>Feature sequence01 481 1974 gene locus_tag LOCUS_00010 481 1974 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_00010 2718 2185 gene locus_tag LOCUS_00020 gene dcd 2718 2185 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_00020 3130 2801 gene locus_tag LOCUS_00030 3130 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3455 4729 gene locus_tag LOCUS_00040 3455 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4726 8265 gene locus_tag LOCUS_00050 gene nifJ 4726 8265 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_00050 8262 9629 gene locus_tag LOCUS_00060 gene gltA 8262 9629 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_00060 9810 10634 gene locus_tag LOCUS_00070 9810 10634 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358274.1 protein_id gnl|my_center|LOCUS_00070 10783 13272 gene locus_tag LOCUS_00080 10783 13272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 13376 13861 gene locus_tag LOCUS_00090 13376 13861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13904 14554 gene locus_tag LOCUS_00100 13904 14554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14586 15458 gene locus_tag LOCUS_00110 14586 15458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 16381 15554 gene locus_tag LOCUS_00120 16381 15554 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_00120 16629 17498 gene locus_tag LOCUS_00130 gene cdaA 16629 17498 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420697.1 protein_id gnl|my_center|LOCUS_00130 17495 18739 gene locus_tag LOCUS_00140 17495 18739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18791 19237 gene locus_tag LOCUS_00150 18791 19237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19222 20142 gene locus_tag LOCUS_00160 19222 20142 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_00160 20139 20720 gene locus_tag LOCUS_00170 20139 20720 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_00170 20773 21660 gene locus_tag LOCUS_00180 20773 21660 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_00180 21681 21944 gene locus_tag LOCUS_00190 21681 21944 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392410.1 protein_id gnl|my_center|LOCUS_00190 21941 22537 gene locus_tag LOCUS_00200 gene gmk 21941 22537 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_00200 22544 22945 gene locus_tag LOCUS_00210 22544 22945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22958 25444 gene locus_tag LOCUS_00220 gene priA 22958 25444 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_00220 25507 25998 gene locus_tag LOCUS_00230 gene def 25507 25998 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_00230 26011 26931 gene locus_tag LOCUS_00240 gene fmt 26011 26931 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 protein_id gnl|my_center|LOCUS_00240 26961 28295 gene locus_tag LOCUS_00250 gene rsmB 26961 28295 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_00250 28292 29338 gene locus_tag LOCUS_00260 gene rlmN 28292 29338 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_00260 29364 30098 gene locus_tag LOCUS_00270 gene prpC 29364 30098 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_00270 30115 32097 gene locus_tag LOCUS_00280 gene pknB 30115 32097 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087065956.1 protein_id gnl|my_center|LOCUS_00280 32094 32978 gene locus_tag LOCUS_00290 gene rsgA 32094 32978 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113935.1 protein_id gnl|my_center|LOCUS_00290 33173 34738 gene locus_tag LOCUS_00300 33173 34738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 36069 34822 gene locus_tag LOCUS_00310 36069 34822 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_00310 36281 37216 gene locus_tag LOCUS_00320 gene fba 36281 37216 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948010.1 protein_id gnl|my_center|LOCUS_00320 37322 38929 gene locus_tag LOCUS_00330 37322 38929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38947 42306 gene locus_tag LOCUS_00340 gene addB 38947 42306 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_00340 42284 45889 gene locus_tag LOCUS_00350 gene addA 42284 45889 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572274.1 protein_id gnl|my_center|LOCUS_00350 45992 46195 gene locus_tag LOCUS_00360 gene rpmE 45992 46195 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_00360 46337 46834 gene locus_tag LOCUS_00370 46337 46834 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434028.1 protein_id gnl|my_center|LOCUS_00370 46883 48190 gene locus_tag LOCUS_00380 gene hflX 46883 48190 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_00380 48195 48836 gene locus_tag LOCUS_00390 48195 48836 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965593.1 protein_id gnl|my_center|LOCUS_00390 48973 49977 gene locus_tag LOCUS_00400 48973 49977 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_00400 50010 51770 gene locus_tag LOCUS_00410 gene dnaG 50010 51770 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896376.1 protein_id gnl|my_center|LOCUS_00410 51773 53074 gene locus_tag LOCUS_00420 gene rpoD 51773 53074 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964612.1 protein_id gnl|my_center|LOCUS_00420 53996 53136 gene locus_tag LOCUS_00430 53996 53136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 54787 53993 gene locus_tag LOCUS_00440 54787 53993 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_00440 55027 55827 gene locus_tag LOCUS_00450 55027 55827 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948565.1 protein_id gnl|my_center|LOCUS_00450 55821 56324 gene locus_tag LOCUS_00460 55821 56324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 56450 56995 gene locus_tag LOCUS_00470 56450 56995 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393868.1 protein_id gnl|my_center|LOCUS_00470 58272 57130 gene locus_tag LOCUS_00480 gene acdA 58272 57130 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_00480 58427 58645 gene locus_tag LOCUS_00490 58427 58645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 60195 58798 gene locus_tag LOCUS_00500 60195 58798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 60973 60347 gene locus_tag LOCUS_00510 60973 60347 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048153.1 protein_id gnl|my_center|LOCUS_00510 61854 61042 gene locus_tag LOCUS_00520 61854 61042 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404186.1 protein_id gnl|my_center|LOCUS_00520 66075 62053 gene locus_tag LOCUS_00530 gene carB 66075 62053 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_00530 67148 66075 gene locus_tag LOCUS_00540 67148 66075 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723080.1 protein_id gnl|my_center|LOCUS_00540 68768 67437 gene locus_tag LOCUS_00550 gene glnA 68768 67437 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393265.1 protein_id gnl|my_center|LOCUS_00550 69138 69860 gene locus_tag LOCUS_00560 69138 69860 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_00560 69874 71700 gene locus_tag LOCUS_00570 gene glmS 69874 71700 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432446.1 protein_id gnl|my_center|LOCUS_00570 71750 72478 gene locus_tag LOCUS_00580 gene nadE 71750 72478 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808614.1 protein_id gnl|my_center|LOCUS_00580 73741 72572 gene locus_tag LOCUS_00590 73741 72572 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989507.1 protein_id gnl|my_center|LOCUS_00590 73949 75067 gene locus_tag LOCUS_00600 73949 75067 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644645.1 protein_id gnl|my_center|LOCUS_00600 75087 75953 gene locus_tag LOCUS_00610 75087 75953 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416734.1 protein_id gnl|my_center|LOCUS_00610 75975 76745 gene locus_tag LOCUS_00620 75975 