>Feature sequence01 219 19 gene locus_tag LOCUS_00010 219 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 406 248 gene locus_tag LOCUS_00020 406 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 774 391 gene locus_tag LOCUS_00030 774 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1013 1384 gene locus_tag LOCUS_00040 1013 1384 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963588.1 protein_id gnl|my_center|LOCUS_00040 1378 2115 gene locus_tag LOCUS_00050 1378 2115 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403437.1 protein_id gnl|my_center|LOCUS_00050 2139 2978 gene locus_tag LOCUS_00060 2139 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 2971 3207 gene locus_tag LOCUS_00070 2971 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5135 3456 gene locus_tag LOCUS_00080 5135 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 5483 6430 gene locus_tag LOCUS_00090 5483 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6370 7467 gene locus_tag LOCUS_00100 6370 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 7471 7770 gene locus_tag LOCUS_00110 7471 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 7892 7968 gene locus_tag LOCUS_t00010 7892 7968 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8036 8833 gene locus_tag LOCUS_00120 8036 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 8824 9690 gene locus_tag LOCUS_00130 8824 9690 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966758.1 protein_id gnl|my_center|LOCUS_00130 10010 9753 gene locus_tag LOCUS_00140 10010 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 10689 10003 gene locus_tag LOCUS_00150 10689 10003 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010777.1 protein_id gnl|my_center|LOCUS_00150 11993 10686 gene locus_tag LOCUS_00160 11993 10686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 13258 12008 gene locus_tag LOCUS_00170 13258 12008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 13495 16056 gene locus_tag LOCUS_00180 13495 16056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18365 16119 gene locus_tag LOCUS_00190 gene gyrA 18365 16119 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_00190 20359 18380 gene locus_tag LOCUS_00200 gene gyrB 20359 18380 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_00200 20708 20781 gene locus_tag LOCUS_t00020 20708 20781 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 20785 20861 gene locus_tag LOCUS_t00030 20785 20861 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20889 20965 gene locus_tag LOCUS_t00040 20889 20965 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 22901 21096 gene locus_tag LOCUS_00210 22901 21096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23817 23128 gene locus_tag LOCUS_00220 23817 23128 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582881.1 protein_id gnl|my_center|LOCUS_00220 24518 23826 gene locus_tag LOCUS_00230 24518 23826 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963931.1 protein_id gnl|my_center|LOCUS_00230 24882 24511 gene locus_tag LOCUS_00240 24882 24511 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948112.1 protein_id gnl|my_center|LOCUS_00240 26409 25027 gene locus_tag LOCUS_00250 26409 25027 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_00250 26705 26780 gene locus_tag LOCUS_t00050 26705 26780 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 26936 27011 gene locus_tag LOCUS_t00060 26936 27011 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 29341 27149 gene locus_tag LOCUS_00260 29341 27149 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_00260 30407 29511 gene locus_tag LOCUS_00270 30407 29511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 31580 30411 gene locus_tag LOCUS_00280 31580 30411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 32373 31627 gene locus_tag LOCUS_00290 gene truA 32373 31627 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_00290 35045 32370 gene locus_tag LOCUS_00300 35045 32370 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106612643.1 protein_id gnl|my_center|LOCUS_00300 35861 35058 gene locus_tag LOCUS_00310 35861 35058 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_00310 36727 35864 gene locus_tag LOCUS_00320 36727 35864 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_00320 37590 36742 gene locus_tag LOCUS_00330 37590 36742 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 protein_id gnl|my_center|LOCUS_00330 37829 37611 gene locus_tag LOCUS_00340 37829 37611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 38700 37831 gene locus_tag LOCUS_00350 38700 37831 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_00350 40076 38724 gene locus_tag LOCUS_00360 gene glmM 40076 38724 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_00360 41236 40175 gene locus_tag LOCUS_00370 gene ruvB 41236 40175 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344450.1 protein_id gnl|my_center|LOCUS_00370 41871 41254 gene locus_tag LOCUS_00380 gene ruvA 41871 41254 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257302.1 protein_id gnl|my_center|LOCUS_00380 42383 41868 gene locus_tag LOCUS_00390 gene ruvC 42383 41868 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_00390 42487 42657 gene locus_tag LOCUS_00400 42487 42657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 42644 43762 gene locus_tag LOCUS_00410 gene pheA 42644 43762 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_00410 44510 43830 gene locus_tag LOCUS_00420 44510 43830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 45107 46132 gene locus_tag LOCUS_00430 45107 46132 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583040.1 protein_id gnl|my_center|LOCUS_00430 46305 47774 gene locus_tag LOCUS_00440 46305 47774 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_00440 48291 47866 gene locus_tag LOCUS_00450 gene ruvX 48291 47866 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810863.1 protein_id gnl|my_center|LOCUS_00450 49219 48308 gene locus_tag LOCUS_00460 49219 48308 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_00460 49989 49219 gene locus_tag LOCUS_00470 gene pyrK 49989 49219 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983358.1 protein_id gnl|my_center|LOCUS_00470 53268 50077 gene locus_tag LOCUS_00480 gene carB 53268 50077 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862003.1 protein_id gnl|my_center|LOCUS_00480 54378 53272 gene locus_tag LOCUS_00490 gene carA 54378 53272 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_00490 55325 54408 gene locus_tag LOCUS_00500 gene pyrF 55325 54408 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_00500 56649 55360 gene locus_tag LOCUS_00510 56649 55360 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_00510 57200 56646 gene locus_tag LOCUS_00520 gene pyrR 57200 56646 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_00520 58358 57474 gene locus_tag LOCUS_00530 gene rsmA 58358 57474 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651548.1 protein_id gnl|my_center|LOCUS_00530 61996 58355 gene locus_tag LOCUS_00540 gene addA 61996 58355 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572298.1 protein_id gnl|my_center|LOCUS_00540 65355 61996 gene locus_tag LOCUS_00550 gene addB 65355 61996 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_00550 65933 65490 gene locus_tag LOCUS_00560 65933 65490 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642743.1 protein_id gnl|my_center|LOCUS_00560 66640 66188 gene locus_tag LOCUS_00570 66640 66188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 67134 66637 gene locus_tag LOCUS_00580 gene coaD 67134 66637 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080981.1 protein_id gnl|my_center|LOCUS_00580 67686 67138 gene locus_tag LOCUS_00590 gene rsmD 67686 67138 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_00590 69556 67790 gene locus_tag LOCUS_00600 gene uvrC 69556 67790 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_00600 71016 69736 gene locus_tag LOCUS_00610 gene purD 71016 69736 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_00610 72216 71035 gene locus_tag LOCUS_00620 72216 71035 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_00620 72942 72229 gene locus_tag LOCUS_00630 72942 72229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 73615 72989 gene locus_tag LOCUS_00640 gene purN 73615 72989 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_00640 74671 73637 gene locus_tag LOCUS_00650 gene purM 74671 73637 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_00650 76150 74720 gene locus_tag LOCUS_00660 gene purF 76150 74720 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_00660 77578 76157 gene locus_tag LOCUS_00670 77578 76157 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_00670 78301 77582 gene locus_tag LOCUS_00680 78301 77582 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_00680 78863 78363 gene locus_tag LOCUS_00690 gene purE 78863 78363 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393549.1 protein_id gnl|my_center|LOCUS_00690 79945 78992 gene locus_tag LOCUS_00700 79945 78992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 80926 79961 gene locus_tag LOCUS_00710 80926 79961 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_00710 81631 81131 gene locus_tag LOCUS_00720 81631 81131 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454674.1 protein_id gnl|my_center|LOCUS_00720 81888 82295 gene locus_tag LOCUS_00730 81888 82295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386950.1 protein_id gnl|my_center|LOCUS_00730 82304 83167 gene locus_tag LOCUS_00740 82304 83167 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_00740 83154 83768 gene locus_tag LOCUS_00750 83154 83768 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_00750 83995 84936 gene locus_tag LOCUS_00760 83995 84936 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_00760 86440 85022 gene locus_tag LOCUS_00770 gene pyk 86440 85022 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_00770 87416 86607 gene locus_tag LOCUS_00780 87416 86607 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_00780 89794 87434 gene locus_tag LOCUS_00790 gene pcrA 89794 87434 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357577.1 protein_id gnl|my_center|LOCUS_00790 90171 91103 gene locus_tag LOCUS_00800 90171 91103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 92641 91157 gene locus_tag LOCUS_00810 92641 91157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 92855 93643 gene locus_tag LOCUS_00820 gene sigG 92855 93643 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965003.1 protein_id gnl|my_center|LOCUS_00820 93822 94211 gene locus_tag LOCUS_00830 93822 94211 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949091.1 protein_id gnl|my_center|LOCUS_00830 94227 95087 gene locus_tag LOCUS_00840 94227 95087 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_00840 95686 96411 gene locus_tag LOCUS_00850 95686 96411 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_00850 96424 97860 gene locus_tag LOCUS_00860 96424 97860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 97848 99236 gene locus_tag LOCUS_00870 97848 99236 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861322.1 protein_id gnl|my_center|LOCUS_00870 99218 99913 gene locus_tag LOCUS_00880 gene sfsA 99218 99913 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_00880 100303 99974 gene locus_tag LOCUS_00890 100303 99974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 100655 103168 gene locus_tag LOCUS_00900 100655 103168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 103246 104367 gene locus_tag LOCUS_00910 103246 104367 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944494.1 protein_id gnl|my_center|LOCUS_00910 104381 105070 gene locus_tag LOCUS_00920 104381 105070 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948613.1 protein_id gnl|my_center|LOCUS_00920 105951 105169 gene locus_tag LOCUS_00930 105951 105169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 112691 106155 gene locus_tag LOCUS_00940 112691 106155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 113467 113207 gene locus_tag LOCUS_00950 113467 113207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 113906 114061 gene locus_tag LOCUS_00960 113906 114061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 114330 116339 gene locus_tag LOCUS_00970 114330 116339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 116544 118838 gene locus_tag LOCUS_00980 116544 118838 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390143.1 protein_id gnl|my_center|LOCUS_00980 118896 120320 gene locus_tag LOCUS_00990 118896 120320 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023877.1 protein_id gnl|my_center|LOCUS_00990 120317 121003 gene locus_tag LOCUS_01000 120317 121003 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459873.1 protein_id gnl|my_center|LOCUS_01000 121022 121885 gene locus_tag LOCUS_01010 121022 121885 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948584.1 protein_id gnl|my_center|LOCUS_01010 122234 121959 gene locus_tag LOCUS_01020 122234 121959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01020 122354 122488 gene locus_tag LOCUS_01030 122354 122488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01030 122952 122590 gene locus_tag LOCUS_01040 122952 122590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01040 124004 123072 gene locus_tag LOCUS_01050 124004 123072 CDS product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680020.1 protein_id gnl|my_center|LOCUS_01050 124788 124021 gene locus_tag LOCUS_01060 124788 124021 CDS product 2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964779.1 protein_id gnl|my_center|LOCUS_01060 126608 125001 gene locus_tag LOCUS_01070 126608 125001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 126893 126817 gene locus_tag LOCUS_t00070 126893 126817 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 127217 127011 gene locus_tag LOCUS_01080 127217 127011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 128693 127290 gene locus_tag LOCUS_01090 128693 127290 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391671.1 protein_id gnl|my_center|LOCUS_01090 129427 128786 gene locus_tag LOCUS_01100 gene coaE 129427 128786 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495251.1 protein_id gnl|my_center|LOCUS_01100 130437 129424 gene locus_tag LOCUS_01110 130437 129424 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_01110 131519 130443 gene locus_tag LOCUS_01120 gene prfA 131519 130443 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_01120 131744 131547 gene locus_tag LOCUS_01130 131744 131547 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_01130 132083 133021 gene locus_tag LOCUS_01140 132083 133021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 133296 134033 gene locus_tag LOCUS_01150 133296 134033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 134163 136097 gene locus_tag LOCUS_01160 134163 136097 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_01160 136838 136167 gene locus_tag LOCUS_01170 136838 136167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 137145 139682 gene locus_tag LOCUS_01180 137145 139682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 140847 139969 gene locus_tag LOCUS_01190 140847 139969 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289864.1 protein_id gnl|my_center|LOCUS_01190 141495 141016 gene locus_tag LOCUS_01200 141495 141016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 142401 141520 gene locus_tag LOCUS_01210 gene hslO 142401 141520 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_01210 143163 142405 gene locus_tag LOCUS_01220 143163 142405 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_01220 145932 143251 gene locus_tag LOCUS_01230 gene secA 145932 143251 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_01230 146727 146098 gene locus_tag LOCUS_01240 146727 146098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 147210 146743 gene locus_tag LOCUS_01250 147210 146743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 147718 147236 gene locus_tag LOCUS_01260 147718 147236 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403109.1 protein_id gnl|my_center|LOCUS_01260 148116 147715 gene locus_tag LOCUS_01270 148116 147715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 149768 148281 gene locus_tag LOCUS_01280 149768 148281 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_01280 154351 149783 gene locus_tag LOCUS_01290 gene gltB 154351 149783 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_01290 155096 154698 gene locus_tag LOCUS_01300 155096 154698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 155270 156040 gene locus_tag LOCUS_01310 155270 156040 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 protein_id gnl|my_center|LOCUS_01310 156113 156547 gene locus_tag LOCUS_01320 156113 156547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 158346 156658 gene locus_tag LOCUS_01330 gene cysN 158346 156658 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021169.1 protein_id gnl|my_center|LOCUS_01330 159245 158346 gene locus_tag LOCUS_01340 gene cysD 159245 158346 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707309.1 protein_id gnl|my_center|LOCUS_01340 159573 159259 gene locus_tag LOCUS_01350 159573 159259 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963432.1 protein_id gnl|my_center|LOCUS_01350 161236 159557 gene locus_tag LOCUS_01360 161236 159557 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963431.1 protein_id gnl|my_center|LOCUS_01360 162152 161241 gene locus_tag LOCUS_01370 gene trxB 162152 161241 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_01370 162569 162156 gene locus_tag LOCUS_01380 162569 162156 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_01380 163378 162566 gene locus_tag LOCUS_01390 gene moeB 163378 162566 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460729.1 protein_id gnl|my_center|LOCUS_01390 163586 163380 gene locus_tag LOCUS_01400 gene thiS 163586 163380 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945026.1 protein_id gnl|my_center|LOCUS_01400 163975 163658 gene locus_tag LOCUS_01410 gene trxA 163975 163658 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140882.1 protein_id gnl|my_center|LOCUS_01410 164221 163976 gene locus_tag LOCUS_01420 164221 163976 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816171.1 protein_id gnl|my_center|LOCUS_01420 165074 164214 gene locus_tag LOCUS_01430 165074 164214 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460728.1 protein_id gnl|my_center|LOCUS_01430 166370 165075 gene locus_tag LOCUS_01440 166370 165075 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963429.1 protein_id gnl|my_center|LOCUS_01440 167073 166624 gene locus_tag LOCUS_01450 167073 166624 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356138.1 protein_id gnl|my_center|LOCUS_01450 168075 167143 gene locus_tag LOCUS_01460 gene cysK 168075 167143 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_01460 169188 168130 gene locus_tag LOCUS_01470 169188 168130 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057527.1 protein_id gnl|my_center|LOCUS_01470 170009 169188 gene locus_tag LOCUS_01480 gene cysW 170009 169188 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 protein_id gnl|my_center|LOCUS_01480 170844 170011 gene locus_tag LOCUS_01490 gene cysT 170844 170011 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227884.1 protein_id gnl|my_center|LOCUS_01490 171861 170854 gene locus_tag LOCUS_01500 171861 170854 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 protein_id gnl|my_center|LOCUS_01500 172176 173732 gene locus_tag LOCUS_01510 172176 173732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 173753 175228 gene locus_tag LOCUS_01520 gene spoIVA 173753 175228 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_01520 175847 175335 gene locus_tag LOCUS_01530 175847 175335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 176837 175854 gene locus_tag LOCUS_01540 176837 175854 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_01540 178287 176839 gene locus_tag LOCUS_01550 gene sacA 178287 176839 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886636.1 protein_id gnl|my_center|LOCUS_01550 179718 178303 gene locus_tag LOCUS_01560 179718 178303 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166879.1 protein_id gnl|my_center|LOCUS_01560 181000 179996 gene locus_tag LOCUS_01570 181000 179996 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356351.1 protein_id gnl|my_center|LOCUS_01570 181882 181304 gene locus_tag LOCUS_01580 181882 181304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 182193 181879 gene locus_tag LOCUS_01590 182193 181879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 183470 182883 gene locus_tag LOCUS_01600 183470 182883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 183625 183470 gene locus_tag LOCUS_01610 183625 183470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 184104 183841 gene locus_tag LOCUS_01620 184104 183841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 186295 184244 gene locus_tag LOCUS_01630 gene fusA 186295 184244 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_01630 186622 186774 gene locus_tag LOCUS_01640 186622 186774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 186848 188167 gene locus_tag LOCUS_01650 186848 188167 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_01650 188390 190180 gene locus_tag LOCUS_01660 188390 190180 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_01660 191562 190207 gene locus_tag LOCUS_01670 191562 190207 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_01670 192080 191610 gene locus_tag LOCUS_01680 192080 191610 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262715.1 protein_id gnl|my_center|LOCUS_01680 192585 192133 gene locus_tag LOCUS_01690 192585 192133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 193962 192619 gene locus_tag LOCUS_01700 193962 192619 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_01700 194423 193962 gene locus_tag LOCUS_01710 194423 193962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 195850 194573 gene locus_tag LOCUS_01720 195850 194573 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_01720 198515 195900 gene locus_tag LOCUS_01730 198515 195900 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048157.1 protein_id gnl|my_center|LOCUS_01730 199102 199572 gene locus_tag LOCUS_01740 gene greA 199102 199572 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_01740 199600 201225 gene locus_tag LOCUS_01750 gene lysS 199600 201225 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048371.1 protein_id gnl|my_center|LOCUS_01750 201328 202332 gene locus_tag LOCUS_01760 201328 202332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 202335 203165 gene locus_tag LOCUS_01770 202335 203165 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_01770 203322 204341 gene locus_tag LOCUS_01780 gene galE 203322 204341 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775237.1 protein_id gnl|my_center|LOCUS_01780 204840 204481 gene locus_tag LOCUS_01790 204840 204481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 206054 204861 gene locus_tag LOCUS_01800 gene coaBC 206054 204861 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_01800 206450 206067 gene locus_tag LOCUS_01810 206450 206067 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287876.1 protein_id gnl|my_center|LOCUS_01810 207307 206447 gene locus_tag LOCUS_01820 gene panC 207307 206447 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287875.1 protein_id gnl|my_center|LOCUS_01820 208146 207304 gene locus_tag LOCUS_01830 gene panB 208146 207304 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_01830 208467 210218 gene locus_tag LOCUS_01840 208467 210218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 210262 210990 gene locus_tag LOCUS_01850 210262 210990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 211213 211122 gene locus_tag LOCUS_t00080 211213 211122 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 211326 211244 gene locus_tag LOCUS_t00090 211326 211244 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 213308 211554 gene locus_tag LOCUS_01860 213308 211554 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107752.1 protein_id gnl|my_center|LOCUS_01860 213720 213319 gene locus_tag LOCUS_01870 213720 213319 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 protein_id gnl|my_center|LOCUS_01870 214203 213859 gene locus_tag LOCUS_01880 214203 213859 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390711.1 protein_id gnl|my_center|LOCUS_01880 214967 214218 gene locus_tag LOCUS_01890 214967 214218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 215448 214951 gene locus_tag LOCUS_01900 215448 214951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 215898 215458 gene locus_tag LOCUS_01910 215898 215458 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722849.1 protein_id gnl|my_center|LOCUS_01910 216794 215895 gene locus_tag LOCUS_01920 216794 215895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 217707 216769 gene locus_tag LOCUS_01930 217707 216769 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812720.1 protein_id gnl|my_center|LOCUS_01930 244997 217893 gene locus_tag LOCUS_01940 244997 217893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 246626 245442 gene locus_tag LOCUS_01950 246626 245442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 247789 246632 gene locus_tag LOCUS_01960 247789 246632 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028649.1 protein_id gnl|my_center|LOCUS_01960 248032 248595 gene locus_tag LOCUS_01970 248032 248595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 249693 248659 gene locus_tag LOCUS_01980 249693 248659 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583040.1 protein_id gnl|my_center|LOCUS_01980 249889 250638 gene locus_tag LOCUS_01990 249889 250638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 251675 250752 gene locus_tag LOCUS_02000 251675 250752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02000 252092 251679 gene locus_tag LOCUS_02010 252092 251679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02010 252913 252284 gene locus_tag LOCUS_02020 252913 252284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 253515 252910 gene locus_tag LOCUS_02030 253515 252910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 254301 253675 gene locus_tag LOCUS_02040 254301 253675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 254957 254331 gene locus_tag LOCUS_02050 254957 254331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 255129 255566 gene locus_tag LOCUS_02060 255129 255566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 256311 255694 gene locus_tag LOCUS_02070 256311 255694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 256848 256360 gene locus_tag LOCUS_02080 256848 256360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 257027 257365 gene locus_tag LOCUS_02090 257027 257365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 257530 257824 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttcaatccagtctctccacacgga 257887 259161 gene locus_tag LOCUS_02100 257887 259161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 259168 259320 gene locus_tag LOCUS_02110 259168 259320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 259425 259571 gene locus_tag LOCUS_02120 259425 259571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 260038 260679 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccactccctccgtatggagggagac >Feature sequence02 313 225 gene locus_tag LOCUS_t00100 313 225 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 749 1291 gene locus_tag LOCUS_02130 749 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 2063 2752 gene locus_tag LOCUS_02140 2063 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 2757 3926 gene locus_tag LOCUS_02150 2757 3926 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_02150 3928 4308 gene locus_tag LOCUS_02160 3928 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 4532 7060 gene locus_tag LOCUS_02170 4532 7060 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964234.1 protein_id gnl|my_center|LOCUS_02170 7082 7591 gene locus_tag LOCUS_02180 7082 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 7714 9306 gene locus_tag LOCUS_02190 7714 9306 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_02190 9313 9849 gene locus_tag LOCUS_02200 9313 9849 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_02200 10123 9944 gene locus_tag LOCUS_02210 10123 9944 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_02210 10392 10478 gene locus_tag LOCUS_t00110 10392 10478 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10574 11080 gene locus_tag LOCUS_02220 10574 11080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 11328 12395 gene locus_tag LOCUS_02230 gene trpS 11328 12395 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_02230 12562 13119 gene locus_tag LOCUS_02240 12562 13119 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_02240 13382 13209 gene locus_tag LOCUS_02250 13382 13209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 13498 14010 gene locus_tag LOCUS_02260 13498 14010 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_02260 15133 14078 gene locus_tag LOCUS_02270 15133 14078 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_02270 16819 15218 gene locus_tag LOCUS_02280 16819 15218 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_02280 18072 16816 gene locus_tag LOCUS_02290 18072 16816 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_02290 19450 18080 gene locus_tag LOCUS_02300 19450 18080 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_02300 19744 19475 gene locus_tag LOCUS_02310 19744 19475 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721327.1 protein_id gnl|my_center|LOCUS_02310 20995 19790 gene locus_tag LOCUS_02320 20995 19790 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_02320 21894 21043 gene locus_tag LOCUS_02330 gene dapF 21894 21043 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_02330 21879 22094 gene locus_tag LOCUS_02340 21879 22094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 22167 22445 gene locus_tag LOCUS_02350 22167 22445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 22496 23950 gene locus_tag LOCUS_02360 gene gatA 22496 23950 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812377.1 protein_id gnl|my_center|LOCUS_02360 23969 26839 gene locus_tag LOCUS_02370 23969 26839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 26929 27609 gene locus_tag LOCUS_02380 26929 27609 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_02380 29050 27695 gene locus_tag LOCUS_02390 29050 27695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 30342 29047 gene locus_tag LOCUS_02400 30342 29047 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002486299.1 protein_id gnl|my_center|LOCUS_02400 30799 30335 gene locus_tag LOCUS_02410 30799 30335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 31084 31608 gene locus_tag LOCUS_02420 gene raiA 31084 31608 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671190.1 protein_id gnl|my_center|LOCUS_02420 32813 31680 gene locus_tag LOCUS_02430 gene tgt 32813 31680 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965580.1 protein_id gnl|my_center|LOCUS_02430 33881 32841 gene locus_tag LOCUS_02440 gene queA 33881 32841 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_02440 34216 35295 gene locus_tag LOCUS_02450 gene asd 34216 35295 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_02450 35345 36235 gene locus_tag LOCUS_02460 gene dapA 35345 36235 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_02460 36268 37023 gene locus_tag LOCUS_02470 gene dapB 36268 37023 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438808.1 protein_id gnl|my_center|LOCUS_02470 38024 37212 gene locus_tag LOCUS_02480 38024 37212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 38393 38704 gene locus_tag LOCUS_02490 38393 38704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 38807 40966 gene locus_tag LOCUS_02500 gene nrdD 38807 40966 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095357.1 protein_id gnl|my_center|LOCUS_02500 40984 41496 gene locus_tag LOCUS_02510 40984 41496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 42689 41607 gene locus_tag LOCUS_02520 42689 41607 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_02520 43357 42821 gene locus_tag LOCUS_02530 43357 42821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 43600 46032 gene locus_tag LOCUS_02540 43600 46032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 48363 46102 gene locus_tag LOCUS_02550 gene metE 48363 46102 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864555.1 protein_id gnl|my_center|LOCUS_02550 49449 48544 gene locus_tag LOCUS_02560 49449 48544 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775137.1 protein_id gnl|my_center|LOCUS_02560 50645 49467 gene locus_tag LOCUS_02570 50645 