCUS_08560 gene rffG 8129 9208 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226601.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence080 1016 777 gene locus_tag LOCUS_08570 1016 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 2246 1089 gene locus_tag LOCUS_08580 2246 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 3114 4256 gene locus_tag LOCUS_08590 3114 4256 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310055.1 protein_id gnl|my_center|LOCUS_08590 4330 6432 gene locus_tag LOCUS_08600 4330 6432 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707714.1 protein_id gnl|my_center|LOCUS_08600 6429 6851 gene locus_tag LOCUS_08610 6429 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 6848 7369 gene locus_tag LOCUS_08620 6848 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 7363 8715 gene locus_tag LOCUS_08630 7363 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence081 251 726 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaatccctttatgaatcaggtctatttctac 2534 954 gene locus_tag LOCUS_08640 2534 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 3501 2536 gene locus_tag LOCUS_08650 3501 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229150.1 protein_id gnl|my_center|LOCUS_08650 4364 3675 gene locus_tag LOCUS_08660 gene csm3 4364 3675 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876704.1 protein_id gnl|my_center|LOCUS_08660 4779 4387 gene locus_tag LOCUS_08670 4779 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 7202 4791 gene locus_tag LOCUS_08680 gene cas10 7202 4791 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229152.1 protein_id gnl|my_center|LOCUS_08680 8728 7634 gene locus_tag LOCUS_08690 gene csm6 8728 7634 CDS product CRISPR-associated ring nuclease Csm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546577.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence082 1383 235 gene locus_tag LOCUS_08700 1383 235 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937701.1 protein_id gnl|my_center|LOCUS_08700 1497 1784 gene locus_tag LOCUS_08710 1497 1784 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937703.1 protein_id gnl|my_center|LOCUS_08710 2013 3542 gene locus_tag LOCUS_08720 2013 3542 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083207.1 protein_id gnl|my_center|LOCUS_08720 3555 5831 gene locus_tag LOCUS_08730 3555 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 6078 7325 gene locus_tag LOCUS_08740 6078 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 7383 8834 gene locus_tag LOCUS_08750 7383 8834 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940197.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence083 1280 129 gene locus_tag LOCUS_08760 1280 129 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467385.1 protein_id gnl|my_center|LOCUS_08760 3706 1277 gene locus_tag LOCUS_08770 3706 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 4809 3712 gene locus_tag LOCUS_08780 4809 3712 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_08780 6579 4969 gene locus_tag LOCUS_08790 6579 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 8167 6800 gene locus_tag LOCUS_08800 8167 6800 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850841.1 protein_id gnl|my_center|LOCUS_08800 >Feature sequence084 330 244 gene locus_tag LOCUS_t00170 330 244 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3553 842 gene locus_tag LOCUS_08810 3553 842 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938942.1 protein_id gnl|my_center|LOCUS_08810 4452 3550 gene locus_tag LOCUS_08820 gene xerD 4452 3550 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792251.1 protein_id gnl|my_center|LOCUS_08820 4615 5121 gene locus_tag LOCUS_08830 gene folK 4615 5121 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081428870.1 protein_id gnl|my_center|LOCUS_08830 5205 5513 gene locus_tag LOCUS_08840 5205 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938946.1 protein_id gnl|my_center|LOCUS_08840 6987 5665 gene locus_tag LOCUS_08850 6987 5665 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_08850 7169 7807 gene locus_tag LOCUS_08860 7169 7807 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524381.1 protein_id gnl|my_center|LOCUS_08860 7829 8734 gene locus_tag LOCUS_08870 7829 8734 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939133.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence085 1368 139 gene locus_tag LOCUS_08880 1368 139 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_08880 2085 1414 gene locus_tag LOCUS_08890 gene cysC 2085 1414 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046849124.1 protein_id gnl|my_center|LOCUS_08890 2785 2078 gene locus_tag LOCUS_08900 2785 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 5384 2967 gene locus_tag LOCUS_08910 5384 2967 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792925.1 protein_id gnl|my_center|LOCUS_08910 7086 5734 gene locus_tag LOCUS_08920 7086 5734 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703620.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence086 116 772 gene locus_tag LOCUS_08930 116 772 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937882.1 protein_id gnl|my_center|LOCUS_08930 1057 1491 gene locus_tag LOCUS_08940 gene rplM 1057 1491 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939788.1 protein_id gnl|my_center|LOCUS_08940 1505 1897 gene locus_tag LOCUS_08950 gene rpsI 1505 1897 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939789.1 protein_id gnl|my_center|LOCUS_08950 2303 3556 gene locus_tag LOCUS_08960 2303 3556 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938299.1 protein_id gnl|my_center|LOCUS_08960 3606 4121 gene locus_tag LOCUS_08970 3606 4121 CDS product rhodanese family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920703.1 protein_id gnl|my_center|LOCUS_08970 4109 5167 gene locus_tag LOCUS_08980 gene gluQRS 4109 5167 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_08980 5597 6307 gene locus_tag LOCUS_08990 5597 6307 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391259.1 protein_id gnl|my_center|LOCUS_08990 6391 6879 gene locus_tag LOCUS_09000 6391 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 7729 7022 gene locus_tag LOCUS_09010 7729 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 7924 8298 gene locus_tag LOCUS_09020 7924 8298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938981.1 protein_id gnl|my_center|LOCUS_09020 8347 8422 gene locus_tag LOCUS_t00180 8347 8422 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence087 519 998 gene locus_tag LOCUS_09030 gene rnhA 519 998 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937992.1 protein_id gnl|my_center|LOCUS_09030 1010 1978 gene locus_tag LOCUS_09040 1010 1978 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937994.1 protein_id gnl|my_center|LOCUS_09040 2023 2271 gene locus_tag LOCUS_09050 2023 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937447.1 protein_id gnl|my_center|LOCUS_09050 2686 2985 gene locus_tag LOCUS_09060 2686 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 3049 3714 gene locus_tag LOCUS_09070 3049 3714 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937452.1 protein_id gnl|my_center|LOCUS_09070 3777 4760 gene locus_tag LOCUS_09080 gene trpS 3777 4760 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937453.1 protein_id gnl|my_center|LOCUS_09080 4771 5208 gene locus_tag LOCUS_09090 gene ruvX 4771 5208 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940329.1 protein_id gnl|my_center|LOCUS_09090 5205 6245 gene locus_tag LOCUS_09100 5205 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 6358 7830 gene locus_tag LOCUS_09110 6358 7830 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391106.1 protein_id gnl|my_center|LOCUS_09110 7907 8572 gene locus_tag LOCUS_09120 7907 8572 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940346.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence088 3366 142 gene locus_tag LOCUS_09130 3366 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 4160 3363 gene locus_tag LOCUS_09140 4160 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09140 6579 4378 gene locus_tag LOCUS_09150 6579 4378 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940570.1 protein_id gnl|my_center|LOCUS_09150 7582 6572 gene locus_tag LOCUS_09160 7582 6572 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_09160 7792 8634 gene locus_tag LOCUS_09170 7792 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 >Feature sequence089 674 96 gene locus_tag LOCUS_09180 674 96 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792236.1 protein_id gnl|my_center|LOCUS_09180 3445 983 gene locus_tag LOCUS_09190 3445 983 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939179.1 protein_id gnl|my_center|LOCUS_09190 4527 3589 gene locus_tag LOCUS_09200 gene hemC 4527 3589 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939176.1 protein_id gnl|my_center|LOCUS_09200 5073 4837 gene locus_tag LOCUS_09210 5073 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 5645 5091 gene locus_tag LOCUS_09220 5645 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 5745 6605 gene locus_tag LOCUS_09230 5745 6605 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939174.1 protein_id gnl|my_center|LOCUS_09230 6624 8366 gene locus_tag LOCUS_09240 6624 8366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939173.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence090 614 24 gene locus_tag LOCUS_09250 614 24 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938344.1 protein_id gnl|my_center|LOCUS_09250 744 607 gene locus_tag LOCUS_09260 744 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1498 800 gene locus_tag LOCUS_09270 gene ccsA 1498 800 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_09270 2922 1495 gene locus_tag LOCUS_09280 2922 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 5016 3031 gene locus_tag LOCUS_09290 5016 3031 CDS product cytochrome c-type biogenesis CcmF C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938349.1 protein_id gnl|my_center|LOCUS_09290 5694 5284 gene locus_tag LOCUS_09300 5694 5284 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938350.1 protein_id gnl|my_center|LOCUS_09300 7066 6020 gene locus_tag LOCUS_09310 7066 6020 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792562.1 protein_id gnl|my_center|LOCUS_09310 7173 8561 gene locus_tag LOCUS_09320 7173 8561 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706226.1 protein_id gnl|my_center|LOCUS_09320 >Feature sequence091 2508 109 gene locus_tag LOCUS_09330 gene gyrB 2508 109 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937314.1 protein_id gnl|my_center|LOCUS_09330 3662 2508 gene locus_tag LOCUS_09340 gene dnaN 3662 2508 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937313.1 protein_id gnl|my_center|LOCUS_09340 5060 3807 gene locus_tag LOCUS_09350 5060 3807 CDS product DnaA/Hda family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937312.1 protein_id gnl|my_center|LOCUS_09350 5314 6756 gene locus_tag LOCUS_09360 5314 6756 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940649.1 protein_id gnl|my_center|LOCUS_09360 8132 6945 gene locus_tag LOCUS_09370 8132 6945 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393028.1 protein_id gnl|my_center|LOCUS_09370 >Feature sequence092 1456 71 gene locus_tag LOCUS_09380 1456 71 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021695.1 protein_id gnl|my_center|LOCUS_09380 2170 1607 gene locus_tag LOCUS_09390 2170 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 2427 4010 gene locus_tag LOCUS_09400 gene lysS 2427 4010 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791906.1 protein_id gnl|my_center|LOCUS_09400 4017 5249 gene locus_tag LOCUS_09410 4017 5249 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939648.1 protein_id gnl|my_center|LOCUS_09410 5252 5935 gene locus_tag LOCUS_09420 5252 5935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939647.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence093 3144 145 gene locus_tag LOCUS_09430 3144 145 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940439.1 protein_id gnl|my_center|LOCUS_09430 4152 3181 gene locus_tag LOCUS_09440 4152 3181 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940437.1 protein_id gnl|my_center|LOCUS_09440 4914 4159 gene locus_tag LOCUS_09450 gene mqnB 4914 4159 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791464.1 protein_id gnl|my_center|LOCUS_09450 6229 4916 gene locus_tag LOCUS_09460 6229 4916 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940434.1 protein_id gnl|my_center|LOCUS_09460 7066 6335 gene locus_tag LOCUS_09470 7066 6335 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940432.1 protein_id gnl|my_center|LOCUS_09470 7242 7063 gene locus_tag LOCUS_09480 7242 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 >Feature sequence094 2439 1324 gene locus_tag LOCUS_09490 2439 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 4100 2934 gene locus_tag LOCUS_09500 4100 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 5206 4097 gene locus_tag LOCUS_09510 5206 4097 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813006.1 protein_id gnl|my_center|LOCUS_09510 5302 6762 gene locus_tag LOCUS_09520 gene rfaE1 5302 6762 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387884.1 protein_id gnl|my_center|LOCUS_09520 6944 8320 gene locus_tag LOCUS_09530 6944 8320 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938716.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence095 755 51 gene locus_tag LOCUS_09540 gene atpB 755 51 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938217.1 protein_id gnl|my_center|LOCUS_09540 1282 866 gene locus_tag LOCUS_09550 1282 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1577 1275 gene locus_tag LOCUS_09560 1577 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 3265 1751 gene locus_tag LOCUS_09570 gene rlmD 3265 1751 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938223.1 protein_id gnl|my_center|LOCUS_09570 3467 3775 gene locus_tag LOCUS_09580 gene rplU 3467 3775 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938226.1 protein_id gnl|my_center|LOCUS_09580 3833 4102 gene locus_tag LOCUS_09590 gene rpmA 3833 4102 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938227.1 protein_id gnl|my_center|LOCUS_09590 4216 5316 gene locus_tag LOCUS_09600 gene obgE 4216 5316 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938228.1 protein_id gnl|my_center|LOCUS_09600 5329 6510 gene locus_tag LOCUS_09610 gene proB 5329 6510 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938229.1 protein_id gnl|my_center|LOCUS_09610 6922 7092 gene locus_tag LOCUS_09620 6922 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 7320 8279 gene locus_tag LOCUS_09630 7320 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence096 998 60 gene locus_tag LOCUS_09640 998 60 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940312.1 protein_id gnl|my_center|LOCUS_09640 3472 1079 gene locus_tag LOCUS_09650 3472 1079 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937936.1 protein_id gnl|my_center|LOCUS_09650 3980 3663 gene locus_tag LOCUS_09660 3980 3663 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940042.1 protein_id gnl|my_center|LOCUS_09660 4816 4172 gene locus_tag LOCUS_09670 4816 4172 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_09670 4987 6237 gene locus_tag LOCUS_09680 4987 6237 CDS product LarC family nickel insertion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940038.1 protein_id gnl|my_center|LOCUS_09680 7632 6616 gene locus_tag LOCUS_09690 gene gap 7632 6616 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937869.1 protein_id gnl|my_center|LOCUS_09690 8335 7781 gene locus_tag LOCUS_09700 8335 7781 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937870.