76745 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_00620 77188 77787 gene locus_tag LOCUS_00630 77188 77787 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_00630 77820 79169 gene locus_tag LOCUS_00640 77820 79169 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_00640 79478 80644 gene locus_tag LOCUS_00650 79478 80644 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903799.1 protein_id gnl|my_center|LOCUS_00650 82298 80808 gene locus_tag LOCUS_00660 gene gltX 82298 80808 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_00660 82496 83494 gene locus_tag LOCUS_00670 gene trpS 82496 83494 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048270.1 protein_id gnl|my_center|LOCUS_00670 83530 84699 gene locus_tag LOCUS_00680 83530 84699 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356585.1 protein_id gnl|my_center|LOCUS_00680 84611 85756 gene locus_tag LOCUS_00690 gene wecB 84611 85756 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966158.1 protein_id gnl|my_center|LOCUS_00690 85789 86523 gene locus_tag LOCUS_00700 85789 86523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 86778 86518 gene locus_tag LOCUS_00710 86778 86518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 87166 86771 gene locus_tag LOCUS_00720 87166 86771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 87475 87203 gene locus_tag LOCUS_00730 87475 87203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 87679 88458 gene locus_tag LOCUS_00740 87679 88458 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359441.1 protein_id gnl|my_center|LOCUS_00740 89228 88500 gene locus_tag LOCUS_00750 gene nth 89228 88500 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_00750 89358 90602 gene locus_tag LOCUS_00760 gene glyA 89358 90602 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 protein_id gnl|my_center|LOCUS_00760 90706 91974 gene locus_tag LOCUS_00770 90706 91974 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_00770 92891 91971 gene locus_tag LOCUS_00780 92891 91971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 92992 93186 gene locus_tag LOCUS_00790 92992 93186 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_00790 93205 94083 gene locus_tag LOCUS_00800 93205 94083 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965718.1 protein_id gnl|my_center|LOCUS_00800 94531 95661 gene locus_tag LOCUS_00810 94531 95661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437819.1 protein_id gnl|my_center|LOCUS_00810 96206 96123 gene locus_tag LOCUS_t00010 96206 96123 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 97304 96378 gene locus_tag LOCUS_00820 97304 96378 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_00820 97463 98089 gene locus_tag LOCUS_00830 97463 98089 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082876.1 protein_id gnl|my_center|LOCUS_00830 98522 98157 gene locus_tag LOCUS_00840 98522 98157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 98762 99289 gene locus_tag LOCUS_00850 98762 99289 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_00850 99306 100412 gene locus_tag LOCUS_00860 99306 100412 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530805.1 protein_id gnl|my_center|LOCUS_00860 100455 101282 gene locus_tag LOCUS_00870 100455 101282 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530806.1 protein_id gnl|my_center|LOCUS_00870 101279 102082 gene locus_tag LOCUS_00880 101279 102082 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530807.1 protein_id gnl|my_center|LOCUS_00880 102075 103073 gene locus_tag LOCUS_00890 gene potG 102075 103073 CDS product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097371.1 protein_id gnl|my_center|LOCUS_00890 103077 103970 gene locus_tag LOCUS_00900 103077 103970 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012656.1 protein_id gnl|my_center|LOCUS_00900 104021 104962 gene locus_tag LOCUS_00910 104021 104962 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230702.1 protein_id gnl|my_center|LOCUS_00910 104982 105563 gene locus_tag LOCUS_00920 104982 105563 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966279.1 protein_id gnl|my_center|LOCUS_00920 105939 105571 gene locus_tag LOCUS_00930 gene spoVAE 105939 105571 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_00930 106963 105932 gene locus_tag LOCUS_00940 gene spoVAD 106963 105932 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_00940 107128 107580 gene locus_tag LOCUS_00950 107128 107580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 107580 109187 gene locus_tag LOCUS_00960 107580 109187 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228677.1 protein_id gnl|my_center|LOCUS_00960 109209 110144 gene locus_tag LOCUS_00970 109209 110144 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808885.1 protein_id gnl|my_center|LOCUS_00970 110204 111358 gene locus_tag LOCUS_00980 110204 111358 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966034.1 protein_id gnl|my_center|LOCUS_00980 112217 111315 gene locus_tag LOCUS_00990 112217 111315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 112388 113662 gene locus_tag LOCUS_01000 112388 113662 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016377.1 protein_id gnl|my_center|LOCUS_01000 113665 114393 gene locus_tag LOCUS_01010 gene pyrK 113665 114393 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983359.1 protein_id gnl|my_center|LOCUS_01010 114387 115298 gene locus_tag LOCUS_01020 114387 115298 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905897.1 protein_id gnl|my_center|LOCUS_01020 115298 115996 gene locus_tag LOCUS_01030 gene pyrF 115298 115996 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_01030 116029 116661 gene locus_tag LOCUS_01040 gene pyrE 116029 116661 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232105.1 protein_id gnl|my_center|LOCUS_01040 116716 117633 gene locus_tag LOCUS_01050 gene pyrB 116716 117633 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_01050 117635 118057 gene locus_tag LOCUS_01060 117635 118057 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_01060 120848 118122 gene locus_tag LOCUS_01070 120848 118122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 121777 121031 gene locus_tag LOCUS_01080 121777 121031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 122450 121887 gene locus_tag LOCUS_01090 122450 121887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 123673 122447 gene locus_tag LOCUS_01100 123673 122447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01100 124072 123689 gene locus_tag LOCUS_01110 124072 123689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 124188 125246 gene locus_tag LOCUS_01120 124188 125246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 125259 125963 gene locus_tag LOCUS_01130 125259 125963 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 protein_id gnl|my_center|LOCUS_01130 126023 127072 gene locus_tag LOCUS_01140 gene rsmH 126023 127072 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_01140 127344 127135 gene locus_tag LOCUS_01150 127344 127135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 127608 127378 gene locus_tag LOCUS_01160 127608 127378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 128650 129648 gene locus_tag LOCUS_01170 128650 129648 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_01170 131530 130847 gene locus_tag LOCUS_01180 131530 130847 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890976.1 protein_id gnl|my_center|LOCUS_01180 132594 131524 gene locus_tag LOCUS_01190 132594 131524 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454156.1 protein_id gnl|my_center|LOCUS_01190 132951 134498 gene locus_tag LOCUS_01200 132951 134498 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_01200 134495 135751 gene locus_tag LOCUS_01210 134495 