49467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 51260 50700 gene locus_tag LOCUS_02580 51260 50700 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_02580 51493 51260 gene locus_tag LOCUS_02590 51493 51260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 52968 51670 gene locus_tag LOCUS_02600 gene lysA 52968 51670 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_02600 53655 53056 gene locus_tag LOCUS_02610 gene yihA 53655 53056 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796925.1 protein_id gnl|my_center|LOCUS_02610 56114 53673 gene locus_tag LOCUS_02620 gene lon 56114 53673 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_02620 56577 57410 gene locus_tag LOCUS_02630 gene speD 56577 57410 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101641.1 protein_id gnl|my_center|LOCUS_02630 57425 58873 gene locus_tag LOCUS_02640 57425 58873 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808143.1 protein_id gnl|my_center|LOCUS_02640 58921 59241 gene locus_tag LOCUS_02650 58921 59241 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004612621.1 protein_id gnl|my_center|LOCUS_02650 59272 60102 gene locus_tag LOCUS_02660 59272 60102 CDS product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244223.1 protein_id gnl|my_center|LOCUS_02660 60172 60648 gene locus_tag LOCUS_02670 60172 60648 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_02670 60679 61542 gene locus_tag LOCUS_02680 gene speE 60679 61542 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_02680 61552 62430 gene locus_tag LOCUS_02690 61552 62430 CDS product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799764.1 protein_id gnl|my_center|LOCUS_02690 62471 63673 gene locus_tag LOCUS_02700 62471 63673 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461406.1 protein_id gnl|my_center|LOCUS_02700 63686 64045 gene locus_tag LOCUS_02710 63686 64045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 64183 65334 gene locus_tag LOCUS_02720 gene nspC 64183 65334 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_02720 65331 66215 gene locus_tag LOCUS_02730 65331 66215 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542436.1 protein_id gnl|my_center|LOCUS_02730 66696 66334 gene locus_tag LOCUS_02740 66696 66334 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461711.1 protein_id gnl|my_center|LOCUS_02740 67958 66714 gene locus_tag LOCUS_02750 67958 66714 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262686.1 protein_id gnl|my_center|LOCUS_02750 68545 68820 gene locus_tag LOCUS_02760 68545 68820 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_02760 68841 69137 gene locus_tag LOCUS_02770 68841 69137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 70168 69269 gene locus_tag LOCUS_02780 70168 69269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 70415 71170 gene locus_tag LOCUS_02790 70415 71170 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048245.1 protein_id gnl|my_center|LOCUS_02790 71224 72666 gene locus_tag LOCUS_02800 71224 72666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 75381 72781 gene locus_tag LOCUS_02810 gene clpB 75381 72781 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_02810 76091 75435 gene locus_tag LOCUS_02820 76091 75435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 77015 76269 gene locus_tag LOCUS_02830 77015 76269 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065331.1 protein_id gnl|my_center|LOCUS_02830 77802 77008 gene locus_tag LOCUS_02840 77802 77008 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_02840 78026 78259 gene locus_tag LOCUS_02850 78026 78259 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986552.1 protein_id gnl|my_center|LOCUS_02850 78546 80303 gene locus_tag LOCUS_02860 gene iorA 78546 80303 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_02860 80303 80902 gene locus_tag LOCUS_02870 80303 80902 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_02870 80908 82542 gene locus_tag LOCUS_02880 80908 82542 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_02880 82882 84564 gene locus_tag LOCUS_02890 82882 84564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 84694 85728 gene locus_tag LOCUS_02900 84694 85728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 85796 86257 gene locus_tag LOCUS_02910 85796 86257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 86396 86596 gene locus_tag LOCUS_02920 gene rpmE 86396 86596 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_02920 86688 87326 gene locus_tag LOCUS_02930 86688 87326 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_02930 87454 88443 gene locus_tag LOCUS_02940 87454 88443 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_02940 88459 90195 gene locus_tag LOCUS_02950 gene dnaG 88459 90195 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896376.1 protein_id gnl|my_center|LOCUS_02950 90215 91294 gene locus_tag LOCUS_02960 gene rpoD 90215 91294 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_02960 91360 91671 gene locus_tag LOCUS_02970 91360 91671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 91675 91932 gene locus_tag LOCUS_02980 91675 91932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 92726 91947 gene locus_tag LOCUS_02990 92726 91947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 92849 93157 gene locus_tag LOCUS_03000 92849 93157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 93369 93088 gene locus_tag LOCUS_03010 93369 93088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 94701 96497 gene locus_tag LOCUS_03020 94701 96497 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964230.1 protein_id gnl|my_center|LOCUS_03020 96510 96989 gene locus_tag LOCUS_03030 96510 96989 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_03030 97262 98005 gene locus_tag LOCUS_03040 gene trmB 97262 98005 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965915.1 protein_id gnl|my_center|LOCUS_03040 97983 101096 gene locus_tag LOCUS_03050 97983 101096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 101062 102477 gene locus_tag LOCUS_03060 101062 102477 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_03060 103894 102524 gene locus_tag LOCUS_03070 103894 102524 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_03070 104171 105958 gene locus_tag LOCUS_03080 104171 105958 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783199.1 protein_id gnl|my_center|LOCUS_03080 107413 106016 gene locus_tag LOCUS_03090 107413 106016 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_03090 108255 107410 gene locus_tag LOCUS_03100 gene nudC 108255 107410 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102051.1 protein_id gnl|my_center|LOCUS_03100 108513 109868 gene locus_tag LOCUS_03110 108513 109868 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262172.1 protein_id gnl|my_center|LOCUS_03110 111305 109935 gene locus_tag LOCUS_03120 111305 109935 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_03120 111476 112342 gene locus_tag LOCUS_03130 111476 112342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 112512 113723 gene locus_tag LOCUS_03140 112512 113723 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_03140 115382 113865 gene locus_tag LOCUS_03150 gene gpmI 115382 113865 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_03150 116250 115483 gene locus_tag LOCUS_03160 gene tpiA 116250 115483 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_03160 116479 116270 gene locus_tag LOCUS_03170 116479 116270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 117768 116554 gene locus_tag LOCUS_03180 117768 116554 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_03180 120818 117990 gene locus_tag LOCUS_03190 gene uvrA 120818 117990 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_03190 122786 120822 gene locus_tag LOCUS_03200 gene uvrB 122786 120822 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_03200 123568 122798 gene locus_tag LOCUS_03210 gene radC 123568 122798 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328269.1 protein_id gnl|my_center|LOCUS_03210 123693 124691 gene locus_tag LOCUS_03220 123693 124691 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_03220 126207 124771 gene locus_tag LOCUS_03230 gene gatB 126207 124771 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966259.1 protein_id gnl|my_center|LOCUS_03230 127685 126225 gene locus_tag LOCUS_03240 gene gatA 127685 126225 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_03240 127970 127701 gene locus_tag LOCUS_03250 gene gatC 127970 127701 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929772.1 protein_id gnl|my_center|LOCUS_03250 130021 128030 gene locus_tag LOCUS_03260 gene ligA 130021 128030 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031442.1 protein_id gnl|my_center|LOCUS_03260 130808 130128 gene locus_tag LOCUS_03270 gene yunB 130808 130128 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393210.1 protein_id gnl|my_center|LOCUS_03270 131632 130865 gene locus_tag LOCUS_03280 131632 130865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 132523 131870 gene locus_tag LOCUS_03290 132523 131870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 132957 132613 gene locus_tag LOCUS_03300 gene hisI 132957 132613 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721356.1 protein_id gnl|my_center|LOCUS_03300 133303 132944 gene locus_tag LOCUS_03310 133303 132944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 134098 133343 gene locus_tag LOCUS_03320 gene hisF 134098 133343 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964259.1 protein_id gnl|my_center|LOCUS_03320 134830 134102 gene locus_tag LOCUS_03330 gene hisA 134830 134102 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603770.1 protein_id gnl|my_center|LOCUS_03330 135435 134827 gene locus_tag LOCUS_03340 gene hisH 135435 134827 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560341.1 protein_id gnl|my_center|LOCUS_03340 136018 135437 gene locus_tag LOCUS_03350 gene hisB 136018 135437 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837141.1 protein_id gnl|my_center|LOCUS_03350 137423 136116 gene locus_tag LOCUS_03360 gene hisD 137423 136116 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964255.1 protein_id gnl|my_center|LOCUS_03360 138054 137425 gene locus_tag LOCUS_03370 gene hisG 138054 137425 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964254.1 protein_id gnl|my_center|LOCUS_03370 139251 138055 gene locus_tag LOCUS_03380 139251 138055 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964253.1 protein_id gnl|my_center|LOCUS_03380 143669 139329 gene locus_tag LOCUS_03390 143669 139329 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_03390 144731 143694 gene locus_tag LOCUS_03400 gene ispG 144731 143694 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965103.1 protein_id gnl|my_center|LOCUS_03400 145811 144744 gene locus_tag LOCUS_03410 gene rseP 145811 144744 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_03410 146971 145826 gene locus_tag LOCUS_03420 146971 145826 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_03420 147897 147082 gene locus_tag LOCUS_03430 gene cdsA 147897 147082 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231924.1 protein_id gnl|my_center|LOCUS_03430 148667 147900 gene locus_tag LOCUS_03440 148667 147900 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_03440 149238 148717 gene locus_tag LOCUS_03450 gene frr 149238 148717 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985763.1 protein_id gnl|my_center|LOCUS_03450 150063 149332 gene locus_tag LOCUS_03460 gene pyrH 150063 149332 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_03460 151222 150299 gene locus_tag LOCUS_03470 gene tsf 151222 150299 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_03470 152071 151334 gene locus_tag LOCUS_03480 gene rpsB 152071 151334 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_03480 152517 152245 gene locus_tag LOCUS_03490 152517 152245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 153130 152564 gene locus_tag LOCUS_03500 153130 152564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 154177 153227 gene locus_tag LOCUS_03510 154177 153227 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_03510 155839 154181 gene locus_tag LOCUS_03520 155839 154181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 156767 155853 gene locus_tag LOCUS_03530 156767 155853 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_03530 157272 156760 gene locus_tag LOCUS_03540 gene lspA 157272 156760 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965414.1 protein_id gnl|my_center|LOCUS_03540 160075 157295 gene locus_tag LOCUS_03550 gene ileS 160075 157295 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_03550 160789 160142 gene locus_tag LOCUS_03560 160789 160142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 161610 160840 gene locus_tag LOCUS_03570 161610 160840 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002164454.1 protein_id gnl|my_center|LOCUS_03570 162108 161623 gene locus_tag LOCUS_03580 162108 161623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 162913 162215 gene locus_tag LOCUS_03590 162913 162215 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_03590 164180 162903 gene locus_tag LOCUS_03600 164180 162903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 164464 164231 gene locus_tag LOCUS_03610 gene hfq 164464 164231 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358923.1 protein_id gnl|my_center|LOCUS_03610 165533 164571 gene locus_tag LOCUS_03620 gene miaA 165533 164571 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_03620 167528 165537 gene locus_tag LOCUS_03630 gene mutL 167528 165537 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516465.1 protein_id gnl|my_center|LOCUS_03630 170239 167615 gene locus_tag LOCUS_03640 gene mutS 170239 167615 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_03640 170688 170272 gene locus_tag LOCUS_03650 170688 170272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 172097 170685 gene locus_tag LOCUS_03660 gene miaB 172097 170685 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965143.1 protein_id gnl|my_center|LOCUS_03660 172550 173455 gene locus_tag LOCUS_03670 172550 173455 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868018.1 protein_id gnl|my_center|LOCUS_03670 176533 174614 gene locus_tag LOCUS_03680 176533 174614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 178005 176731 gene locus_tag LOCUS_03690 178005 176731 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_03690 178794 178009 gene locus_tag LOCUS_03700 178794 178009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 179828 178791 gene locus_tag LOCUS_03710 179828 178791 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811665.1 protein_id gnl|my_center|LOCUS_03710 180841 179822 gene locus_tag LOCUS_03720 180841 179822 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_03720 182235 180844 gene locus_tag LOCUS_03730 gene murD 182235 180844 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_03730 182964 182335 gene locus_tag LOCUS_03740 182964 182335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 183611 185884 gene locus_tag LOCUS_03750 183611 185884 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_03750 186439 185942 gene locus_tag LOCUS_03760 186439 185942 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_03760 187538 186510 gene locus_tag LOCUS_03770 187538 186510 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_03770 188961 187711 gene locus_tag LOCUS_03780 188961 187711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 189935 189072 gene locus_tag LOCUS_03790 189935 189072 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_03790 191098 189932 gene locus_tag LOCUS_03800 191098 189932 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_03800 192490 191114 gene locus_tag LOCUS_03810 192490 191114 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_03810 193126 192542 gene locus_tag LOCUS_03820 gene rnmV 193126 192542 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832196.1 protein_id gnl|my_center|LOCUS_03820 194174 193095 gene locus_tag LOCUS_03830 194174 193095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 196272 194209 gene locus_tag LOCUS_03840 196272 194209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 196828 196286 gene locus_tag LOCUS_03850 196828 196286 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_03850 197204 196842 gene locus_tag LOCUS_03860 197204 196842 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047999.1 protein_id gnl|my_center|LOCUS_03860 199852 197207 gene locus_tag LOCUS_03870 gene alaS 199852 197207 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_03870 201448 200297 gene locus_tag LOCUS_03880 201448 200297 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_03880 202078 201545 gene locus_tag LOCUS_03890 202078 201545 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250651.1 protein_id gnl|my_center|LOCUS_03890 202557 203498 gene locus_tag LOCUS_03900 202557 203498 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_03900 203504 204619 gene locus_tag LOCUS_03910 203504 204619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 204616 207273 gene locus_tag LOCUS_03920 204616 207273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 207294 207923 gene locus_tag LOCUS_03930 207294 207923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 207939 208715 gene locus_tag LOCUS_03940 207939 208715 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785236.1 protein_id gnl|my_center|LOCUS_03940 208912 209112 gene locus_tag LOCUS_03950 gene thiS 208912 209112 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_03950 209132 209911 gene locus_tag LOCUS_03960 209132 209911 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 protein_id gnl|my_center|LOCUS_03960 209924 211090 gene locus_tag LOCUS_03970 gene thiH 209924 211090 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_03970 211087 211677 gene locus_tag LOCUS_03980 211087 211677 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015812.1 protein_id gnl|my_center|LOCUS_03980 211674 212363 gene locus_tag LOCUS_03990 211674 212363 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_03990 213744 212437 gene locus_tag LOCUS_04000 gene clpX 213744 212437 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_04000 214347 213757 gene locus_tag LOCUS_04010 gene clpP 214347 213757 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_04010 215785 214463 gene locus_tag LOCUS_04020 gene tig 215785 214463 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_04020 216637 215948 gene locus_tag LOCUS_04030 216637 215948 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_04030 218148 216649 gene locus_tag LOCUS_04040 gene thrC 218148 216649 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_04040 218507 218181 gene locus_tag LOCUS_04050 218507 218181 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938134.1 protein_id gnl|my_center|LOCUS_04050 219195 218545 gene locus_tag LOCUS_04060 gene rnhB 219195 218545 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_04060 220081 219188 gene locus_tag LOCUS_04070 gene ylqF 220081 219188 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965068.1 protein_id gnl|my_center|LOCUS_04070 220741 220106 gene locus_tag LOCUS_04080 gene lepB 220741 220106 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_04080 221254 220910 gene locus_tag LOCUS_04090 gene rplS 221254 220910 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965066.1 protein_id gnl|my_center|LOCUS_04090 222201 221542 gene locus_tag LOCUS_04100 222201 221542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 224048 222198 gene locus_tag LOCUS_04110 224048 222198 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099491.1 protein_id gnl|my_center|LOCUS_04110 224825 224160 gene locus_tag LOCUS_04120 gene sigF 224825 224160 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 protein_id gnl|my_center|LOCUS_04120 225256 224810 gene locus_tag LOCUS_04130 gene spoIIAB 225256 224810 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230452.1 protein_id gnl|my_center|LOCUS_04130 225612 225253 gene locus_tag LOCUS_04140 225612 225253 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393007.1 protein_id gnl|my_center|LOCUS_04140 226548 225742 gene locus_tag LOCUS_04150 226548 225742 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256722.1 protein_id gnl|my_center|LOCUS_04150 226891 227445 gene locus_tag LOCUS_04160 226891 227445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 227940 227512 gene locus_tag LOCUS_04170 227940 227512 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339434.1 protein_id gnl|my_center|LOCUS_04170 228752 227937 gene locus_tag LOCUS_04180 228752 227937 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_04180 229441 228749 gene locus_tag LOCUS_04190 229441 228749 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892101.1 protein_id gnl|my_center|LOCUS_04190 230616 229438 gene locus_tag LOCUS_04200 230616 229438 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435857.1 protein_id gnl|my_center|LOCUS_04200 231465 230632 gene locus_tag LOCUS_04210 231465 230632 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435860.1 protein_id gnl|my_center|LOCUS_04210 232300 231455 gene locus_tag LOCUS_04220 232300 231455 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435861.1 protein_id gnl|my_center|LOCUS_04220 233360 232287 gene locus_tag LOCUS_04230 233360 232287 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861993.1 protein_id gnl|my_center|LOCUS_04230 233935 233348 gene locus_tag LOCUS_04240 gene phnH 233935 233348 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965300.1 protein_id gnl|my_center|LOCUS_04240 234357 233932 gene locus_tag LOCUS_04250 234357 233932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 235263 234403 gene locus_tag LOCUS_04260 235263 234403 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258839.1 protein_id gnl|my_center|LOCUS_04260 236057 235263 gene locus_tag LOCUS_04270 gene phnE 236057 235263 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258840.1 protein_id gnl|my_center|LOCUS_04270 236836 236054 gene locus_tag LOCUS_04280 gene phnC 236836 236054 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258841.1 protein_id gnl|my_center|LOCUS_04280 237932 236856 gene locus_tag LOCUS_04290 237932 236856 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258842.1 protein_id gnl|my_center|LOCUS_04290 238619 238206 gene locus_tag LOCUS_04300 238619 238206 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_04300 >Feature sequence03 108 1352 gene locus_tag LOCUS_04310 108 1352 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_04310 1379 2290 gene locus_tag LOCUS_04320 1379 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 2312 2971 gene locus_tag LOCUS_04330 2312 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 2968 3741 gene locus_tag LOCUS_04340 2968 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 3814 4272 gene locus_tag LOCUS_04350 3814 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 4285 4578 gene locus_tag LOCUS_04360 4285 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 4634 5239 gene locus_tag LOCUS_04370 4634 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 5270 6946 gene locus_tag LOCUS_04380 5270 6946 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460315.1 protein_id gnl|my_center|LOCUS_04380 6971 8020 gene locus_tag LOCUS_04390 6971 8020 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_04390 8546 11881 gene locus_tag LOCUS_04400 8546 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 12731 11946 gene locus_tag LOCUS_04410 12731 11946 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546828.1 protein_id gnl|my_center|LOCUS_04410 12948 13529 gene locus_tag LOCUS_04420 gene eutD 12948 13529 CDS product ethanolamine utilization phosphate acetyltransferase EutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721580.1 protein_id gnl|my_center|LOCUS_04420 13624 15756 gene locus_tag LOCUS_04430 13624 15756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 15942 16556 gene locus_tag LOCUS_04440 15942 16556 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_04440 16747 17424 gene locus_tag LOCUS_04450 16747 17424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 17500 18723 gene locus_tag LOCUS_04460 17500 18723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 18910 19236 gene locus_tag LOCUS_04470 18910 19236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 19236 20312 gene locus_tag LOCUS_04480 gene hemW 19236 20312 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_04480 20375 20977 gene locus_tag LOCUS_04490 gene spoIIR 20375 20977 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947973.1 protein_id gnl|my_center|LOCUS_04490 21349 21780 gene locus_tag LOCUS_04500 gene infC 21349 21780 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973215.1 protein_id gnl|my_center|LOCUS_04500 21797 22000 gene locus_tag LOCUS_04510 gene rpmI 21797 22000 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869473.1 protein_id gnl|my_center|LOCUS_04510 22055 22408 gene locus_tag LOCUS_04520 gene rplT 22055 22408 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037598.1 protein_id gnl|my_center|LOCUS_04520 22556 23377 gene locus_tag LOCUS_04530 22556 23377 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158483.1 protein_id gnl|my_center|LOCUS_04530 23379 24623 gene locus_tag LOCUS_04540 gene dprA 23379 24623 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_04540 24745 26835 gene locus_tag LOCUS_04550 gene topA 24745 26835 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_04550 26836 28146 gene locus_tag LOCUS_04560 gene trmFO 26836 28146 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475886.1 protein_id gnl|my_center|LOCUS_04560 28167 29165 gene locus_tag LOCUS_04570 gene plsX 28167 29165 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684092.1 protein_id gnl|my_center|LOCUS_04570 29179 29892 gene locus_tag LOCUS_04580 gene rnc 29179 29892 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_04580 29879 30910 gene locus_tag LOCUS_04590 29879 30910 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942867.1 protein_id gnl|my_center|LOCUS_04590 30919 31560 gene locus_tag LOCUS_04600 30919 31560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 31588 35139 gene locus_tag LOCUS_04610 gene smc 31588 35139 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478987.1 protein_id gnl|my_center|LOCUS_04610 35156 36700 gene locus_tag LOCUS_04620 35156 36700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 36703 37287 gene locus_tag LOCUS_04630 36703 37287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 37303 37590 gene locus_tag LOCUS_04640 gene yhbY 37303 37590 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955224.1 protein_id gnl|my_center|LOCUS_04640 37590 38189 gene locus_tag LOCUS_04650 gene nadD 37590 38189 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223158.1 protein_id gnl|my_center|LOCUS_04650 38457 39041 gene locus_tag LOCUS_04660 gene yqeK 38457 39041 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_04660 39045 40289 gene locus_tag LOCUS_04670 39045 40289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 40337 40699 gene locus_tag LOCUS_04680 gene rsfS 40337 40699 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475792.1 protein_id gnl|my_center|LOCUS_04680 41000 41326 gene locus_tag LOCUS_04690 41000 41326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 41439 42077 gene locus_tag LOCUS_04700 41439 42077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 42104 44518 gene locus_tag LOCUS_04710 gene leuS 42104 44518 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830785.1 protein_id gnl|my_center|LOCUS_04710 44730 44903 gene locus_tag LOCUS_04720 44730 44903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 45057 45551 gene locus_tag LOCUS_04730 45057 45551 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888598.1 protein_id gnl|my_center|LOCUS_04730 45566 45997 gene locus_tag LOCUS_04740 gene aroQ 45566 45997 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757082.1 protein_id gnl|my_center|LOCUS_04740 46013 47089 gene locus_tag LOCUS_04750 46013 47089 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722481.1 protein_id gnl|my_center|LOCUS_04750 47320 47877 gene locus_tag LOCUS_04760 gene efp 47320 47877 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_04760 47959 48450 gene locus_tag LOCUS_04770 47959 48450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 48612 49442 gene locus_tag LOCUS_04780 48612 49442 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932161.1 protein_id gnl|my_center|LOCUS_04780 49445 50845 gene locus_tag LOCUS_04790 gene gltA 49445 50845 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_04790 50887 51390 gene locus_tag LOCUS_04800 50887 51390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 51684 52091 gene locus_tag LOCUS_04810 51684 52091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 52206 52343 gene locus_tag LOCUS_04820 gene scfA 52206 52343 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_04820 52472 53860 gene locus_tag LOCUS_04830 gene scfB 52472 53860 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_04830 54728 53946 gene locus_tag LOCUS_04840 54728 53946 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_04840 55256 54795 gene locus_tag LOCUS_04850 gene ribE 55256 54795 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454467.1 protein_id gnl|my_center|LOCUS_04850 56493 55291 gene locus_tag LOCUS_04860 56493 55291 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905673.1 protein_id gnl|my_center|LOCUS_04860 57189 56554 gene locus_tag LOCUS_04870 57189 56554 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459819.1 protein_id gnl|my_center|LOCUS_04870 58352 57189 gene locus_tag LOCUS_04880 gene ribD 58352 57189 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905672.1 protein_id gnl|my_center|LOCUS_04880 58749 59435 gene locus_tag LOCUS_04890 58749 59435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 59666 60649 gene locus_tag LOCUS_04900 59666 60649 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_04900 60662 62509 gene locus_tag LOCUS_04910 60662 62509 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281991.1 protein_id gnl|my_center|LOCUS_04910 62843 63499 gene locus_tag LOCUS_04920 62843 63499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_04920 63738 63944 gene locus_tag LOCUS_04930 63738 63944 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357528.1 protein_id gnl|my_center|LOCUS_04930 63962 65023 gene locus_tag LOCUS_04940 63962 65023 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 protein_id gnl|my_center|LOCUS_04940 65023 65781 gene locus_tag LOCUS_04950 65023 65781 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_04950 65778 66314 gene locus_tag LOCUS_04960 65778 66314 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420711.1 protein_id gnl|my_center|LOCUS_04960 68220 66400 gene locus_tag LOCUS_04970 68220 66400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 69915 68407 gene locus_tag LOCUS_04980 69915 68407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 71129 70089 gene locus_tag LOCUS_04990 71129 70089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 71815 71267 gene locus_tag LOCUS_05000 71815 71267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 72851 71826 gene locus_tag LOCUS_05010 72851 71826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 74199 72856 gene locus_tag LOCUS_05020 gene pepV 74199 72856 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459801.1 protein_id gnl|my_center|LOCUS_05020 75246 74260 gene locus_tag LOCUS_05030 75246 74260 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107870.1 protein_id gnl|my_center|LOCUS_05030 75831 75259 gene locus_tag LOCUS_05040 75831 75259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 76425 77372 gene locus_tag LOCUS_05050 76425 77372 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_05050 79433 77796 gene locus_tag LOCUS_05060 79433 77796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 80835 79474 gene locus_tag LOCUS_05070 80835 79474 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_05070 81148 81564 gene locus_tag LOCUS_05080 81148 81564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 82744 81461 gene locus_tag LOCUS_05090 82744 81461 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_05090 84004 82748 gene locus_tag LOCUS_05100 84004 82748 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_05100 84793 84065 gene locus_tag LOCUS_05110 84793 84065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 85548 85171 gene locus_tag LOCUS_05120 85548 85171 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707699.1 protein_id gnl|my_center|LOCUS_05120 86993 85797 gene locus_tag LOCUS_05130 gene ilvA 86993 85797 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890721.1 protein_id gnl|my_center|LOCUS_05130 88249 87062 gene locus_tag LOCUS_05140 88249 87062 