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence097 99 347 gene locus_tag LOCUS_09710 99 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 412 1026 gene locus_tag LOCUS_09720 412 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1026 1292 gene locus_tag LOCUS_09730 1026 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1295 1774 gene locus_tag LOCUS_09740 1295 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1774 2235 gene locus_tag LOCUS_09750 1774 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 2217 3584 gene locus_tag LOCUS_09760 2217 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 3597 4067 gene locus_tag LOCUS_09770 3597 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 4067 4378 gene locus_tag LOCUS_09780 4067 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 4371 5009 gene locus_tag LOCUS_09790 4371 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 5155 6081 gene locus_tag LOCUS_09800 5155 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940670.1 protein_id gnl|my_center|LOCUS_09800 6082 6570 gene locus_tag LOCUS_09810 6082 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 6597 8024 gene locus_tag LOCUS_09820 6597 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence098 639 88 gene locus_tag LOCUS_09830 gene aroL 639 88 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816919.1 protein_id gnl|my_center|LOCUS_09830 1840 764 gene locus_tag LOCUS_09840 1840 764 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937603.1 protein_id gnl|my_center|LOCUS_09840 2250 1837 gene locus_tag LOCUS_09850 2250 1837 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940310.1 protein_id gnl|my_center|LOCUS_09850 4237 2252 gene locus_tag LOCUS_09860 4237 2252 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940311.1 protein_id gnl|my_center|LOCUS_09860 5343 4234 gene locus_tag LOCUS_09870 5343 4234 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927122.1 protein_id gnl|my_center|LOCUS_09870 6690 5515 gene locus_tag LOCUS_09880 6690 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_09880 7612 6698 gene locus_tag LOCUS_09890 7612 6698 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940572.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence099 2857 194 gene locus_tag LOCUS_09900 gene alaS 2857 194 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938388.1 protein_id gnl|my_center|LOCUS_09900 4216 3125 gene locus_tag LOCUS_09910 gene recA 4216 3125 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938389.1 protein_id gnl|my_center|LOCUS_09910 4440 5672 gene locus_tag LOCUS_09920 4440 5672 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938390.1 protein_id gnl|my_center|LOCUS_09920 5723 6085 gene locus_tag LOCUS_09930 gene dksA 5723 6085 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939427.1 protein_id gnl|my_center|LOCUS_09930 6418 8130 gene locus_tag LOCUS_09940 6418 8130 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939426.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence100 2928 286 gene locus_tag LOCUS_09950 2928 286 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791422.1 protein_id gnl|my_center|LOCUS_09950 5251 3155 gene locus_tag LOCUS_09960 5251 3155 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_09960 5766 5263 gene locus_tag LOCUS_09970 5766 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 6871 5924 gene locus_tag LOCUS_09980 6871 5924 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_09980 6921 7913 gene locus_tag LOCUS_09990 6921 7913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence101 1833 85 gene locus_tag LOCUS_10000 1833 85 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_10000 2261 3337 gene locus_tag LOCUS_10010 2261 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 3484 4878 gene locus_tag LOCUS_10020 3484 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 4914 7976 gene locus_tag LOCUS_10030 4914 7976 CDS product virulence factor SrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267841.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence102 2051 261 gene locus_tag LOCUS_10040 2051 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 3032 2421 gene locus_tag LOCUS_10050 3032 2421 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255233.1 protein_id gnl|my_center|LOCUS_10050 4327 3029 gene locus_tag LOCUS_10060 4327 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 4431 5147 gene locus_tag LOCUS_10070 4431 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 5528 6271 gene locus_tag LOCUS_10080 5528 6271 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938534.1 protein_id gnl|my_center|LOCUS_10080 6419 7222 gene locus_tag LOCUS_10090 6419 7222 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792490.1 protein_id gnl|my_center|LOCUS_10090 7206 7952 gene locus_tag LOCUS_10100 7206 7952 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938532.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence103 720 211 gene locus_tag LOCUS_10110 720 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 783 1085 gene locus_tag LOCUS_10120 783 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1082 1471 gene locus_tag LOCUS_10130 1082 1471 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940583.1 protein_id gnl|my_center|LOCUS_10130 1471 1809 gene locus_tag LOCUS_10140 1471 1809 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791360.1 protein_id gnl|my_center|LOCUS_10140 1939 2190 gene locus_tag LOCUS_10150 1939 2190 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939210.1 protein_id gnl|my_center|LOCUS_10150 2513 5326 gene locus_tag LOCUS_10160 gene ileS 2513 5326 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939213.1 protein_id gnl|my_center|LOCUS_10160 5331 5837 gene locus_tag LOCUS_10170 gene lspA 5331 5837 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939214.1 protein_id gnl|my_center|LOCUS_10170 5834 6043 gene locus_tag LOCUS_10180 5834 6043 CDS product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939215.1 protein_id gnl|my_center|LOCUS_10180 6064 7011 gene locus_tag LOCUS_10190 gene ybgF 6064 7011 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939216.1 protein_id gnl|my_center|LOCUS_10190 7168 7833 gene locus_tag LOCUS_10200 7168 7833 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938751.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence104 1280 492 gene locus_tag LOCUS_10210 1280 492 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707810.1 protein_id gnl|my_center|LOCUS_10210 3681 1306 gene locus_tag LOCUS_10220 3681 1306 CDS product PEP-utilizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707812.1 protein_id gnl|my_center|LOCUS_10220 4374 3703 gene locus_tag LOCUS_10230 4374 3703 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201881088.1 protein_id gnl|my_center|LOCUS_10230 4774 5517 gene locus_tag LOCUS_10240 4774 5517 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937693.1 protein_id gnl|my_center|LOCUS_10240 5632 6306 gene locus_tag LOCUS_10250 5632 6306 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937694.1 protein_id gnl|my_center|LOCUS_10250 6310 7059 gene locus_tag LOCUS_10260 6310 7059 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937695.1 protein_id gnl|my_center|LOCUS_10260 7066 7734 gene locus_tag LOCUS_10270 7066 7734 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937696.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence105 88 1563 gene locus_tag LOCUS_10280 88 1563 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937712.1 protein_id gnl|my_center|LOCUS_10280 2096 3241 gene locus_tag LOCUS_10290 2096 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 3291 3776 gene locus_tag LOCUS_10300 gene moaC 3291 3776 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294688.1 protein_id gnl|my_center|LOCUS_10300 3801 4586 gene locus_tag LOCUS_10310 gene lgt 3801 4586 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937326.1 protein_id gnl|my_center|LOCUS_10310 4763 4981 gene locus_tag LOCUS_10320 gene infA 4763 4981 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937325.1 protein_id gnl|my_center|LOCUS_10320 5173 5646 gene locus_tag LOCUS_10330 5173 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 5701 5786 gene locus_tag LOCUS_t00190 5701 5786 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6163 7359 gene locus_tag LOCUS_10340 6163 7359 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939834.1 protein_id gnl|my_center|LOCUS_10340 7768 7493 gene locus_tag LOCUS_10350 7768 7493 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence106 69 830 gene locus_tag LOCUS_10360 69 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 840 1901 gene locus_tag LOCUS_10370 840 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1912 2460 gene locus_tag LOCUS_10380 1912 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 2462 2713 gene locus_tag LOCUS_10390 2462 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2718 3122 gene locus_tag LOCUS_10400 2718 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 3125 5242 gene locus_tag LOCUS_10410 3125 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 5232 5795 gene locus_tag LOCUS_10420 5232 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 5792 6331 gene locus_tag LOCUS_10430 5792 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 6331 6993 gene locus_tag LOCUS_10440 6331 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 7063 7866 gene locus_tag LOCUS_10450 7063 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence107 589 83 gene locus_tag LOCUS_10460 589 83 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_10460 2344 914 gene locus_tag LOCUS_10470 gene cls 2344 914 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937731.1 protein_id gnl|my_center|LOCUS_10470 2613 2801 gene locus_tag LOCUS_10480 2613 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 3223 2798 gene locus_tag LOCUS_10490 3223 2798 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629761.1 protein_id gnl|my_center|LOCUS_10490 6534 3271 gene locus_tag LOCUS_10500 6534 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 7371 6811 gene locus_tag LOCUS_10510 7371 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 7633 7298 gene locus_tag LOCUS_10520 7633 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence108 427 71 gene locus_tag LOCUS_10530 427 71 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938085.1 protein_id gnl|my_center|LOCUS_10530 1578 469 gene locus_tag LOCUS_10540 gene rodA 1578 469 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938086.1 protein_id gnl|my_center|LOCUS_10540 3703 1649 gene locus_tag LOCUS_10550 gene mrdA 3703 1649 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938087.1 protein_id gnl|my_center|LOCUS_10550 4163 3690 gene locus_tag LOCUS_10560 4163 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938088.1 protein_id gnl|my_center|LOCUS_10560 5108 4167 gene locus_tag LOCUS_10570 gene mreC 5108 4167 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938089.1 protein_id gnl|my_center|LOCUS_10570 6471 5443 gene locus_tag LOCUS_10580 6471 5443 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_10580 6806 7690 gene locus_tag LOCUS_10590 6806 7690 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938091.1 protein_id gnl|my_center|LOCUS_10590 >Feature sequence109 257 940 gene locus_tag LOCUS_10600 257 940 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792219.1 protein_id gnl|my_center|LOCUS_10600 1238 2017 gene locus_tag LOCUS_10610 gene queC 1238 2017 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939928.1 protein_id gnl|my_center|LOCUS_10610 2041 2592 gene locus_tag LOCUS_10620 2041 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 2785 3006 gene locus_tag LOCUS_10630 2785 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 3269 4504 gene locus_tag LOCUS_10640 3269 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 5017 5601 gene locus_tag LOCUS_10650 5017 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 5598 6569 gene locus_tag LOCUS_10660 5598 6569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 6569 6820 gene locus_tag LOCUS_10670 6569 6820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 6823 7452 gene locus_tag LOCUS_10680 6823 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence110 1495 560 gene locus_tag LOCUS_10690 1495 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1860 1579 gene locus_tag LOCUS_10700 1860 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 3128 1986 gene locus_tag LOCUS_10710 3128 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 5437 3125 gene locus_tag LOCUS_10720 5437 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 7601 5418 gene locus_tag LOCUS_10730 7601 5418 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence111 1719 262 gene locus_tag LOCUS_10740 1719 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938421.1 protein_id gnl|my_center|LOCUS_10740 2477 1875 gene locus_tag LOCUS_10750 2477 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035066306.1 protein_id gnl|my_center|LOCUS_10750 2718 2461 gene locus_tag LOCUS_10760 2718 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 3119 2715 gene locus_tag LOCUS_10770 3119 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 3446 3123 gene locus_tag LOCUS_10780 3446 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 3747 3400 gene locus_tag LOCUS_10790 3747 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 4427 3744 gene locus_tag LOCUS_10800 4427 3744 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939968.1 protein_id gnl|my_center|LOCUS_10800 4812 4450 gene locus_tag LOCUS_10810 4812 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 5429 4977 gene locus_tag LOCUS_10820 5429 4977 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938429.1 protein_id gnl|my_center|LOCUS_10820 5789 5439 gene locus_tag LOCUS_10830 5789 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 6267 5782 gene locus_tag LOCUS_10840 6267 5782 CDS product regulatory protein GemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035066287.1 protein_id gnl|my_center|LOCUS_10840 6688 6260 gene locus_tag LOCUS_10850 6688 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938432.1 protein_id gnl|my_center|LOCUS_10850 6872 6693 gene locus_tag LOCUS_10860 6872 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence112 <1 1880 gene locus_tag LOCUS_10870 <1 1880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940228.1:acetate--CoA ligase 2538 2447 gene locus_tag LOCUS_t00200 2538 2447 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2922 2686 gene locus_tag LOCUS_10880 2922 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 3588 2941 gene locus_tag LOCUS_10890 3588 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 5582 3924 gene locus_tag LOCUS_10900 5582 3924 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938175.1 protein_id gnl|my_center|LOCUS_10900 7248 5830 gene locus_tag LOCUS_10910 7248 5830 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940356.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence113 331 92 gene locus_tag LOCUS_10920 gene rpsP 331 92 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938140.1 protein_id gnl|my_center|LOCUS_10920 1933 422 gene locus_tag LOCUS_10930 gene ffh 1933 422 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938141.1 protein_id gnl|my_center|LOCUS_10930 2151 3608 gene locus_tag LOCUS_10940 gene guaB 2151 3608 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938343.1 protein_id gnl|my_center|LOCUS_10940 3721 5265 gene locus_tag LOCUS_10950 gene guaA 3721 5265 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938342.1 protein_id gnl|my_center|LOCUS_10950 6027 5635 gene locus_tag LOCUS_10960 6027 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10960 7056 6046 gene locus_tag LOCUS_10970 7056 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10970 >Feature sequence114 1610 66 gene locus_tag LOCUS_10980 1610 66 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937653.1 protein_id gnl|my_center|LOCUS_10980 2343 1615 gene locus_tag LOCUS_10990 2343 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 3227 2370 gene locus_tag LOCUS_11000 3227 2370 CDS product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929312.1 protein_id gnl|my_center|LOCUS_11000 3398 5068 gene locus_tag LOCUS_11010 3398 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 5231 6019 gene locus_tag LOCUS_11020 5231 6019 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937628.1 protein_id gnl|my_center|LOCUS_11020 6064 7365 gene locus_tag LOCUS_11030 gene eno 6064 7365 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937629.