135751 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_01210 135748 136779 gene locus_tag LOCUS_01220 135748 136779 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_01220 136926 138254 gene locus_tag LOCUS_01230 136926 138254 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072447.1 protein_id gnl|my_center|LOCUS_01230 139681 138260 gene locus_tag LOCUS_01240 gene purF 139681 138260 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_01240 141297 139678 gene locus_tag LOCUS_01250 141297 139678 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_01250 142874 141294 gene locus_tag LOCUS_01260 gene asnB 142874 141294 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_01260 145049 142953 gene locus_tag LOCUS_01270 145049 142953 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_01270 145743 145345 gene locus_tag LOCUS_01280 145743 145345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 146278 145907 gene locus_tag LOCUS_01290 146278 145907 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166961.1 protein_id gnl|my_center|LOCUS_01290 147550 146354 gene locus_tag LOCUS_01300 147550 146354 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476376.1 protein_id gnl|my_center|LOCUS_01300 147800 148603 gene locus_tag LOCUS_01310 gene proC 147800 148603 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689692.1 protein_id gnl|my_center|LOCUS_01310 149829 148774 gene locus_tag LOCUS_01320 149829 148774 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_01320 150655 150113 gene locus_tag LOCUS_01330 150655 150113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 151098 150652 gene locus_tag LOCUS_01340 151098 150652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 151877 151488 gene locus_tag LOCUS_01350 151877 151488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 152026 152238 gene locus_tag LOCUS_01360 152026 152238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 152253 152669 gene locus_tag LOCUS_01370 152253 152669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 152614 152826 gene locus_tag LOCUS_01380 152614 152826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 152858 153211 gene locus_tag LOCUS_01390 152858 153211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 153225 153452 gene locus_tag LOCUS_01400 153225 153452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 153449 153763 gene locus_tag LOCUS_01410 153449 153763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 153766 154062 gene locus_tag LOCUS_01420 153766 154062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 154049 154555 gene locus_tag LOCUS_01430 154049 154555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 154555 155157 gene locus_tag LOCUS_01440 154555 155157 CDS product ERF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047604.1 protein_id gnl|my_center|LOCUS_01440 155141 155833 gene locus_tag LOCUS_01450 155141 155833 CDS product putative HNHc nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286553.1 protein_id gnl|my_center|LOCUS_01450 155837 156232 gene locus_tag LOCUS_01460 gene ssb 155837 156232 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815182.1 protein_id gnl|my_center|LOCUS_01460 156256 156666 gene locus_tag LOCUS_01470 156256 156666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 156668 157495 gene locus_tag LOCUS_01480 156668 157495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 157495 157884 gene locus_tag LOCUS_01490 157495 157884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 157921 158454 gene locus_tag LOCUS_01500 gene dcd 157921 158454 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604072.1 protein_id gnl|my_center|LOCUS_01500 158447 158749 gene locus_tag LOCUS_01510 158447 158749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 158739 159119 gene locus_tag LOCUS_01520 158739 159119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 159109 159423 gene locus_tag LOCUS_01530 159109 159423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 159413 159616 gene locus_tag LOCUS_01540 159413 159616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 159636 159920 gene locus_tag LOCUS_01550 159636 159920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 159994 160326 gene locus_tag LOCUS_01560 159994 160326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 160310 160558 gene locus_tag LOCUS_01570 160310 160558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 160512 160697 gene locus_tag LOCUS_01580 160512 160697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 160687 160881 gene locus_tag LOCUS_01590 160687 160881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 160878 161192 gene locus_tag LOCUS_01600 160878 161192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 161243 161998 gene locus_tag LOCUS_01610 161243 161998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_01610 161998 162540 gene locus_tag LOCUS_01620 161998 162540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 162542 162739 gene locus_tag LOCUS_01630 162542 162739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 162736 163236 gene locus_tag LOCUS_01640 162736 163236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 163871 163959 gene locus_tag LOCUS_t00020 163871 163959 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 164313 164555 gene locus_tag LOCUS_01650 164313 164555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 164552 165001 gene locus_tag LOCUS_01660 164552 165001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 164985 166187 gene locus_tag LOCUS_01670 164985 166187 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_01670 166187 167590 gene locus_tag LOCUS_01680 166187 167590 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922075.1 protein_id gnl|my_center|LOCUS_01680 167590 168390 gene locus_tag LOCUS_01690 167590 168390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 168739 169158 gene locus_tag LOCUS_01700 168739 169158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 169510 169671 gene locus_tag LOCUS_01710 169510 169671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 169664 169825 gene locus_tag LOCUS_01720 169664 169825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 170054 170680 gene locus_tag LOCUS_01730 170054 170680 CDS product phage scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003769956.1 protein_id gnl|my_center|LOCUS_01730 170686 171042 gene locus_tag LOCUS_01740 170686 171042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 171059 172129 gene locus_tag LOCUS_01750 171059 172129 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922218.1 protein_id gnl|my_center|LOCUS_01750 172145 172561 gene locus_tag LOCUS_01760 172145 172561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 172564 173010 gene locus_tag LOCUS_01770 172564 173010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 173010 173408 gene locus_tag LOCUS_01780 173010 173408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 173401 173847 gene locus_tag LOCUS_01790 173401 173847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 173864 174364 gene locus_tag LOCUS_01800 173864 174364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 174387 174821 gene locus_tag LOCUS_01810 174387 174821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 174919 175440 gene locus_tag LOCUS_01820 174919 175440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 175454 178924 gene locus_tag LOCUS_01830 175454 178924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 178937 179332 gene locus_tag LOCUS_01840 178937 179332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 179325 181505 gene locus_tag LOCUS_01850 179325 181505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 181514 182029 gene locus_tag LOCUS_01860 181514 