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393799.1 protein_id gnl|my_center|LOCUS_05140 89375 88290 gene locus_tag LOCUS_05150 gene leuB 89375 88290 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_05150 89814 90131 gene locus_tag LOCUS_05160 89814 90131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 90263 90454 gene locus_tag LOCUS_05170 90263 90454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 90586 91020 gene locus_tag LOCUS_05180 90586 91020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 91602 91108 gene locus_tag LOCUS_05190 gene leuD 91602 91108 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_05190 92867 91605 gene locus_tag LOCUS_05200 gene leuC 92867 91605 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_05200 94565 92898 gene locus_tag LOCUS_05210 gene ilvD 94565 92898 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966447.1 protein_id gnl|my_center|LOCUS_05210 95789 94755 gene locus_tag LOCUS_05220 gene ilvC 95789 94755 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_05220 96409 95903 gene locus_tag LOCUS_05230 gene ilvN 96409 95903 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496411.1 protein_id gnl|my_center|LOCUS_05230 98097 96424 gene locus_tag LOCUS_05240 gene ilvB 98097 96424 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_05240 98443 98288 gene locus_tag LOCUS_05250 98443 98288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 99086 100759 gene locus_tag LOCUS_05260 99086 100759 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_05260 101563 100889 gene locus_tag LOCUS_05270 101563 100889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 102130 101579 gene locus_tag LOCUS_05280 102130 101579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 102933 103364 gene locus_tag LOCUS_05290 102933 103364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 103371 104099 gene locus_tag LOCUS_05300 103371 104099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 105478 104864 gene locus_tag LOCUS_05310 105478 104864 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 protein_id gnl|my_center|LOCUS_05310 105809 108499 gene locus_tag LOCUS_05320 105809 108499 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774941.1 protein_id gnl|my_center|LOCUS_05320 110591 109002 gene locus_tag LOCUS_05330 110591 109002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 110829 113441 gene locus_tag LOCUS_05340 110829 113441 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392406.1 protein_id gnl|my_center|LOCUS_05340 113882 115297 gene locus_tag LOCUS_05350 gene mgtE 113882 115297 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829287.1 protein_id gnl|my_center|LOCUS_05350 115518 118019 gene locus_tag LOCUS_05360 115518 118019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 118036 119016 gene locus_tag LOCUS_05370 118036 119016 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_05370 119087 120082 gene locus_tag LOCUS_05380 119087 120082 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363756.1 protein_id gnl|my_center|LOCUS_05380 120371 120234 gene locus_tag LOCUS_05390 120371 120234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 120786 120649 gene locus_tag LOCUS_05400 120786 120649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 122451 120982 gene locus_tag LOCUS_05410 122451 120982 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987111.1 protein_id gnl|my_center|LOCUS_05410 123637 122543 gene locus_tag LOCUS_05420 gene ychF 123637 122543 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_05420 124097 126253 gene locus_tag LOCUS_05430 124097 126253 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 protein_id gnl|my_center|LOCUS_05430 126264 127469 gene locus_tag LOCUS_05440 126264 127469 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845922.1 protein_id gnl|my_center|LOCUS_05440 128015 132316 gene locus_tag LOCUS_05450 128015 132316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 132669 133958 gene locus_tag LOCUS_05460 gene galK 132669 133958 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210748.1 protein_id gnl|my_center|LOCUS_05460 134003 135013 gene locus_tag LOCUS_05470 gene galE 134003 135013 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996539.1 protein_id gnl|my_center|LOCUS_05470 135065 135601 gene locus_tag LOCUS_05480 135065 135601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 137522 135684 gene locus_tag LOCUS_05490 137522 135684 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898068.1 protein_id gnl|my_center|LOCUS_05490 138224 141865 gene locus_tag LOCUS_05500 138224 141865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 142200 143381 gene locus_tag LOCUS_05510 142200 143381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 145116 143479 gene locus_tag LOCUS_05520 145116 143479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 146402 145185 gene locus_tag LOCUS_05530 146402 145185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 147091 146405 gene locus_tag LOCUS_05540 147091 146405 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_05540 147863 147093 gene locus_tag LOCUS_05550 gene udp 147863 147093 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_05550 148222 148596 gene locus_tag LOCUS_05560 148222 148596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 149637 148588 gene locus_tag LOCUS_05570 149637 148588 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_05570 149939 150856 gene locus_tag LOCUS_05580 149939 150856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 151386 151559 gene locus_tag LOCUS_05590 151386 151559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 151561 153882 gene locus_tag LOCUS_05600 151561 153882 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_05600 154097 155668 gene locus_tag LOCUS_05610 154097 155668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 155880 156101 gene locus_tag LOCUS_05620 155880 156101 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903516.1 protein_id gnl|my_center|LOCUS_05620 156316 158178 gene locus_tag LOCUS_05630 156316 158178 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 protein_id gnl|my_center|LOCUS_05630 158405 160078 gene locus_tag LOCUS_05640 158405 160078 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_05640 160253 161002 gene locus_tag LOCUS_05650 160253 161002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 161024 162001 gene locus_tag LOCUS_05660 161024 162001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 163095 162064 gene locus_tag LOCUS_05670 163095 162064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 163229 164263 gene locus_tag LOCUS_05680 gene hydE 163229 164263 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_05680 164515 165663 gene locus_tag LOCUS_05690 164515 165663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 165684 166166 gene locus_tag LOCUS_05700 gene mscL 165684 166166 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147388001.1 protein_id gnl|my_center|LOCUS_05700 166389 166264 gene locus_tag LOCUS_05710 166389 166264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 166735 166559 gene locus_tag LOCUS_05720 166735 166559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 169281 166774 gene locus_tag LOCUS_05730 169281 166774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 169634 169413 gene locus_tag LOCUS_05740 169634 169413 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_05740 169863 169651 gene locus_tag LOCUS_05750 169863 169651 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_05750 170523 170599 gene locus_tag LOCUS_t00120 170523 170599 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 172234 171092 gene locus_tag LOCUS_05760 172234 171092 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861441.1 protein_id gnl|my_center|LOCUS_05760 172606 172304 gene locus_tag LOCUS_05770 172606 172304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 172923 172606 gene locus_tag LOCUS_05780 172923 172606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 173188 173060 gene locus_tag LOCUS_05790 173188 173060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 174163 173198 gene locus_tag LOCUS_05800 174163 173198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 175256 174165 gene locus_tag LOCUS_05810 175256 174165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 175486 176196 gene locus_tag LOCUS_05820 175486 176196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 178277 176301 gene locus_tag LOCUS_05830 178277 176301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 178652 178296 gene locus_tag LOCUS_05840 178652 178296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 180121 178658 gene locus_tag LOCUS_05850 180121 178658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 180973 180125 gene locus_tag LOCUS_05860 180973 180125 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001388628.1 protein_id gnl|my_center|LOCUS_05860 182273 180993 gene locus_tag LOCUS_05870 182273 180993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 184826 182292 gene locus_tag LOCUS_05880 184826 182292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 184979 185254 gene locus_tag LOCUS_05890 184979 185254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 186504 185512 gene locus_tag LOCUS_05900 186504 185512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 186606 187832 gene locus_tag LOCUS_05910 186606 187832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 188936 188043 gene locus_tag LOCUS_05920 188936 188043 CDS product IS5-like element ISVch5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019370.1 protein_id gnl|my_center|LOCUS_05920 189130 189303 gene locus_tag LOCUS_05930 189130 189303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 189410 189658 gene locus_tag LOCUS_05940 189410 189658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 189612 190670 gene locus_tag LOCUS_05950 189612 190670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 190725 191219 gene locus_tag LOCUS_05960 190725 191219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 191461 191622 gene locus_tag LOCUS_05970 191461 191622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 191667 192176 gene locus_tag LOCUS_05980 191667 192176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 192431 193246 gene locus_tag LOCUS_05990 192431 193246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477844.1 protein_id gnl|my_center|LOCUS_05990 193263 194288 gene locus_tag LOCUS_06000 193263 194288 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476131.1 protein_id gnl|my_center|LOCUS_06000 194337 194951 gene locus_tag LOCUS_06010 194337 194951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 194966 195961 gene locus_tag LOCUS_06020 194966 195961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 196019 196774 gene locus_tag LOCUS_06030 196019 196774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 197015 197659 gene locus_tag LOCUS_06040 197015 197659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205180329.1 protein_id gnl|my_center|LOCUS_06040 197672 198019 gene locus_tag LOCUS_06050 197672 198019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 198022 198465 gene locus_tag LOCUS_06060 198022 198465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 199957 198515 gene locus_tag LOCUS_06070 199957 198515 CDS product phage/plasmid primase, P4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962558.1 protein_id gnl|my_center|LOCUS_06070 200119 200490 gene locus_tag LOCUS_06080 200119 200490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 200506 203754 gene locus_tag LOCUS_06090 200506 203754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 204112 205758 gene locus_tag LOCUS_06100 204112 205758 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144178156.1 protein_id gnl|my_center|LOCUS_06100 206027 205743 gene locus_tag LOCUS_06110 206027 205743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 206388 206239 gene locus_tag LOCUS_06120 206388 206239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 <207072 206420 gene locus_tag LOCUS_06130 <207072 206420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002208497.1:CoA-disulfide reductase >Feature sequence04 207 917 gene locus_tag LOCUS_06140 gene rgbR 207 917 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_06140 919 2238 gene locus_tag LOCUS_06150 919 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 2256 2531 gene locus_tag LOCUS_06160 2256 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 2716 4872 gene locus_tag LOCUS_06170 2716 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 5338 6135 gene locus_tag LOCUS_06180 5338 6135 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023395.1 protein_id gnl|my_center|LOCUS_06180 6293 6898 gene locus_tag LOCUS_06190 6293 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 7107 7964 gene locus_tag LOCUS_06200 7107 7964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 8001 8480 gene locus_tag LOCUS_06210 8001 8480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 8502 9161 gene locus_tag LOCUS_06220 8502 9161 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193328953.1 protein_id gnl|my_center|LOCUS_06220 9991 9254 gene locus_tag LOCUS_06230 9991 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 11098 10106 gene locus_tag LOCUS_06240 11098 10106 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945452.1 protein_id gnl|my_center|LOCUS_06240 13055 11262 gene locus_tag LOCUS_06250 13055 11262 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_06250 13828 13274 gene locus_tag LOCUS_06260 13828 13274 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_06260 14826 13849 gene locus_tag LOCUS_06270 gene bsh 14826 13849 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723950.1 protein_id gnl|my_center|LOCUS_06270 15943 14996 gene locus_tag LOCUS_06280 15943 14996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 16065 16301 gene locus_tag LOCUS_06290 16065 16301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 16298 18199 gene locus_tag LOCUS_06300 gene feoB 16298 18199 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903695.1 protein_id gnl|my_center|LOCUS_06300 19078 18752 gene locus_tag LOCUS_06310 19078 18752 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_06310 19352 20143 gene locus_tag LOCUS_06320 19352 20143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 20220 20840 gene locus_tag LOCUS_06330 20220 20840 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066132.1 protein_id gnl|my_center|LOCUS_06330 20855 21619 gene locus_tag LOCUS_06340 20855 21619 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_06340 21570 22433 gene locus_tag LOCUS_06350 21570 22433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_06350 22586 25456 gene locus_tag LOCUS_06360 22586 25456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 25807 27648 gene locus_tag LOCUS_06370 25807 27648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 29856 27739 gene locus_tag LOCUS_06380 29856 27739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 30253 36753 gene locus_tag LOCUS_06390 30253 36753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 37847 36837 gene locus_tag LOCUS_06400 37847 36837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 39022 37892 gene locus_tag LOCUS_06410 39022 37892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 40687 39251 gene locus_tag LOCUS_06420 40687 39251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 42189 40714 gene locus_tag LOCUS_06430 42189 40714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 42927 42196 gene locus_tag LOCUS_06440 42927 42196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 43986 42934 gene locus_tag LOCUS_06450 43986 42934 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_06450 44542 47538 gene locus_tag LOCUS_06460 44542 47538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 47727 48662 gene locus_tag LOCUS_06470 47727 48662 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811868.1 protein_id gnl|my_center|LOCUS_06470 48677 49279 gene locus_tag LOCUS_06480 gene gmk 48677 49279 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633187.1 protein_id gnl|my_center|LOCUS_06480 49276 49488 gene locus_tag LOCUS_06490 49276 49488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 49495 51945 gene locus_tag LOCUS_06500 gene priA 49495 51945 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_06500 51977 52447 gene locus_tag LOCUS_06510 gene def 51977 52447 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_06510 52444 53367 gene locus_tag LOCUS_06520 gene fmt 52444 53367 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_06520 53391 54101 gene locus_tag LOCUS_06530 53391 54101 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416253.1 protein_id gnl|my_center|LOCUS_06530 54098 55399 gene locus_tag LOCUS_06540 gene rsmB 54098 55399 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460525.1 protein_id gnl|my_center|LOCUS_06540 55438 56493 gene locus_tag LOCUS_06550 gene rlmN 55438 56493 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_06550 56653 57405 gene locus_tag LOCUS_06560 56653 57405 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648699.1 protein_id gnl|my_center|LOCUS_06560 57411 59531 gene locus_tag LOCUS_06570 gene pknB 57411 59531 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087065956.1 protein_id gnl|my_center|LOCUS_06570 59536 60429 gene locus_tag LOCUS_06580 gene rsgA 59536 60429 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113935.1 protein_id gnl|my_center|LOCUS_06580 60426 61043 gene locus_tag LOCUS_06590 60426 61043 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_06590 61073 61501 gene locus_tag LOCUS_06600 61073 61501 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476578.1 protein_id gnl|my_center|LOCUS_06600 61597 61851 gene locus_tag LOCUS_06610 61597 61851 CDS product CPCC family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877836.1 protein_id gnl|my_center|LOCUS_06610 61911 62078 gene locus_tag LOCUS_06620 61911 62078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 62106 62297 gene locus_tag LOCUS_06630 62106 62297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 62325 62762 gene locus_tag LOCUS_06640 62325 62762 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816860.1 protein_id gnl|my_center|LOCUS_06640 62904 63791 gene locus_tag LOCUS_06650 gene spoIIIAA 62904 63791 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438117.1 protein_id gnl|my_center|LOCUS_06650 63791 64291 gene locus_tag LOCUS_06660 63791 64291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 64303 64497 gene locus_tag LOCUS_06670 gene spoIIIAC 64303 64497 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358967.1 protein_id gnl|my_center|LOCUS_06670 64494 64886 gene locus_tag LOCUS_06680 64494 64886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 64883 66025 gene locus_tag LOCUS_06690 gene spoIIIAE 64883 66025 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358911.1 protein_id gnl|my_center|LOCUS_06690 66028 66489 gene locus_tag LOCUS_06700 66028 66489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 66470 67015 gene locus_tag LOCUS_06710 66470 67015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 67035 67700 gene locus_tag LOCUS_06720 67035 67700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 67944 68390 gene locus_tag LOCUS_06730 gene nusB 67944 68390 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977336.1 protein_id gnl|my_center|LOCUS_06730 68368 69324 gene locus_tag LOCUS_06740 68368 69324 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_06740 69312 70505 gene locus_tag LOCUS_06750 gene xseA 69312 70505 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_06750 70585 70797 gene locus_tag LOCUS_06760 70585 70797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 70781 71674 gene locus_tag LOCUS_06770 70781 71674 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_06770 71760 73643 gene locus_tag LOCUS_06780 gene dxs 71760 73643 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965377.1 protein_id gnl|my_center|LOCUS_06780 73630 74436 gene locus_tag LOCUS_06790 73630 74436 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_06790 74433 75305 gene locus_tag LOCUS_06800 74433 75305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 75314 75760 gene locus_tag LOCUS_06810 75314 75760 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_06810 75760 77463 gene locus_tag LOCUS_06820 gene recN 75760 77463 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_06820 77460 79310 gene locus_tag LOCUS_06830 gene recQ 77460 79310 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965975.1 protein_id gnl|my_center|LOCUS_06830 79446 80483 gene locus_tag LOCUS_06840 79446 80483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 80628 82214 gene locus_tag LOCUS_06850 80628 82214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 83154 82108 gene locus_tag LOCUS_06860 83154 82108 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681885.1 protein_id gnl|my_center|LOCUS_06860 83658 83167 gene locus_tag LOCUS_06870 gene ybaK 83658 83167 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_06870 84206 83664 gene locus_tag LOCUS_06880 84206 83664 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433028.1 protein_id gnl|my_center|LOCUS_06880 85801 84479 gene locus_tag LOCUS_06890 gene xylA 85801 84479 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082185.1 protein_id gnl|my_center|LOCUS_06890 86862 85915 gene locus_tag LOCUS_06900 86862 85915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 87329 88873 gene locus_tag LOCUS_06910 87329 88873 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_06910 89080 91173 gene locus_tag LOCUS_06920 89080 91173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 92039 91407 gene locus_tag LOCUS_06930 gene sigK 92039 91407 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_06930 92143 92376 gene locus_tag LOCUS_06940 92143 92376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 92276 92851 gene locus_tag LOCUS_06950 92276 92851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06950 92852 93439 gene locus_tag LOCUS_06960 92852 93439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06960 93454 94014 gene locus_tag LOCUS_06970 93454 94014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 94094 94645 gene locus_tag LOCUS_06980 94094 94645 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_06980 94649 94792 gene locus_tag LOCUS_06990 94649 94792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 94789 95382 gene locus_tag LOCUS_07000 94789 95382 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383106.1 protein_id gnl|my_center|LOCUS_07000 95406 96401 gene locus_tag LOCUS_07010 95406 96401 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287604.1 protein_id gnl|my_center|LOCUS_07010 96795 97574 gene locus_tag LOCUS_07020 96795 97574 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240183.1 protein_id gnl|my_center|LOCUS_07020 97591 98439 gene locus_tag LOCUS_07030 97591 98439 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339096.1 protein_id gnl|my_center|LOCUS_07030 98423 99232 gene locus_tag LOCUS_07040 98423 99232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 99300 100427 gene locus_tag LOCUS_07050 99300 100427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 100445 101800 gene locus_tag LOCUS_07060 gene hydA 100445 101800 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895004.1 protein_id gnl|my_center|LOCUS_07060 101840 103333 gene locus_tag LOCUS_07070 gene preA 101840 103333 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987091.1 protein_id gnl|my_center|LOCUS_07070 103340 104488 gene locus_tag LOCUS_07080 103340 104488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 104530 105858 gene locus_tag LOCUS_07090 104530 105858 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112315.1 protein_id gnl|my_center|LOCUS_07090 105876 106319 gene locus_tag LOCUS_07100 105876 106319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 106349 107611 gene locus_tag LOCUS_07110 106349 107611 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948355.1 protein_id gnl|my_center|LOCUS_07110 107674 108828 gene locus_tag LOCUS_07120 107674 108828 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158673.1 protein_id gnl|my_center|LOCUS_07120 109027 109707 gene locus_tag LOCUS_07130 109027 109707 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861403.1 protein_id gnl|my_center|LOCUS_07130 109694 112216 gene locus_tag LOCUS_07140 109694 112216 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814229.1 protein_id gnl|my_center|LOCUS_07140 112318 113001 gene locus_tag LOCUS_07150 112318 113001 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459494.1 protein_id gnl|my_center|LOCUS_07150 112998 114047 gene locus_tag LOCUS_07160 112998 114047 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897088.1 protein_id gnl|my_center|LOCUS_07160 115130 114057 gene locus_tag LOCUS_07170 115130 114057 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_07170 115506 116309 gene locus_tag LOCUS_07180 115506 116309 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206755.1 protein_id gnl|my_center|LOCUS_07180 116323 117093 gene locus_tag LOCUS_07190 116323 117093 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808828.1 protein_id gnl|my_center|LOCUS_07190 117109 118149 gene locus_tag LOCUS_07200 117109 118149 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728151.1 protein_id gnl|my_center|LOCUS_07200 118163 119446 gene locus_tag LOCUS_07210 118163 119446 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150981032.1 protein_id gnl|my_center|LOCUS_07210 119462 121480 gene locus_tag LOCUS_07220 119462 121480 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114166.1 protein_id gnl|my_center|LOCUS_07220 121604 121816 gene locus_tag LOCUS_07230 121604 121816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 121813 122865 gene locus_tag LOCUS_07240 121813 122865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 122984 123241 gene locus_tag LOCUS_07250 122984 123241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 123569 123213 gene locus_tag LOCUS_07260 123569 123213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 123842 124552 gene locus_tag LOCUS_07270 123842 124552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 124570 125286 gene locus_tag LOCUS_07280 124570 125286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 125300 125674 gene locus_tag LOCUS_07290 125300 125674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 125694 126290 gene locus_tag LOCUS_07300 125694 126290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 126495 127610 gene locus_tag LOCUS_07310 126495 127610 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882793.1 protein_id gnl|my_center|LOCUS_07310 128098 127685 gene locus_tag LOCUS_07320 128098 127685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 129573 128095 gene locus_tag LOCUS_07330 129573 128095 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_07330 130159 129584 gene locus_tag LOCUS_07340 130159 129584 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092482714.1 protein_id gnl|my_center|LOCUS_07340 130609 130178 gene locus_tag LOCUS_07350 130609 130178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 131116 130742 gene locus_tag LOCUS_07360 131116 130742 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459154.1 protein_id gnl|my_center|LOCUS_07360 131313 131708 gene locus_tag LOCUS_07370 131313 131708 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496452.1 protein_id gnl|my_center|LOCUS_07370 133051 131777 gene locus_tag LOCUS_07380 133051 131777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 133498 134343 gene locus_tag LOCUS_07390 gene licT 133498 134343 CDS product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 protein_id gnl|my_center|LOCUS_07390 134427 136592 gene locus_tag LOCUS_07400 gene ptsG 134427 136592 CDS product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473200.1 protein_id gnl|my_center|LOCUS_07400 136647 136904 gene locus_tag LOCUS_07410 136647 136904 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_07410 136940 137482 gene locus_tag LOCUS_07420 136940 137482 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250651.1 protein_id gnl|my_center|LOCUS_07420 137498 139132 gene locus_tag LOCUS_07430 gene ptsP 137498 139132 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_07430 139264 139677 gene locus_tag LOCUS_07440 139264 139677 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644790.1 protein_id gnl|my_center|LOCUS_07440 141741 139756 gene locus_tag LOCUS_07450 141741 139756 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_07450 141871 142731 gene locus_tag LOCUS_07460 141871 142731 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002932053.1 protein_id gnl|my_center|LOCUS_07460 143254 142787 gene locus_tag LOCUS_07470 143254 142787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 143388 143251 gene locus_tag LOCUS_07480 143388 143251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 145421 143388 gene locus_tag LOCUS_07490 145421 143388 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459160.1 protein_id gnl|my_center|LOCUS_07490 146182 145418 gene locus_tag LOCUS_07500 146182 145418 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 protein_id gnl|my_center|LOCUS_07500 147309 146317 gene locus_tag LOCUS_07510 147309 146317 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_07510 147996 147322 gene locus_tag LOCUS_07520 147996 147322 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_07520 148130 148864 gene locus_tag LOCUS_07530 gene rgbR 148130 148864 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_07530 148861 150210 gene locus_tag LOCUS_07540 148861 150210 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948726.1 protein_id gnl|my_center|LOCUS_07540 150262 150849 gene locus_tag LOCUS_07550 150262 150849 CDS product accessory gene regulator B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454130.1 protein_id gnl|my_center|LOCUS_07550 150846 150986 gene locus_tag LOCUS_07560 150846 150986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 151157 151489 gene locus_tag LOCUS_07570 151157 151489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 151739 153421 gene locus_tag LOCUS_07580 151739 153421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 153464 157027 gene locus_tag LOCUS_07590 153464 157027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 157021 157971 gene locus_tag LOCUS_07600 157021 157971 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553997.1 protein_id gnl|my_center|LOCUS_07600 157968 159143 gene locus_tag LOCUS_07610 157968 159143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 159184 161490 gene locus_tag LOCUS_07620 159184 161490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 161661 163643 gene locus_tag LOCUS_07630 161661 163643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 163664 164017 gene locus_tag LOCUS_07640 163664 164017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 164626 164081 gene locus_tag LOCUS_07650 164626 164081 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052021.1 protein_id gnl|my_center|LOCUS_07650 166088 164664 gene locus_tag LOCUS_07660 166088 164664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 166284 166883 gene locus_tag LOCUS_07670 166284 166883 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460672.1 protein_id gnl|my_center|LOCUS_07670 167041 168831 gene locus_tag LOCUS_07680 167041 168831 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048173276.1 protein_id gnl|my_center|LOCUS_07680 168828 170558 gene locus_tag LOCUS_07690 168828 170558 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065725.1 protein_id gnl|my_center|LOCUS_07690 171049 171897 gene locus_tag LOCUS_07700 171049 171897 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453971.1 protein_id gnl|my_center|LOCUS_07700 172078 172752 gene locus_tag LOCUS_07710 172078 172752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07710 172740 173411 gene locus_tag LOCUS_07720 172740 173411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07720 173404 175050 gene locus_tag LOCUS_07730 173404 175050 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453968.1 protein_id gnl|my_center|LOCUS_07730 175080 175262 gene locus_tag LOCUS_07740 175080 175262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 175291 175755 gene locus_tag LOCUS_07750 gene smpB 175291 175755 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391819.1 protein_id gnl|my_center|LOCUS_07750 175774 176146 gene locus_tag LOCUS_tm00010 175774 176146 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 177966 176437 gene locus_tag LOCUS_07760 177966 176437 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_07760 179252 177954 gene locus_tag LOCUS_07770 179252 177954 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081586538.1 