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence115 850 227 gene locus_tag LOCUS_11040 850 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1245 2009 gene locus_tag LOCUS_11050 gene rfbF 1245 2009 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937383.1 protein_id gnl|my_center|LOCUS_11050 2119 3225 gene locus_tag LOCUS_11060 gene rfbG 2119 3225 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937384.1 protein_id gnl|my_center|LOCUS_11060 3213 3743 gene locus_tag LOCUS_11070 3213 3743 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937385.1 protein_id gnl|my_center|LOCUS_11070 3946 4773 gene locus_tag LOCUS_11080 3946 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 5255 5911 gene locus_tag LOCUS_11090 5255 5911 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223792.1 protein_id gnl|my_center|LOCUS_11090 7364 6471 gene locus_tag LOCUS_11100 7364 6471 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108744.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence116 1138 4719 gene locus_tag LOCUS_11110 1138 4719 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940330.1 protein_id gnl|my_center|LOCUS_11110 5205 7295 gene locus_tag LOCUS_11120 5205 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence117 920 135 gene locus_tag LOCUS_11130 920 135 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937454.1 protein_id gnl|my_center|LOCUS_11130 1919 1026 gene locus_tag LOCUS_11140 gene hisG 1919 1026 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937425.1 protein_id gnl|my_center|LOCUS_11140 2548 2150 gene locus_tag LOCUS_11150 gene hisI 2548 2150 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937424.1 protein_id gnl|my_center|LOCUS_11150 3670 5334 gene locus_tag LOCUS_11160 3670 5334 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940347.1 protein_id gnl|my_center|LOCUS_11160 5589 6080 gene locus_tag LOCUS_11170 5589 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 6199 7158 gene locus_tag LOCUS_11180 6199 7158 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937757.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence118 323 1321 gene locus_tag LOCUS_11190 323 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 2301 1540 gene locus_tag LOCUS_11200 2301 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 2610 2398 gene locus_tag LOCUS_11210 2610 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 3106 3849 gene locus_tag LOCUS_11220 3106 3849 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_11220 3997 5406 gene locus_tag LOCUS_11230 3997 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 <7313 5910 gene locus_tag LOCUS_11240 <7313 5910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851742.1:aspartate ammonia-lyase >Feature sequence119 <1 1876 gene locus_tag LOCUS_11250 <1 1876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014524181.1:DNA gyrase subunit A 1880 2662 gene locus_tag LOCUS_11260 1880 2662 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937316.1 protein_id gnl|my_center|LOCUS_11260 2997 4403 gene locus_tag LOCUS_11270 gene purF 2997 4403 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937472.1 protein_id gnl|my_center|LOCUS_11270 4442 5701 gene locus_tag LOCUS_11280 gene hisS 4442 5701 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940623.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence120 247 1155 gene locus_tag LOCUS_11290 247 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1146 3383 gene locus_tag LOCUS_11300 1146 3383 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454973.1 protein_id gnl|my_center|LOCUS_11300 3376 4185 gene locus_tag LOCUS_11310 gene cbiR 3376 4185 CDS product cobamide remodeling phosphodiesterase CbiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294611.1 protein_id gnl|my_center|LOCUS_11310 4193 5452 gene locus_tag LOCUS_11320 4193 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 5559 6035 gene locus_tag LOCUS_11330 5559 6035 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_11330 6650 7006 gene locus_tag LOCUS_11340 6650 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence121 1090 62 gene locus_tag LOCUS_11350 1090 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 2853 1087 gene locus_tag LOCUS_11360 2853 1087 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937364.1 protein_id gnl|my_center|LOCUS_11360 4058 2925 gene locus_tag LOCUS_11370 4058 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294655.1 protein_id gnl|my_center|LOCUS_11370 4319 5422 gene locus_tag LOCUS_11380 4319 5422 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524423.1 protein_id gnl|my_center|LOCUS_11380 5748 6383 gene locus_tag LOCUS_11390 5748 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence122 800 177 gene locus_tag LOCUS_11400 800 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11400 1501 851 gene locus_tag LOCUS_11410 gene thiE 1501 851 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939368.1 protein_id gnl|my_center|LOCUS_11410 2578 1655 gene locus_tag LOCUS_11420 2578 1655 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294642.1 protein_id gnl|my_center|LOCUS_11420 2721 5381 gene locus_tag LOCUS_11430 2721 5381 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792363.1 protein_id gnl|my_center|LOCUS_11430 5884 6612 gene locus_tag LOCUS_11440 5884 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence123 2719 179 gene locus_tag LOCUS_11450 2719 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 4170 3247 gene locus_tag LOCUS_11460 4170 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 4329 4907 gene locus_tag LOCUS_11470 4329 4907 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_11470 5242 6996 gene locus_tag LOCUS_11480 5242 6996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence124 928 137 gene locus_tag LOCUS_11490 gene fliR 928 137 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940492.1 protein_id gnl|my_center|LOCUS_11490 1910 942 gene locus_tag LOCUS_11500 1910 942 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938291.1 protein_id gnl|my_center|LOCUS_11500 2703 2014 gene locus_tag LOCUS_11510 2703 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 2875 3258 gene locus_tag LOCUS_11520 2875 3258 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389363.1 protein_id gnl|my_center|LOCUS_11520 3301 4248 gene locus_tag LOCUS_11530 3301 4248 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938287.1 protein_id gnl|my_center|LOCUS_11530 5335 4448 gene locus_tag LOCUS_11540 gene rfbA 5335 4448 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103413.1 protein_id gnl|my_center|LOCUS_11540 6249 5920 gene locus_tag LOCUS_11550 6249 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 6779 6489 gene locus_tag LOCUS_11560 6779 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 >Feature sequence125 199 1080 gene locus_tag LOCUS_11570 gene pdxS 199 1080 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391558.1 protein_id gnl|my_center|LOCUS_11570 1083 1673 gene locus_tag LOCUS_11580 gene pdxT 1083 1673 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728706.1 protein_id gnl|my_center|LOCUS_11580 3409 2045 gene locus_tag LOCUS_11590 gene asnS 3409 2045 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937318.1 protein_id gnl|my_center|LOCUS_11590 3574 4041 gene locus_tag LOCUS_11600 3574 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938042.1 protein_id gnl|my_center|LOCUS_11600 4049 4786 gene locus_tag LOCUS_11610 4049 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 4817 5224 gene locus_tag LOCUS_11620 4817 5224 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939832.1 protein_id gnl|my_center|LOCUS_11620 5206 6486 gene locus_tag LOCUS_11630 5206 6486 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939833.1 protein_id gnl|my_center|LOCUS_11630 6483 6938 gene locus_tag LOCUS_11640 6483 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence126 1820 1041 gene locus_tag LOCUS_11650 gene cobM 1820 1041 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791695.1 protein_id gnl|my_center|LOCUS_11650 2949 2053 gene locus_tag LOCUS_11660 2949 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 5610 2950 gene locus_tag LOCUS_11670 5610 2950 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938033.1 protein_id gnl|my_center|LOCUS_11670 5650 6987 gene locus_tag LOCUS_11680 5650 6987 CDS product BPL-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294597.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence127 516 1664 gene locus_tag LOCUS_11690 516 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1664 2002 gene locus_tag LOCUS_11700 1664 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792721.1 protein_id gnl|my_center|LOCUS_11700 2228 3010 gene locus_tag LOCUS_11710 gene argB 2228 3010 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938759.1 protein_id gnl|my_center|LOCUS_11710 4081 3266 gene locus_tag LOCUS_11720 4081 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 4559 5953 gene locus_tag LOCUS_11730 4559 5953 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787452.1 protein_id gnl|my_center|LOCUS_11730 6010 6906 gene locus_tag LOCUS_11740 6010 6906 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791421.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence128 1166 708 gene locus_tag LOCUS_11750 gene tnpA 1166 708 CDS product IS200/IS605-like element IS200C family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526135.1 protein_id gnl|my_center|LOCUS_11750 3024 1381 gene locus_tag LOCUS_11760 3024 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 3536 6457 gene locus_tag LOCUS_11770 3536 6457 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938240.1 protein_id gnl|my_center|LOCUS_11770 6625 6927 gene locus_tag LOCUS_11780 6625 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence129 2430 151 gene locus_tag LOCUS_11790 2430 151 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_11790 3530 2430 gene locus_tag LOCUS_11800 gene aroC 3530 2430 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938193.1 protein_id gnl|my_center|LOCUS_11800 4671 3697 gene locus_tag LOCUS_11810 gene sppA 4671 3697 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940407.1 protein_id gnl|my_center|LOCUS_11810 4570 4794 gene locus_tag LOCUS_11820 4570 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 4796 5650 gene locus_tag LOCUS_11830 gene panC 4796 5650 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939719.1 protein_id gnl|my_center|LOCUS_11830 5707 6879 gene locus_tag LOCUS_11840 gene metK 5707 6879 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939720.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence130 179 853 gene locus_tag LOCUS_11850 179 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1011 1382 gene locus_tag LOCUS_11860 1011 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1692 2603 gene locus_tag LOCUS_11870 1692 2603 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940332.1 protein_id gnl|my_center|LOCUS_11870 4601 2883 gene locus_tag LOCUS_11880 4601 2883 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966061.1 protein_id gnl|my_center|LOCUS_11880 6351 4693 gene locus_tag LOCUS_11890 6351 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence131 811 329 gene locus_tag LOCUS_11900 811 329 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379185.1 protein_id gnl|my_center|LOCUS_11900 4715 990 gene locus_tag LOCUS_11910 4715 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 6658 4715 gene locus_tag LOCUS_11920 6658 4715 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294667.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence132 69 956 gene locus_tag LOCUS_11930 69 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1049 1558 gene locus_tag LOCUS_11940 1049 1558 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937552.1 protein_id gnl|my_center|LOCUS_11940 1577 1945 gene locus_tag LOCUS_11950 1577 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 2347 3687 gene locus_tag LOCUS_11960 2347 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940480.1 protein_id gnl|my_center|LOCUS_11960 3691 5223 gene locus_tag LOCUS_11970 3691 5223 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791433.1 protein_id gnl|my_center|LOCUS_11970 5404 6783 gene locus_tag LOCUS_11980 5404 6783 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence133 2365 1745 gene locus_tag LOCUS_11990 2365 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 3348 2677 gene locus_tag LOCUS_12000 3348 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 5071 3644 gene locus_tag LOCUS_12010 5071 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 5595 5098 gene locus_tag LOCUS_12020 5595 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 6522 5596 gene locus_tag LOCUS_12030 6522 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940670.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence134 4893 3316 gene locus_tag LOCUS_12040 4893 3316 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937928.1 protein_id gnl|my_center|LOCUS_12040 5353 4886 gene locus_tag LOCUS_12050 5353 4886 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937927.1 protein_id gnl|my_center|LOCUS_12050 5678 6253 gene locus_tag LOCUS_12060 5678 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 6240 6713 gene locus_tag LOCUS_12070 6240 6713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence135 <1 1195 gene locus_tag LOCUS_12080 <1 1195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860848.1:bifunctional diguanylate cyclase/phosphodiesterase 2294 1323 gene locus_tag LOCUS_12090 2294 1323 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939846.1 protein_id gnl|my_center|LOCUS_12090 2306 2497 gene locus_tag LOCUS_12100 2306 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 3395 2559 gene locus_tag LOCUS_12110 3395 2559 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938538.1 protein_id gnl|my_center|LOCUS_12110 4022 3399 gene locus_tag LOCUS_12120 4022 3399 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938539.1 protein_id gnl|my_center|LOCUS_12120 4509 4069 gene locus_tag LOCUS_12130 gene mlaD 4509 4069 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938540.1 protein_id gnl|my_center|LOCUS_12130 5510 4683 gene locus_tag LOCUS_12140 5510 4683 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938541.1 protein_id gnl|my_center|LOCUS_12140 6700 5909 gene locus_tag LOCUS_12150 6700 5909 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938542.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence136 1182 64 gene locus_tag LOCUS_12160 1182 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1967 1194 gene locus_tag LOCUS_12170 1967 1194 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939371.1 protein_id gnl|my_center|LOCUS_12170 2373 2173 gene locus_tag LOCUS_12180 gene thiS 2373 2173 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939372.1 protein_id gnl|my_center|LOCUS_12180 2913 4043 gene locus_tag LOCUS_12190 2913 4043 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937822.1 protein_id gnl|my_center|LOCUS_12190 4044 5417 gene locus_tag LOCUS_12200 4044 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 5506 5976 gene locus_tag LOCUS_12210 5506 5976 CDS product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937824.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence137 28 798 gene locus_tag LOCUS_12220 28 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 939 1235 gene locus_tag LOCUS_12230 939 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1280 2377 gene locus_tag LOCUS_12240 1280 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2468 2392 gene locus_tag LOCUS_t00210 2468 2392 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2953 2591 gene locus_tag LOCUS_12250 2953 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 3481 3059 gene locus_tag LOCUS_12260 3481 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939597.1 protein_id gnl|my_center|LOCUS_12260 4361 3585 gene locus_tag LOCUS_12270 gene dapB 4361 3585 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938900.1 protein_id gnl|my_center|LOCUS_12270 6653 4416 gene locus_tag LOCUS_12280 gene ligA 6653 4416 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938899.