182029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 182031 183182 gene locus_tag LOCUS_01870 182031 183182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 183235 183636 gene locus_tag LOCUS_01880 183235 183636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 183927 184976 gene locus_tag LOCUS_01890 183927 184976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 184931 185122 gene locus_tag LOCUS_01900 184931 185122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 185180 185785 gene locus_tag LOCUS_01910 185180 185785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 185838 186257 gene locus_tag LOCUS_01920 185838 186257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 186270 186461 gene locus_tag LOCUS_01930 186270 186461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 186454 187233 gene locus_tag LOCUS_01940 186454 187233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 187246 187440 gene locus_tag LOCUS_01950 187246 187440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 188754 188320 gene locus_tag LOCUS_01960 188754 188320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 189305 188793 gene locus_tag LOCUS_01970 189305 188793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 190049 189318 gene locus_tag LOCUS_01980 190049 189318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 190402 190857 gene locus_tag LOCUS_01990 190402 190857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 190814 191050 gene locus_tag LOCUS_02000 190814 191050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 191122 191964 gene locus_tag LOCUS_02010 191122 191964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 192041 192220 gene locus_tag LOCUS_02020 192041 192220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 192223 192456 gene locus_tag LOCUS_02030 192223 192456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 192456 192866 gene locus_tag LOCUS_02040 192456 192866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 192863 193588 gene locus_tag LOCUS_02050 192863 193588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 193854 193763 gene locus_tag LOCUS_t00030 193854 193763 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 193978 193892 gene locus_tag LOCUS_t00040 193978 193892 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 194403 194675 gene locus_tag LOCUS_02060 194403 194675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 194752 195858 gene locus_tag LOCUS_02070 194752 195858 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048278.1 protein_id gnl|my_center|LOCUS_02070 196768 197985 gene locus_tag LOCUS_02080 196768 197985 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940010.1 protein_id gnl|my_center|LOCUS_02080 198206 199093 gene locus_tag LOCUS_02090 198206 199093 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_02090 199102 200316 gene locus_tag LOCUS_02100 199102 200316 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080270.1 protein_id gnl|my_center|LOCUS_02100 200313 201164 gene locus_tag LOCUS_02110 200313 201164 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937856.1 protein_id gnl|my_center|LOCUS_02110 201157 201867 gene locus_tag LOCUS_02120 201157 201867 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_02120 202242 202715 gene locus_tag LOCUS_02130 202242 202715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 203217 203759 gene locus_tag LOCUS_02140 203217 203759 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_02140 203756 206839 gene locus_tag LOCUS_02150 203756 206839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 206843 208660 gene locus_tag LOCUS_02160 206843 208660 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_02160 209524 208748 gene locus_tag LOCUS_02170 gene trmD 209524 208748 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965065.1 protein_id gnl|my_center|LOCUS_02170 210021 209530 gene locus_tag LOCUS_02180 gene rimM 210021 209530 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_02180 210311 210081 gene locus_tag LOCUS_02190 210311 210081 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_02190 210563 210324 gene locus_tag LOCUS_02200 gene rpsP 210563 210324 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_02200 211991 210633 gene locus_tag LOCUS_02210 gene ffh 211991 210633 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_02210 212367 211999 gene locus_tag LOCUS_02220 212367 211999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 212615 213898 gene locus_tag LOCUS_02230 212615 213898 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886510.1 protein_id gnl|my_center|LOCUS_02230 213902 215182 gene locus_tag LOCUS_02240 213902 215182 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411954.1 protein_id gnl|my_center|LOCUS_02240 215179 216048 gene locus_tag LOCUS_02250 gene lgt 215179 216048 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646080.1 protein_id gnl|my_center|LOCUS_02250 216052 216891 gene locus_tag LOCUS_02260 216052 216891 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162927877.1 protein_id gnl|my_center|LOCUS_02260 217020 217391 gene locus_tag LOCUS_02270 217020 217391 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_02270 217577 218092 gene locus_tag LOCUS_02280 gene nusB 217577 218092 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_02280 218096 219037 gene locus_tag LOCUS_02290 218096 219037 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_02290 219037 220257 gene locus_tag LOCUS_02300 gene xseA 219037 220257 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_02300 220239 220472 gene locus_tag LOCUS_02310 220239 220472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 220477 221349 gene locus_tag LOCUS_02320 gene ispA 220477 221349 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150378.1 protein_id gnl|my_center|LOCUS_02320 221384 223237 gene locus_tag LOCUS_02330 gene dxs 221384 223237 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_02330 223227 224042 gene locus_tag LOCUS_02340 223227 224042 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965376.1 protein_id gnl|my_center|LOCUS_02340 224039 224914 gene locus_tag LOCUS_02350 224039 224914 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880555.1 protein_id gnl|my_center|LOCUS_02350 224911 225372 gene locus_tag LOCUS_02360 gene argR 224911 225372 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935393.1 protein_id gnl|my_center|LOCUS_02360 225397 227088 gene locus_tag LOCUS_02370 gene recN 225397 227088 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_02370 227452 228681 gene locus_tag LOCUS_02380 gene tyrS 227452 228681 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_02380 229085 228837 gene locus_tag LOCUS_02390 229085 228837 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_02390 231585 229186 gene locus_tag LOCUS_02400 gene pheT 231585 229186 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357703.1 protein_id gnl|my_center|LOCUS_02400 232629 231604 gene locus_tag LOCUS_02410 gene pheS 232629 231604 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436795.1 protein_id gnl|my_center|LOCUS_02410 233271 233146 gene locus_tag LOCUS_02420 233271 233146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 233403 233888 gene locus_tag LOCUS_02430 233403 233888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 233911 234522 gene locus_tag LOCUS_02440 233911 234522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 234543 235685 gene locus_tag LOCUS_02450 gene alr 234543 235685 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_02450 235921 236286 gene locus_tag LOCUS_02460 235921 236286 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_02460 236392 236886 gene locus_tag LOCUS_02470 236392 236886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 238344 