protein_id gnl|my_center|LOCUS_07770 179473 179315 gene locus_tag LOCUS_07780 179473 179315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 180848 179844 gene locus_tag LOCUS_07790 180848 179844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 181307 180852 gene locus_tag LOCUS_07800 181307 180852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 183103 181304 gene locus_tag LOCUS_07810 183103 181304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 184467 183100 gene locus_tag LOCUS_07820 184467 183100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 185545 184472 gene locus_tag LOCUS_07830 185545 184472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 186421 185549 gene locus_tag LOCUS_07840 186421 185549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 186549 186968 gene locus_tag LOCUS_07850 186549 186968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 <189893 186985 gene locus_tag LOCUS_07860 <189893 186985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003271441.1:phage tail tape measure protein >Feature sequence05 166 816 gene locus_tag LOCUS_07870 166 816 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582846.1 protein_id gnl|my_center|LOCUS_07870 1018 1773 gene locus_tag LOCUS_07880 1018 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 1997 3898 gene locus_tag LOCUS_07890 gene htpG 1997 3898 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 protein_id gnl|my_center|LOCUS_07890 4376 4038 gene locus_tag LOCUS_07900 4376 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 4689 5780 gene locus_tag LOCUS_07910 4689 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 6015 5845 gene locus_tag LOCUS_07920 6015 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 6129 6344 gene locus_tag LOCUS_07930 6129 6344 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214020.1 protein_id gnl|my_center|LOCUS_07930 6656 7603 gene locus_tag LOCUS_07940 6656 7603 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389971.1 protein_id gnl|my_center|LOCUS_07940 7921 7658 gene locus_tag LOCUS_07950 7921 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 8266 9276 gene locus_tag LOCUS_07960 8266 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 9264 9971 gene locus_tag LOCUS_07970 9264 9971 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815055.1 protein_id gnl|my_center|LOCUS_07970 9968 10810 gene locus_tag LOCUS_07980 9968 10810 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_07980 12026 10881 gene locus_tag LOCUS_07990 12026 10881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 12210 12974 gene locus_tag LOCUS_08000 12210 12974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 13021 13752 gene locus_tag LOCUS_08010 13021 13752 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001184072.1 protein_id gnl|my_center|LOCUS_08010 13851 14579 gene locus_tag LOCUS_08020 gene cwlD 13851 14579 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966373.1 protein_id gnl|my_center|LOCUS_08020 15912 14854 gene locus_tag LOCUS_08030 gene hisC 15912 14854 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905826.1 protein_id gnl|my_center|LOCUS_08030 16889 16107 gene locus_tag LOCUS_08040 16889 16107 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_08040 17814 16921 gene locus_tag LOCUS_08050 17814 16921 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102012.1 protein_id gnl|my_center|LOCUS_08050 17945 18448 gene locus_tag LOCUS_08060 17945 18448 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_08060 18453 18602 gene locus_tag LOCUS_08070 18453 18602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 18550 19287 gene locus_tag LOCUS_08080 18550 19287 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08080 19312 20163 gene locus_tag LOCUS_08090 19312 20163 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787284.1 protein_id gnl|my_center|LOCUS_08090 20179 20613 gene locus_tag LOCUS_08100 20179 20613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 20642 20965 gene locus_tag LOCUS_08110 20642 20965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 20962 21435 gene locus_tag LOCUS_08120 20962 21435 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367229.1 protein_id gnl|my_center|LOCUS_08120 22552 21635 gene locus_tag LOCUS_08130 22552 21635 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183854.1 protein_id gnl|my_center|LOCUS_08130 22953 22729 gene locus_tag LOCUS_08140 22953 22729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 23054 24871 gene locus_tag LOCUS_08150 23054 24871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 26687 25668 gene locus_tag LOCUS_08160 26687 25668 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_08160 28978 26684 gene locus_tag LOCUS_08170 28978 26684 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_08170 29390 29013 gene locus_tag LOCUS_08180 29390 29013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 29971 29477 gene locus_tag LOCUS_08190 29971 29477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 30650 30036 gene locus_tag LOCUS_08200 30650 30036 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_08200 31018 31149 gene locus_tag LOCUS_08210 31018 31149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 31265 32509 gene locus_tag LOCUS_08220 31265 32509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 32794 33228 gene locus_tag LOCUS_08230 32794 33228 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245063.1 protein_id gnl|my_center|LOCUS_08230 33384 33821 gene locus_tag LOCUS_08240 33384 33821 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986313.1 protein_id gnl|my_center|LOCUS_08240 34419 35813 gene locus_tag LOCUS_08250 gene radA 34419 35813 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085212.1 protein_id gnl|my_center|LOCUS_08250 35907 36818 gene locus_tag LOCUS_08260 35907 36818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 36831 37946 gene locus_tag LOCUS_08270 36831 37946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 37959 39206 gene locus_tag LOCUS_08280 37959 39206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 39353 39826 gene locus_tag LOCUS_08290 39353 39826 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_08290 39955 40377 gene locus_tag LOCUS_08300 39955 40377 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385810.1 protein_id gnl|my_center|LOCUS_08300 40597 40427 gene locus_tag LOCUS_08310 40597 40427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 41040 40609 gene locus_tag LOCUS_08320 41040 40609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 41154 41675 gene locus_tag LOCUS_08330 41154 41675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 42073 41711 gene locus_tag LOCUS_08340 42073 41711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 42321 43862 gene locus_tag LOCUS_08350 42321 43862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 44557 44009 gene locus_tag LOCUS_08360 44557 44009 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_08360 44855 47065 gene locus_tag LOCUS_08370 44855 47065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 47560 47297 gene locus_tag LOCUS_08380 47560 47297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 48184 47696 gene locus_tag LOCUS_08390 48184 47696 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_08390 48955 48251 gene locus_tag LOCUS_08400 gene deoD 48955 48251 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_08400 50582 49164 gene locus_tag LOCUS_08410 50582 49164 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024339.1 protein_id gnl|my_center|LOCUS_08410 50924 51121 gene locus_tag LOCUS_08420 50924 51121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 51508 52011 gene locus_tag LOCUS_08430 51508 52011 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_08430 51992 52906 gene locus_tag LOCUS_08440 51992 52906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 53080 53877 gene locus_tag LOCUS_08450 53080 53877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 54073 54549 gene locus_tag LOCUS_08460 gene tnpA 54073 54549 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966797.1 protein_id gnl|my_center|LOCUS_08460 56025 54697 gene locus_tag LOCUS_08470 56025 54697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 56336 56061 gene locus_tag LOCUS_08480 56336 56061 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221875345.1 protein_id gnl|my_center|LOCUS_08480 56851 56336 gene locus_tag LOCUS_08490 56851 56336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 57506 58525 gene locus_tag LOCUS_08500 gene pheS 57506 58525 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_08500 58543 60942 gene locus_tag LOCUS_08510 gene pheT 58543 60942 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_08510 60973 61266 gene locus_tag LOCUS_08520 60973 61266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 61610 61338 gene locus_tag LOCUS_08530 61610 61338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 61820 62236 gene locus_tag LOCUS_08540 61820 62236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 62815 63699 gene locus_tag LOCUS_08550 62815 63699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 63742 64299 gene locus_tag LOCUS_08560 63742 64299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 64479 65675 gene locus_tag LOCUS_08570 64479 65675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 65909 68092 gene locus_tag LOCUS_08580 65909 68092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 70055 68169 gene locus_tag LOCUS_08590 gene glgB 70055 68169 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398803.1 protein_id gnl|my_center|LOCUS_08590 70358 71221 gene locus_tag LOCUS_08600 gene fba 70358 71221 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_08600 71260 71394 gene locus_tag LOCUS_08610 71260 71394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 71675 72157 gene locus_tag LOCUS_08620 gene rimP 71675 72157 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_08620 72172 73335 gene locus_tag LOCUS_08630 gene nusA 72172 73335 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_08630 73325 73618 gene locus_tag LOCUS_08640 73325 73618 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_08640 73572 73901 gene locus_tag LOCUS_08650 73572 73901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 74040 76547 gene locus_tag LOCUS_08660 gene infB 74040 76547 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388357.1 protein_id gnl|my_center|LOCUS_08660 76623 77006 gene locus_tag LOCUS_08670 gene rbfA 76623 77006 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268880.1 protein_id gnl|my_center|LOCUS_08670 77012 77983 gene locus_tag LOCUS_08680 77012 77983 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986790.1 protein_id gnl|my_center|LOCUS_08680 77980 78891 gene locus_tag LOCUS_08690 gene truB 77980 78891 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944714.1 protein_id gnl|my_center|LOCUS_08690 78908 79837 gene locus_tag LOCUS_08700 78908 79837 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036352.1 protein_id gnl|my_center|LOCUS_08700 79910 81373 gene locus_tag LOCUS_08710 gene gltX 79910 81373 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_08710 81519 82610 gene locus_tag LOCUS_08720 81519 82610 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_08720 82610 83317 gene locus_tag LOCUS_08730 gene gldF 82610 83317 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_08730 83334 85055 gene locus_tag LOCUS_08740 83334 85055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 85074 86570 gene locus_tag LOCUS_08750 85074 86570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 86650 86940 gene locus_tag LOCUS_08760 86650 86940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 87769 88206 gene locus_tag LOCUS_08770 87769 88206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 88608 90038 gene locus_tag LOCUS_08780 88608 90038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 90221 90565 gene locus_tag LOCUS_08790 90221 90565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 90642 90950 gene locus_tag LOCUS_08800 90642 90950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 90969 91652 gene locus_tag LOCUS_08810 90969 91652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 93134 91908 gene locus_tag LOCUS_08820 93134 91908 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595708.1 protein_id gnl|my_center|LOCUS_08820 93314 94045 gene locus_tag LOCUS_08830 93314 94045 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963651.1 protein_id gnl|my_center|LOCUS_08830 94305 97784 gene locus_tag LOCUS_08840 94305 97784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 98166 101330 gene locus_tag LOCUS_08850 98166 101330 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963882.1 protein_id gnl|my_center|LOCUS_08850 101701 102882 gene locus_tag LOCUS_08860 gene metK 101701 102882 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163123.1 protein_id gnl|my_center|LOCUS_08860 103021 103581 gene locus_tag LOCUS_08870 103021 103581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 103578 104219 gene locus_tag LOCUS_08880 103578 104219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 105853 104564 gene locus_tag LOCUS_08890 105853 104564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 106076 107746 gene locus_tag LOCUS_08900 106076 107746 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_08900 107762 108211 gene locus_tag LOCUS_08910 gene tsaE 107762 108211 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049642.1 protein_id gnl|my_center|LOCUS_08910 108192 108875 gene locus_tag LOCUS_08920 gene tsaB 108192 108875 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865740.1 protein_id gnl|my_center|LOCUS_08920 108964 109404 gene locus_tag LOCUS_08930 gene rpiB 108964 109404 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430700.1 protein_id gnl|my_center|LOCUS_08930 109420 110049 gene locus_tag LOCUS_08940 gene upp 109420 110049 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829916.1 protein_id gnl|my_center|LOCUS_08940 110703 110131 gene locus_tag LOCUS_08950 110703 110131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 112031 110748 gene locus_tag LOCUS_08960 gene glnA 112031 110748 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_08960 112276 112788 gene locus_tag LOCUS_08970 112276 112788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 113022 114008 gene locus_tag LOCUS_08980 113022 114008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 115048 114086 gene locus_tag LOCUS_08990 115048 114086 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072569.1 protein_id gnl|my_center|LOCUS_08990 115328 117034 gene locus_tag LOCUS_09000 115328 117034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 117263 119203 gene locus_tag LOCUS_09010 117263 119203 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_09010 119282 119470 gene locus_tag LOCUS_09020 119282 119470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 119467 120174 gene locus_tag LOCUS_09030 119467 120174 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_09030 120175 120723 gene locus_tag LOCUS_09040 120175 120723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 120774 121988 gene locus_tag LOCUS_09050 120774 121988 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_09050 122053 122679 gene locus_tag LOCUS_09060 122053 122679 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966000.1 protein_id gnl|my_center|LOCUS_09060 122739 123440 gene locus_tag LOCUS_09070 gene ispD 122739 123440 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_09070 123441 123929 gene locus_tag LOCUS_09080 gene ispF 123441 123929 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_09080 124028 124246 gene locus_tag LOCUS_09090 124028 124246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 124253 125431 gene locus_tag LOCUS_09100 124253 125431 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943290.1 protein_id gnl|my_center|LOCUS_09100 125553 126512 gene locus_tag LOCUS_09110 gene cdaA 125553 126512 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360232.1 protein_id gnl|my_center|LOCUS_09110 126445 127857 gene locus_tag LOCUS_09120 126445 127857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 128176 130860 gene locus_tag LOCUS_09130 128176 130860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 131681 130944 gene locus_tag LOCUS_09140 gene sigE 131681 130944 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_09140 132505 131696 gene locus_tag LOCUS_09150 132505 131696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 132945 135596 gene locus_tag LOCUS_09160 gene adhE 132945 135596 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_09160 135602 136342 gene locus_tag LOCUS_09170 135602 136342 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242850.1 protein_id gnl|my_center|LOCUS_09170 136705 137832 gene locus_tag LOCUS_09180 136705 137832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 138537 139070 gene locus_tag LOCUS_09190 138537 139070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence06 179 15 gene locus_tag LOCUS_09200 179 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 456 115 gene locus_tag LOCUS_09210 456 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1402 542 gene locus_tag LOCUS_09220 1402 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1518 1799 gene locus_tag LOCUS_09230 1518 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 2767 1862 gene locus_tag LOCUS_09240 gene argF 2767 1862 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_09240 4127 2961 gene locus_tag LOCUS_09250 4127 2961 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861434.1 protein_id gnl|my_center|LOCUS_09250 4537 4142 gene locus_tag LOCUS_09260 4537 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 4995 4534 gene locus_tag LOCUS_09270 4995 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 5973 5107 gene locus_tag LOCUS_09280 gene argB 5973 5107 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 protein_id gnl|my_center|LOCUS_09280 7242 5989 gene locus_tag LOCUS_09290 gene argJ 7242 5989 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_09290 8547 7600 gene locus_tag LOCUS_09300 gene argC 8547 7600 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 protein_id gnl|my_center|LOCUS_09300 9245 8583 gene locus_tag LOCUS_09310 9245 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 9570 9388 gene locus_tag LOCUS_09320 9570 9388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 10943 9567 gene locus_tag LOCUS_09330 gene argH 10943 9567 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_09330 11487 10948 gene locus_tag LOCUS_09340 11487 10948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 12809 11571 gene locus_tag LOCUS_09350 12809 11571 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_09350 13611 13087 gene locus_tag LOCUS_09360 13611 13087 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_09360 14541 13768 gene locus_tag LOCUS_09370 gene spo0A 14541 13768 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_09370 15248 14688 gene locus_tag LOCUS_09380 15248 14688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 15457 16665 gene locus_tag LOCUS_09390 gene spoIVB 15457 16665 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_09390 17003 16740 gene locus_tag LOCUS_09400 17003 16740 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 protein_id gnl|my_center|LOCUS_09400 18017 17322 gene locus_tag LOCUS_09410 gene trmD 18017 17322 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_09410 18516 18007 gene locus_tag LOCUS_09420 gene rimM 18516 18007 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_09420 18824 18591 gene locus_tag LOCUS_09430 18824 18591 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_09430 19232 18990 gene locus_tag LOCUS_09440 gene rpsP 19232 18990 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_09440 20718 19303 gene locus_tag LOCUS_09450 gene ffh 20718 19303 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_09450 21237 20872 gene locus_tag LOCUS_09460 21237 20872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 21491 22123 gene locus_tag LOCUS_09470 21491 22123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 23734 22229 gene locus_tag LOCUS_09480 23734 22229 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_09480 25923 24781 gene locus_tag LOCUS_09490 25923 24781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 26155 25871 gene locus_tag LOCUS_09500 26155 25871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 26765 26133 gene locus_tag LOCUS_09510 26765 26133 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083848.1 protein_id gnl|my_center|LOCUS_09510 27633 26890 gene locus_tag LOCUS_09520 27633 26890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 28746 27646 gene locus_tag LOCUS_09530 28746 27646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 30410 28989 gene locus_tag LOCUS_09540 30410 28989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 31167 30451 gene locus_tag LOCUS_09550 31167 30451 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_09550 32815 31208 gene locus_tag LOCUS_09560 32815 31208 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_09560 33431 34597 gene locus_tag LOCUS_09570 33431 34597 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_09570 34914 34651 gene locus_tag LOCUS_09580 34914 34651 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356943.1 protein_id gnl|my_center|LOCUS_09580 36142 35000 gene locus_tag LOCUS_09590 36142 35000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 36899 38947 gene locus_tag LOCUS_09600 36899 38947 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097213.1 protein_id gnl|my_center|LOCUS_09600 38978 41272 gene locus_tag LOCUS_09610 38978 41272 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_09610 42279 41479 gene locus_tag LOCUS_09620 42279 41479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 42394 43188 gene locus_tag LOCUS_09630 42394 43188 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886481.1 protein_id gnl|my_center|LOCUS_09630 43761 43904 gene locus_tag LOCUS_09640 43761 43904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 46420 43964 gene locus_tag LOCUS_09650 46420 43964 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_09650 46851 46714 gene locus_tag LOCUS_09660 46851 46714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 47523 47026 gene locus_tag LOCUS_09670 47523 47026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911276.1 protein_id gnl|my_center|LOCUS_09670 48641 47850 gene locus_tag LOCUS_09680 48641 47850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 49318 48743 gene locus_tag LOCUS_09690 49318 48743 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_09690 53647 49577 gene locus_tag LOCUS_09700 53647 49577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 54752 53784 gene locus_tag LOCUS_09710 54752 53784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 55948 55607 gene locus_tag LOCUS_09720 gene rplQ 55948 55607 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_09720 57000 56047 gene locus_tag LOCUS_09730 57000 56047 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_09730 57777 57181 gene locus_tag LOCUS_09740 gene rpsD 57777 57181 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421121.1 protein_id gnl|my_center|LOCUS_09740 58206 57805 gene locus_tag LOCUS_09750 gene rpsK 58206 57805 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_09750 58591 58223 gene locus_tag LOCUS_09760 gene rpsM 58591 58223 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_09760 58738 58902 gene locus_tag LOCUS_09770 58738 58902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 59078 58860 gene locus_tag LOCUS_09780 gene infA 59078 58860 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 protein_id gnl|my_center|LOCUS_09780 59364 59119 gene locus_tag LOCUS_09790 59364 59119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 60130 59378 gene locus_tag LOCUS_09800 gene map 60130 59378 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_09800 60762 60127 gene locus_tag LOCUS_09810 gene adk 60762 60127 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649108.1 protein_id gnl|my_center|LOCUS_09810 62106 60781 gene locus_tag LOCUS_09820 gene secY 62106 60781 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810127.1 protein_id gnl|my_center|LOCUS_09820 62548 62108 gene locus_tag LOCUS_09830 gene rplO 62548 62108 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393918.1 protein_id gnl|my_center|LOCUS_09830 62751 62575 gene locus_tag LOCUS_09840 gene rpmD 62751 62575 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357637.1 protein_id gnl|my_center|LOCUS_09840 63264 62764 gene locus_tag LOCUS_09850 gene rpsE 63264 62764 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_09850 63642 63283 gene locus_tag LOCUS_09860 gene rplR 63642 63283 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003739848.1 protein_id gnl|my_center|LOCUS_09860 64208 63663 gene locus_tag LOCUS_09870 gene rplF 64208 63663 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810135.1 protein_id gnl|my_center|LOCUS_09870 64622 64224 gene locus_tag LOCUS_09880 gene rpsH 64622 64224 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_09880 64839 64654 gene locus_tag LOCUS_09890 64839 64654 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_09890 65396 64857 gene locus_tag LOCUS_09900 gene rplE 65396 64857 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_09900 65762 65409 gene locus_tag LOCUS_09910 gene rplX 65762 65409 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546700.1 protein_id gnl|my_center|LOCUS_09910 66146 65778 gene locus_tag LOCUS_09920 gene rplN 66146 65778 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_09920 66480 66223 gene locus_tag LOCUS_09930 gene rpsQ 66480 66223 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_09930 66688 66497 gene locus_tag LOCUS_09940 gene rpmC 66688 66497 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421158.1 protein_id gnl|my_center|LOCUS_09940 67110 66688 gene locus_tag LOCUS_09950 gene rplP 67110 66688 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_09950 67904 67110 gene locus_tag LOCUS_09960 gene rpsC 67904 67110 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421163.1 protein_id gnl|my_center|LOCUS_09960 68261 67926 gene locus_tag LOCUS_09970 gene rplV 68261 67926 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156475.1 protein_id gnl|my_center|LOCUS_09970 68561 68280 gene locus_tag LOCUS_09980 gene rpsS 68561 68280 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_09980 69415 68582 gene locus_tag LOCUS_09990 gene rplB 69415 68582 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_09990 69818 69495 gene locus_tag LOCUS_10000 gene rplW 69818 69495 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_10000 70441 69815 gene locus_tag LOCUS_10010 gene rplD 70441 69815 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966411.1 protein_id gnl|my_center|LOCUS_10010 71091 70459 gene locus_tag LOCUS_10020 gene rplC 71091 70459 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421173.1 protein_id gnl|my_center|LOCUS_10020 71515 71201 gene locus_tag LOCUS_10030 gene rpsJ 71515 71201 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284513.1 protein_id gnl|my_center|LOCUS_10030 73095 72247 gene locus_tag LOCUS_10040 73095 72247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 73799 73092 gene locus_tag LOCUS_10050 73799 73092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 74586 73810 gene locus_tag LOCUS_10060 74586 73810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 76866 75406 gene locus_tag LOCUS_10070 gene proS 76866 75406 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 protein_id gnl|my_center|LOCUS_10070 77426 77908 gene locus_tag LOCUS_10080 77426 77908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 78443 77964 gene locus_tag LOCUS_10090 78443 77964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 79681 78443 gene locus_tag LOCUS_10100 79681 78443 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016932.1 protein_id gnl|my_center|LOCUS_10100 82947 79981 gene locus_tag LOCUS_10110 82947 79981 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_10110 84693 83545 gene locus_tag LOCUS_10120 gene alr 84693 83545 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_10120 85204 85968 gene locus_tag LOCUS_10130 85204 85968 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_10130 86559 87554 gene locus_tag LOCUS_10140 86559 87554 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_10140 87628 88305 gene locus_tag LOCUS_10150 87628 88305 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_10150 88398 88517 gene locus_tag LOCUS_10160 88398 88517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 88517 88759 gene locus_tag LOCUS_10170 88517 88759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10170 88763 89038 gene locus_tag LOCUS_10180 88763 89038 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815811.1 protein_id gnl|my_center|LOCUS_10180 90512 89118 gene locus_tag LOCUS_10190 90512 89118 CDS product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316782.1 protein_id gnl|my_center|LOCUS_10190 92880 90538 gene locus_tag LOCUS_10200 92880 90538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 94579 93557 gene locus_tag LOCUS_10210 gene galM 94579 93557 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399304.1 protein_id gnl|my_center|LOCUS_10210 95008 94871 gene locus_tag LOCUS_10220 95008 94871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 95799 95224 gene locus_tag LOCUS_10230 gene pgsA 95799 95224 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965120.1 protein_id gnl|my_center|LOCUS_10230 97126 95783 gene locus_tag LOCUS_10240 gene rimO 97126 95783 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_10240 98451 97441 gene locus_tag LOCUS_10250 98451 97441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 99300 98665 gene locus_tag LOCUS_10260 99300 98665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 100541 99312 gene locus_tag LOCUS_10270 gene recA 100541 99312 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_10270 101508 100657 gene locus_tag LOCUS_10280 gene prmC 101508 100657 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_10280 102479 101502 gene locus_tag LOCUS_10290 102479 101502 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_10290 104162 102717 gene locus_tag LOCUS_10300 104162 102717 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_10300 104850 104152 gene locus_tag LOCUS_10310 104850 104152 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142165.1 protein_id gnl|my_center|LOCUS_10310 106596 105364 gene locus_tag LOCUS_10320 106596 105364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 108062 106689 gene locus_tag LOCUS_10330 108062 106689 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_10330 108275 108141 gene locus_tag LOCUS_10340 108275 108141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 108602 109651 gene locus_tag LOCUS_10350 gene spoIID 108602 109651 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243408.1 protein_id gnl|my_center|LOCUS_10350 112084 110741 gene locus_tag LOCUS_10360 112084 110741 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845922.1 protein_id gnl|my_center|LOCUS_10360 112931 112128 gene locus_tag LOCUS_10370 112931 112128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 113817 114068 gene locus_tag LOCUS_10380 113817 114068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 114806 114156 gene locus_tag LOCUS_10390 114806 114156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 115622 114837 gene locus_tag LOCUS_10400 115622 114837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 117075 115672 gene locus_tag LOCUS_10410 117075 115672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 118194 117187 gene locus_tag LOCUS_10420 118194 117187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 120015 118720 gene locus_tag LOCUS_10430 gene serS 120015 118720 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_10430 120942 120106 gene locus_tag LOCUS_10440 120942 120106 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476457.1 protein_id gnl|my_center|LOCUS_10440 121760 120939 gene locus_tag LOCUS_10450 121760 120939 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_10450 122388 123209 gene locus_tag LOCUS_10460 gene noc 122388 123209 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_10460 125632 123938 gene locus_tag LOCUS_10470 125632 123938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 126303 125629 gene locus_tag LOCUS_10480 126303 125629 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_10480 127878 127168 gene locus_tag LOCUS_10490 gene rsmG 127878 127168 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 protein_id gnl|my_center|LOCUS_10490 129758 127875 gene locus_tag LOCUS_10500 gene mnmG 129758 127875 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966993.1 