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence138 675 52 gene locus_tag LOCUS_12290 675 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1414 758 gene locus_tag LOCUS_12300 1414 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1704 3944 gene locus_tag LOCUS_12310 gene topA 1704 3944 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940644.1 protein_id gnl|my_center|LOCUS_12310 3937 5085 gene locus_tag LOCUS_12320 3937 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 5507 6133 gene locus_tag LOCUS_12330 5507 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence139 2718 976 gene locus_tag LOCUS_12340 gene dnaG 2718 976 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939077.1 protein_id gnl|my_center|LOCUS_12340 5427 3001 gene locus_tag LOCUS_12350 5427 3001 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939078.1 protein_id gnl|my_center|LOCUS_12350 5896 5441 gene locus_tag LOCUS_12360 5896 5441 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939079.1 protein_id gnl|my_center|LOCUS_12360 6321 6118 gene locus_tag LOCUS_12370 gene rpsU 6321 6118 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939080.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence140 369 602 gene locus_tag LOCUS_12380 gene csrA 369 602 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937827.1 protein_id gnl|my_center|LOCUS_12380 1529 2572 gene locus_tag LOCUS_12390 1529 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 4235 2673 gene locus_tag LOCUS_12400 gene murJ 4235 2673 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792519.1 protein_id gnl|my_center|LOCUS_12400 6409 4235 gene locus_tag LOCUS_12410 6409 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 >Feature sequence141 728 1033 gene locus_tag LOCUS_12420 gene rpsF 728 1033 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938255.1 protein_id gnl|my_center|LOCUS_12420 1034 1297 gene locus_tag LOCUS_12430 gene rpsR 1034 1297 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938256.1 protein_id gnl|my_center|LOCUS_12430 1308 1817 gene locus_tag LOCUS_12440 gene rplI 1308 1817 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938257.1 protein_id gnl|my_center|LOCUS_12440 1829 3292 gene locus_tag LOCUS_12450 gene dnaB 1829 3292 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938258.1 protein_id gnl|my_center|LOCUS_12450 3476 3742 gene locus_tag LOCUS_12460 3476 3742 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939702.1 protein_id gnl|my_center|LOCUS_12460 4112 5110 gene locus_tag LOCUS_12470 gene era 4112 5110 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937363.1 protein_id gnl|my_center|LOCUS_12470 5107 5820 gene locus_tag LOCUS_12480 5107 5820 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937362.1 protein_id gnl|my_center|LOCUS_12480 5918 6529 gene locus_tag LOCUS_12490 5918 6529 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793169.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence142 2137 3228 gene locus_tag LOCUS_12500 2137 3228 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965647.1 protein_id gnl|my_center|LOCUS_12500 3917 3396 gene locus_tag LOCUS_12510 gene tsaA 3917 3396 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868101.1 protein_id gnl|my_center|LOCUS_12510 4056 4613 gene locus_tag LOCUS_12520 4056 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 4625 6328 gene locus_tag LOCUS_12530 4625 6328 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence143 2505 1123 gene locus_tag LOCUS_12540 2505 1123 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938700.1 protein_id gnl|my_center|LOCUS_12540 2602 2946 gene locus_tag LOCUS_12550 2602 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 2953 3038 gene locus_tag LOCUS_t00220 2953 3038 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3298 6450 gene locus_tag LOCUS_12560 3298 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence144 890 417 gene locus_tag LOCUS_12570 890 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 3777 1150 gene locus_tag LOCUS_12580 3777 1150 CDS product DUF927 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536119.1 protein_id gnl|my_center|LOCUS_12580 4193 3789 gene locus_tag LOCUS_12590 4193 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 4321 4851 gene locus_tag LOCUS_12600 4321 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 5146 4919 gene locus_tag LOCUS_12610 5146 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 6276 5338 gene locus_tag LOCUS_12620 6276 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence145 1550 102 gene locus_tag LOCUS_12630 1550 102 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294624.1 protein_id gnl|my_center|LOCUS_12630 2690 1722 gene locus_tag LOCUS_12640 2690 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 3030 4232 gene locus_tag LOCUS_12650 3030 4232 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938527.1 protein_id gnl|my_center|LOCUS_12650 4254 4592 gene locus_tag LOCUS_12660 4254 4592 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938528.1 protein_id gnl|my_center|LOCUS_12660 5004 6197 gene locus_tag LOCUS_12670 5004 6197 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104266.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence146 1653 2180 gene locus_tag LOCUS_12680 1653 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 2856 2422 gene locus_tag LOCUS_12690 gene fliE 2856 2422 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937621.1 protein_id gnl|my_center|LOCUS_12690 3400 2963 gene locus_tag LOCUS_12700 gene flgC 3400 2963 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937622.1 protein_id gnl|my_center|LOCUS_12700 3985 3572 gene locus_tag LOCUS_12710 gene flgB 3985 3572 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937623.1 protein_id gnl|my_center|LOCUS_12710 4697 4146 gene locus_tag LOCUS_12720 4697 4146 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788385.1 protein_id gnl|my_center|LOCUS_12720 5227 4694 gene locus_tag LOCUS_12730 5227 4694 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291442.1 protein_id gnl|my_center|LOCUS_12730 5898 5482 gene locus_tag LOCUS_12740 5898 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938912.1 protein_id gnl|my_center|LOCUS_12740 6378 6103 gene locus_tag LOCUS_12750 6378 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence147 1778 1143 gene locus_tag LOCUS_12760 1778 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3941 2415 gene locus_tag LOCUS_12770 3941 2415 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_12770 6328 3938 gene locus_tag LOCUS_12780 6328 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence148 2177 150 gene locus_tag LOCUS_12790 gene uvrB 2177 150 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938896.1 protein_id gnl|my_center|LOCUS_12790 2937 2146 gene locus_tag LOCUS_12800 gene aat 2937 2146 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_12800 5267 2934 gene locus_tag LOCUS_12810 5267 2934 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109716.1 protein_id gnl|my_center|LOCUS_12810 5655 5344 gene locus_tag LOCUS_12820 5655 5344 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938892.1 protein_id gnl|my_center|LOCUS_12820 6281 5652 gene locus_tag LOCUS_12830 6281 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence149 206 131 gene locus_tag LOCUS_t00230 206 131 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1005 352 gene locus_tag LOCUS_12840 1005 352 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940315.1 protein_id gnl|my_center|LOCUS_12840 1496 1005 gene locus_tag LOCUS_12850 gene ahbA 1496 1005 CDS product siroheme decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938154.1 protein_id gnl|my_center|LOCUS_12850 2833 1523 gene locus_tag LOCUS_12860 2833 1523 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792073.1 protein_id gnl|my_center|LOCUS_12860 3171 3049 gene locus_tag LOCUS_12870 3171 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 4097 3171 gene locus_tag LOCUS_12880 4097 3171 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937965.1 protein_id gnl|my_center|LOCUS_12880 4330 4512 gene locus_tag LOCUS_12890 4330 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 4890 6101 gene locus_tag LOCUS_12900 4890 6101 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815802.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence150 399 1406 gene locus_tag LOCUS_12910 gene fbp 399 1406 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939127.1 protein_id gnl|my_center|LOCUS_12910 1410 2474 gene locus_tag LOCUS_12920 gene tsaD 1410 2474 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939126.1 protein_id gnl|my_center|LOCUS_12920 2568 2891 gene locus_tag LOCUS_12930 gene trxA 2568 2891 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939125.1 protein_id gnl|my_center|LOCUS_12930 2888 3817 gene locus_tag LOCUS_12940 2888 3817 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939124.1 protein_id gnl|my_center|LOCUS_12940 3834 4541 gene locus_tag LOCUS_12950 3834 4541 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792195.1 protein_id gnl|my_center|LOCUS_12950 4738 6183 gene locus_tag LOCUS_12960 4738 6183 CDS product cation-efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939066.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence151 308 793 gene locus_tag LOCUS_12970 308 793 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939520.1 protein_id gnl|my_center|LOCUS_12970 966 2789 gene locus_tag LOCUS_12980 966 2789 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791940.1 protein_id gnl|my_center|LOCUS_12980 3467 5110 gene locus_tag LOCUS_12990 3467 5110 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_12990 5360 5866 gene locus_tag LOCUS_13000 5360 5866 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065697.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence152 2287 1247 gene locus_tag LOCUS_13010 2287 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 3913 2414 gene locus_tag LOCUS_13020 3913 2414 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387751.1 protein_id gnl|my_center|LOCUS_13020 5653 3914 gene locus_tag LOCUS_13030 5653 3914 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387750.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence153 659 474 gene locus_tag LOCUS_13040 659 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 760 1227 gene locus_tag LOCUS_13050 760 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1244 1711 gene locus_tag LOCUS_13060 1244 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1713 3221 gene locus_tag LOCUS_13070 1713 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 3221 4384 gene locus_tag LOCUS_13080 gene dotB 3221 4384 CDS product Dot/Icm type IV secretion system ATPase DotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769572.1 protein_id gnl|my_center|LOCUS_13080 4359 4631 gene locus_tag LOCUS_13090 4359 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 4645 4818 gene locus_tag LOCUS_13100 4645 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 4815 5798 gene locus_tag LOCUS_13110 4815 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 5756 6082 gene locus_tag LOCUS_13120 5756 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence154 946 1311 gene locus_tag LOCUS_13130 946 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 2092 1676 gene locus_tag LOCUS_13140 2092 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940279.1 protein_id gnl|my_center|LOCUS_13140 2864 2394 gene locus_tag LOCUS_13150 2864 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 3058 4248 gene locus_tag LOCUS_13160 3058 4248 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938142.1 protein_id gnl|my_center|LOCUS_13160 5400 4393 gene locus_tag LOCUS_13170 gene ruvB 5400 4393 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939530.1 protein_id gnl|my_center|LOCUS_13170 6002 5400 gene locus_tag LOCUS_13180 6002 5400 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939531.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence155 46 603 gene locus_tag LOCUS_13190 46 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1184 681 gene locus_tag LOCUS_13200 1184 681 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938696.1 protein_id gnl|my_center|LOCUS_13200 2191 1181 gene locus_tag LOCUS_13210 gene amrS 2191 1181 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409338.1 protein_id gnl|my_center|LOCUS_13210 3133 2306 gene locus_tag LOCUS_13220 3133 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 3473 3228 gene locus_tag LOCUS_13230 3473 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 3390 4442 gene locus_tag LOCUS_13240 gene purM 3390 4442 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938699.1 protein_id gnl|my_center|LOCUS_13240 4638 5093 gene locus_tag LOCUS_13250 4638 5093 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939050.1 protein_id gnl|my_center|LOCUS_13250 5145 5969 gene locus_tag LOCUS_13260 5145 5969 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932822.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence156 959 111 gene locus_tag LOCUS_13270 959 111 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940024.1 protein_id gnl|my_center|LOCUS_13270 2120 999 gene locus_tag LOCUS_13280 gene mqnC 2120 999 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940023.1 protein_id gnl|my_center|LOCUS_13280 3241 2117 gene locus_tag LOCUS_13290 gene mqnE 3241 2117 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940022.1 protein_id gnl|my_center|LOCUS_13290 3443 4285 gene locus_tag LOCUS_13300 3443 4285 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940021.1 protein_id gnl|my_center|LOCUS_13300 4507 5928 gene locus_tag LOCUS_13310 gene mdtK 4507 5928 CDS product multidrug efflux MATE transporter MdtK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174945.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence157 2618 1374 gene locus_tag LOCUS_13320 2618 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 3796 2615 gene locus_tag LOCUS_13330 gene cbiD 3796 2615 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940016.1 protein_id gnl|my_center|LOCUS_13330 4668 3793 gene locus_tag LOCUS_13340 4668 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940012.1 protein_id gnl|my_center|LOCUS_13340 4872 5870 gene locus_tag LOCUS_13350 4872 5870 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792396.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence158 1044 16 gene locus_tag LOCUS_13360 1044 16 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937955.1 protein_id gnl|my_center|LOCUS_13360 2510 1590 gene locus_tag LOCUS_13370 gene cysK 2510 1590 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937966.1 protein_id gnl|my_center|LOCUS_13370 2724 3179 gene locus_tag LOCUS_13380 2724 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 4250 3366 gene locus_tag LOCUS_13390 4250 3366 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932386.1 protein_id gnl|my_center|LOCUS_13390 4391 4774 gene locus_tag LOCUS_13400 4391 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence159 351 2264 gene locus_tag LOCUS_13410 351 2264 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294591.1 protein_id gnl|my_center|LOCUS_13410 2453 2695 gene locus_tag LOCUS_13420 2453 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792157.1 protein_id gnl|my_center|LOCUS_13420 5752 3119 gene locus_tag LOCUS_13430 5752 3119 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938725.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence160 173 418 gene locus_tag LOCUS_13440 173 418 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943075.1 protein_id gnl|my_center|LOCUS_13440 405 692 gene locus_tag LOCUS_13450 405 692 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221352.1 protein_id gnl|my_center|LOCUS_13450 2882 1353 gene locus_tag LOCUS_13460 2882 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 3306 4910 gene locus_tag LOCUS_13470 3306 4910 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435782.1 protein_id gnl|my_center|LOCUS_13470 5243 5677 gene locus_tag LOCUS_13480 5243 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence161 <1 867 gene locus_tag LOCUS_13490 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939355.1:HEAT repeat domain-containing protein 1591 773 gene locus_tag LOCUS_13500 1591 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1740 2576 gene locus_tag LOCUS_13510 1740 2576 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939354.1 protein_id gnl|my_center|LOCUS_13510 2660 3028 gene locus_tag LOCUS_13520 2660 3028 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939351.