237076 gene locus_tag LOCUS_02480 238344 237076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 239283 240422 gene locus_tag LOCUS_02490 239283 240422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 240423 241790 gene locus_tag LOCUS_02500 240423 241790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 243441 244799 gene locus_tag LOCUS_02510 243441 244799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 244868 246583 gene locus_tag LOCUS_02520 244868 246583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 247549 248283 gene locus_tag LOCUS_02530 gene cwlD 247549 248283 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966373.1 protein_id gnl|my_center|LOCUS_02530 248280 249647 gene locus_tag LOCUS_02540 gene radA 248280 249647 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_02540 251175 249913 gene locus_tag LOCUS_02550 251175 249913 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_02550 251443 252591 gene locus_tag LOCUS_02560 251443 252591 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732062.1 protein_id gnl|my_center|LOCUS_02560 252776 253063 gene locus_tag LOCUS_02570 252776 253063 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_02570 253094 254731 gene locus_tag LOCUS_02580 gene groL 253094 254731 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357641.1 protein_id gnl|my_center|LOCUS_02580 254916 255578 gene locus_tag LOCUS_02590 254916 255578 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681526.1 protein_id gnl|my_center|LOCUS_02590 255634 255942 gene locus_tag LOCUS_02600 255634 255942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 255968 256393 gene locus_tag LOCUS_02610 255968 256393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 256383 257306 gene locus_tag LOCUS_02620 256383 257306 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_02620 257348 258478 gene locus_tag LOCUS_02630 257348 258478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 258499 259446 gene locus_tag LOCUS_02640 258499 259446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 262664 259512 gene locus_tag LOCUS_02650 262664 259512 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_02650 263833 262661 gene locus_tag LOCUS_02660 263833 262661 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214669.1 protein_id gnl|my_center|LOCUS_02660 264353 263889 gene locus_tag LOCUS_02670 264353 263889 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_02670 264542 266299 gene locus_tag LOCUS_02680 264542 266299 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948922.1 protein_id gnl|my_center|LOCUS_02680 266396 266920 gene locus_tag LOCUS_02690 gene vanZ1 266396 266920 CDS product glycopeptide resistance protein VanZ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889012.1 protein_id gnl|my_center|LOCUS_02690 268396 267026 gene locus_tag LOCUS_02700 268396 267026 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_02700 268651 269238 gene locus_tag LOCUS_02710 268651 269238 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807769.1 protein_id gnl|my_center|LOCUS_02710 269327 274033 gene locus_tag LOCUS_02720 269327 274033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986914.1 protein_id gnl|my_center|LOCUS_02720 274293 275261 gene locus_tag LOCUS_02730 274293 275261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 275258 276322 gene locus_tag LOCUS_02740 275258 276322 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986916.1 protein_id gnl|my_center|LOCUS_02740 276399 276983 gene locus_tag LOCUS_02750 276399 276983 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943659.1 protein_id gnl|my_center|LOCUS_02750 277733 277050 gene locus_tag LOCUS_02760 gene maeM 277733 277050 CDS product two-component system response regulator MaeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968074.1 protein_id gnl|my_center|LOCUS_02760 279375 277753 gene locus_tag LOCUS_02770 279375 277753 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948042.1 protein_id gnl|my_center|LOCUS_02770 279602 280291 gene locus_tag LOCUS_02780 279602 280291 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966155.1 protein_id gnl|my_center|LOCUS_02780 280358 280576 gene locus_tag LOCUS_02790 280358 280576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 280593 281084 gene locus_tag LOCUS_02800 280593 281084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 281081 281596 gene locus_tag LOCUS_02810 281081 281596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 281602 283119 gene locus_tag LOCUS_02820 gene atpA 281602 283119 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_02820 283107 284069 gene locus_tag LOCUS_02830 gene atpG 283107 284069 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_02830 284093 285490 gene locus_tag LOCUS_02840 gene atpD 284093 285490 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_02840 285490 285900 gene locus_tag LOCUS_02850 285490 285900 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564973.1 protein_id gnl|my_center|LOCUS_02850 286141 287508 gene locus_tag LOCUS_02860 286141 287508 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_02860 288171 287560 gene locus_tag LOCUS_02870 288171 287560 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392905.1 protein_id gnl|my_center|LOCUS_02870 288646 288176 gene locus_tag LOCUS_02880 288646 288176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 288990 290303 gene locus_tag LOCUS_02890 gene thiC 288990 290303 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966296.1 protein_id gnl|my_center|LOCUS_02890 291218 290400 gene locus_tag LOCUS_02900 291218 290400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 291805 291212 gene locus_tag LOCUS_02910 291805 291212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 293534 292644 gene locus_tag LOCUS_02920 gene dapA 293534 292644 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_02920 294740 293655 gene locus_tag LOCUS_02930 gene asd 294740 293655 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_02930 294971 296629 gene locus_tag LOCUS_02940 294971 296629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 296616 297653 gene locus_tag LOCUS_02950 gene queA 296616 297653 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_02950 297666 298796 gene locus_tag LOCUS_02960 gene tgt 297666 298796 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_02960 298879 299184 gene locus_tag LOCUS_02970 gene yajC 298879 299184 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426573.1 protein_id gnl|my_center|LOCUS_02970 299252 299680 gene locus_tag LOCUS_02980 299252 299680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 300427 301410 gene locus_tag LOCUS_02990 300427 301410 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_02990 301733 301413 gene locus_tag LOCUS_03000 301733 301413 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_03000 303889 301871 gene locus_tag LOCUS_03010 gene ligA 303889 301871 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_03010 305167 303920 gene locus_tag LOCUS_03020 305167 303920 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_03020 306179 305169 gene locus_tag LOCUS_03030 306179 305169 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_03030 307225 306197 gene locus_tag LOCUS_03040 307225 306197 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_03040 308255 307215 gene locus_tag LOCUS_03050 308255 307215 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_03050 309650 308265 gene locus_tag LOCUS_03060 gene murD 309650 308265 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_03060 310034 309867 gene locus_tag LOCUS_03070 310034 309867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 312507 310090 gene locus_tag LOCUS_03080 312507 310090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 