protein_id gnl|my_center|LOCUS_10500 130232 130020 gene locus_tag LOCUS_10510 130232 130020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 131822 130458 gene locus_tag LOCUS_10520 gene mnmE 131822 130458 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966994.1 protein_id gnl|my_center|LOCUS_10520 133405 132413 gene locus_tag LOCUS_10530 133405 132413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 134649 133510 gene locus_tag LOCUS_10540 134649 133510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 134934 134659 gene locus_tag LOCUS_10550 gene yidD 134934 134659 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172533.1 protein_id gnl|my_center|LOCUS_10550 135299 134931 gene locus_tag LOCUS_10560 135299 134931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence07 732 1199 gene locus_tag LOCUS_10570 732 1199 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812737.1 protein_id gnl|my_center|LOCUS_10570 1196 1690 gene locus_tag LOCUS_10580 1196 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 2411 1779 gene locus_tag LOCUS_10590 2411 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 4026 2863 gene locus_tag LOCUS_10600 4026 2863 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490229.1 protein_id gnl|my_center|LOCUS_10600 5125 4040 gene locus_tag LOCUS_10610 gene serC 5125 4040 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_10610 5991 5308 gene locus_tag LOCUS_10620 5991 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 6807 6103 gene locus_tag LOCUS_10630 6807 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 8668 6845 gene locus_tag LOCUS_10640 gene typA 8668 6845 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964991.1 protein_id gnl|my_center|LOCUS_10640 8911 8827 gene locus_tag LOCUS_t00130 8911 8827 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 9014 8939 gene locus_tag LOCUS_t00140 9014 8939 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11684 9453 gene locus_tag LOCUS_10650 11684 9453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 11821 11681 gene locus_tag LOCUS_10660 11821 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 12743 11808 gene locus_tag LOCUS_10670 12743 11808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_10670 13132 12740 gene locus_tag LOCUS_10680 gene ytrA 13132 12740 CDS product GntR family transcriptional regulator YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229121.1 protein_id gnl|my_center|LOCUS_10680 13382 13939 gene locus_tag LOCUS_10690 13382 13939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 13929 14402 gene locus_tag LOCUS_10700 13929 14402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 14831 16003 gene locus_tag LOCUS_10710 14831 16003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 16000 16512 gene locus_tag LOCUS_10720 gene tadA 16000 16512 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 protein_id gnl|my_center|LOCUS_10720 16728 19511 gene locus_tag LOCUS_10730 16728 19511 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582726.1 protein_id gnl|my_center|LOCUS_10730 20133 19594 gene locus_tag LOCUS_10740 gene spoVT 20133 19594 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966490.1 protein_id gnl|my_center|LOCUS_10740 20919 20287 gene locus_tag LOCUS_10750 20919 20287 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_10750 21411 20932 gene locus_tag LOCUS_10760 gene rlmH 21411 20932 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435703.1 protein_id gnl|my_center|LOCUS_10760 22205 21411 gene locus_tag LOCUS_10770 22205 21411 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_10770 23579 22281 gene locus_tag LOCUS_10780 23579 22281 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_10780 24884 24051 gene locus_tag LOCUS_10790 24884 24051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 26331 24934 gene locus_tag LOCUS_10800 gene cysS 26331 24934 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_10800 27025 26381 gene locus_tag LOCUS_10810 27025 26381 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485135.1 protein_id gnl|my_center|LOCUS_10810 27712 27041 gene locus_tag LOCUS_10820 gene cysE 27712 27041 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071396735.1 protein_id gnl|my_center|LOCUS_10820 29357 28161 gene locus_tag LOCUS_10830 29357 28161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 30738 29515 gene locus_tag LOCUS_10840 30738 29515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 32005 30755 gene locus_tag LOCUS_10850 32005 30755 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204864755.1 protein_id gnl|my_center|LOCUS_10850 34256 32346 gene locus_tag LOCUS_10860 34256 32346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_10860 35986 34253 gene locus_tag LOCUS_10870 35986 34253 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_10870 36453 35983 gene locus_tag LOCUS_10880 36453 35983 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363192.1 protein_id gnl|my_center|LOCUS_10880 36674 37267 gene locus_tag LOCUS_10890 36674 37267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 38341 37355 gene locus_tag LOCUS_10900 38341 37355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 39684 38356 gene locus_tag LOCUS_10910 39684 38356 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_10910 40181 40630 gene locus_tag LOCUS_10920 40181 40630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 40936 44331 gene locus_tag LOCUS_10930 40936 44331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 44490 46325 gene locus_tag LOCUS_10940 gene asnB 44490 46325 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392813.1 protein_id gnl|my_center|LOCUS_10940 48257 46404 gene locus_tag LOCUS_10950 gene ftsH 48257 46404 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_10950 50281 48419 gene locus_tag LOCUS_10960 50281 48419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 50791 50297 gene locus_tag LOCUS_10970 50791 50297 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_10970 53309 50958 gene locus_tag LOCUS_10980 53309 50958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 55418 53454 gene locus_tag LOCUS_10990 gene ftsH 55418 53454 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373798.1 protein_id gnl|my_center|LOCUS_10990 56833 55481 gene locus_tag LOCUS_11000 gene tilS 56833 55481 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107882.1 protein_id gnl|my_center|LOCUS_11000 58172 56823 gene locus_tag LOCUS_11010 gene dnaB 58172 56823 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_11010 58890 58444 gene locus_tag LOCUS_11020 gene rplI 58890 58444 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226915.1 protein_id gnl|my_center|LOCUS_11020 60926 58962 gene locus_tag LOCUS_11030 60926 58962 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_11030 62873 61029 gene locus_tag LOCUS_11040 62873 61029 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_11040 63793 65079 gene locus_tag LOCUS_11050 63793 65079 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_11050 65259 65645 gene locus_tag LOCUS_11060 65259 65645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 66330 65731 gene locus_tag LOCUS_11070 66330 65731 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943659.1 protein_id gnl|my_center|LOCUS_11070 68182 66482 gene locus_tag LOCUS_11080 68182 66482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 69355 68414 gene locus_tag LOCUS_11090 69355 68414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 70780 69560 gene locus_tag LOCUS_11100 gene tyrS 70780 69560 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963956.1 protein_id gnl|my_center|LOCUS_11100 71315 71390 gene locus_tag LOCUS_t00150 71315 71390 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 73376 71634 gene locus_tag LOCUS_11110 73376 71634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 74050 73391 gene locus_tag LOCUS_11120 74050 73391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903164.1 protein_id gnl|my_center|LOCUS_11120 74274 74086 gene locus_tag LOCUS_11130 74274 74086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 74420 74725 gene locus_tag LOCUS_11140 74420 74725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 79040 75819 gene locus_tag LOCUS_11150 79040 75819 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674564.1 protein_id gnl|my_center|LOCUS_11150 81140 79311 gene locus_tag LOCUS_11160 81140 79311 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_11160 83460 81130 gene locus_tag LOCUS_11170 83460 81130 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_11170 83914 83453 gene locus_tag LOCUS_11180 83914 83453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 84676 84086 gene locus_tag LOCUS_11190 84676 84086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 85181 84681 gene locus_tag LOCUS_11200 85181 84681 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896384.1 protein_id gnl|my_center|LOCUS_11200 85522 86727 gene locus_tag LOCUS_11210 85522 86727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 88184 86796 gene locus_tag LOCUS_11220 88184 86796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 88467 88234 gene locus_tag LOCUS_11230 88467 88234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 89843 88356 gene locus_tag LOCUS_11240 89843 88356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 90403 89840 gene locus_tag LOCUS_11250 90403 89840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 90761 92074 gene locus_tag LOCUS_11260 90761 92074 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451037.1 protein_id gnl|my_center|LOCUS_11260 93514 92213 gene locus_tag LOCUS_11270 gene eno 93514 92213 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948030.1 protein_id gnl|my_center|LOCUS_11270 96148 93752 gene locus_tag LOCUS_11280 96148 93752 CDS product N,N'-diacetylchitobiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195978718.1 protein_id gnl|my_center|LOCUS_11280 97043 96369 gene locus_tag LOCUS_11290 gene tsaA 97043 96369 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_11290 97731 97063 gene locus_tag LOCUS_11300 97731 97063 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435186.1 protein_id gnl|my_center|LOCUS_11300 98591 97728 gene locus_tag LOCUS_11310 98591 97728 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_11310 98971 98594 gene locus_tag LOCUS_11320 98971 98594 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_11320 99154 99672 gene locus_tag LOCUS_11330 99154 99672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 100799 99738 gene locus_tag LOCUS_11340 100799 99738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 101950 101015 gene locus_tag LOCUS_11350 101950 101015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 103312 101975 gene locus_tag LOCUS_11360 103312 101975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 103911 103309 gene locus_tag LOCUS_11370 103911 103309 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459480.1 protein_id gnl|my_center|LOCUS_11370 105701 103992 gene locus_tag LOCUS_11380 105701 103992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 106819 105746 gene locus_tag LOCUS_11390 106819 105746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 107780 106824 gene locus_tag LOCUS_11400 gene yhdJ 107780 106824 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258898.1 protein_id gnl|my_center|LOCUS_11400 109278 107800 gene locus_tag LOCUS_11410 109278 107800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 110546 109275 gene locus_tag LOCUS_11420 110546 109275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 112413 110569 gene locus_tag LOCUS_11430 gene glmS 112413 110569 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_11430 112735 113994 gene locus_tag LOCUS_11440 112735 113994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 113999 114226 gene locus_tag LOCUS_11450 113999 114226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 114223 114786 gene locus_tag LOCUS_11460 114223 114786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 115165 114857 gene locus_tag LOCUS_11470 115165 114857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 118748 115170 gene locus_tag LOCUS_11480 gene rpoC 118748 115170 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966420.1 protein_id gnl|my_center|LOCUS_11480 <121212 118880 gene locus_tag LOCUS_11490 <121212 118880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393945.1:DNA-directed RNA polymerase subunit beta >Feature sequence08 434 309 gene locus_tag LOCUS_11500 434 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 636 427 gene locus_tag LOCUS_11510 636 427 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_11510 889 629 gene locus_tag LOCUS_11520 889 629 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813812.1 protein_id gnl|my_center|LOCUS_11520 1110 886 gene locus_tag LOCUS_11530 1110 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1370 1894 gene locus_tag LOCUS_11540 1370 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 2579 2379 gene locus_tag LOCUS_11550 2579 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 3549 2818 gene locus_tag LOCUS_11560 3549 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 4494 3688 gene locus_tag LOCUS_11570 4494 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 5245 4427 gene locus_tag LOCUS_11580 5245 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 5537 5271 gene locus_tag LOCUS_11590 5537 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 6013 5822 gene locus_tag LOCUS_11600 6013 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 6196 6939 gene locus_tag LOCUS_11610 6196 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 6908 8164 gene locus_tag LOCUS_11620 6908 8164 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_11620 10064 8487 gene locus_tag LOCUS_11630 10064 8487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 10326 10057 gene locus_tag LOCUS_11640 10326 10057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 11853 10696 gene locus_tag LOCUS_11650 11853 10696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 14697 12001 gene locus_tag LOCUS_11660 14697 12001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 15457 14900 gene locus_tag LOCUS_11670 15457 14900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 17994 16171 gene locus_tag LOCUS_11680 17994 16171 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948830.1 protein_id gnl|my_center|LOCUS_11680 18213 18641 gene locus_tag LOCUS_11690 18213 18641 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890794.1 protein_id gnl|my_center|LOCUS_11690 21446 18753 gene locus_tag LOCUS_11700 21446 18753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 22095 21850 gene locus_tag LOCUS_11710 22095 21850 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348590.1 protein_id gnl|my_center|LOCUS_11710 22509 22327 gene locus_tag LOCUS_11720 22509 22327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 24226 22625 gene locus_tag LOCUS_11730 24226 22625 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966231.1 protein_id gnl|my_center|LOCUS_11730 24660 24824 gene locus_tag LOCUS_11740 24660 24824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 24942 25157 gene locus_tag LOCUS_11750 24942 25157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 25769 25167 gene locus_tag LOCUS_11760 gene recR 25769 25167 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_11760 26126 25779 gene locus_tag LOCUS_11770 26126 25779 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_11770 27921 26371 gene locus_tag LOCUS_11780 gene dnaX 27921 26371 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121572.1 protein_id gnl|my_center|LOCUS_11780 29627 28224 gene locus_tag LOCUS_11790 29627 28224 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_11790 30542 31768 gene locus_tag LOCUS_11800 30542 31768 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557280.1 protein_id gnl|my_center|LOCUS_11800 32041 33300 gene locus_tag LOCUS_11810 32041 33300 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_11810 34554 33439 gene locus_tag LOCUS_11820 34554 33439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 34991 34569 gene locus_tag LOCUS_11830 34991 34569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 37578 35239 gene locus_tag LOCUS_11840 gene yicI 37578 35239 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582725.1 protein_id gnl|my_center|LOCUS_11840 38773 37841 gene locus_tag LOCUS_11850 38773 37841 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963688.1 protein_id gnl|my_center|LOCUS_11850 39521 38940 gene locus_tag LOCUS_11860 39521 38940 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460384.1 protein_id gnl|my_center|LOCUS_11860 41105 39630 gene locus_tag LOCUS_11870 41105 39630 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965170.1 protein_id gnl|my_center|LOCUS_11870 41978 41238 gene locus_tag LOCUS_11880 41978 41238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 44350 42092 gene locus_tag LOCUS_11890 44350 42092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 45515 44712 gene locus_tag LOCUS_11900 gene dpsA 45515 44712 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460385.1 protein_id gnl|my_center|LOCUS_11900 46866 45838 gene locus_tag LOCUS_11910 46866 45838 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_11910 47776 46883 gene locus_tag LOCUS_11920 47776 46883 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_11920 50583 47773 gene locus_tag LOCUS_11930 50583 47773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 51232 50603 gene locus_tag LOCUS_11940 51232 50603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11940 52751 51240 gene locus_tag LOCUS_11950 52751 51240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11950 53654 52767 gene locus_tag LOCUS_11960 53654 52767 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_11960 54599 53667 gene locus_tag LOCUS_11970 54599 53667 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_11970 57615 54619 gene locus_tag LOCUS_11980 57615 54619 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_11980 62212 58964 gene locus_tag LOCUS_11990 62212 58964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 63013 64485 gene locus_tag LOCUS_12000 gene guaB 63013 64485 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264083.1 protein_id gnl|my_center|LOCUS_12000 65428 65646 gene locus_tag LOCUS_12010 65428 65646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 66622 65765 gene locus_tag LOCUS_12020 66622 65765 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_12020 67219 66635 gene locus_tag LOCUS_12030 67219 66635 CDS product RnfABCDGE type electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869099.1 protein_id gnl|my_center|LOCUS_12030 67881 67216 gene locus_tag LOCUS_12040 67881 67216 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_12040 68447 67878 gene locus_tag LOCUS_12050 68447 67878 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015690.1 protein_id gnl|my_center|LOCUS_12050 69444 68449 gene locus_tag LOCUS_12060 69444 68449 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869096.1 protein_id gnl|my_center|LOCUS_12060 71348 70062 gene locus_tag LOCUS_12070 gene rsxC 71348 70062 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_12070 72535 71573 gene locus_tag LOCUS_12080 72535 71573 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733041.1 protein_id gnl|my_center|LOCUS_12080 72832 73449 gene locus_tag LOCUS_12090 72832 73449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 73713 74939 gene locus_tag LOCUS_12100 73713 74939 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_12100 76068 75019 gene locus_tag LOCUS_12110 76068 75019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 76418 76065 gene locus_tag LOCUS_12120 76418 76065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 76978 76415 gene locus_tag LOCUS_12130 76978 76415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 77579 77268 gene locus_tag LOCUS_12140 77579 77268 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475524.1 protein_id gnl|my_center|LOCUS_12140 78357 77605 gene locus_tag LOCUS_12150 78357 77605 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_12150 78649 79140 gene locus_tag LOCUS_12160 78649 79140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 79130 80380 gene locus_tag LOCUS_12170 79130 80380 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_12170 80381 81535 gene locus_tag LOCUS_12180 80381 81535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 81552 81908 gene locus_tag LOCUS_12190 81552 81908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 81926 82345 gene locus_tag LOCUS_12200 81926 82345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 82342 82764 gene locus_tag LOCUS_12210 82342 82764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 82761 83696 gene locus_tag LOCUS_12220 82761 83696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 83844 84812 gene locus_tag LOCUS_12230 83844 84812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 84946 85839 gene locus_tag LOCUS_12240 84946 85839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 86564 88117 gene locus_tag LOCUS_12250 86564 88117 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_12250 88104 89858 gene locus_tag LOCUS_12260 88104 89858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 90264 89944 gene locus_tag LOCUS_12270 gene trxA 90264 89944 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_12270 91030 90413 gene locus_tag LOCUS_12280 91030 90413 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254380.1 protein_id gnl|my_center|LOCUS_12280 91321 92805 gene locus_tag LOCUS_12290 91321 92805 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_12290 94866 93652 gene locus_tag LOCUS_12300 94866 93652 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891452.1 protein_id gnl|my_center|LOCUS_12300 95567 95779 gene locus_tag LOCUS_12310 95567 95779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 97500 95878 gene locus_tag LOCUS_12320 97500 95878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 98878 97667 gene locus_tag LOCUS_12330 98878 97667 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016078.1 protein_id gnl|my_center|LOCUS_12330 99236 99162 gene locus_tag LOCUS_t00160 99236 99162 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 99316 99240 gene locus_tag LOCUS_t00170 99316 99240 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 99858 99499 gene locus_tag LOCUS_12340 gene spoVAE 99858 99499 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_12340 101406 100381 gene locus_tag LOCUS_12350 gene spoVAD 101406 100381 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_12350 101876 102325 gene locus_tag LOCUS_12360 gene spoVAC 101876 102325 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418420.1 protein_id gnl|my_center|LOCUS_12360 103149 102301 gene locus_tag LOCUS_12370 103149 102301 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966060.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence09 147 1145 gene locus_tag LOCUS_12380 147 1145 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016646.1 protein_id gnl|my_center|LOCUS_12380 1967 1209 gene locus_tag LOCUS_12390 1967 1209 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963439.1 protein_id gnl|my_center|LOCUS_12390 2632 1979 gene locus_tag LOCUS_12400 2632 1979 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063820.1 protein_id gnl|my_center|LOCUS_12400 3457 2654 gene locus_tag LOCUS_12410 3457 2654 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272547.1 protein_id gnl|my_center|LOCUS_12410 3997 4782 gene locus_tag LOCUS_12420 3997 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 4798 5499 gene locus_tag LOCUS_12430 4798 5499 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_12430 5486 6211 gene locus_tag LOCUS_12440 5486 6211 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_12440 6213 6632 gene locus_tag LOCUS_12450 6213 6632 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226881.1 protein_id gnl|my_center|LOCUS_12450 7174 7863 gene locus_tag LOCUS_12460 7174 7863 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948893.1 protein_id gnl|my_center|LOCUS_12460 7876 8319 gene locus_tag LOCUS_12470 7876 8319 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912113.1 protein_id gnl|my_center|LOCUS_12470 8316 9767 gene locus_tag LOCUS_12480 8316 9767 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_12480 9777 11576 gene locus_tag LOCUS_12490 9777 11576 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614258.1 protein_id gnl|my_center|LOCUS_12490 11795 11583 gene locus_tag LOCUS_12500 11795 11583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 11973 12680 gene locus_tag LOCUS_12510 11973 12680 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_12510 12677 13201 gene locus_tag LOCUS_12520 gene cobO 12677 13201 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392864.1 protein_id gnl|my_center|LOCUS_12520 14140 13286 gene locus_tag LOCUS_12530 14140 13286 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892682.1 protein_id gnl|my_center|LOCUS_12530 14389 15057 gene locus_tag LOCUS_12540 gene rpe 14389 15057 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057721.1 protein_id gnl|my_center|LOCUS_12540 15091 16215 gene locus_tag LOCUS_12550 15091 16215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 16397 17356 gene locus_tag LOCUS_12560 gene hprK 16397 17356 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_12560 17442 18380 gene locus_tag LOCUS_12570 gene murB 17442 18380 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_12570 18412 19305 gene locus_tag LOCUS_12580 gene rapZ 18412 19305 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369722.1 protein_id gnl|my_center|LOCUS_12580 19323 20240 gene locus_tag LOCUS_12590 19323 20240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 20224 23682 gene locus_tag LOCUS_12600 20224 23682 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_12600 23871 24833 gene locus_tag LOCUS_12610 gene pfkA 23871 24833 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_12610 25145 25945 gene locus_tag LOCUS_12620 gene proC 25145 25945 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704543.1 protein_id gnl|my_center|LOCUS_12620 26074 26661 gene locus_tag LOCUS_12630 26074 26661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 26708 27676 gene locus_tag LOCUS_12640 26708 27676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 27842 28108 gene locus_tag LOCUS_12650 gene rpsO 27842 28108 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_12650 28296 30419 gene locus_tag LOCUS_12660 gene pnp 28296 30419 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_12660 30913 30503 gene locus_tag LOCUS_12670 30913 30503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964626.1 protein_id gnl|my_center|LOCUS_12670 31834 30941 gene locus_tag LOCUS_12680 31834 30941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 31973 32188 gene locus_tag LOCUS_12690 31973 32188 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459191.1 protein_id gnl|my_center|LOCUS_12690 34879 32249 gene locus_tag LOCUS_12700 34879 32249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 35618 34863 gene locus_tag LOCUS_12710 35618 34863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 37943 35850 gene locus_tag LOCUS_12720 37943 35850 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_12720 38667 39110 gene locus_tag LOCUS_12730 38667 39110 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674368.1 protein_id gnl|my_center|LOCUS_12730 39380 40615 gene locus_tag LOCUS_12740 39380 40615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 40771 42180 gene locus_tag LOCUS_12750 40771 42180 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_12750 43120 42248 gene locus_tag LOCUS_12760 43120 42248 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_12760 43360 44655 gene locus_tag LOCUS_12770 43360 44655 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068626.1 protein_id gnl|my_center|LOCUS_12770 44652 45533 gene locus_tag LOCUS_12780 44652 45533 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051829.1 protein_id gnl|my_center|LOCUS_12780 45530 46378 gene locus_tag LOCUS_12790 45530 46378 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 protein_id gnl|my_center|LOCUS_12790 46757 48943 gene locus_tag LOCUS_12800 46757 48943 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296412.1 protein_id gnl|my_center|LOCUS_12800 48967 50247 gene locus_tag LOCUS_12810 gene galK 48967 50247 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_12810 50702 52231 gene locus_tag LOCUS_12820 gene cls 50702 52231 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_12820 52954 52316 gene locus_tag LOCUS_12830 52954 52316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 53869 55245 gene locus_tag LOCUS_12840 gene fumC 53869 55245 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456610.1 protein_id gnl|my_center|LOCUS_12840 55295 56077 gene locus_tag LOCUS_12850 55295 56077 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_12850 56090 56470 gene locus_tag LOCUS_12860 56090 56470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 56483 58483 gene locus_tag LOCUS_12870 56483 58483 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_12870 58474 58914 gene locus_tag LOCUS_12880 58474 58914 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_12880 58899 59873 gene locus_tag LOCUS_12890 58899 59873 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392333.1 protein_id gnl|my_center|LOCUS_12890 59873 60907 gene locus_tag LOCUS_12900 59873 60907 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_12900 60904 61764 gene locus_tag LOCUS_12910 60904 61764 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392335.1 protein_id gnl|my_center|LOCUS_12910 61783 62457 gene locus_tag LOCUS_12920 61783 62457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 62473 64074 gene locus_tag LOCUS_12930 62473 64074 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869524.1 protein_id gnl|my_center|LOCUS_12930 64441 67047 gene locus_tag LOCUS_12940 64441 67047 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949094.1 protein_id gnl|my_center|LOCUS_12940 68306 67110 gene locus_tag LOCUS_12950 gene hydF 68306 67110 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_12950 69737 68319 gene locus_tag LOCUS_12960 gene hydG 69737 68319 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203501.1 protein_id gnl|my_center|LOCUS_12960 70017 72146 gene locus_tag LOCUS_12970 70017 72146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 72504 72217 gene locus_tag LOCUS_12980 gene spoIIID 72504 72217 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_12980 72760 73620 gene locus_tag LOCUS_12990 72760 73620 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_12990 74571 73696 gene locus_tag LOCUS_13000 74571 73696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 76003 74597 gene locus_tag LOCUS_13010 76003 74597 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_13010 77811 76222 gene locus_tag LOCUS_13020 77811 76222 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_13020 78275 78532 gene locus_tag LOCUS_13030 78275 78532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 78789 81062 gene locus_tag LOCUS_13040 78789 81062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 81094 81606 gene locus_tag LOCUS_13050 gene feR 81094 81606 CDS product ferric-chelate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878333.1 protein_id gnl|my_center|LOCUS_13050 81847 82266 gene locus_tag LOCUS_13060 gene queD 81847 82266 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949100.1 protein_id gnl|my_center|LOCUS_13060 82270 82935 gene locus_tag LOCUS_13070 gene queE 82270 82935 CDS product putative 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966888.1 protein_id gnl|my_center|LOCUS_13070 82948 83508 gene locus_tag LOCUS_13080 gene folE 82948 83508 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966889.1 protein_id gnl|my_center|LOCUS_13080 83522 84208 gene locus_tag LOCUS_13090 gene queC 83522 84208 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_13090 84210 84707 gene locus_tag LOCUS_13100 gene queF 84210 84707 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918896.1 protein_id gnl|my_center|LOCUS_13100 84991 86409 gene locus_tag LOCUS_13110 84991 86409 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666065.1 protein_id gnl|my_center|LOCUS_13110 86624 87544 gene locus_tag LOCUS_13120 86624 87544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 87610 88059 gene locus_tag LOCUS_13130 87610 88059 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816014.1 protein_id gnl|my_center|LOCUS_13130 88183 89331 gene locus_tag LOCUS_13140 gene fucO 88183 89331 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 protein_id gnl|my_center|LOCUS_13140 89356 90147 gene locus_tag LOCUS_13150 89356 90147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 