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence162 928 53 gene locus_tag LOCUS_13530 928 53 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097200.1 protein_id gnl|my_center|LOCUS_13530 1053 2360 gene locus_tag LOCUS_13540 1053 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 2412 3833 gene locus_tag LOCUS_13550 gene selA 2412 3833 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940143.1 protein_id gnl|my_center|LOCUS_13550 4282 5685 gene locus_tag LOCUS_13560 4282 5685 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940144.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence163 397 714 gene locus_tag LOCUS_13570 gene rpsJ 397 714 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938597.1 protein_id gnl|my_center|LOCUS_13570 727 1356 gene locus_tag LOCUS_13580 gene rplC 727 1356 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938598.1 protein_id gnl|my_center|LOCUS_13580 1366 1998 gene locus_tag LOCUS_13590 gene rplD 1366 1998 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938599.1 protein_id gnl|my_center|LOCUS_13590 2000 2290 gene locus_tag LOCUS_13600 gene rplW 2000 2290 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792455.1 protein_id gnl|my_center|LOCUS_13600 2294 3142 gene locus_tag LOCUS_13610 gene rplB 2294 3142 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938601.1 protein_id gnl|my_center|LOCUS_13610 3152 3436 gene locus_tag LOCUS_13620 gene rpsS 3152 3436 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_13620 3446 3784 gene locus_tag LOCUS_13630 gene rplV 3446 3784 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938603.1 protein_id gnl|my_center|LOCUS_13630 3788 4429 gene locus_tag LOCUS_13640 gene rpsC 3788 4429 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938604.1 protein_id gnl|my_center|LOCUS_13640 4429 4842 gene locus_tag LOCUS_13650 gene rplP 4429 4842 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938605.1 protein_id gnl|my_center|LOCUS_13650 4844 5053 gene locus_tag LOCUS_13660 gene rpmC 4844 5053 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938606.1 protein_id gnl|my_center|LOCUS_13660 5066 5329 gene locus_tag LOCUS_13670 gene rpsQ 5066 5329 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938607.1 protein_id gnl|my_center|LOCUS_13670 5339 5539 gene locus_tag LOCUS_13680 5339 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13680 5552 5707 gene locus_tag LOCUS_13690 5552 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13690 >Feature sequence164 866 27 gene locus_tag LOCUS_13700 866 27 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938210.1 protein_id gnl|my_center|LOCUS_13700 1999 866 gene locus_tag LOCUS_13710 1999 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 2393 1956 gene locus_tag LOCUS_13720 gene fliJ 2393 1956 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865139.1 protein_id gnl|my_center|LOCUS_13720 3413 2610 gene locus_tag LOCUS_13730 gene thiD 3413 2610 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938230.1 protein_id gnl|my_center|LOCUS_13730 4474 3485 gene locus_tag LOCUS_13740 4474 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 4766 5434 gene locus_tag LOCUS_13750 4766 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 >Feature sequence165 946 113 gene locus_tag LOCUS_13760 946 113 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939760.1 protein_id gnl|my_center|LOCUS_13760 1532 1254 gene locus_tag LOCUS_13770 1532 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 2070 2909 gene locus_tag LOCUS_13780 2070 2909 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939745.1 protein_id gnl|my_center|LOCUS_13780 2899 4323 gene locus_tag LOCUS_13790 gene gltA 2899 4323 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939746.1 protein_id gnl|my_center|LOCUS_13790 5437 4727 gene locus_tag LOCUS_13800 5437 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence166 538 894 gene locus_tag LOCUS_13810 538 894 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939487.1 protein_id gnl|my_center|LOCUS_13810 1202 3823 gene locus_tag LOCUS_13820 gene secA 1202 3823 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938126.1 protein_id gnl|my_center|LOCUS_13820 3975 5018 gene locus_tag LOCUS_13830 3975 5018 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388546.1 protein_id gnl|my_center|LOCUS_13830 5011 5673 gene locus_tag LOCUS_13840 5011 5673 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112597.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence167 130 1668 gene locus_tag LOCUS_13850 gene ilvA 130 1668 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225371.1 protein_id gnl|my_center|LOCUS_13850 2105 3304 gene locus_tag LOCUS_13860 gene tyrS 2105 3304 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938252.1 protein_id gnl|my_center|LOCUS_13860 3536 4744 gene locus_tag LOCUS_13870 3536 4744 CDS product 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791484.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence168 536 51 gene locus_tag LOCUS_13880 536 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1533 550 gene locus_tag LOCUS_13890 gene glpX 1533 550 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938831.1 protein_id gnl|my_center|LOCUS_13890 2404 1664 gene locus_tag LOCUS_13900 2404 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 5496 2401 gene locus_tag LOCUS_13910 5496 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence169 80 880 gene locus_tag LOCUS_13920 80 880 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234254.1 protein_id gnl|my_center|LOCUS_13920 1330 893 gene locus_tag LOCUS_13930 gene lrpA 1330 893 CDS product transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246601.1 protein_id gnl|my_center|LOCUS_13930 2347 1613 gene locus_tag LOCUS_13940 gene hisA 2347 1613 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938337.1 protein_id gnl|my_center|LOCUS_13940 3003 2344 gene locus_tag LOCUS_13950 3003 2344 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938338.1 protein_id gnl|my_center|LOCUS_13950 3605 3003 gene locus_tag LOCUS_13960 gene hisB 3605 3003 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938339.1 protein_id gnl|my_center|LOCUS_13960 4787 3612 gene locus_tag LOCUS_13970 gene tatC 4787 3612 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294586.1 protein_id gnl|my_center|LOCUS_13970 5299 4784 gene locus_tag LOCUS_13980 5299 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence170 664 2061 gene locus_tag LOCUS_13990 664 2061 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940093.1 protein_id gnl|my_center|LOCUS_13990 2196 3584 gene locus_tag LOCUS_14000 2196 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14000 3581 4468 gene locus_tag LOCUS_14010 3581 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14010 >Feature sequence171 2004 1378 gene locus_tag LOCUS_14020 2004 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14020 2646 2245 gene locus_tag LOCUS_14030 2646 2245 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436216.1 protein_id gnl|my_center|LOCUS_14030 2780 5335 gene locus_tag LOCUS_14040 2780 5335 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence172 3 2846 gene locus_tag LOCUS_14050 3 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence173 1290 67 gene locus_tag LOCUS_14060 1290 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1689 1315 gene locus_tag LOCUS_14070 1689 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 2167 2817 gene locus_tag LOCUS_14080 2167 2817 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940238.1 protein_id gnl|my_center|LOCUS_14080 2851 3642 gene locus_tag LOCUS_14090 gene pssA 2851 3642 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940239.1 protein_id gnl|my_center|LOCUS_14090 3861 5414 gene locus_tag LOCUS_14100 3861 5414 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940240.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence174 65 1060 gene locus_tag LOCUS_14110 65 1060 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933236.1 protein_id gnl|my_center|LOCUS_14110 1475 1113 gene locus_tag LOCUS_14120 1475 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1868 1488 gene locus_tag LOCUS_14130 1868 1488 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388948.1 protein_id gnl|my_center|LOCUS_14130 2794 1904 gene locus_tag LOCUS_14140 2794 1904 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_14140 3674 2787 gene locus_tag LOCUS_14150 3674 2787 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_14150 4367 3684 gene locus_tag LOCUS_14160 4367 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 4571 5317 gene locus_tag LOCUS_14170 4571 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence175 1194 496 gene locus_tag LOCUS_14180 1194 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1594 4545 gene locus_tag LOCUS_14190 gene uvrA 1594 4545 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939273.1 protein_id gnl|my_center|LOCUS_14190 4801 4877 gene locus_tag LOCUS_t00240 4801 4877 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence176 241 2511 gene locus_tag LOCUS_14200 241 2511 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461557.1 protein_id gnl|my_center|LOCUS_14200 2752 3039 gene locus_tag LOCUS_14210 2752 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 3036 3596 gene locus_tag LOCUS_14220 3036 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 3596 4435 gene locus_tag LOCUS_14230 3596 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 4770 5024 gene locus_tag LOCUS_14240 4770 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937917.1 protein_id gnl|my_center|LOCUS_14240 >Feature sequence177 1073 87 gene locus_tag LOCUS_14250 gene tssG 1073 87 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200970.1 protein_id gnl|my_center|LOCUS_14250 2749 1037 gene locus_tag LOCUS_14260 gene tssF 2749 1037 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941100.1 protein_id gnl|my_center|LOCUS_14260 3378 2758 gene locus_tag LOCUS_14270 3378 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 4687 3392 gene locus_tag LOCUS_14280 4687 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 >Feature sequence178 1105 161 gene locus_tag LOCUS_14290 gene fabD 1105 161 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938545.1 protein_id gnl|my_center|LOCUS_14290 1837 2589 gene locus_tag LOCUS_14300 1837 2589 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938546.1 protein_id gnl|my_center|LOCUS_14300 2586 4838 gene locus_tag LOCUS_14310 2586 4838 CDS product STT3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938548.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence179 1187 51 gene locus_tag LOCUS_14320 1187 51 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529052.1 protein_id gnl|my_center|LOCUS_14320 2311 1184 gene locus_tag LOCUS_14330 2311 1184 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529050.1 protein_id gnl|my_center|LOCUS_14330 4059 2308 gene locus_tag LOCUS_14340 4059 2308 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704811.1 protein_id gnl|my_center|LOCUS_14340 5063 4056 gene locus_tag LOCUS_14350 gene hlyD 5063 4056 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061628.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence180 867 229 gene locus_tag LOCUS_14360 867 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1894 860 gene locus_tag LOCUS_14370 gene thiL 1894 860 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937468.1 protein_id gnl|my_center|LOCUS_14370 4086 1897 gene locus_tag LOCUS_14380 4086 1897 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937467.1 protein_id gnl|my_center|LOCUS_14380 4434 4964 gene locus_tag LOCUS_14390 4434 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940538.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence181 935 1156 gene locus_tag LOCUS_14400 935 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 2315 1554 gene locus_tag LOCUS_14410 2315 1554 CDS product polyphenol oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937672.1 protein_id gnl|my_center|LOCUS_14410 3391 2306 gene locus_tag LOCUS_14420 3391 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 4173 3385 gene locus_tag LOCUS_14430 4173 3385 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938651.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence182 1374 79 gene locus_tag LOCUS_14440 gene purD 1374 79 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937795.1 protein_id gnl|my_center|LOCUS_14440 3543 1897 gene locus_tag LOCUS_14450 3543 1897 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940448.1 protein_id gnl|my_center|LOCUS_14450 3675 4985 gene locus_tag LOCUS_14460 3675 4985 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940447.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence183 420 695 gene locus_tag LOCUS_14470 420 695 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939150.1 protein_id gnl|my_center|LOCUS_14470 730 1608 gene locus_tag LOCUS_14480 gene dapA 730 1608 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939154.1 protein_id gnl|my_center|LOCUS_14480 3456 1969 gene locus_tag LOCUS_14490 3456 1969 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939527.1 protein_id gnl|my_center|LOCUS_14490 3528 3701 gene locus_tag LOCUS_14500 3528 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 4546 3881 gene locus_tag LOCUS_14510 gene pagN 4546 3881 CDS product adhesin/invasin protein PagN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787614.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence184 810 91 gene locus_tag LOCUS_14520 gene lolA 810 91 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938957.1 protein_id gnl|my_center|LOCUS_14520 3301 974 gene locus_tag LOCUS_14530 3301 974 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938956.1 protein_id gnl|my_center|LOCUS_14530 4171 3614 gene locus_tag LOCUS_14540 gene efp 4171 3614 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938955.1 protein_id gnl|my_center|LOCUS_14540 4311 4904 gene locus_tag LOCUS_14550 gene yihA 4311 4904 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938953.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence185 272 1153 gene locus_tag LOCUS_14560 272 1153 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937446.1 protein_id gnl|my_center|LOCUS_14560 1150 1836 gene locus_tag LOCUS_14570 1150 1836 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937654.1 protein_id gnl|my_center|LOCUS_14570 2027 5086 gene locus_tag LOCUS_14580 2027 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence186 702 983 gene locus_tag LOCUS_14590 702 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 973 1251 gene locus_tag LOCUS_14600 973 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 1794 2111 gene locus_tag LOCUS_14610 1794 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 2238 3050 gene locus_tag LOCUS_14620 2238 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 3055 4197 gene locus_tag LOCUS_14630 3055 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 4268 4654 gene locus_tag LOCUS_14640 4268 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 4675 5028 gene locus_tag LOCUS_14650 4675 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence187 4592 4311 gene locus_tag LOCUS_14660 4592 4311 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389060.1 protein_id gnl|my_center|LOCUS_14660 4891 4589 gene locus_tag LOCUS_14670 4891 4589 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence188 <1 889 gene locus_tag LOCUS_14680 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938734.1:flagellin 3875 924 gene locus_tag LOCUS_14690 gene uvrA 3875 924 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939273.1 protein_id gnl|my_center|LOCUS_14690 4490 4206 gene locus_tag LOCUS_14700 4490 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 4645 4397 gene locus_tag LOCUS_14710 4645 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence189 427 1344 gene locus_tag LOCUS_14720 427 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1577 2248 gene locus_tag LOCUS_14730 1577 2248 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938666.1 protein_id gnl|my_center|LOCUS_14730 2245 2559 gene locus_tag LOCUS_14740 2245 2559 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938667.1 protein_id gnl|my_center|LOCUS_14740 2843 3070 gene locus_tag LOCUS_14750 2843 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938670.1 protein_id gnl|my_center|LOCUS_14750 3094 4788 gene locus_tag LOCUS_14760 gene ilvB 3094 4788 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938671.