312850 312629 gene locus_tag LOCUS_03090 312850 312629 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_03090 313078 312866 gene locus_tag LOCUS_03100 313078 312866 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_03100 313397 313762 gene locus_tag LOCUS_03110 313397 313762 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_03110 316037 313872 gene locus_tag LOCUS_03120 316037 313872 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_03120 316762 316457 gene locus_tag LOCUS_03130 316762 316457 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_03130 316949 317037 gene locus_tag LOCUS_t00050 316949 317037 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 318659 317253 gene locus_tag LOCUS_03140 318659 317253 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198991.1 protein_id gnl|my_center|LOCUS_03140 319601 318804 gene locus_tag LOCUS_03150 319601 318804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 321030 319606 gene locus_tag LOCUS_03160 321030 319606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 321284 321493 gene locus_tag LOCUS_03170 321284 321493 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985621.1 protein_id gnl|my_center|LOCUS_03170 321619 322224 gene locus_tag LOCUS_03180 321619 322224 CDS product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459228.1 protein_id gnl|my_center|LOCUS_03180 322236 322793 gene locus_tag LOCUS_03190 322236 322793 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272229.1 protein_id gnl|my_center|LOCUS_03190 322809 326363 gene locus_tag LOCUS_03200 gene brxC 322809 326363 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459229.1 protein_id gnl|my_center|LOCUS_03200 326378 328963 gene locus_tag LOCUS_03210 326378 328963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 328972 330651 gene locus_tag LOCUS_03220 328972 330651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 330669 330869 gene locus_tag LOCUS_03230 330669 330869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 330871 332010 gene locus_tag LOCUS_03240 330871 332010 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460692.1 protein_id gnl|my_center|LOCUS_03240 332012 332953 gene locus_tag LOCUS_03250 332012 332953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 332968 335553 gene locus_tag LOCUS_03260 gene pglZ 332968 335553 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459232.1 protein_id gnl|my_center|LOCUS_03260 335564 337633 gene locus_tag LOCUS_03270 gene brxL 335564 337633 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459233.1 protein_id gnl|my_center|LOCUS_03270 338021 338746 gene locus_tag LOCUS_03280 338021 338746 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_03280 338821 340659 gene locus_tag LOCUS_03290 338821 340659 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099491.1 protein_id gnl|my_center|LOCUS_03290 340652 341323 gene locus_tag LOCUS_03300 340652 341323 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438070.1 protein_id gnl|my_center|LOCUS_03300 342092 341391 gene locus_tag LOCUS_03310 342092 341391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 342282 344054 gene locus_tag LOCUS_03320 342282 344054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807777.1 protein_id gnl|my_center|LOCUS_03320 344335 345993 gene locus_tag LOCUS_03330 344335 345993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 345997 347388 gene locus_tag LOCUS_03340 345997 347388 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643131.1 protein_id gnl|my_center|LOCUS_03340 348257 347361 gene locus_tag LOCUS_03350 348257 347361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 349107 348424 gene locus_tag LOCUS_03360 349107 348424 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808611.1 protein_id gnl|my_center|LOCUS_03360 349286 350050 gene locus_tag LOCUS_03370 349286 350050 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_03370 350436 350056 gene locus_tag LOCUS_03380 350436 350056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 351113 350433 gene locus_tag LOCUS_03390 351113 350433 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_03390 351325 352866 gene locus_tag LOCUS_03400 gene guaA 351325 352866 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679432.1 protein_id gnl|my_center|LOCUS_03400 355121 352947 gene locus_tag LOCUS_03410 355121 352947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 355548 355742 gene locus_tag LOCUS_03420 355548 355742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 356566 356396 gene locus_tag LOCUS_03430 356566 356396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 356721 357458 gene locus_tag LOCUS_03440 356721 357458 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812913.1 protein_id gnl|my_center|LOCUS_03440 358751 357558 gene locus_tag LOCUS_03450 358751 357558 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_03450 359012 359593 gene locus_tag LOCUS_03460 359012 359593 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383642.1 protein_id gnl|my_center|LOCUS_03460 359667 360125 gene locus_tag LOCUS_03470 gene nrdR 359667 360125 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399430.1 protein_id gnl|my_center|LOCUS_03470 361878 360190 gene locus_tag LOCUS_03480 361878 360190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 361805 362053 gene locus_tag LOCUS_03490 361805 362053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 365648 362076 gene locus_tag LOCUS_03500 gene nifJ 365648 362076 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_03500 366719 366012 gene locus_tag LOCUS_03510 366719 366012 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_03510 366819 367499 gene locus_tag LOCUS_03520 366819 367499 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_03520 367519 368550 gene locus_tag LOCUS_03530 367519 368550 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922574.1 protein_id gnl|my_center|LOCUS_03530 368601 370046 gene locus_tag LOCUS_03540 368601 370046 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_03540 370061 371104 gene locus_tag LOCUS_03550 370061 371104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 371987 371148 gene locus_tag LOCUS_03560 gene nudC 371987 371148 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102051.1 protein_id gnl|my_center|LOCUS_03560 373648 372002 gene locus_tag LOCUS_03570 373648 372002 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_03570 373887 373645 gene locus_tag LOCUS_03580 373887 373645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 373846 374541 gene locus_tag LOCUS_03590 gene tsaA 373846 374541 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_03590 375994 374627 gene locus_tag LOCUS_03600 375994 374627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 377059 376187 gene locus_tag LOCUS_03610 377059 376187 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964020.1 protein_id gnl|my_center|LOCUS_03610 377929 377174 gene locus_tag LOCUS_03620 377929 377174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 378984 378034 gene locus_tag LOCUS_03630 378984 378034 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_03630 379479 379015 gene locus_tag LOCUS_03640 379479 379015 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015665.1 protein_id gnl|my_center|LOCUS_03640 379742 381028 gene locus_tag LOCUS_03650 379742 381028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 381069 381776 gene locus_tag LOCUS_03660 381069 381776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 384603 381835 gene locus_tag LOCUS_03670 384603 381835 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948403.1 protein_id gnl|my_center|LOCUS_03670 384817 384587 gene locus_tag LOCUS_03680 384817 384587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 385571 384831 