90309 91442 gene locus_tag LOCUS_13160 90309 91442 CDS product tyramine oxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014462.1 protein_id gnl|my_center|LOCUS_13160 91463 91789 gene locus_tag LOCUS_13170 91463 91789 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869719.1 protein_id gnl|my_center|LOCUS_13170 91786 93375 gene locus_tag LOCUS_13180 91786 93375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 93372 93692 gene locus_tag LOCUS_13190 93372 93692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 93689 94801 gene locus_tag LOCUS_13200 93689 94801 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267598.1 protein_id gnl|my_center|LOCUS_13200 94942 95304 gene locus_tag LOCUS_13210 94942 95304 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964000.1 protein_id gnl|my_center|LOCUS_13210 95335 96810 gene locus_tag LOCUS_13220 95335 96810 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084045.1 protein_id gnl|my_center|LOCUS_13220 96999 97829 gene locus_tag LOCUS_13230 96999 97829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 99139 97874 gene locus_tag LOCUS_13240 99139 97874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 99917 99144 gene locus_tag LOCUS_13250 99917 99144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 100396 101541 gene locus_tag LOCUS_13260 100396 101541 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_13260 103120 101621 gene locus_tag LOCUS_13270 gene galT 103120 101621 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence10 1301 903 gene locus_tag LOCUS_13280 1301 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 3087 1396 gene locus_tag LOCUS_13290 3087 1396 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_13290 4806 3124 gene locus_tag LOCUS_13300 4806 3124 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_13300 6588 4939 gene locus_tag LOCUS_13310 6588 4939 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_13310 8352 6670 gene locus_tag LOCUS_13320 8352 6670 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_13320 10074 8890 gene locus_tag LOCUS_13330 10074 8890 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_13330 10296 10380 gene locus_tag LOCUS_t00180 10296 10380 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10887 10399 gene locus_tag LOCUS_13340 10887 10399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13340 11346 10891 gene locus_tag LOCUS_13350 11346 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 12527 11343 gene locus_tag LOCUS_13360 12527 11343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 13997 13921 gene locus_tag LOCUS_t00190 13997 13921 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 16090 14204 gene locus_tag LOCUS_13370 16090 14204 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437164.1 protein_id gnl|my_center|LOCUS_13370 18844 16436 gene locus_tag LOCUS_13380 18844 16436 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141000.1 protein_id gnl|my_center|LOCUS_13380 19477 29130 gene locus_tag LOCUS_13390 19477 29130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 29317 30753 gene locus_tag LOCUS_13400 gene purB 29317 30753 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965127.1 protein_id gnl|my_center|LOCUS_13400 30905 31459 gene locus_tag LOCUS_13410 30905 31459 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_13410 32304 31501 gene locus_tag LOCUS_13420 32304 31501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 32686 34866 gene locus_tag LOCUS_13430 32686 34866 CDS product dockerin type I domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964237.1 protein_id gnl|my_center|LOCUS_13430 34863 35639 gene locus_tag LOCUS_13440 34863 35639 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727676.1 protein_id gnl|my_center|LOCUS_13440 35652 36629 gene locus_tag LOCUS_13450 gene manA 35652 36629 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_13450 36671 37615 gene locus_tag LOCUS_13460 gene glcK 36671 37615 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_13460 37920 40691 gene locus_tag LOCUS_13470 37920 40691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 41181 41915 gene locus_tag LOCUS_13480 41181 41915 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356899.1 protein_id gnl|my_center|LOCUS_13480 41985 42191 gene locus_tag LOCUS_13490 gene atpE 41985 42191 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356112.1 protein_id gnl|my_center|LOCUS_13490 42254 42460 gene locus_tag LOCUS_13500 gene atpE 42254 42460 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356112.1 protein_id gnl|my_center|LOCUS_13500 42546 43040 gene locus_tag LOCUS_13510 42546 43040 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019758.1 protein_id gnl|my_center|LOCUS_13510 43037 43540 gene locus_tag LOCUS_13520 43037 43540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 43550 45058 gene locus_tag LOCUS_13530 gene atpA 43550 45058 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_13530 45060 45956 gene locus_tag LOCUS_13540 gene atpG 45060 45956 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_13540 46037 47440 gene locus_tag LOCUS_13550 gene atpD 46037 47440 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_13550 47451 47867 gene locus_tag LOCUS_13560 gene atpC 47451 47867 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847211.1 protein_id gnl|my_center|LOCUS_13560 48325 47924 gene locus_tag LOCUS_13570 48325 47924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 48555 48322 gene locus_tag LOCUS_13580 48555 48322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 50714 49326 gene locus_tag LOCUS_13590 50714 49326 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_13590 51457 50876 gene locus_tag LOCUS_13600 51457 50876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 52051 51656 gene locus_tag LOCUS_13610 52051 51656 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966724.1 protein_id gnl|my_center|LOCUS_13610 52646 52044 gene locus_tag LOCUS_13620 52646 52044 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924525.1 protein_id gnl|my_center|LOCUS_13620 53124 54053 gene locus_tag LOCUS_13630 gene hrcA 53124 54053 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_13630 54070 54762 gene locus_tag LOCUS_13640 54070 54762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 54778 55398 gene locus_tag LOCUS_13650 54778 55398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 55502 57367 gene locus_tag LOCUS_13660 gene dnaK 55502 57367 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_13660 57542 58711 gene locus_tag LOCUS_13670 gene dnaJ 57542 58711 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142730484.1 protein_id gnl|my_center|LOCUS_13670 59127 58768 gene locus_tag LOCUS_13680 59127 58768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 60448 59618 gene locus_tag LOCUS_13690 gene rsmI 60448 59618 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530019.1 protein_id gnl|my_center|LOCUS_13690 61125 60469 gene locus_tag LOCUS_13700 61125 60469 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390012.1 protein_id gnl|my_center|LOCUS_13700 62732 61140 gene locus_tag LOCUS_13710 62732 61140 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_13710 63407 62820 gene locus_tag LOCUS_13720 63407 62820 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965241.1 protein_id gnl|my_center|LOCUS_13720 64958 63672 gene locus_tag LOCUS_13730 64958 63672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 65484 64936 gene locus_tag LOCUS_13740 65484 64936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 65693 67732 gene locus_tag LOCUS_13750 65693 67732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 68078 67893 gene locus_tag LOCUS_13760 68078 67893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 70307 68214 gene locus_tag LOCUS_13770 gene feoB 70307 68214 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439379.1 protein_id gnl|my_center|LOCUS_13770 71985 70609 gene locus_tag LOCUS_13780 71985 70609 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680439.1 protein_id gnl|my_center|LOCUS_13780 72837 72130 gene locus_tag LOCUS_13790 72837 72130 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_13790 73793 72915 gene locus_tag LOCUS_13800 73793 72915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 75118 73889 gene locus_tag LOCUS_13810 75118 73889 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861133.1 protein_id gnl|my_center|LOCUS_13810 75368 76561 gene locus_tag LOCUS_13820 75368 76561 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_13820 76645 77046 gene locus_tag LOCUS_13830 76645 77046 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_13830 77293 77078 gene locus_tag LOCUS_13840 77293 77078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 77912 78634 gene locus_tag LOCUS_13850 77912 78634 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_13850 78880 80766 gene locus_tag LOCUS_13860 78880 80766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 80796 81188 gene locus_tag LOCUS_13870 80796 81188 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_13870 82979 81348 gene locus_tag LOCUS_13880 gene groL 82979 81348 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_13880 83319 83026 gene locus_tag LOCUS_13890 gene groES 83319 83026 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567052.1 protein_id gnl|my_center|LOCUS_13890 83874 84572 gene locus_tag LOCUS_13900 83874 84572 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_13900 84650 86077 gene locus_tag LOCUS_13910 84650 86077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 86144 87874 gene locus_tag LOCUS_13920 86144 87874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 89357 87954 gene locus_tag LOCUS_13930 89357 87954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 89699 91354 gene locus_tag LOCUS_13940 89699 91354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 91411 93042 gene locus_tag LOCUS_13950 91411 93042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 93177 93872 gene locus_tag LOCUS_13960 gene azlC 93177 93872 CDS product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969035.1 protein_id gnl|my_center|LOCUS_13960 93869 94198 gene locus_tag LOCUS_13970 gene azlD 93869 94198 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_13970 94677 94204 gene locus_tag LOCUS_13980 94677 94204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 95129 94689 gene locus_tag LOCUS_13990 95129 94689 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868208.1 protein_id gnl|my_center|LOCUS_13990 95719 96993 gene locus_tag LOCUS_14000 95719 96993 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048438.1 protein_id gnl|my_center|LOCUS_14000 97131 98375 gene locus_tag LOCUS_14010 gene rmuC 97131 98375 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793488.1 protein_id gnl|my_center|LOCUS_14010 99917 98457 gene locus_tag LOCUS_14020 99917 98457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 101126 100014 gene locus_tag LOCUS_14030 101126 100014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 >Feature sequence11 55 642 gene locus_tag LOCUS_14040 55 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 644 796 gene locus_tag LOCUS_14050 644 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 983 1276 gene locus_tag LOCUS_14060 983 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1403 1639 gene locus_tag LOCUS_14070 1403 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 2553 1921 gene locus_tag LOCUS_14080 2553 1921 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_14080 2808 2554 gene locus_tag LOCUS_14090 gene cotJB 2808 2554 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002157501.1 protein_id gnl|my_center|LOCUS_14090 3073 2801 gene locus_tag LOCUS_14100 3073 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 3297 4109 gene locus_tag LOCUS_14110 3297 4109 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464970.1 protein_id gnl|my_center|LOCUS_14110 4276 4740 gene locus_tag LOCUS_14120 4276 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 4798 5811 gene locus_tag LOCUS_14130 4798 5811 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_14130 6054 7460 gene locus_tag LOCUS_14140 6054 7460 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964872.1 protein_id gnl|my_center|LOCUS_14140 7478 9151 gene locus_tag LOCUS_14150 7478 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 9164 10963 gene locus_tag LOCUS_14160 9164 10963 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336813.1 protein_id gnl|my_center|LOCUS_14160 10960 11238 gene locus_tag LOCUS_14170 10960 11238 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291951.1 protein_id gnl|my_center|LOCUS_14170 11779 11549 gene locus_tag LOCUS_14180 11779 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 12545 11805 gene locus_tag LOCUS_14190 gene thiF 12545 11805 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821634.1 protein_id gnl|my_center|LOCUS_14190 13278 12562 gene locus_tag LOCUS_14200 13278 12562 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_14200 15314 13275 gene locus_tag LOCUS_14210 15314 13275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 15633 15334 gene locus_tag LOCUS_14220 15633 15334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 16256 15576 gene locus_tag LOCUS_14230 16256 15576 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_14230 17176 16259 gene locus_tag LOCUS_14240 gene nadA 17176 16259 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066395.1 protein_id gnl|my_center|LOCUS_14240 17580 19502 gene locus_tag LOCUS_14250 17580 19502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 19516 21333 gene locus_tag LOCUS_14260 19516 21333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 21281 22033 gene locus_tag LOCUS_14270 21281 22033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 22930 22097 gene locus_tag LOCUS_14280 22930 22097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 24949 23144 gene locus_tag LOCUS_14290 gene lepA 24949 23144 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030952.1 protein_id gnl|my_center|LOCUS_14290 25923 25054 gene locus_tag LOCUS_14300 25923 25054 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547989.1 protein_id gnl|my_center|LOCUS_14300 26862 25936 gene locus_tag LOCUS_14310 26862 25936 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 protein_id gnl|my_center|LOCUS_14310 27109 28161 gene locus_tag LOCUS_14320 gene cobT 27109 28161 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_14320 28172 30103 gene locus_tag LOCUS_14330 28172 30103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 31961 30204 gene locus_tag LOCUS_14340 31961 30204 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_14340 33710 31974 gene locus_tag LOCUS_14350 33710 31974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_14350 33919 34659 gene locus_tag LOCUS_14360 33919 34659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 35307 34702 gene locus_tag LOCUS_14370 35307 34702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 36615 35326 gene locus_tag LOCUS_14380 36615 35326 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831857.1 protein_id gnl|my_center|LOCUS_14380 36751 38220 gene locus_tag LOCUS_14390 36751 38220 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890705.1 protein_id gnl|my_center|LOCUS_14390 38213 39211 gene locus_tag LOCUS_14400 38213 39211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 39208 40125 gene locus_tag LOCUS_14410 39208 40125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 42059 40224 gene locus_tag LOCUS_14420 42059 40224 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391166.1 protein_id gnl|my_center|LOCUS_14420 42312 42121 gene locus_tag LOCUS_14430 42312 42121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 42406 43410 gene locus_tag LOCUS_14440 gene dusB 42406 43410 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_14440 43575 43889 gene locus_tag LOCUS_14450 43575 43889 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_14450 43953 46490 gene locus_tag LOCUS_14460 43953 46490 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_14460 46650 49667 gene locus_tag LOCUS_14470 46650 49667 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054447.1 protein_id gnl|my_center|LOCUS_14470 51355 49757 gene locus_tag LOCUS_14480 gene hcp 51355 49757 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_14480 52054 51356 gene locus_tag LOCUS_14490 52054 51356 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459260.1 protein_id gnl|my_center|LOCUS_14490 52172 52831 gene locus_tag LOCUS_14500 52172 52831 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459526.1 protein_id gnl|my_center|LOCUS_14500 53345 52935 gene locus_tag LOCUS_14510 53345 52935 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_14510 53979 53407 gene locus_tag LOCUS_14520 53979 53407 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_14520 54809 54192 gene locus_tag LOCUS_14530 54809 54192 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_14530 56150 54915 gene locus_tag LOCUS_14540 56150 54915 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021729.1 protein_id gnl|my_center|LOCUS_14540 56735 56163 gene locus_tag LOCUS_14550 56735 56163 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392451.1 protein_id gnl|my_center|LOCUS_14550 58542 56728 gene locus_tag LOCUS_14560 gene iorA 58542 56728 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021731.1 protein_id gnl|my_center|LOCUS_14560 61415 58929 gene locus_tag LOCUS_14570 61415 58929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 64249 61430 gene locus_tag LOCUS_14580 64249 61430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 65500 64328 gene locus_tag LOCUS_14590 65500 64328 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108595.1 protein_id gnl|my_center|LOCUS_14590 66685 65513 gene locus_tag LOCUS_14600 66685 65513 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583022.1 protein_id gnl|my_center|LOCUS_14600 67907 66888 gene locus_tag LOCUS_14610 67907 66888 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_14610 68776 67925 gene locus_tag LOCUS_14620 68776 67925 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_14620 69735 68773 gene locus_tag LOCUS_14630 69735 68773 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_14630 71131 69764 gene locus_tag LOCUS_14640 71131 69764 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_14640 72465 71458 gene locus_tag LOCUS_14650 72465 71458 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_14650 72693 73391 gene locus_tag LOCUS_14660 gene vanR 72693 73391 CDS product vancomycin resistance response regulator transcriptoin factor VanR-G-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436401.1 protein_id gnl|my_center|LOCUS_14660 73384 74721 gene locus_tag LOCUS_14670 73384 74721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 74815 75483 gene locus_tag LOCUS_14680 74815 75483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 75623 77248 gene locus_tag LOCUS_14690 75623 77248 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964230.1 protein_id gnl|my_center|LOCUS_14690 77833 77333 gene locus_tag LOCUS_14700 77833 77333 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807782.1 protein_id gnl|my_center|LOCUS_14700 81444 77935 gene locus_tag LOCUS_14710 81444 77935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 82205 81741 gene locus_tag LOCUS_14720 82205 81741 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028534.1 protein_id gnl|my_center|LOCUS_14720 82467 84833 gene locus_tag LOCUS_14730 82467 84833 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983425.1 protein_id gnl|my_center|LOCUS_14730 84848 85618 gene locus_tag LOCUS_14740 84848 85618 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 protein_id gnl|my_center|LOCUS_14740 85698 86360 gene locus_tag LOCUS_14750 gene regX 85698 86360 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876914.1 protein_id gnl|my_center|LOCUS_14750 86441 87565 gene locus_tag LOCUS_14760 86441 87565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 87593 89791 gene locus_tag LOCUS_14770 87593 89791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 90394 89912 gene locus_tag LOCUS_14780 90394 89912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 91180 90539 gene locus_tag LOCUS_14790 91180 90539 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 protein_id gnl|my_center|LOCUS_14790 93793 92816 gene locus_tag LOCUS_14800 93793 92816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 93840 94037 gene locus_tag LOCUS_14810 93840 94037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 95529 94210 gene locus_tag LOCUS_14820 95529 94210 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860860.1 protein_id gnl|my_center|LOCUS_14820 96260 95526 gene locus_tag LOCUS_14830 96260 95526 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_14830 96614 97798 gene locus_tag LOCUS_14840 gene larC 96614 97798 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence12 213 521 gene locus_tag LOCUS_14850 213 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 756 2471 gene locus_tag LOCUS_14860 756 2471 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_14860 3442 2591 gene locus_tag LOCUS_14870 gene ispE 3442 2591 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966185.1 protein_id gnl|my_center|LOCUS_14870 4620 3445 gene locus_tag LOCUS_14880 4620 3445 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_14880 5132 4650 gene locus_tag LOCUS_14890 5132 4650 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_14890 6017 5172 gene locus_tag LOCUS_14900 6017 5172 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459478.1 protein_id gnl|my_center|LOCUS_14900 7159 6362 gene locus_tag LOCUS_14910 gene trpA 7159 6362 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966434.1 protein_id gnl|my_center|LOCUS_14910 8339 7152 gene locus_tag LOCUS_14920 gene trpB 8339 7152 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966435.1 protein_id gnl|my_center|LOCUS_14920 8958 8332 gene locus_tag LOCUS_14930 8958 8332 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_14930 9740 8955 gene locus_tag LOCUS_14940 gene trpC 9740 8955 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221930.1 protein_id gnl|my_center|LOCUS_14940 11384 9750 gene locus_tag LOCUS_14950 11384 9750 CDS product bifunctional anthranilate synthase component II/anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943371.1 protein_id gnl|my_center|LOCUS_14950 12847 11381 gene locus_tag LOCUS_14960 gene trpE 12847 11381 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113204.1 protein_id gnl|my_center|LOCUS_14960 13373 14158 gene locus_tag LOCUS_14970 13373 14158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 15173 14133 gene locus_tag LOCUS_14980 15173 14133 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965779.1 protein_id gnl|my_center|LOCUS_14980 16787 15189 gene locus_tag LOCUS_14990 16787 15189 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435782.1 protein_id gnl|my_center|LOCUS_14990 17552 16821 gene locus_tag LOCUS_15000 17552 16821 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 protein_id gnl|my_center|LOCUS_15000 18612 17686 gene locus_tag LOCUS_15010 gene cysK 18612 17686 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_15010 19398 18643 gene locus_tag LOCUS_15020 19398 18643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 20031 19411 gene locus_tag LOCUS_15030 20031 19411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 20598 20059 gene locus_tag LOCUS_15040 20598 20059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675099.1 protein_id gnl|my_center|LOCUS_15040 20795 21493 gene locus_tag LOCUS_15050 20795 21493 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943112.1 protein_id gnl|my_center|LOCUS_15050 21490 21789 gene locus_tag LOCUS_15060 21490 21789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 22031 22582 gene locus_tag LOCUS_15070 22031 22582 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 protein_id gnl|my_center|LOCUS_15070 22557 23960 gene locus_tag LOCUS_15080 22557 23960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 25358 24327 gene locus_tag LOCUS_15090 gene tsaD 25358 24327 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_15090 26558 25428 gene locus_tag LOCUS_15100 26558 25428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 27001 26555 gene locus_tag LOCUS_15110 gene rimI 27001 26555 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056042.1 protein_id gnl|my_center|LOCUS_15110 29576 26985 gene locus_tag LOCUS_15120 gene polA 29576 26985 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048038.1 protein_id gnl|my_center|LOCUS_15120 30118 30043 gene locus_tag LOCUS_t00200 30118 30043 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 30536 30252 gene locus_tag LOCUS_15130 30536 30252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 30887 30555 gene locus_tag LOCUS_15140 30887 30555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 32066 31047 gene locus_tag LOCUS_15150 32066 31047 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_15150 32779 32087 gene locus_tag LOCUS_15160 32779 32087 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_15160 33041 34387 gene locus_tag LOCUS_15170 33041 34387 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_15170 34469 35068 gene locus_tag LOCUS_15180 gene thrH 34469 35068 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_15180 35081 35338 gene locus_tag LOCUS_15190 35081 35338 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595964.1 protein_id gnl|my_center|LOCUS_15190 35344 35667 gene locus_tag LOCUS_15200 35344 35667 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943224.1 protein_id gnl|my_center|LOCUS_15200 36517 35753 gene locus_tag LOCUS_15210 36517 35753 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_15210 37711 36518 gene locus_tag LOCUS_15220 37711 36518 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094666698.1 protein_id gnl|my_center|LOCUS_15220 37949 40348 gene locus_tag LOCUS_15230 37949 40348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 40352 41335 gene locus_tag LOCUS_15240 40352 41335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 44549 41502 gene locus_tag LOCUS_15250 44549 41502 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963882.1 protein_id gnl|my_center|LOCUS_15250 45776 44805 gene locus_tag LOCUS_15260 45776 44805 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013877237.1 protein_id gnl|my_center|LOCUS_15260 47071 45869 gene locus_tag LOCUS_15270 47071 45869 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_15270 48644 47151 gene locus_tag LOCUS_15280 48644 47151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 49580 48675 gene locus_tag LOCUS_15290 gene ftsX 49580 48675 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968247.1 protein_id gnl|my_center|LOCUS_15290 50259 49570 gene locus_tag LOCUS_15300 gene ftsE 50259 49570 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963819.1 protein_id gnl|my_center|LOCUS_15300 51565 50480 gene locus_tag LOCUS_15310 51565 50480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 53495 51804 gene locus_tag LOCUS_15320 gene argS 53495 51804 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_15320 53939 53499 gene locus_tag LOCUS_15330 53939 53499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 54807 53968 gene locus_tag LOCUS_15340 gene murI 54807 53968 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_15340 55908 54838 gene locus_tag LOCUS_15350 55908 54838 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_15350 56406 56555 gene locus_tag LOCUS_15360 gene rpmG 56406 56555 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_15360 56571 56885 gene locus_tag LOCUS_15370 56571 56885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 56916 57443 gene locus_tag LOCUS_15380 gene nusG 56916 57443 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_15380 57542 57967 gene locus_tag LOCUS_15390 gene rplK 57542 57967 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966425.1 protein_id gnl|my_center|LOCUS_15390 58062 58757 gene locus_tag LOCUS_15400 gene rplA 58062 58757 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966424.1 protein_id gnl|my_center|LOCUS_15400 59065 59577 gene locus_tag LOCUS_15410 gene rplJ 59065 59577 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_15410 59638 60012 gene locus_tag LOCUS_15420 gene rplL 59638 60012 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832283.1 protein_id gnl|my_center|LOCUS_15420 60339 60085 gene locus_tag LOCUS_15430 60339 60085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 60711 60355 gene locus_tag LOCUS_15440 60711 60355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 61104 60742 gene locus_tag LOCUS_15450 61104 60742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 61426 61178 gene locus_tag LOCUS_15460 61426 61178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 61520 62023 gene locus_tag LOCUS_15470 61520 62023 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357651.1 protein_id gnl|my_center|LOCUS_15470 62080 64584 gene locus_tag LOCUS_15480 62080 64584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 64586 65131 gene locus_tag LOCUS_15490 gene nudF 64586 65131 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398600.1 protein_id gnl|my_center|LOCUS_15490 65556 65242 gene locus_tag LOCUS_15500 65556 65242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 65767 67230 gene locus_tag LOCUS_15510 gene murC 65767 67230 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425936.1 protein_id gnl|my_center|LOCUS_15510 67342 67698 gene locus_tag LOCUS_15520 67342 67698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 67695 69737 gene locus_tag LOCUS_15530 67695 69737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 69750 70190 gene locus_tag LOCUS_15540 gene dut 69750 70190 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808844.1 protein_id gnl|my_center|LOCUS_15540 70212 70475 gene locus_tag LOCUS_15550 70212 70475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 70935 71954 gene locus_tag LOCUS_15560 70935 71954 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_15560 71974 72834 gene locus_tag LOCUS_15570 gene mreC 71974 72834 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546337.1 protein_id gnl|my_center|LOCUS_15570 72821 73405 gene locus_tag LOCUS_15580 72821 73405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 73483 75573 gene locus_tag LOCUS_15590 73483 75573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 75794 76198 gene locus_tag LOCUS_15600 gene mgsA 75794 76198 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684755.1 protein_id gnl|my_center|LOCUS_15600 76319 77635 gene locus_tag LOCUS_15610 gene hisS 76319 77635 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422928.1 protein_id gnl|my_center|LOCUS_15610 77638 79419 gene locus_tag LOCUS_15620 gene aspS 77638 79419 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_15620 80857 79514 gene locus_tag LOCUS_15630 80857 79514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 81981 80854 gene locus_tag LOCUS_15640 81981 80854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 82916 81972 gene locus_tag LOCUS_15650 82916 81972 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057395.1 protein_id gnl|my_center|LOCUS_15650 84419 83055 gene locus_tag LOCUS_15660 84419 83055 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671452.1 protein_id gnl|my_center|LOCUS_15660 84970 84419 gene locus_tag LOCUS_15670 gene hpt 84970 84419 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817255.1 protein_id gnl|my_center|LOCUS_15670 86594 84987 gene locus_tag LOCUS_15680 86594 84987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 88013 86649 gene locus_tag LOCUS_15690 88013 86649 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052123.1 protein_id gnl|my_center|LOCUS_15690 88613 88026 gene locus_tag LOCUS_15700 88613 88026 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947081.1 protein_id gnl|my_center|LOCUS_15700 89667 88765 gene locus_tag LOCUS_15710 89667 88765 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059807.1 protein_id gnl|my_center|LOCUS_15710 90918 89776 gene locus_tag LOCUS_15720 90918 89776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 91135 90923 gene locus_tag LOCUS_15730 91135 90923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 91643 91212 gene locus_tag LOCUS_15740 91643 91212 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_15740 92865 91636 gene locus_tag LOCUS_15750 92865 91636 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_15750 93922 92867 gene locus_tag LOCUS_15760 gene sufD 93922 92867 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_15760 95321 93915 gene locus_tag LOCUS_15770 gene sufB 95321 93915 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_15770 96110 95358 gene locus_tag LOCUS_15780 gene sufC 96110 95358 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_15780 96538 96107 gene locus_tag LOCUS_15790 gene iscR 96538 96107 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705634.