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence190 956 195 gene locus_tag LOCUS_14770 956 195 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_14770 2575 1067 gene locus_tag LOCUS_14780 2575 1067 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_14780 4087 2579 gene locus_tag LOCUS_14790 4087 2579 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941402.1 protein_id gnl|my_center|LOCUS_14790 4713 4093 gene locus_tag LOCUS_14800 4713 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 >Feature sequence191 237 2909 gene locus_tag LOCUS_14810 237 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2909 4840 gene locus_tag LOCUS_14820 2909 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence192 4037 1956 gene locus_tag LOCUS_14830 4037 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938515.1 protein_id gnl|my_center|LOCUS_14830 4867 4040 gene locus_tag LOCUS_14840 gene mazG 4867 4040 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938482.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence193 969 1898 gene locus_tag LOCUS_14850 969 1898 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113465.1 protein_id gnl|my_center|LOCUS_14850 2007 4886 gene locus_tag LOCUS_14860 2007 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence194 1012 50 gene locus_tag LOCUS_14870 1012 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1183 2853 gene locus_tag LOCUS_14880 1183 2853 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814052.1 protein_id gnl|my_center|LOCUS_14880 2892 4589 gene locus_tag LOCUS_14890 2892 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence195 45 2288 gene locus_tag LOCUS_14900 45 2288 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939500.1 protein_id gnl|my_center|LOCUS_14900 2301 2951 gene locus_tag LOCUS_14910 2301 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939499.1 protein_id gnl|my_center|LOCUS_14910 3134 3925 gene locus_tag LOCUS_14920 3134 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 4035 4577 gene locus_tag LOCUS_14930 4035 4577 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939497.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence196 1241 138 gene locus_tag LOCUS_14940 1241 138 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937367.1 protein_id gnl|my_center|LOCUS_14940 2140 1295 gene locus_tag LOCUS_14950 gene ispH 2140 1295 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937366.1 protein_id gnl|my_center|LOCUS_14950 2407 2919 gene locus_tag LOCUS_14960 2407 2919 CDS product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941405.1 protein_id gnl|my_center|LOCUS_14960 3436 3008 gene locus_tag LOCUS_14970 3436 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 3889 4662 gene locus_tag LOCUS_14980 gene modA 3889 4662 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937488.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence197 1099 1473 gene locus_tag LOCUS_14990 1099 1473 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939195.1 protein_id gnl|my_center|LOCUS_14990 1470 3152 gene locus_tag LOCUS_15000 1470 3152 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939196.1 protein_id gnl|my_center|LOCUS_15000 3140 3616 gene locus_tag LOCUS_15010 gene tsaE 3140 3616 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939198.1 protein_id gnl|my_center|LOCUS_15010 3641 4867 gene locus_tag LOCUS_15020 3641 4867 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939199.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence198 1823 15 gene locus_tag LOCUS_15030 1823 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 2221 1910 gene locus_tag LOCUS_15040 2221 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 2557 3561 gene locus_tag LOCUS_15050 2557 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 3554 4048 gene locus_tag LOCUS_15060 3554 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 4415 4636 gene locus_tag LOCUS_15070 4415 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence199 577 353 gene locus_tag LOCUS_15080 577 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1806 634 gene locus_tag LOCUS_15090 1806 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 2680 1799 gene locus_tag LOCUS_15100 gene trbG 2680 1799 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974834.1 protein_id gnl|my_center|LOCUS_15100 3392 2682 gene locus_tag LOCUS_15110 gene trbF 3392 2682 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891631.1 protein_id gnl|my_center|LOCUS_15110 4427 3402 gene locus_tag LOCUS_15120 4427 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence200 852 274 gene locus_tag LOCUS_15130 852 274 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937691.1 protein_id gnl|my_center|LOCUS_15130 1726 1184 gene locus_tag LOCUS_15140 1726 1184 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020471.1 protein_id gnl|my_center|LOCUS_15140 2615 1872 gene locus_tag LOCUS_15150 2615 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 2725 3687 gene locus_tag LOCUS_15160 2725 3687 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence201 999 148 gene locus_tag LOCUS_15170 999 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1815 1081 gene locus_tag LOCUS_15180 1815 1081 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938660.1 protein_id gnl|my_center|LOCUS_15180 1961 2860 gene locus_tag LOCUS_15190 gene rfbD 1961 2860 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938658.1 protein_id gnl|my_center|LOCUS_15190 2963 4507 gene locus_tag LOCUS_15200 2963 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence202 1630 98 gene locus_tag LOCUS_15210 1630 98 CDS product DUF3880 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939536.1 protein_id gnl|my_center|LOCUS_15210 1708 2352 gene locus_tag LOCUS_15220 1708 2352 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939535.1 protein_id gnl|my_center|LOCUS_15220 2503 3240 gene locus_tag LOCUS_15230 2503 3240 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939534.1 protein_id gnl|my_center|LOCUS_15230 3441 3956 gene locus_tag LOCUS_15240 gene ruvC 3441 3956 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939533.1 protein_id gnl|my_center|LOCUS_15240 4622 4077 gene locus_tag LOCUS_15250 4622 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence203 2229 142 gene locus_tag LOCUS_15260 gene glyS 2229 142 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939183.1 protein_id gnl|my_center|LOCUS_15260 3111 2233 gene locus_tag LOCUS_15270 gene glyQ 3111 2233 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939184.1 protein_id gnl|my_center|LOCUS_15270 3921 3151 gene locus_tag LOCUS_15280 gene recO 3921 3151 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939185.1 protein_id gnl|my_center|LOCUS_15280 4611 3949 gene locus_tag LOCUS_15290 4611 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 >Feature sequence204 4442 138 gene locus_tag LOCUS_15300 4442 138 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965697.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence205 307 1005 gene locus_tag LOCUS_15310 307 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 3960 1183 gene locus_tag LOCUS_15320 3960 1183 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861232.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence206 854 222 gene locus_tag LOCUS_15330 854 222 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938113.1 protein_id gnl|my_center|LOCUS_15330 1086 2390 gene locus_tag LOCUS_15340 gene hisD 1086 2390 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938097.1 protein_id gnl|my_center|LOCUS_15340 2488 3384 gene locus_tag LOCUS_15350 2488 3384 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938096.1 protein_id gnl|my_center|LOCUS_15350 3776 4540 gene locus_tag LOCUS_15360 3776 4540 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938095.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence207 78 1016 gene locus_tag LOCUS_15370 78 1016 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_15370 1748 1215 gene locus_tag LOCUS_15380 1748 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15380 2074 1691 gene locus_tag LOCUS_15390 2074 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15390 2976 2071 gene locus_tag LOCUS_15400 2976 2071 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791710.1 protein_id gnl|my_center|LOCUS_15400 3823 2981 gene locus_tag LOCUS_15410 3823 2981 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939936.1 protein_id gnl|my_center|LOCUS_15410 4636 4130 gene locus_tag LOCUS_15420 4636 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence208 245 1522 gene locus_tag LOCUS_15430 245 1522 CDS product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666700.1 protein_id gnl|my_center|LOCUS_15430 1619 3022 gene locus_tag LOCUS_15440 1619 3022 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939424.1 protein_id gnl|my_center|LOCUS_15440 3760 3362 gene locus_tag LOCUS_15450 3760 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 <4685 4149 gene locus_tag LOCUS_15460 <4685 4149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938734.1:flagellin >Feature sequence209 380 138 gene locus_tag LOCUS_15470 380 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938911.1 protein_id gnl|my_center|LOCUS_15470 2177 651 gene locus_tag LOCUS_15480 gene gpmI 2177 651 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938910.1 protein_id gnl|my_center|LOCUS_15480 2577 2185 gene locus_tag LOCUS_15490 gene rsfS 2577 2185 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938909.1 protein_id gnl|my_center|LOCUS_15490 2747 4051 gene locus_tag LOCUS_15500 2747 4051 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938906.1 protein_id gnl|my_center|LOCUS_15500 4189 4395 gene locus_tag LOCUS_15510 4189 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence210 837 52 gene locus_tag LOCUS_15520 837 52 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940571.1 protein_id gnl|my_center|LOCUS_15520 1049 2092 gene locus_tag LOCUS_15530 1049 2092 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940307.1 protein_id gnl|my_center|LOCUS_15530 2267 3205 gene locus_tag LOCUS_15540 2267 3205 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940306.1 protein_id gnl|my_center|LOCUS_15540 3205 4452 gene locus_tag LOCUS_15550 3205 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence211 945 870 gene locus_tag LOCUS_t00250 945 870 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1164 2144 gene locus_tag LOCUS_15560 1164 2144 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388760.1 protein_id gnl|my_center|LOCUS_15560 2233 4116 gene locus_tag LOCUS_15570 gene asnB 2233 4116 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_15570 4113 4460 gene locus_tag LOCUS_15580 4113 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence212 1379 3982 gene locus_tag LOCUS_15590 1379 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039763.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence213 4333 86 gene locus_tag LOCUS_15600 4333 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence214 1027 200 gene locus_tag LOCUS_15610 1027 200 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938977.1 protein_id gnl|my_center|LOCUS_15610 2253 1024 gene locus_tag LOCUS_15620 2253 1024 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938975.1 protein_id gnl|my_center|LOCUS_15620 3016 2273 gene locus_tag LOCUS_15630 3016 2273 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938974.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence215 696 256 gene locus_tag LOCUS_15640 696 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 788 2326 gene locus_tag LOCUS_15650 788 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 2323 3693 gene locus_tag LOCUS_15660 2323 3693 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_15660 3782 4456 gene locus_tag LOCUS_15670 3782 4456 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939708.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence216 1027 92 gene locus_tag LOCUS_15680 gene metA 1027 92 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080711.1 protein_id gnl|my_center|LOCUS_15680 1809 1105 gene locus_tag LOCUS_15690 1809 1105 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939814.1 protein_id gnl|my_center|LOCUS_15690 2828 2163 gene locus_tag LOCUS_15700 2828 2163 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937441.1 protein_id gnl|my_center|LOCUS_15700 3039 3947 gene locus_tag LOCUS_15710 3039 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence217 276 2669 gene locus_tag LOCUS_15720 gene priA 276 2669 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938580.1 protein_id gnl|my_center|LOCUS_15720 2872 4152 gene locus_tag LOCUS_15730 2872 4152 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938556.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence218 2417 114 gene locus_tag LOCUS_15740 2417 114 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024901093.1 protein_id gnl|my_center|LOCUS_15740 2793 3137 gene locus_tag LOCUS_15750 2793 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence219 1248 394 gene locus_tag LOCUS_15760 1248 394 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939612.1 protein_id gnl|my_center|LOCUS_15760 1394 2113 gene locus_tag LOCUS_15770 1394 2113 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939484.1 protein_id gnl|my_center|LOCUS_15770 2110 3846 gene locus_tag LOCUS_15780 2110 3846 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939485.1 protein_id gnl|my_center|LOCUS_15780 3983 4059 gene locus_tag LOCUS_t00260 3983 4059 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence220 590 195 gene locus_tag LOCUS_15790 590 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15790 2266 581 gene locus_tag LOCUS_15800 2266 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 4143 2215 gene locus_tag LOCUS_15810 4143 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence221 1587 295 gene locus_tag LOCUS_15820 1587 295 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094037.1 protein_id gnl|my_center|LOCUS_15820 2273 1584 gene locus_tag LOCUS_15830 2273 1584 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 protein_id gnl|my_center|LOCUS_15830 2884 2507 gene locus_tag LOCUS_15840 2884 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 3294 2896 gene locus_tag LOCUS_15850 3294 2896 CDS product NirD/YgiW/YdeI family stress tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074233.1 protein_id gnl|my_center|LOCUS_15850 3823 3425 gene locus_tag LOCUS_15860 3823 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 3937 4194 gene locus_tag LOCUS_15870 3937 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence222 <1 1656 gene locus_tag LOCUS_15880 <1 1656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939160.1:ATP-dependent chaperone ClpB 2015 4039 gene locus_tag LOCUS_15890 2015 4039 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237518.