gene locus_tag LOCUS_03690 385571 384831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 386711 385587 gene locus_tag LOCUS_03700 386711 385587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 387114 386689 gene locus_tag LOCUS_03710 387114 386689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 388185 387307 gene locus_tag LOCUS_03720 388185 387307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 391972 388454 gene locus_tag LOCUS_03730 391972 388454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 395588 391986 gene locus_tag LOCUS_03740 395588 391986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 398448 395605 gene locus_tag LOCUS_03750 398448 395605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 400558 398450 gene locus_tag LOCUS_03760 400558 398450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 401367 400591 gene locus_tag LOCUS_03770 401367 400591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 402617 401367 gene locus_tag LOCUS_03780 402617 401367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 402849 402631 gene locus_tag LOCUS_03790 402849 402631 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_03790 403066 405039 gene locus_tag LOCUS_03800 403066 405039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 405424 405933 gene locus_tag LOCUS_03810 405424 405933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 406088 406297 gene locus_tag LOCUS_03820 406088 406297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 406233 406538 gene locus_tag LOCUS_03830 406233 406538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 406528 407667 gene locus_tag LOCUS_03840 406528 407667 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 protein_id gnl|my_center|LOCUS_03840 407660 408232 gene locus_tag LOCUS_03850 407660 408232 CDS product DUF2815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399690.1 protein_id gnl|my_center|LOCUS_03850 408247 408465 gene locus_tag LOCUS_03860 408247 408465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 408533 410473 gene locus_tag LOCUS_03870 408533 410473 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_03870 410565 410984 gene locus_tag LOCUS_03880 410565 410984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 410989 411258 gene locus_tag LOCUS_03890 410989 411258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 411320 412840 gene locus_tag LOCUS_03900 411320 412840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03900 412847 413599 gene locus_tag LOCUS_03910 412847 413599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03910 413727 414008 gene locus_tag LOCUS_03920 413727 414008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 413989 415338 gene locus_tag LOCUS_03930 413989 415338 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 protein_id gnl|my_center|LOCUS_03930 415338 415598 gene locus_tag LOCUS_03940 415338 415598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 415595 416008 gene locus_tag LOCUS_03950 415595 416008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 416134 416502 gene locus_tag LOCUS_03960 416134 416502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 416447 416647 gene locus_tag LOCUS_03970 416447 416647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 416628 417176 gene locus_tag LOCUS_03980 416628 417176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 417234 418472 gene locus_tag LOCUS_03990 417234 418472 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_03990 418582 419241 gene locus_tag LOCUS_04000 418582 419241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 419225 419452 gene locus_tag LOCUS_04010 419225 419452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 419445 419627 gene locus_tag LOCUS_04020 419445 419627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 419779 421380 gene locus_tag LOCUS_04030 419779 421380 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443313.1 protein_id gnl|my_center|LOCUS_04030 421484 422803 gene locus_tag LOCUS_04040 421484 422803 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016570.1 protein_id gnl|my_center|LOCUS_04040 422967 424319 gene locus_tag LOCUS_04050 422967 424319 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523689.1 protein_id gnl|my_center|LOCUS_04050 424228 424959 gene locus_tag LOCUS_04060 424228 424959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 424977 426161 gene locus_tag LOCUS_04070 424977 426161 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640585.1 protein_id gnl|my_center|LOCUS_04070 426180 426491 gene locus_tag LOCUS_04080 426180 426491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 426488 426823 gene locus_tag LOCUS_04090 426488 426823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 426816 427283 gene locus_tag LOCUS_04100 426816 427283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 427241 427579 gene locus_tag LOCUS_04110 427241 427579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 427586 428179 gene locus_tag LOCUS_04120 427586 428179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 428176 428568 gene locus_tag LOCUS_04130 428176 428568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 428759 431929 gene locus_tag LOCUS_04140 428759 431929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 431922 432302 gene locus_tag LOCUS_04150 431922 432302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 432299 433840 gene locus_tag LOCUS_04160 432299 433840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 433840 434223 gene locus_tag LOCUS_04170 433840 434223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 434220 434708 gene locus_tag LOCUS_04180 434220 434708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 434705 436414 gene locus_tag LOCUS_04190 434705 436414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 436533 436946 gene locus_tag LOCUS_04200 436533 436946 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439566.1 protein_id gnl|my_center|LOCUS_04200 437043 437882 gene locus_tag LOCUS_04210 437043 437882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 438016 438438 gene locus_tag LOCUS_04220 438016 438438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 438431 438646 gene locus_tag LOCUS_04230 438431 438646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 438651 440450 gene locus_tag LOCUS_04240 438651 440450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 440429 442012 gene locus_tag LOCUS_04250 440429 442012 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_04250 443230 442073 gene locus_tag LOCUS_04260 443230 442073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 443415 443233 gene locus_tag LOCUS_04270 443415 443233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 444129 443494 gene locus_tag LOCUS_04280 444129 443494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 445483 444287 gene locus_tag LOCUS_04290 445483 444287 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020871.1 protein_id gnl|my_center|LOCUS_04290 445684 446661 gene locus_tag LOCUS_04300 445684 446661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 446827 447738 gene locus_tag LOCUS_04310 446827 447738 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368732.1 protein_id gnl|my_center|LOCUS_04310 447978 451247 gene locus_tag LOCUS_04320 447978 451247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 451287 451763 gene locus_tag LOCUS_04330 451287 451763 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_04330 451760 453340 gene locus_tag LOCUS_04340 451760 453340 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368726.1 protein_id gnl|my_center|LOCUS_04340 453393 453770 gene locus_tag LOCUS_04350 453393 453770 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_04350 453785 453967 gene locus_tag LOCUS_04360 453785 