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence13 275 1135 gene locus_tag LOCUS_15800 275 1135 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_15800 1132 2142 gene locus_tag LOCUS_15810 gene prmA 1132 2142 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861555.1 protein_id gnl|my_center|LOCUS_15810 2145 3032 gene locus_tag LOCUS_15820 2145 3032 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421907.1 protein_id gnl|my_center|LOCUS_15820 3691 3119 gene locus_tag LOCUS_15830 gene pdxT 3691 3119 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689963.1 protein_id gnl|my_center|LOCUS_15830 4563 3691 gene locus_tag LOCUS_15840 gene pdxS 4563 3691 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813582.1 protein_id gnl|my_center|LOCUS_15840 5542 4826 gene locus_tag LOCUS_15850 5542 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 6179 7627 gene locus_tag LOCUS_15860 6179 7627 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922718.1 protein_id gnl|my_center|LOCUS_15860 7617 8327 gene locus_tag LOCUS_15870 7617 8327 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895848.1 protein_id gnl|my_center|LOCUS_15870 8324 10099 gene locus_tag LOCUS_15880 8324 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 10114 11385 gene locus_tag LOCUS_15890 10114 11385 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244568.1 protein_id gnl|my_center|LOCUS_15890 11791 11648 gene locus_tag LOCUS_15900 11791 11648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 13895 12306 gene locus_tag LOCUS_15910 13895 12306 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438168.1 protein_id gnl|my_center|LOCUS_15910 14208 15701 gene locus_tag LOCUS_15920 gene glgA 14208 15701 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_15920 15871 16200 gene locus_tag LOCUS_15930 15871 16200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 16802 18724 gene locus_tag LOCUS_15940 16802 18724 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011178617.1 protein_id gnl|my_center|LOCUS_15940 20120 18813 gene locus_tag LOCUS_15950 20120 18813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 20440 20515 gene locus_tag LOCUS_t00210 20440 20515 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 20547 20620 gene locus_tag LOCUS_t00220 20547 20620 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 20935 21720 gene locus_tag LOCUS_15960 20935 21720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 21876 21951 gene locus_tag LOCUS_t00230 21876 21951 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 22245 22320 gene locus_tag LOCUS_t00240 22245 22320 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 22323 22399 gene locus_tag LOCUS_t00250 22323 22399 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 22402 22477 gene locus_tag LOCUS_t00260 22402 22477 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 22481 22555 gene locus_tag LOCUS_t00270 22481 22555 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 22715 23458 gene locus_tag LOCUS_15970 22715 23458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 23796 23611 gene locus_tag LOCUS_15980 gene rpmB 23796 23611 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_15980 24207 24884 gene locus_tag LOCUS_15990 24207 24884 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545727.1 protein_id gnl|my_center|LOCUS_15990 24889 25644 gene locus_tag LOCUS_16000 gene scpA 24889 25644 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199758.1 protein_id gnl|my_center|LOCUS_16000 25701 26243 gene locus_tag LOCUS_16010 gene scpB 25701 26243 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428258.1 protein_id gnl|my_center|LOCUS_16010 26265 26927 gene locus_tag LOCUS_16020 26265 26927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 26943 27350 gene locus_tag LOCUS_16030 gene ytfJ 26943 27350 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402813.1 protein_id gnl|my_center|LOCUS_16030 27418 28653 gene locus_tag LOCUS_16040 27418 28653 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_16040 28581 29342 gene locus_tag LOCUS_16050 28581 29342 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_16050 29400 30347 gene locus_tag LOCUS_16060 gene metA 29400 30347 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_16060 31748 30495 gene locus_tag LOCUS_16070 31748 30495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890480.1 protein_id gnl|my_center|LOCUS_16070 32925 32479 gene locus_tag LOCUS_16080 32925 32479 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_16080 35084 33006 gene locus_tag LOCUS_16090 35084 33006 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423561.1 protein_id gnl|my_center|LOCUS_16090 35428 36354 gene locus_tag LOCUS_16100 35428 36354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 39198 36430 gene locus_tag LOCUS_16110 39198 36430 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964234.1 protein_id gnl|my_center|LOCUS_16110 39625 39326 gene locus_tag LOCUS_16120 39625 39326 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_16120 41726 40005 gene locus_tag LOCUS_16130 41726 40005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 42807 41974 gene locus_tag LOCUS_16140 42807 41974 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_16140 43799 42993 gene locus_tag LOCUS_16150 43799 42993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 45402 43876 gene locus_tag LOCUS_16160 gene xylB 45402 43876 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324985.1 protein_id gnl|my_center|LOCUS_16160 45741 45989 gene locus_tag LOCUS_16170 45741 45989 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357396.1 protein_id gnl|my_center|LOCUS_16170 46467 46069 gene locus_tag LOCUS_16180 46467 46069 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355907.1 protein_id gnl|my_center|LOCUS_16180 46841 46503 gene locus_tag LOCUS_16190 46841 46503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 47140 46838 gene locus_tag LOCUS_16200 47140 46838 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399122.1 protein_id gnl|my_center|LOCUS_16200 47588 47181 gene locus_tag LOCUS_16210 47588 47181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 48063 47644 gene locus_tag LOCUS_16220 48063 47644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 49539 48121 gene locus_tag LOCUS_16230 gene glgA 49539 48121 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_16230 50823 49699 gene locus_tag LOCUS_16240 gene glgD 50823 49699 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_16240 52041 50839 gene locus_tag LOCUS_16250 gene glgC 52041 50839 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_16250 54143 52110 gene locus_tag LOCUS_16260 gene glgB 54143 52110 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880434.1 protein_id gnl|my_center|LOCUS_16260 56701 54452 gene locus_tag LOCUS_16270 gene spoIIE 56701 54452 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966481.1 protein_id gnl|my_center|LOCUS_16270 58034 57111 gene locus_tag LOCUS_16280 58034 57111 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813143.1 protein_id gnl|my_center|LOCUS_16280 58723 58046 gene locus_tag LOCUS_16290 58723 58046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 59596 58739 gene locus_tag LOCUS_16300 gene modD 59596 58739 CDS product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814376.1 protein_id gnl|my_center|LOCUS_16300 59871 60791 gene locus_tag LOCUS_16310 59871 60791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 61002 61946 gene locus_tag LOCUS_16320 61002 61946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 62979 62029 gene locus_tag LOCUS_16330 62979 62029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 63140 63054 gene locus_tag LOCUS_t00280 63140 63054 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 63312 63226 gene locus_tag LOCUS_t00290 63312 63226 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 63450 63364 gene locus_tag LOCUS_t00300 63450 63364 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 63721 64851 gene locus_tag LOCUS_16340 63721 64851 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_16340 64888 66066 gene locus_tag LOCUS_16350 gene thiI 64888 66066 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_16350 66091 66672 gene locus_tag LOCUS_16360 66091 66672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 66645 68036 gene locus_tag LOCUS_16370 66645 68036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 68037 68843 gene locus_tag LOCUS_16380 68037 68843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 68959 70062 gene locus_tag LOCUS_16390 68959 70062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 70212 70781 gene locus_tag LOCUS_16400 70212 70781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 70931 72229 gene locus_tag LOCUS_16410 70931 72229 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048134.1 protein_id gnl|my_center|LOCUS_16410 72240 72926 gene locus_tag LOCUS_16420 72240 72926 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504032.1 protein_id gnl|my_center|LOCUS_16420 72955 73104 gene locus_tag LOCUS_16430 72955 73104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 74966 73293 gene locus_tag LOCUS_16440 74966 73293 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048148.1 protein_id gnl|my_center|LOCUS_16440 75274 75792 gene locus_tag LOCUS_16450 75274 75792 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289559.1 protein_id gnl|my_center|LOCUS_16450 76046 76687 gene locus_tag LOCUS_16460 gene thiE 76046 76687 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_16460 76684 77487 gene locus_tag LOCUS_16470 gene thiD 76684 77487 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055440.1 protein_id gnl|my_center|LOCUS_16470 77494 78810 gene locus_tag LOCUS_16480 gene thiC 77494 78810 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047970.1 protein_id gnl|my_center|LOCUS_16480 79087 79500 gene locus_tag LOCUS_16490 79087 79500 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357560.1 protein_id gnl|my_center|LOCUS_16490 79516 80058 gene locus_tag LOCUS_16500 79516 80058 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_16500 80144 81436 gene locus_tag LOCUS_16510 80144 81436 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416818.1 protein_id gnl|my_center|LOCUS_16510 81455 82330 gene locus_tag LOCUS_16520 81455 82330 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681080.1 protein_id gnl|my_center|LOCUS_16520 86136 82660 gene locus_tag LOCUS_16530 gene xynA 86136 82660 CDS product endo-1,4-beta-xylanase XynA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082550.1 protein_id gnl|my_center|LOCUS_16530 87052 86291 gene locus_tag LOCUS_16540 87052 86291 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_16540 87290 88699 gene locus_tag LOCUS_16550 87290 88699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence14 631 2559 gene locus_tag LOCUS_16560 631 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 2676 3515 gene locus_tag LOCUS_16570 2676 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 3647 4162 gene locus_tag LOCUS_16580 3647 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 4374 4246 gene locus_tag LOCUS_16590 4374 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 4868 6820 gene locus_tag LOCUS_16600 gene metG 4868 6820 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_16600 8434 7133 gene locus_tag LOCUS_16610 8434 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 10655 8763 gene locus_tag LOCUS_16620 10655 8763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 12157 10841 gene locus_tag LOCUS_16630 12157 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 12740 12252 gene locus_tag LOCUS_16640 12740 12252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 14597 12759 gene locus_tag LOCUS_16650 14597 12759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 16265 14616 gene locus_tag LOCUS_16660 16265 14616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 19199 16578 gene locus_tag LOCUS_16670 19199 16578 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_16670 20213 19425 gene locus_tag LOCUS_16680 20213 19425 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966354.1 protein_id gnl|my_center|LOCUS_16680 22339 20393 gene locus_tag LOCUS_16690 gene thrS 22339 20393 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229473.1 protein_id gnl|my_center|LOCUS_16690 23684 22914 gene locus_tag LOCUS_16700 gene tam 23684 22914 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530924.1 protein_id gnl|my_center|LOCUS_16700 24331 23681 gene locus_tag LOCUS_16710 24331 23681 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_16710 25181 24297 gene locus_tag LOCUS_16720 25181 24297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 26069 25203 gene locus_tag LOCUS_16730 26069 25203 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427637.1 protein_id gnl|my_center|LOCUS_16730 27080 26112 gene locus_tag LOCUS_16740 gene holB 27080 26112 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_16740 28418 27090 gene locus_tag LOCUS_16750 28418 27090 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143476.1 protein_id gnl|my_center|LOCUS_16750 28682 28452 gene locus_tag LOCUS_16760 28682 28452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 28963 28730 gene locus_tag LOCUS_16770 28963 28730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 29756 29130 gene locus_tag LOCUS_16780 29756 29130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 30056 29886 gene locus_tag LOCUS_16790 30056 29886 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888017.1 protein_id gnl|my_center|LOCUS_16790 30490 30161 gene locus_tag LOCUS_16800 30490 30161 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_16800 32232 30646 gene locus_tag LOCUS_16810 gene rny 32232 30646 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_16810 33700 32858 gene locus_tag LOCUS_16820 gene nadC 33700 32858 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_16820 35208 33748 gene locus_tag LOCUS_16830 gene nadB 35208 33748 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764756.1 protein_id gnl|my_center|LOCUS_16830 35665 36201 gene locus_tag LOCUS_16840 35665 36201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 36275 36697 gene locus_tag LOCUS_16850 36275 36697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 36886 37233 gene locus_tag LOCUS_16860 36886 37233 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637688.1 protein_id gnl|my_center|LOCUS_16860 37565 37230 gene locus_tag LOCUS_16870 37565 37230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 37812 37552 gene locus_tag LOCUS_16880 gene rpsT 37812 37552 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358111.1 protein_id gnl|my_center|LOCUS_16880 38100 38957 gene locus_tag LOCUS_16890 gene gpr 38100 38957 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_16890 39338 39628 gene locus_tag LOCUS_16900 gene rpsF 39338 39628 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_16900 39654 40196 gene locus_tag LOCUS_16910 39654 40196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 40243 40485 gene locus_tag LOCUS_16920 gene rpsR 40243 40485 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_16920 40842 41615 gene locus_tag LOCUS_16930 gene thyX 40842 41615 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099542.1 protein_id gnl|my_center|LOCUS_16930 41599 42276 gene locus_tag LOCUS_16940 41599 42276 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892113.1 protein_id gnl|my_center|LOCUS_16940 42270 43178 gene locus_tag LOCUS_16950 42270 43178 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108933.1 protein_id gnl|my_center|LOCUS_16950 43261 43803 gene locus_tag LOCUS_16960 43261 43803 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673829.1 protein_id gnl|my_center|LOCUS_16960 43796 44392 gene locus_tag LOCUS_16970 43796 44392 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834298.1 protein_id gnl|my_center|LOCUS_16970 44385 45938 gene locus_tag LOCUS_16980 44385 45938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 45922 47142 gene locus_tag LOCUS_16990 45922 47142 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_16990 47155 47883 gene locus_tag LOCUS_17000 47155 47883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 48692 47949 gene locus_tag LOCUS_17010 48692 47949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 49959 48697 gene locus_tag LOCUS_17020 49959 48697 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674871.1 protein_id gnl|my_center|LOCUS_17020 50910 50452 gene locus_tag LOCUS_17030 50910 50452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 52095 51307 gene locus_tag LOCUS_17040 gene proB 52095 51307 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_17040 53061 52111 gene locus_tag LOCUS_17050 53061 52111 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938705.1 protein_id gnl|my_center|LOCUS_17050 53390 53058 gene locus_tag LOCUS_17060 53390 53058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 54257 53571 gene locus_tag LOCUS_17070 54257 53571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 55524 54529 gene locus_tag LOCUS_17080 55524 54529 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_17080 58040 55545 gene locus_tag LOCUS_17090 58040 55545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 59312 58119 gene locus_tag LOCUS_17100 59312 58119 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021204.1 protein_id gnl|my_center|LOCUS_17100 60504 59317 gene locus_tag LOCUS_17110 60504 59317 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842681.1 protein_id gnl|my_center|LOCUS_17110 61712 60612 gene locus_tag LOCUS_17120 61712 60612 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_17120 62200 61709 gene locus_tag LOCUS_17130 62200 61709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 63220 62216 gene locus_tag LOCUS_17140 63220 62216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 64584 63229 gene locus_tag LOCUS_17150 64584 63229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_17150 65361 64585 gene locus_tag LOCUS_17160 65361 64585 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_17160 66123 65884 gene locus_tag LOCUS_17170 66123 65884 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081111.1 protein_id gnl|my_center|LOCUS_17170 67039 66221 gene locus_tag LOCUS_17180 67039 66221 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048421.1 protein_id gnl|my_center|LOCUS_17180 67902 67042 gene locus_tag LOCUS_17190 gene accD 67902 67042 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 protein_id gnl|my_center|LOCUS_17190 69288 67918 gene locus_tag LOCUS_17200 69288 67918 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 protein_id gnl|my_center|LOCUS_17200 69738 69301 gene locus_tag LOCUS_17210 gene fabZ 69738 69301 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447678.1 protein_id gnl|my_center|LOCUS_17210 70212 69751 gene locus_tag LOCUS_17220 gene accB 70212 69751 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 protein_id gnl|my_center|LOCUS_17220 71463 70225 gene locus_tag LOCUS_17230 gene fabF 71463 70225 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_17230 72262 71522 gene locus_tag LOCUS_17240 gene fabG 72262 71522 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830161.1 protein_id gnl|my_center|LOCUS_17240 73224 72298 gene locus_tag LOCUS_17250 gene fabK 73224 72298 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048429.1 protein_id gnl|my_center|LOCUS_17250 74269 73262 gene locus_tag LOCUS_17260 74269 73262 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_17260 74503 75456 gene locus_tag LOCUS_17270 gene fabD 74503 75456 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032624.1 protein_id gnl|my_center|LOCUS_17270 75456 76295 gene locus_tag LOCUS_17280 gene aroE 75456 76295 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229967.1 protein_id gnl|my_center|LOCUS_17280 76304 76798 gene locus_tag LOCUS_17290 76304 76798 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930588.1 protein_id gnl|my_center|LOCUS_17290 77370 76957 gene locus_tag LOCUS_17300 gene nifU 77370 76957 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_17300 78547 77360 gene locus_tag LOCUS_17310 gene nifS 78547 77360 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_17310 80405 79116 gene locus_tag LOCUS_17320 80405 79116 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_17320 81406 80660 gene locus_tag LOCUS_17330 81406 80660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 82728 81760 gene locus_tag LOCUS_17340 82728 81760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 83895 82744 gene locus_tag LOCUS_17350 83895 82744 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815048.1 protein_id gnl|my_center|LOCUS_17350 84444 84187 gene locus_tag LOCUS_17360 84444 84187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 84731 84806 gene locus_tag LOCUS_t00310 84731 84806 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 86375 85083 gene locus_tag LOCUS_17370 86375 85083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 87106 86372 gene locus_tag LOCUS_17380 87106 86372 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_17380 87245 87170 gene locus_tag LOCUS_t00320 87245 87170 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 87389 87281 gene locus_tag LOCUS_r00010 87389 87281 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 87477 87403 gene locus_tag LOCUS_t00330 87477 87403 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 87558 87483 gene locus_tag LOCUS_t00340 87558 87483 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence15 302 925 gene locus_tag LOCUS_17390 302 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2523 1006 gene locus_tag LOCUS_17400 2523 1006 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269931.1 protein_id gnl|my_center|LOCUS_17400 5132 2556 gene locus_tag LOCUS_17410 5132 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 6517 5168 gene locus_tag LOCUS_17420 6517 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 7870 6833 gene locus_tag LOCUS_17430 gene gap 7870 6833 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_17430 8201 9283 gene locus_tag LOCUS_17440 8201 9283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 9485 10492 gene locus_tag LOCUS_17450 9485 10492 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_17450 10806 11321 gene locus_tag LOCUS_17460 10806 11321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 11318 12214 gene locus_tag LOCUS_17470 gene era 11318 12214 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_17470 12323 12508 gene locus_tag LOCUS_17480 12323 12508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 12444 13223 gene locus_tag LOCUS_17490 gene recO 12444 13223 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861552.1 protein_id gnl|my_center|LOCUS_17490 13247 15631 gene locus_tag LOCUS_17500 13247 15631 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_17500 15635 16036 gene locus_tag LOCUS_17510 15635 16036 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104332.1 protein_id gnl|my_center|LOCUS_17510 16033 17181 gene locus_tag LOCUS_17520 16033 17181 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_17520 17399 17926 gene locus_tag LOCUS_17530 17399 17926 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_17530 17877 18950 gene locus_tag LOCUS_17540 17877 18950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 20814 19087 gene locus_tag LOCUS_17550 20814 19087 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_17550 21839 21102 gene locus_tag LOCUS_17560 21839 21102 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_17560 22257 21853 gene locus_tag LOCUS_17570 22257 21853 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640934.1 protein_id gnl|my_center|LOCUS_17570 23541 22270 gene locus_tag LOCUS_17580 gene obgE 23541 22270 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_17580 24017 23736 gene locus_tag LOCUS_17590 gene rpmA 24017 23736 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564659.1 protein_id gnl|my_center|LOCUS_17590 24347 24021 gene locus_tag LOCUS_17600 24347 24021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 24659 24348 gene locus_tag LOCUS_17610 gene rplU 24659 24348 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270907.1 protein_id gnl|my_center|LOCUS_17610 24902 24826 gene locus_tag LOCUS_t00350 24902 24826 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25622 24963 gene locus_tag LOCUS_17620 gene pyrE 25622 24963 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389897.1 protein_id gnl|my_center|LOCUS_17620 26992 25874 gene locus_tag LOCUS_17630 gene prfB 26992 25874 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_17630 27166 28161 gene locus_tag LOCUS_17640 27166 28161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 28173 28634 gene locus_tag LOCUS_17650 28173 28634 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816386.1 protein_id gnl|my_center|LOCUS_17650 28946 29356 gene locus_tag LOCUS_17660 28946 29356 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084116061.1 protein_id gnl|my_center|LOCUS_17660 30706 29426 gene locus_tag LOCUS_17670 30706 29426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 34782 31870 gene locus_tag LOCUS_17680 34782 31870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 35346 34972 gene locus_tag LOCUS_17690 35346 34972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 36026 35343 gene locus_tag LOCUS_17700 36026 35343 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_17700 36651 36145 gene locus_tag LOCUS_17710 gene gtcA 36651 36145 CDS product cell wall teichoic acid glycosylation protein GtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724105.1 protein_id gnl|my_center|LOCUS_17710 36831 38087 gene locus_tag LOCUS_17720 36831 38087 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_17720 39108 38179 gene locus_tag LOCUS_17730 39108 38179 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963617.1 protein_id gnl|my_center|LOCUS_17730 40129 39368 gene locus_tag LOCUS_17740 gene pflA 40129 39368 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807699.1 protein_id gnl|my_center|LOCUS_17740 40494 40255 gene locus_tag LOCUS_17750 40494 40255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 40761 40552 gene locus_tag LOCUS_17760 40761 40552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 42885 40798 gene locus_tag LOCUS_17770 gene pflB 42885 40798 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195485.1 protein_id gnl|my_center|LOCUS_17770 43281 44141 gene locus_tag LOCUS_17780 43281 44141 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964728.1 protein_id gnl|my_center|LOCUS_17780 45242 44121 gene locus_tag LOCUS_17790 45242 44121 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_17790 45571 46656 gene locus_tag LOCUS_17800 gene mnmA 45571 46656 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_17800 47008 47442 gene locus_tag LOCUS_17810 47008 47442 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419409.1 protein_id gnl|my_center|LOCUS_17810 49792 47513 gene locus_tag LOCUS_17820 49792 47513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 50040 49789 gene locus_tag LOCUS_17830 50040 49789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 50858 50148 gene locus_tag LOCUS_17840 50858 50148 CDS product NERD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820009.1 protein_id gnl|my_center|LOCUS_17840 51816 50944 gene locus_tag LOCUS_17850 51816 50944 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_17850 53008 52199 gene locus_tag LOCUS_17860 53008 52199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 54511 53024 gene locus_tag LOCUS_17870 54511 53024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 54981 55631 gene locus_tag LOCUS_17880 54981 55631 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_17880 56266 57624 gene locus_tag LOCUS_17890 gene gdhA 56266 57624 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051757.1 protein_id gnl|my_center|LOCUS_17890 58422 57844 gene locus_tag LOCUS_17900 58422 57844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 59565 58474 gene locus_tag LOCUS_17910 gene aroC 59565 58474 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_17910 60787 59543 gene locus_tag LOCUS_17920 gene aroA 60787 59543 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_17920 61833 60784 gene locus_tag LOCUS_17930 gene aroB 61833 60784 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775572.1 protein_id gnl|my_center|LOCUS_17930 62178 63455 gene locus_tag LOCUS_17940 62178 63455 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_17940 63457 64743 gene locus_tag LOCUS_17950 63457 64743 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732282.1 protein_id gnl|my_center|LOCUS_17950 64786 65895 gene locus_tag LOCUS_17960 64786 65895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 65902 66753 gene locus_tag LOCUS_17970 65902 66753 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162927877.1 protein_id gnl|my_center|LOCUS_17970 67794 66907 gene locus_tag LOCUS_17980 67794 66907 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052908.1 protein_id gnl|my_center|LOCUS_17980 68837 67794 gene locus_tag LOCUS_17990 68837 67794 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224315.1 protein_id gnl|my_center|LOCUS_17990 70448 68961 gene locus_tag LOCUS_18000 70448 68961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 71575 70784 gene locus_tag LOCUS_18010 71575 70784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 73036 71858 gene locus_tag LOCUS_18020 73036 71858 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_18020 74179 73229 gene locus_tag LOCUS_18030 74179 73229 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_18030 74741 76909 gene locus_tag LOCUS_18040 74741 76909 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964231.1 protein_id gnl|my_center|LOCUS_18040 76984 78309 gene locus_tag LOCUS_18050 76984 78309 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987123.1 protein_id gnl|my_center|LOCUS_18050 78512 78643 gene locus_tag LOCUS_18060 78512 78643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 79811 78816 gene locus_tag LOCUS_18070 79811 78816 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_18070 80844 79858 gene locus_tag LOCUS_18080 80844 79858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 81412 81498 gene locus_tag LOCUS_t00360 81412 81498 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 81766 81690 gene locus_tag LOCUS_t00370 81766 81690 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 82216 81971 gene locus_tag LOCUS_18090 82216 81971 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965244.1 protein_id gnl|my_center|LOCUS_18090 82596 82671 gene locus_tag LOCUS_t00380 82596 82671 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 82744 83943 gene locus_tag LOCUS_18100 82744 83943 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_18100 84233 84090 gene locus_tag LOCUS_18110 84233 84090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 84393 84752 gene locus_tag LOCUS_18120 84393 84752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 86754 84850 gene locus_tag LOCUS_18130 86754 84850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 >Feature sequence16 732 61 gene locus_tag LOCUS_18140 gene plsY 732 61 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_18140 2076 748 gene locus_tag LOCUS_18150 gene der 2076 748 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965018.1 protein_id gnl|my_center|LOCUS_18150 3068 2880 gene locus_tag LOCUS_18160 gene rpmF 3068 2880 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965052.1 protein_id gnl|my_center|LOCUS_18160 3540 3085 gene locus_tag LOCUS_18170 3540 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 4062 3655 gene locus_tag LOCUS_18180 4062 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_18180 5495 4155 gene locus_tag LOCUS_18190 5495 4155 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831993.1 protein_id gnl|my_center|LOCUS_18190 6886 5747 gene locus_tag LOCUS_18200 6886 5747 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555330.1 protein_id gnl|my_center|LOCUS_18200 11049 7345 gene locus_tag LOCUS_18210 11049 7345 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_18210 12652 11330 gene locus_tag LOCUS_18220 gene mtaB 12652 11330 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964598.1 protein_id gnl|my_center|LOCUS_18220 13015 13245 gene locus_tag LOCUS_18230 13015 13245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 14801 13356 gene locus_tag LOCUS_18240 14801 13356 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016814.1 protein_id gnl|my_center|LOCUS_18240 16172 14814 gene locus_tag LOCUS_18250 gene trkA 16172 14814 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_18250 18281 16692 gene locus_tag LOCUS_18260 18281 