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence223 1691 870 gene locus_tag LOCUS_15900 gene panB 1691 870 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_15900 2603 1701 gene locus_tag LOCUS_15910 gene speB 2603 1701 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937728.1 protein_id gnl|my_center|LOCUS_15910 3035 2960 gene locus_tag LOCUS_t00270 3035 2960 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3164 4126 gene locus_tag LOCUS_15920 3164 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence224 961 74 gene locus_tag LOCUS_15930 961 74 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545741.1 protein_id gnl|my_center|LOCUS_15930 1515 949 gene locus_tag LOCUS_15940 1515 949 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545577.1 protein_id gnl|my_center|LOCUS_15940 1781 1560 gene locus_tag LOCUS_15950 1781 1560 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546446.1 protein_id gnl|my_center|LOCUS_15950 2875 1781 gene locus_tag LOCUS_15960 gene yedE 2875 1781 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545330.1 protein_id gnl|my_center|LOCUS_15960 3571 3495 gene locus_tag LOCUS_t00280 3571 3495 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3999 3733 gene locus_tag LOCUS_15970 gene rpsT 3999 3733 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence225 1572 127 gene locus_tag LOCUS_15980 1572 127 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939501.1 protein_id gnl|my_center|LOCUS_15980 1735 2580 gene locus_tag LOCUS_15990 1735 2580 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939505.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence226 1554 289 gene locus_tag LOCUS_16000 1554 289 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_16000 2145 3092 gene locus_tag LOCUS_16010 2145 3092 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939207.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence227 714 559 gene locus_tag LOCUS_16020 714 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2236 1364 gene locus_tag LOCUS_16030 2236 1364 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_16030 2754 2236 gene locus_tag LOCUS_16040 2754 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 3052 3936 gene locus_tag LOCUS_16050 gene rluC 3052 3936 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002871.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence228 2227 1445 gene locus_tag LOCUS_16060 2227 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 3834 2224 gene locus_tag LOCUS_16070 3834 2224 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427788.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence229 >Feature sequence230 2469 1597 gene locus_tag LOCUS_16080 gene yihU 2469 1597 CDS product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065003.1 protein_id gnl|my_center|LOCUS_16080 3604 2708 gene locus_tag LOCUS_16090 3604 2708 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459063.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence231 719 132 gene locus_tag LOCUS_16100 719 132 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760532.1 protein_id gnl|my_center|LOCUS_16100 3739 1658 gene locus_tag LOCUS_16110 3739 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence232 589 83 gene locus_tag LOCUS_16120 589 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 869 1306 gene locus_tag LOCUS_16130 869 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1705 2712 gene locus_tag LOCUS_16140 1705 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 3009 3539 gene locus_tag LOCUS_16150 3009 3539 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938587.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence233 <1 647 gene locus_tag LOCUS_16160 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102012.1:LysR family transcriptional regulator 921 2669 gene locus_tag LOCUS_16170 921 2669 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_16170 2781 3020 gene locus_tag LOCUS_16180 2781 3020 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938477.1 protein_id gnl|my_center|LOCUS_16180 3268 3900 gene locus_tag LOCUS_16190 3268 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence234 1266 67 gene locus_tag LOCUS_16200 1266 67 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939620.1 protein_id gnl|my_center|LOCUS_16200 2052 1564 gene locus_tag LOCUS_16210 gene dut 2052 1564 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791926.1 protein_id gnl|my_center|LOCUS_16210 2147 3484 gene locus_tag LOCUS_16220 gene trmFO 2147 3484 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791925.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence235 1289 900 gene locus_tag LOCUS_16230 1289 900 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940429.1 protein_id gnl|my_center|LOCUS_16230 2200 1421 gene locus_tag LOCUS_16240 gene cobJ 2200 1421 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940428.1 protein_id gnl|my_center|LOCUS_16240 3747 2638 gene locus_tag LOCUS_16250 3747 2638 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229228.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence236 609 109 gene locus_tag LOCUS_16260 609 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2707 611 gene locus_tag LOCUS_16270 2707 611 CDS product thiosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937484.1 protein_id gnl|my_center|LOCUS_16270 3508 2960 gene locus_tag LOCUS_16280 3508 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937559.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence237 527 1786 gene locus_tag LOCUS_16290 527 1786 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938325.1 protein_id gnl|my_center|LOCUS_16290 1996 2649 gene locus_tag LOCUS_16300 1996 2649 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_16300 2809 3774 gene locus_tag LOCUS_16310 2809 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence238 1038 91 gene locus_tag LOCUS_16320 1038 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 2579 1035 gene locus_tag LOCUS_16330 2579 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 3708 2569 gene locus_tag LOCUS_16340 gene rffA 3708 2569 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950550.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence239 347 150 gene locus_tag LOCUS_16350 347 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 477 713 gene locus_tag LOCUS_16360 477 713 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939842.1 protein_id gnl|my_center|LOCUS_16360 956 1192 gene locus_tag LOCUS_16370 956 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1207 3372 gene locus_tag LOCUS_16380 1207 3372 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791356.1 protein_id gnl|my_center|LOCUS_16380 3369 3665 gene locus_tag LOCUS_16390 3369 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence240 207 1781 gene locus_tag LOCUS_16400 207 1781 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063774.1 protein_id gnl|my_center|LOCUS_16400 2343 3734 gene locus_tag LOCUS_16410 2343 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence241 124 1065 gene locus_tag LOCUS_16420 124 1065 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043786554.1 protein_id gnl|my_center|LOCUS_16420 1231 1986 gene locus_tag LOCUS_16430 gene rpsB 1231 1986 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938173.1 protein_id gnl|my_center|LOCUS_16430 2166 3020 gene locus_tag LOCUS_16440 gene tsf 2166 3020 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938172.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence242 674 165 gene locus_tag LOCUS_16450 674 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 1297 743 gene locus_tag LOCUS_16460 gene gmhB 1297 743 CDS product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194255.1 protein_id gnl|my_center|LOCUS_16460 2155 1325 gene locus_tag LOCUS_16470 2155 1325 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939760.1 protein_id gnl|my_center|LOCUS_16470 2473 3576 gene locus_tag LOCUS_16480 2473 3576 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868082.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence243 1249 629 gene locus_tag LOCUS_16490 1249 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1841 1317 gene locus_tag LOCUS_16500 1841 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 2720 1893 gene locus_tag LOCUS_16510 2720 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 3638 2856 gene locus_tag LOCUS_16520 3638 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence244 1498 356 gene locus_tag LOCUS_16530 1498 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1701 1495 gene locus_tag LOCUS_16540 1701 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 <3808 1920 gene locus_tag LOCUS_16550 <3808 1920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860848.1:bifunctional diguanylate cyclase/phosphodiesterase >Feature sequence245 582 1103 gene locus_tag LOCUS_16560 582 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 >Feature sequence246 285 1673 gene locus_tag LOCUS_16570 285 1673 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033562369.1 protein_id gnl|my_center|LOCUS_16570 1781 3046 gene locus_tag LOCUS_16580 1781 3046 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940511.1 protein_id gnl|my_center|LOCUS_16580 3349 3726 gene locus_tag LOCUS_16590 3349 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939266.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence247 <1 817 gene locus_tag LOCUS_16600 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938100.1:outer membrane homotrimeric porin 1125 913 gene locus_tag LOCUS_16610 1125 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938547.1 protein_id gnl|my_center|LOCUS_16610 1572 1237 gene locus_tag LOCUS_16620 1572 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 1799 3574 gene locus_tag LOCUS_16630 1799 3574 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546634.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence248 1308 199 gene locus_tag LOCUS_16640 1308 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1571 3673 gene locus_tag LOCUS_16650 1571 3673 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939143.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence249 744 100 gene locus_tag LOCUS_16660 gene tmk 744 100 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939417.1 protein_id gnl|my_center|LOCUS_16660 1780 752 gene locus_tag LOCUS_16670 1780 752 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939418.1 protein_id gnl|my_center|LOCUS_16670 1857 2615 gene locus_tag LOCUS_16680 gene surE 1857 2615 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939419.1 protein_id gnl|my_center|LOCUS_16680 2786 3712 gene locus_tag LOCUS_16690 gene fba 2786 3712 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence250 1760 1296 gene locus_tag LOCUS_16700 gene rplO 1760 1296 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938617.1 protein_id gnl|my_center|LOCUS_16700 1957 1781 gene locus_tag LOCUS_16710 gene rpmD 1957 1781 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633387.1 protein_id gnl|my_center|LOCUS_16710 2479 1961 gene locus_tag LOCUS_16720 gene rpsE 2479 1961 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938615.1 protein_id gnl|my_center|LOCUS_16720 2840 2481 gene locus_tag LOCUS_16730 gene rplR 2840 2481 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938614.1 protein_id gnl|my_center|LOCUS_16730 3391 2852 gene locus_tag LOCUS_16740 gene rplF 3391 2852 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938613.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence251 372 2681 gene locus_tag LOCUS_16750 372 2681 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459976.1 protein_id gnl|my_center|LOCUS_16750 2684 2899 gene locus_tag LOCUS_16760 2684 2899 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938849.1 protein_id gnl|my_center|LOCUS_16760 2900 3568 gene locus_tag LOCUS_16770 2900 3568 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792356.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence252 2903 201 gene locus_tag LOCUS_16780 2903 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16780 >Feature sequence253 391 1038 gene locus_tag LOCUS_16790 391 1038 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938215.1 protein_id gnl|my_center|LOCUS_16790 1048 1848 gene locus_tag LOCUS_16800 1048 1848 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938213.1 protein_id gnl|my_center|LOCUS_16800 2151 2738 gene locus_tag LOCUS_16810 2151 2738 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938908.1 protein_id gnl|my_center|LOCUS_16810 3431 3021 gene locus_tag LOCUS_16820 3431 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence254 935 138 gene locus_tag LOCUS_16830 935 138 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_16830 1288 2247 gene locus_tag LOCUS_16840 1288 2247 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940161.1 protein_id gnl|my_center|LOCUS_16840 2244 3506 gene locus_tag LOCUS_16850 2244 3506 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940162.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence255 1047 250 gene locus_tag LOCUS_16860 gene sfsA 1047 250 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940482.1 protein_id gnl|my_center|LOCUS_16860 1165 2355 gene locus_tag LOCUS_16870 1165 2355 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940481.1 protein_id gnl|my_center|LOCUS_16870 2442 3602 gene locus_tag LOCUS_16880 2442 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence256 550 1011 gene locus_tag LOCUS_16890 550 1011 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294635.1 protein_id gnl|my_center|LOCUS_16890 1642 2217 gene locus_tag LOCUS_16900 1642 2217 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791459.1 protein_id gnl|my_center|LOCUS_16900 3457 2387 gene locus_tag LOCUS_16910 3457 2387 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937445.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence257 339 1601 gene locus_tag LOCUS_16920 339 1601 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940241.1 protein_id gnl|my_center|LOCUS_16920 1626 2123 gene locus_tag LOCUS_16930 1626 2123 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940242.1 protein_id gnl|my_center|LOCUS_16930 2282 3355 gene locus_tag LOCUS_16940 gene leuB 2282 3355 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940244.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence258 1599 1078 gene locus_tag LOCUS_16950 gene traF 1599 1078 CDS product conjugative transfer signal peptidase TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002726.1 protein_id gnl|my_center|LOCUS_16950 2936 1599 gene locus_tag LOCUS_16960 2936 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16960 >Feature sequence259 428 99 gene locus_tag LOCUS_16970 428 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 2556 439 gene locus_tag LOCUS_16980 2556 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 <3438 2531 gene locus_tag LOCUS_16990 <3438 2531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339612.1:phage portal protein >Feature sequence260 1549 119 gene locus_tag LOCUS_17000 1549 119 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939629.1 protein_id gnl|my_center|LOCUS_17000 1919 2506 gene locus_tag LOCUS_17010 1919 2506 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939628.1 protein_id gnl|my_center|LOCUS_17010 2617 3372 gene locus_tag LOCUS_17020 2617 3372 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939933.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence261 1379 75 gene locus_tag LOCUS_17030 gene larA 1379 75 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986388.1 protein_id gnl|my_center|LOCUS_17030 3192 1672 gene locus_tag LOCUS_17040 3192 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence262 799 191 gene locus_tag LOCUS_17050 799 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 2113 806 gene locus_tag LOCUS_17060 2113 806 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940001.1 protein_id gnl|my_center|LOCUS_17060 3186 2122 gene locus_tag LOCUS_17070 3186 2122 CDS product DUF1786 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940672.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence263 <1 597 gene locus_tag LOCUS_17080 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104542.1:VapE family protein 600 2909 gene locus_tag LOCUS_17090 600 2909 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461760.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence264 488 1975 gene locus_tag LOCUS_17100 488 1975 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479935.1 protein_id gnl|my_center|LOCUS_17100 2082 3296 gene locus_tag LOCUS_17110 2082 3296 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938495.