16692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 20777 18306 gene locus_tag LOCUS_18270 20777 18306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 21590 20802 gene locus_tag LOCUS_18280 gene rlmB 21590 20802 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724085.1 protein_id gnl|my_center|LOCUS_18280 21986 21738 gene locus_tag LOCUS_18290 21986 21738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 23775 22252 gene locus_tag LOCUS_18300 23775 22252 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767764.1 protein_id gnl|my_center|LOCUS_18300 24134 24736 gene locus_tag LOCUS_18310 24134 24736 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_18310 25360 26052 gene locus_tag LOCUS_18320 25360 26052 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392585.1 protein_id gnl|my_center|LOCUS_18320 26139 28784 gene locus_tag LOCUS_18330 26139 28784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 28940 30838 gene locus_tag LOCUS_18340 28940 30838 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_18340 30997 31761 gene locus_tag LOCUS_18350 30997 31761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 31773 31985 gene locus_tag LOCUS_18360 31773 31985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 32229 33464 gene locus_tag LOCUS_18370 32229 33464 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_18370 33513 34181 gene locus_tag LOCUS_18380 gene cmk 33513 34181 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644391.1 protein_id gnl|my_center|LOCUS_18380 34198 34944 gene locus_tag LOCUS_18390 34198 34944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 34951 36903 gene locus_tag LOCUS_18400 34951 36903 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811135.1 protein_id gnl|my_center|LOCUS_18400 37983 37462 gene locus_tag LOCUS_18410 37983 37462 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207579.1 protein_id gnl|my_center|LOCUS_18410 38781 37999 gene locus_tag LOCUS_18420 38781 37999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 40527 38785 gene locus_tag LOCUS_18430 40527 38785 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392405.1 protein_id gnl|my_center|LOCUS_18430 41052 40765 gene locus_tag LOCUS_18440 41052 40765 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052490.1 protein_id gnl|my_center|LOCUS_18440 41911 41072 gene locus_tag LOCUS_18450 gene rlmA 41911 41072 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072721.1 protein_id gnl|my_center|LOCUS_18450 42702 41908 gene locus_tag LOCUS_18460 42702 41908 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338546.1 protein_id gnl|my_center|LOCUS_18460 43382 42696 gene locus_tag LOCUS_18470 43382 42696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 43745 43533 gene locus_tag LOCUS_18480 43745 43533 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_18480 44169 43888 gene locus_tag LOCUS_18490 44169 43888 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391912.1 protein_id gnl|my_center|LOCUS_18490 44781 44296 gene locus_tag LOCUS_18500 44781 44296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 45700 45188 gene locus_tag LOCUS_18510 45700 45188 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021451.1 protein_id gnl|my_center|LOCUS_18510 46068 45757 gene locus_tag LOCUS_18520 46068 45757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 46586 45996 gene locus_tag LOCUS_18530 46586 45996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 46873 46586 gene locus_tag LOCUS_18540 46873 46586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 47126 47383 gene locus_tag LOCUS_18550 47126 47383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 47589 49751 gene locus_tag LOCUS_18560 gene rnr 47589 49751 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_18560 49846 50532 gene locus_tag LOCUS_18570 gene pnuC 49846 50532 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992863.1 protein_id gnl|my_center|LOCUS_18570 51817 50663 gene locus_tag LOCUS_18580 gene ftsZ 51817 50663 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890867.1 protein_id gnl|my_center|LOCUS_18580 53013 52096 gene locus_tag LOCUS_18590 53013 52096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 54302 53046 gene locus_tag LOCUS_18600 gene murA 54302 53046 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940516.1 protein_id gnl|my_center|LOCUS_18600 55490 54363 gene locus_tag LOCUS_18610 gene murG 55490 54363 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110342.1 protein_id gnl|my_center|LOCUS_18610 56737 55487 gene locus_tag LOCUS_18620 gene spoVE 56737 55487 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753510.1 protein_id gnl|my_center|LOCUS_18620 57791 56763 gene locus_tag LOCUS_18630 gene mraY 57791 56763 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731978.1 protein_id gnl|my_center|LOCUS_18630 59133 57775 gene locus_tag LOCUS_18640 59133 57775 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272578.1 protein_id gnl|my_center|LOCUS_18640 60620 59178 gene locus_tag LOCUS_18650 60620 59178 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_18650 63038 60693 gene locus_tag LOCUS_18660 63038 60693 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965429.1 protein_id gnl|my_center|LOCUS_18660 63916 63452 gene locus_tag LOCUS_18670 63916 63452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 64848 63922 gene locus_tag LOCUS_18680 gene rsmH 64848 63922 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_18680 65279 64851 gene locus_tag LOCUS_18690 gene mraZ 65279 64851 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355890.1 protein_id gnl|my_center|LOCUS_18690 66741 65542 gene locus_tag LOCUS_18700 gene tuf 66741 65542 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_18700 68947 66872 gene locus_tag LOCUS_18710 gene fusA 68947 66872 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436178.1 protein_id gnl|my_center|LOCUS_18710 69451 68981 gene locus_tag LOCUS_18720 gene rpsG 69451 68981 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137495.1 protein_id gnl|my_center|LOCUS_18720 70116 69694 gene locus_tag LOCUS_18730 gene rpsL 70116 69694 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_18730 71902 70232 gene locus_tag LOCUS_18740 71902 70232 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964334.1 protein_id gnl|my_center|LOCUS_18740 72136 73332 gene locus_tag LOCUS_18750 72136 73332 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 protein_id gnl|my_center|LOCUS_18750 73357 73881 gene locus_tag LOCUS_18760 73357 73881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 73894 74703 gene locus_tag LOCUS_18770 73894 74703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 74707 74952 gene locus_tag LOCUS_18780 74707 74952 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567635.1 protein_id gnl|my_center|LOCUS_18780 75455 76162 gene locus_tag LOCUS_18790 75455 76162 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060578.1 protein_id gnl|my_center|LOCUS_18790 76967 76248 gene locus_tag LOCUS_18800 76967 76248 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692438.1 protein_id gnl|my_center|LOCUS_18800 77269 77916 gene locus_tag LOCUS_18810 77269 77916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 78391 78316 gene locus_tag LOCUS_t00390 78391 78316 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 78699 79961 gene locus_tag LOCUS_18820 78699 79961 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_18820 79982 81067 gene locus_tag LOCUS_18830 79982 81067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379688.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence17 502 41 gene locus_tag LOCUS_18840 502 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 1818 718 gene locus_tag LOCUS_18850 1818 718 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_18850 3615 2260 gene locus_tag LOCUS_18860 gene rlmD 3615 2260 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233892.1 protein_id gnl|my_center|LOCUS_18860 4089 3748 gene locus_tag LOCUS_18870 4089 3748 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811601.1 protein_id gnl|my_center|LOCUS_18870 5627 4104 gene locus_tag LOCUS_18880 5627 4104 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_18880 6254 5631 gene locus_tag LOCUS_18890 6254 5631 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048078.1 protein_id gnl|my_center|LOCUS_18890 8520 6265 gene locus_tag LOCUS_18900 8520 6265 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_18900 10553 8517 gene locus_tag LOCUS_18910 gene recJ 10553 8517 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_18910 10848 11282 gene locus_tag LOCUS_18920 10848 11282 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_18920 12770 11964 gene locus_tag LOCUS_18930 12770 11964 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964972.1 protein_id gnl|my_center|LOCUS_18930 14322 12784 gene locus_tag LOCUS_18940 14322 12784 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964579.1 protein_id gnl|my_center|LOCUS_18940 14629 15339 gene locus_tag LOCUS_18950 14629 15339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 16174 15404 gene locus_tag LOCUS_18960 16174 15404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 16908 16201 gene locus_tag LOCUS_18970 16908 16201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 17276 17800 gene locus_tag LOCUS_18980 gene thrB 17276 17800 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939791.1 protein_id gnl|my_center|LOCUS_18980 18057 17881 gene locus_tag LOCUS_18990 18057 17881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 19484 18054 gene locus_tag LOCUS_19000 19484 18054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 20972 19488 gene locus_tag LOCUS_19010 gene cobA 20972 19488 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898657.1 protein_id gnl|my_center|LOCUS_19010 21827 20985 gene locus_tag LOCUS_19020 21827 20985 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345602.1 protein_id gnl|my_center|LOCUS_19020 22645 21812 gene locus_tag LOCUS_19030 gene cbiQ 22645 21812 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812266.1 protein_id gnl|my_center|LOCUS_19030 23794 22661 gene locus_tag LOCUS_19040 23794 22661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 25162 23858 gene locus_tag LOCUS_19050 gene hemL 25162 23858 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704436.1 protein_id gnl|my_center|LOCUS_19050 26145 25162 gene locus_tag LOCUS_19060 gene hemB 26145 25162 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963427.1 protein_id gnl|my_center|LOCUS_19060 27023 26142 gene locus_tag LOCUS_19070 gene hemC 27023 26142 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073972.1 protein_id gnl|my_center|LOCUS_19070 28267 27029 gene locus_tag LOCUS_19080 gene hemA 28267 27029 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460182.1 protein_id gnl|my_center|LOCUS_19080 28869 28276 gene locus_tag LOCUS_19090 gene cobC 28869 28276 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933053.1 protein_id gnl|my_center|LOCUS_19090 29297 29091 gene locus_tag LOCUS_19100 29297 29091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 29990 29361 gene locus_tag LOCUS_19110 29990 29361 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721591.1 protein_id gnl|my_center|LOCUS_19110 30741 29971 gene locus_tag LOCUS_19120 gene cobK 30741 29971 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876633.1 protein_id gnl|my_center|LOCUS_19120 31490 30738 gene locus_tag LOCUS_19130 gene cobJ 31490 30738 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931509.1 protein_id gnl|my_center|LOCUS_19130 32497 31487 gene locus_tag LOCUS_19140 gene cbiG 32497 31487 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721596.1 protein_id gnl|my_center|LOCUS_19140 33249 32494 gene locus_tag LOCUS_19150 gene cobM 33249 32494 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016784.1 protein_id gnl|my_center|LOCUS_19150 33949 33251 gene locus_tag LOCUS_19160 33949 33251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 35158 33953 gene locus_tag LOCUS_19170 35158 33953 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214081.1 protein_id gnl|my_center|LOCUS_19170 36234 35143 gene locus_tag LOCUS_19180 gene cbiD 36234 35143 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168467.1 protein_id gnl|my_center|LOCUS_19180 37748 36231 gene locus_tag LOCUS_19190 37748 36231 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836536.1 protein_id gnl|my_center|LOCUS_19190 38809 37730 gene locus_tag LOCUS_19200 gene cobD 38809 37730 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168408.1 protein_id gnl|my_center|LOCUS_19200 39790 38822 gene locus_tag LOCUS_19210 gene cbiB 39790 38822 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989705.1 protein_id gnl|my_center|LOCUS_19210 40184 39804 gene locus_tag LOCUS_19220 40184 39804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 40960 40181 gene locus_tag LOCUS_19230 40960 40181 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206643.1 protein_id gnl|my_center|LOCUS_19230 41483 40911 gene locus_tag LOCUS_19240 gene cobU 41483 40911 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202889.1 protein_id gnl|my_center|LOCUS_19240 42847 41477 gene locus_tag LOCUS_19250 42847 41477 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258422.1 protein_id gnl|my_center|LOCUS_19250 43248 44645 gene locus_tag LOCUS_19260 43248 44645 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_19260 44667 45551 gene locus_tag LOCUS_19270 44667 45551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 48148 45881 gene locus_tag LOCUS_19280 48148 45881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 48850 48152 gene locus_tag LOCUS_19290 48850 48152 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461283.1 protein_id gnl|my_center|LOCUS_19290 51855 49069 gene locus_tag LOCUS_19300 51855 49069 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480361.1 protein_id gnl|my_center|LOCUS_19300 52988 51852 gene locus_tag LOCUS_19310 52988 51852 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733226.1 protein_id gnl|my_center|LOCUS_19310 54022 53114 gene locus_tag LOCUS_19320 gene pfkB 54022 53114 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861506.1 protein_id gnl|my_center|LOCUS_19320 54303 55382 gene locus_tag LOCUS_19330 54303 55382 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_19330 55379 55759 gene locus_tag LOCUS_19340 55379 55759 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416526.1 protein_id gnl|my_center|LOCUS_19340 55743 56288 gene locus_tag LOCUS_19350 55743 56288 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_19350 56543 59188 gene locus_tag LOCUS_19360 56543 59188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 60263 59409 gene locus_tag LOCUS_19370 60263 59409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 60696 60256 gene locus_tag LOCUS_19380 60696 60256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 62391 60703 gene locus_tag LOCUS_19390 62391 60703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 64689 62572 gene locus_tag LOCUS_19400 64689 62572 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808998.1 protein_id gnl|my_center|LOCUS_19400 64943 64689 gene locus_tag LOCUS_19410 64943 64689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 65354 65629 gene locus_tag LOCUS_19420 65354 65629 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_19420 65775 67649 gene locus_tag LOCUS_19430 65775 67649 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_19430 67646 67819 gene locus_tag LOCUS_19440 67646 67819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 67883 68050 gene locus_tag LOCUS_19450 67883 68050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 69438 68116 gene locus_tag LOCUS_19460 69438 68116 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475463.1 protein_id gnl|my_center|LOCUS_19460 69865 70506 gene locus_tag LOCUS_19470 69865 70506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 70997 70623 gene locus_tag LOCUS_19480 70997 70623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 72848 71187 gene locus_tag LOCUS_19490 72848 71187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 73406 73179 gene locus_tag LOCUS_19500 73406 73179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence18 151 75 gene locus_tag LOCUS_t00400 151 75 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 229 154 gene locus_tag LOCUS_t00410 229 154 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2458 413 gene locus_tag LOCUS_19510 gene recG 2458 413 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_19510 3149 2502 gene locus_tag LOCUS_19520 3149 2502 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072772897.1 protein_id gnl|my_center|LOCUS_19520 4751 3288 gene locus_tag LOCUS_19530 4751 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 5020 5457 gene locus_tag LOCUS_19540 gene rnhA 5020 5457 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003511799.1 protein_id gnl|my_center|LOCUS_19540 6485 5568 gene locus_tag LOCUS_19550 6485 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 10123 6662 gene locus_tag LOCUS_19560 gene mfd 10123 6662 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_19560 10811 10182 gene locus_tag LOCUS_19570 gene pth 10811 10182 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_19570 12307 10913 gene locus_tag LOCUS_19580 gene glmU 12307 10913 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966498.1 protein_id gnl|my_center|LOCUS_19580 12658 15294 gene locus_tag LOCUS_19590 gene ppdK 12658 15294 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_19590 15965 16186 gene locus_tag LOCUS_19600 15965 16186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 16304 16960 gene locus_tag LOCUS_19610 16304 16960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 16976 18373 gene locus_tag LOCUS_19620 16976 18373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19620 18385 18882 gene locus_tag LOCUS_19630 18385 18882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 19441 19001 gene locus_tag LOCUS_19640 19441 19001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 20525 19455 gene locus_tag LOCUS_19650 20525 19455 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246499.1 protein_id gnl|my_center|LOCUS_19650 21028 21711 gene locus_tag LOCUS_19660 21028 21711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 22865 21840 gene locus_tag LOCUS_19670 22865 21840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 23245 26067 gene locus_tag LOCUS_19680 23245 26067 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083030.1 protein_id gnl|my_center|LOCUS_19680 26182 26361 gene locus_tag LOCUS_19690 26182 26361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 26469 27869 gene locus_tag LOCUS_19700 26469 27869 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_19700 27882 28259 gene locus_tag LOCUS_19710 27882 28259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 28249 28647 gene locus_tag LOCUS_19720 28249 28647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 28663 29889 gene locus_tag LOCUS_19730 28663 29889 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_19730 30066 30446 gene locus_tag LOCUS_19740 30066 30446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 32186 30327 gene locus_tag LOCUS_19750 32186 30327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 33426 32527 gene locus_tag LOCUS_19760 gene aguB 33426 32527 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246756.1 protein_id gnl|my_center|LOCUS_19760 34534 33419 gene locus_tag LOCUS_19770 gene aguA 34534 33419 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989327.1 protein_id gnl|my_center|LOCUS_19770 34716 34889 gene locus_tag LOCUS_19780 34716 34889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 34921 35172 gene locus_tag LOCUS_19790 34921 35172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 35730 35218 gene locus_tag LOCUS_19800 35730 35218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 35970 36212 gene locus_tag LOCUS_19810 35970 36212 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809979.1 protein_id gnl|my_center|LOCUS_19810 36435 37154 gene locus_tag LOCUS_19820 36435 37154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 37348 40056 gene locus_tag LOCUS_19830 37348 40056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 40429 41961 gene locus_tag LOCUS_19840 40429 41961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 41987 43306 gene locus_tag LOCUS_19850 41987 43306 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546148.1 protein_id gnl|my_center|LOCUS_19850 43318 45552 gene locus_tag LOCUS_19860 43318 45552 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546149.1 protein_id gnl|my_center|LOCUS_19860 45672 46832 gene locus_tag LOCUS_19870 45672 46832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 47294 46914 gene locus_tag LOCUS_19880 47294 46914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 49693 47327 gene locus_tag LOCUS_19890 49693 47327 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016705.1 protein_id gnl|my_center|LOCUS_19890 51285 49690 gene locus_tag LOCUS_19900 gene malQ 51285 49690 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_19900 51404 51805 gene locus_tag LOCUS_19910 51404 51805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 53113 52028 gene locus_tag LOCUS_19920 gene pyrB 53113 52028 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_19920 53871 53203 gene locus_tag LOCUS_19930 53871 53203 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_19930 55772 53898 gene locus_tag LOCUS_19940 gene asnB 55772 53898 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288533.1 protein_id gnl|my_center|LOCUS_19940 55893 56066 gene locus_tag LOCUS_19950 55893 56066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 56426 56088 gene locus_tag LOCUS_19960 56426 56088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 56817 57245 gene locus_tag LOCUS_19970 gene rplM 56817 57245 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393902.1 protein_id gnl|my_center|LOCUS_19970 57264 57665 gene locus_tag LOCUS_19980 gene rpsI 57264 57665 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence19 2014 1067 gene locus_tag LOCUS_19990 2014 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 3095 2196 gene locus_tag LOCUS_20000 3095 2196 CDS product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161220.1 protein_id gnl|my_center|LOCUS_20000 3412 3113 gene locus_tag LOCUS_20010 3412 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 5008 3701 gene locus_tag LOCUS_20020 5008 3701 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433873.1 protein_id gnl|my_center|LOCUS_20020 7418 5025 gene locus_tag LOCUS_20030 7418 5025 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_20030 7941 7456 gene locus_tag LOCUS_20040 7941 7456 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_20040 8742 8077 gene locus_tag LOCUS_20050 8742 8077 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435810.1 protein_id gnl|my_center|LOCUS_20050 9614 8736 gene locus_tag LOCUS_20060 gene metF 9614 8736 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_20060 11365 9737 gene locus_tag LOCUS_20070 11365 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 12035 11367 gene locus_tag LOCUS_20080 12035 11367 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732773.1 protein_id gnl|my_center|LOCUS_20080 12340 13764 gene locus_tag LOCUS_20090 gene secD 12340 13764 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965576.1 protein_id gnl|my_center|LOCUS_20090 13748 14743 gene locus_tag LOCUS_20100 gene secF 13748 14743 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048082.1 protein_id gnl|my_center|LOCUS_20100 14951 15766 gene locus_tag LOCUS_20110 14951 15766 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048205.1 protein_id gnl|my_center|LOCUS_20110 15774 16259 gene locus_tag LOCUS_20120 gene nrdR 15774 16259 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_20120 16256 16636 gene locus_tag LOCUS_20130 16256 16636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 17080 16646 gene locus_tag LOCUS_20140 17080 16646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 17166 17921 gene locus_tag LOCUS_20150 17166 17921 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546764.1 protein_id gnl|my_center|LOCUS_20150 18070 19206 gene locus_tag LOCUS_20160 gene ugpC 18070 19206 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_20160 19618 19529 gene locus_tag LOCUS_t00420 19618 19529 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19763 19675 gene locus_tag LOCUS_t00430 19763 19675 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20016 20411 gene locus_tag LOCUS_20170 20016 20411 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964225.1 protein_id gnl|my_center|LOCUS_20170 20426 21166 gene locus_tag LOCUS_20180 20426 21166 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_20180 21163 21618 gene locus_tag LOCUS_20190 gene dtd 21163 21618 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691419.1 protein_id gnl|my_center|LOCUS_20190 22078 22317 gene locus_tag LOCUS_20200 22078 22317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 22217 23512 gene locus_tag LOCUS_20210 22217 23512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 23717 25402 gene locus_tag LOCUS_20220 23717 25402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 25704 28109 gene locus_tag LOCUS_20230 25704 28109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 28587 29936 gene locus_tag LOCUS_20240 28587 29936 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_20240 29933 31009 gene locus_tag LOCUS_20250 29933 31009 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_20250 31057 32091 gene locus_tag LOCUS_20260 gene gmd 31057 32091 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880676.1 protein_id gnl|my_center|LOCUS_20260 32185 33336 gene locus_tag LOCUS_20270 32185 33336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 33329 34480 gene locus_tag LOCUS_20280 33329 34480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 34477 35421 gene locus_tag LOCUS_20290 34477 35421 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_20290 35443 35877 gene locus_tag LOCUS_20300 35443 35877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 36212 36916 gene locus_tag LOCUS_20310 36212 36916 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057529.1 protein_id gnl|my_center|LOCUS_20310 36919 37077 gene locus_tag LOCUS_20320 36919 37077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 37333 37971 gene locus_tag LOCUS_20330 37333 37971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 38837 38037 gene locus_tag LOCUS_20340 gene fabG 38837 38037 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_20340 38946 39404 gene locus_tag LOCUS_20350 38946 39404 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459496.1 protein_id gnl|my_center|LOCUS_20350 41312 39645 gene locus_tag LOCUS_20360 41312 39645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 45131 41553 gene locus_tag LOCUS_20370 45131 41553 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721622.1 protein_id gnl|my_center|LOCUS_20370 45699 45142 gene locus_tag LOCUS_20380 45699 45142 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837230.1 protein_id gnl|my_center|LOCUS_20380 45790 46011 gene locus_tag LOCUS_20390 45790 46011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 47434 46304 gene locus_tag LOCUS_20400 47434 46304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 >Feature sequence20 23 2202 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccactccctccacacggagggagac 2686 2396 gene locus_tag LOCUS_20410 gene cas2 2686 2396 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989044.1 protein_id gnl|my_center|LOCUS_20410 3721 2693 gene locus_tag LOCUS_20420 gene cas1c 3721 2693 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932802.1 protein_id gnl|my_center|LOCUS_20420 4391 3729 gene locus_tag LOCUS_20430 gene cas4 4391 3729 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_20430 5258 4398 gene locus_tag LOCUS_20440 gene cas7c 5258 4398 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 protein_id gnl|my_center|LOCUS_20440 7193 5262 gene locus_tag LOCUS_20450 gene cas8c 7193 5262 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922511.1 protein_id gnl|my_center|LOCUS_20450 7929 7177 gene locus_tag LOCUS_20460 gene cas5c 7929 7177 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009051.1 protein_id gnl|my_center|LOCUS_20460 10547 8094 gene locus_tag LOCUS_20470 10547 8094 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263668.1 protein_id gnl|my_center|LOCUS_20470 11015 12499 gene locus_tag LOCUS_20480 11015 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence21 902 1384 gene locus_tag LOCUS_20490 902 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 1466 2272 gene locus_tag LOCUS_20500 1466 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2469 5279 gene locus_tag LOCUS_20510 2469 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 5582 5439 gene locus_tag LOCUS_20520 5582 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 7483 5816 gene locus_tag LOCUS_20530 7483 5816 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_20530 8157 7480 gene locus_tag LOCUS_20540 8157 7480 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_20540 8613 8440 gene locus_tag LOCUS_20550 8613 8440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 9503 8856 gene locus_tag LOCUS_20560 gene phoU 9503 8856 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_20560 10252 9503 gene locus_tag LOCUS_20570 gene pstB 10252 9503 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence22 517 1887 gene locus_tag LOCUS_20580 gene dnaA 517 1887 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_20580 3508 4614 gene locus_tag LOCUS_20590 gene dnaN 3508 4614 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_20590 5093 4935 gene locus_tag LOCUS_20600 5093 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 5572 5805 gene locus_tag LOCUS_20610 5572 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 5802 6935 gene locus_tag LOCUS_20620 gene recF 5802 6935 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549377.1 protein_id gnl|my_center|LOCUS_20620 7161 9107 gene locus_tag LOCUS_20630 gene gyrB 7161 9107 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_20630 9120 9671 gene locus_tag LOCUS_20640 9120 9671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 >Feature sequence23 1096 245 gene locus_tag LOCUS_20650 1096 245 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_20650 1795 2331 gene locus_tag LOCUS_20660 1795 2331 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965803.1 protein_id gnl|my_center|LOCUS_20660 3856 2873 gene locus_tag LOCUS_20670 3856 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 4602 5678 gene locus_tag LOCUS_20680 4602 5678 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_20680 6037 6342 gene locus_tag LOCUS_20690 6037 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 7671 6778 gene locus_tag LOCUS_20700 7671 6778 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_20700 9522 8527 gene locus_tag LOCUS_20710 9522 8527 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_20710 >Feature sequence24 1529 1447 gene locus_tag LOCUS_t00440 1529 1447 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1859 2965 gene locus_tag LOCUS_20720 1859 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 3231 3306 gene locus_tag LOCUS_t00450 3231 3306 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4463 5203 gene locus_tag LOCUS_20730 4463 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 5216 6100 gene locus_tag LOCUS_20740 5216 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 6376 7251 gene locus_tag LOCUS_20750 6376 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence25 2087 3622 gene locus_tag LOCUS_20760 2087 3622 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_20760 3646 4812 gene locus_tag LOCUS_20770 gene rodA 3646 4812 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_20770 4951 5631 gene locus_tag LOCUS_20780 4951 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 5628 5912 gene locus_tag LOCUS_20790 5628 5912 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200772684.1 protein_id gnl|my_center|LOCUS_20790 6023 7561 gene locus_tag LOCUS_20800 gene guaA 6023 7561 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence26 253 2922 gene locus_tag LOCUS_20810 gene gyrA 253 2922 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence27 84 159 gene locus_tag LOCUS_t00460 84 159 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 394 1158 gene locus_tag LOCUS_20820 gene ymdB 394 1158 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_20820 1352 1612 gene locus_tag LOCUS_20830 gene spoVS 1352 1612 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 protein_id gnl|my_center|LOCUS_20830 1730 3031 gene locus_tag LOCUS_20840 1730 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840