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence265 >Feature sequence266 1364 105 gene locus_tag LOCUS_17120 1364 105 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939787.1 protein_id gnl|my_center|LOCUS_17120 1564 3210 gene locus_tag LOCUS_17130 1564 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence267 653 183 gene locus_tag LOCUS_17140 gene pal 653 183 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940363.1 protein_id gnl|my_center|LOCUS_17140 2177 864 gene locus_tag LOCUS_17150 gene tolB 2177 864 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524613.1 protein_id gnl|my_center|LOCUS_17150 3057 2218 gene locus_tag LOCUS_17160 3057 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence268 2542 110 gene locus_tag LOCUS_17170 gene lon 2542 110 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938632.1 protein_id gnl|my_center|LOCUS_17170 <3317 2690 gene locus_tag LOCUS_17180 <3317 2690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938631.1:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence269 1968 886 gene locus_tag LOCUS_17190 gene eutH 1968 886 CDS product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897061.1 protein_id gnl|my_center|LOCUS_17190 2206 1961 gene locus_tag LOCUS_17200 2206 1961 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016131.1 protein_id gnl|my_center|LOCUS_17200 2655 2203 gene locus_tag LOCUS_17210 2655 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence270 571 664 gene locus_tag LOCUS_t00290 571 664 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 2626 917 gene locus_tag LOCUS_17220 2626 917 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940294.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence271 1050 634 gene locus_tag LOCUS_17230 gene nikR 1050 634 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940151.1 protein_id gnl|my_center|LOCUS_17230 2055 1354 gene locus_tag LOCUS_17240 2055 1354 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294676.1 protein_id gnl|my_center|LOCUS_17240 2384 2875 gene locus_tag LOCUS_17250 2384 2875 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938481.1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence272 1077 139 gene locus_tag LOCUS_17260 1077 139 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_17260 3104 1074 gene locus_tag LOCUS_17270 3104 1074 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence273 387 1508 gene locus_tag LOCUS_17280 387 1508 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937439.1 protein_id gnl|my_center|LOCUS_17280 1483 2364 gene locus_tag LOCUS_17290 1483 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 2437 2655 gene locus_tag LOCUS_17300 2437 2655 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938662.1 protein_id gnl|my_center|LOCUS_17300 2678 3109 gene locus_tag LOCUS_17310 2678 3109 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938903.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence274 2850 124 gene locus_tag LOCUS_17320 2850 124 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938851.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence275 222 1175 gene locus_tag LOCUS_17330 222 1175 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494482.1 protein_id gnl|my_center|LOCUS_17330 1239 1688 gene locus_tag LOCUS_17340 1239 1688 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903082.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence276 424 1680 gene locus_tag LOCUS_17350 424 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1797 2801 gene locus_tag LOCUS_17360 1797 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence277 595 101 gene locus_tag LOCUS_17370 595 101 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_17370 837 1061 gene locus_tag LOCUS_17380 837 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2404 1313 gene locus_tag LOCUS_17390 2404 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2704 2779 gene locus_tag LOCUS_t00300 2704 2779 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2785 2861 gene locus_tag LOCUS_t00310 2785 2861 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence278 1033 80 gene locus_tag LOCUS_17400 1033 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 2779 1124 gene locus_tag LOCUS_17410 gene ggt 2779 1124 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808651.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence279 188 1216 gene locus_tag LOCUS_17420 188 1216 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940615.1 protein_id gnl|my_center|LOCUS_17420 2830 1442 gene locus_tag LOCUS_17430 2830 1442 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940618.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence280 1338 277 gene locus_tag LOCUS_17440 1338 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 1916 1482 gene locus_tag LOCUS_17450 gene tolR 1916 1482 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940359.1 protein_id gnl|my_center|LOCUS_17450 2614 1919 gene locus_tag LOCUS_17460 gene tolQ 2614 1919 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940358.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence281 <1 1790 gene locus_tag LOCUS_17470 <1 1790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105486.1:type VI secretion system ATPase TssH <2934 2164 gene locus_tag LOCUS_17480 <2934 2164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920729.1:glycosyltransferase family 2 protein >Feature sequence282 145 1497 gene locus_tag LOCUS_17490 gene glmU 145 1497 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939937.1 protein_id gnl|my_center|LOCUS_17490 1684 1935 gene locus_tag LOCUS_17500 1684 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 1945 2214 gene locus_tag LOCUS_17510 gene zapA 1945 2214 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939939.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence283 1304 222 gene locus_tag LOCUS_17520 gene gcvT 1304 222 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938973.1 protein_id gnl|my_center|LOCUS_17520 2696 1716 gene locus_tag LOCUS_17530 2696 1716 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897260.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence284 1175 75 gene locus_tag LOCUS_17540 gene dnaJ 1175 75 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940501.1 protein_id gnl|my_center|LOCUS_17540 1707 1468 gene locus_tag LOCUS_17550 gene rpoZ 1707 1468 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940500.1 protein_id gnl|my_center|LOCUS_17550 1898 2662 gene locus_tag LOCUS_17560 1898 2662 CDS product tRNA 2-thiocytidine biosynthesis TtcA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940499.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence285 110 1399 gene locus_tag LOCUS_17570 gene rfbH 110 1399 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939427.1 protein_id gnl|my_center|LOCUS_17570 1436 2032 gene locus_tag LOCUS_17580 gene rfbC 1436 2032 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565041.1 protein_id gnl|my_center|LOCUS_17580 2029 2874 gene locus_tag LOCUS_17590 2029 2874 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545190.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence286 >Feature sequence287 1704 2801 gene locus_tag LOCUS_17600 1704 2801 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294613.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence288 380 138 gene locus_tag LOCUS_17610 380 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 2346 367 gene locus_tag LOCUS_17620 2346 367 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939685.1 protein_id gnl|my_center|LOCUS_17620 2718 2356 gene locus_tag LOCUS_17630 2718 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence289 403 1203 gene locus_tag LOCUS_17640 gene glpF 403 1203 CDS product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084268.1 protein_id gnl|my_center|LOCUS_17640 1231 2739 gene locus_tag LOCUS_17650 gene glpK 1231 2739 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099318.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence290 1057 263 gene locus_tag LOCUS_17660 1057 263 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937704.1 protein_id gnl|my_center|LOCUS_17660 1938 1060 gene locus_tag LOCUS_17670 1938 1060 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937706.1 protein_id gnl|my_center|LOCUS_17670 2204 1935 gene locus_tag LOCUS_17680 2204 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792913.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence291 290 2758 gene locus_tag LOCUS_17690 gene hypF 290 2758 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629133.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence292 770 15 gene locus_tag LOCUS_17700 770 15 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097055.1 protein_id gnl|my_center|LOCUS_17700 2559 1009 gene locus_tag LOCUS_17710 gene tet(35) 2559 1009 CDS product tetracycline efflux Na+/H+ antiporter family transporter Tet(35) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480402.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence293 1585 59 gene locus_tag LOCUS_17720 1585 59 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937617.1 protein_id gnl|my_center|LOCUS_17720 <2815 1761 gene locus_tag LOCUS_17730 <2815 1761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937618.1:FliH/SctL family protein >Feature sequence294 233 796 gene locus_tag LOCUS_17740 233 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2008 1109 gene locus_tag LOCUS_17750 2008 1109 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938302.1 protein_id gnl|my_center|LOCUS_17750 2461 2012 gene locus_tag LOCUS_17760 2461 2012 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938301.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence295 953 24 gene locus_tag LOCUS_17770 953 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 2570 957 gene locus_tag LOCUS_17780 gene argS 2570 957 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938544.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence296 1128 655 gene locus_tag LOCUS_17790 1128 655 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938241.1 protein_id gnl|my_center|LOCUS_17790 1386 2333 gene locus_tag LOCUS_17800 1386 2333 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082945.1 protein_id gnl|my_center|LOCUS_17800 2772 2440 gene locus_tag LOCUS_tm00010 2772 2440 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence297 544 365 gene locus_tag LOCUS_17810 544 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 <2766 726 gene locus_tag LOCUS_17820 <2766 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938648.1:DNA polymerase III subunit alpha >Feature sequence298 1659 76 gene locus_tag LOCUS_17830 1659 76 CDS product IS66-like element ISBf10 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004312011.1 protein_id gnl|my_center|LOCUS_17830 2299 1937 gene locus_tag LOCUS_17840 gene tnpB 2299 1937 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108244.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence299 <1 1070 gene locus_tag LOCUS_17850 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860848.1:bifunctional diguanylate cyclase/phosphodiesterase 2540 1176 gene locus_tag LOCUS_17860 2540 1176 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939416.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence300 364 2484 gene locus_tag LOCUS_17870 364 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence301 1249 137 gene locus_tag LOCUS_17880 1249 137 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401993.1 protein_id gnl|my_center|LOCUS_17880 1644 2660 gene locus_tag LOCUS_17890 1644 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence302 1033 50 gene locus_tag LOCUS_17900 1033 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 1333 1962 gene locus_tag LOCUS_17910 1333 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1962 2243 gene locus_tag LOCUS_17920 1962 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence303 107 901 gene locus_tag LOCUS_17930 gene rsmA 107 901 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792217.1 protein_id gnl|my_center|LOCUS_17930 1611 1027 gene locus_tag LOCUS_17940 1611 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2054 2440 gene locus_tag LOCUS_17950 2054 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence304 1787 219 gene locus_tag LOCUS_17960 1787 219 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938681.1 protein_id gnl|my_center|LOCUS_17960 2015 2509 gene locus_tag LOCUS_17970 gene greA 2015 2509 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940503.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence305 730 1269 gene locus_tag LOCUS_17980 730 1269 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_17980 2562 1444 gene locus_tag LOCUS_17990 2562 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17990 >Feature sequence306 513 244 gene locus_tag LOCUS_18000 gene fliQ 513 244 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937354.1 protein_id gnl|my_center|LOCUS_18000 1292 549 gene locus_tag LOCUS_18010 gene fliP 1292 549 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524186.1 protein_id gnl|my_center|LOCUS_18010 1785 1255 gene locus_tag LOCUS_18020 1785 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 2296 1796 gene locus_tag LOCUS_18030 gene fliN 2296 1796 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937357.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence307 1156 266 gene locus_tag LOCUS_18040 1156 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 1329 1778 gene locus_tag LOCUS_18050 gene queD 1329 1778 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704886.1 protein_id gnl|my_center|LOCUS_18050 1778 2491 gene locus_tag LOCUS_18060 gene queE 1778 2491 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118723.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence308 1503 52 gene locus_tag LOCUS_18070 1503 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 <2549 1672 gene locus_tag LOCUS_18080 <2549 1672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939129.1:tetratricopeptide repeat protein >Feature sequence309 97 1095 gene locus_tag LOCUS_18090 97 1095 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026837.1 protein_id gnl|my_center|LOCUS_18090 1376 2329 gene locus_tag LOCUS_18100 1376 2329 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence310 421 753 gene locus_tag LOCUS_18110 421 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 750 1031 gene locus_tag LOCUS_18120 750 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 1019 2341 gene locus_tag LOCUS_18130 1019 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 >Feature sequence311 1532 108 gene locus_tag LOCUS_18140 1532 108 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792552.1 protein_id gnl|my_center|LOCUS_18140 1654 2442 gene locus_tag LOCUS_18150 gene larB 1654 2442 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938361.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence312 <1 1324 gene locus_tag LOCUS_18160 <1 1324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038026.1:type I restriction-modification system subunit M 1311 2390 gene locus_tag LOCUS_18170 1311 2390 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938996.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence313 <1 914 gene locus_tag LOCUS_18180 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_061090571.1:PstS family phosphate ABC transporter substrate-binding protein 1597 1073 gene locus_tag LOCUS_18190 1597 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence314 197 1186 gene locus_tag LOCUS_18200 gene selD 197 1186 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:B8DNL1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence315 38 691 gene locus_tag LOCUS_18210 38 691 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942944.1 protein_id gnl|my_center|LOCUS_18210 >Feature sequence316 2134 89 gene locus_tag LOCUS_18220 2134 89 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792407.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence317 940 431 gene locus_tag LOCUS_18230 940 431 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937593.1 protein_id gnl|my_center|LOCUS_18230 1091 2401 gene locus_tag LOCUS_18240 gene mutY 1091 2401 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629788.1 protein_id gnl|my_center|LOCUS_18240