453967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 453979 454281 gene locus_tag LOCUS_04370 453979 454281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 455210 454362 gene locus_tag LOCUS_04380 455210 454362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 455573 455866 gene locus_tag LOCUS_04390 455573 455866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 455850 456155 gene locus_tag LOCUS_04400 455850 456155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 456583 457827 gene locus_tag LOCUS_04410 456583 457827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 457968 458528 gene locus_tag LOCUS_04420 457968 458528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 >Feature sequence02 1162 92 gene locus_tag LOCUS_04430 1162 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 2206 1175 gene locus_tag LOCUS_04440 2206 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 3696 2203 gene locus_tag LOCUS_04450 3696 2203 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541476.1 protein_id gnl|my_center|LOCUS_04450 4526 3843 gene locus_tag LOCUS_04460 4526 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 6501 4822 gene locus_tag LOCUS_04470 gene mrdA 6501 4822 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_04470 6947 6507 gene locus_tag LOCUS_04480 6947 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 7595 6948 gene locus_tag LOCUS_04490 7595 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 8376 7846 gene locus_tag LOCUS_04500 8376 7846 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_04500 10610 8586 gene locus_tag LOCUS_04510 10610 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 11110 10679 gene locus_tag LOCUS_04520 11110 10679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 11283 11876 gene locus_tag LOCUS_04530 gene pth 11283 11876 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_04530 11928 15329 gene locus_tag LOCUS_04540 gene mfd 11928 15329 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_04540 15941 15396 gene locus_tag LOCUS_04550 15941 15396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 16548 15979 gene locus_tag LOCUS_04560 16548 15979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 16709 17197 gene locus_tag LOCUS_04570 16709 17197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 17204 18388 gene locus_tag LOCUS_04580 17204 18388 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207481.1 protein_id gnl|my_center|LOCUS_04580 18385 19803 gene locus_tag LOCUS_04590 18385 19803 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_04590 20608 19793 gene locus_tag LOCUS_04600 20608 19793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 20880 20620 gene locus_tag LOCUS_04610 20880 20620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 21106 20912 gene locus_tag LOCUS_04620 21106 20912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 21320 23530 gene locus_tag LOCUS_04630 21320 23530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 23699 25684 gene locus_tag LOCUS_04640 gene gyrB 23699 25684 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_04640 25747 27432 gene locus_tag LOCUS_04650 25747 27432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 27486 27701 gene locus_tag LOCUS_04660 27486 27701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 27812 30061 gene locus_tag LOCUS_04670 gene gyrA 27812 30061 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632827.1 protein_id gnl|my_center|LOCUS_04670 30058 30780 gene locus_tag LOCUS_04680 30058 30780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 30824 30899 gene locus_tag LOCUS_t00060 30824 30899 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 31030 32298 gene locus_tag LOCUS_04690 31030 32298 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968626.1 protein_id gnl|my_center|LOCUS_04690 32302 33084 gene locus_tag LOCUS_04700 32302 33084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 33538 33023 gene locus_tag LOCUS_04710 33538 33023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 33724 35166 gene locus_tag LOCUS_04720 gene proS 33724 35166 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040960.1 protein_id gnl|my_center|LOCUS_04720 37022 35643 gene locus_tag LOCUS_04730 37022 35643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 37270 37037 gene locus_tag LOCUS_04740 37270 37037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 37416 37724 gene locus_tag LOCUS_04750 37416 37724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 38209 38721 gene locus_tag LOCUS_04760 38209 38721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 39536 38814 gene locus_tag LOCUS_04770 39536 38814 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774590.1 protein_id gnl|my_center|LOCUS_04770 40302 39523 gene locus_tag LOCUS_04780 40302 39523 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903444.1 protein_id gnl|my_center|LOCUS_04780 41247 40393 gene locus_tag LOCUS_04790 41247 40393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 42229 41453 gene locus_tag LOCUS_04800 42229 41453 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_04800 46806 42400 gene locus_tag LOCUS_04810 46806 42400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 47020 47349 gene locus_tag LOCUS_04820 47020 47349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 49455 47869 gene locus_tag LOCUS_04830 49455 47869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 50146 49721 gene locus_tag LOCUS_04840 50146 49721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 50392 51372 gene locus_tag LOCUS_04850 50392 51372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 51376 52380 gene locus_tag LOCUS_04860 51376 52380 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_04860 53693 52443 gene locus_tag LOCUS_04870 53693 52443 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392573.1 protein_id gnl|my_center|LOCUS_04870 56088 53719 gene locus_tag LOCUS_04880 56088 53719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 57021 56314 gene locus_tag LOCUS_04890 57021 56314 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_04890 58257 57049 gene locus_tag LOCUS_04900 58257 57049 CDS product D-aspartate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294441.1 protein_id gnl|my_center|LOCUS_04900 60620 58353 gene locus_tag LOCUS_04910 60620 58353 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810772.1 protein_id gnl|my_center|LOCUS_04910 62673 60643 gene locus_tag LOCUS_04920 gene recJ 62673 60643 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_04920 64647 62884 gene locus_tag LOCUS_04930 64647 62884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 66637 64688 gene locus_tag LOCUS_04940 66637 64688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 68243 66810 gene locus_tag LOCUS_04950 68243 66810 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_04950 69944 68535 gene locus_tag LOCUS_04960 69944 68535 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965728.1 protein_id gnl|my_center|LOCUS_04960 70490 70224 gene locus_tag LOCUS_04970 gene rpsT 70490 70224 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_04970 70691 71602 gene locus_tag LOCUS_04980 gene gpr 70691 71602 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_04980 72115 71678 gene locus_tag LOCUS_04990 gene rnhA 72115 71678 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044664291.1 protein_id gnl|my_center|LOCUS_04990 74688 72112 gene locus_tag LOCUS_05000 gene gyrA 74688 72112 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_05000 75458 74772 gene locus_tag LOCUS_05010 gene prsW 75458 74772 CDS product glutamic-type intramembrane protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230542.1 protein_id gnl|my_center|LOCUS_05010 77444 75498 gene locus_tag LOCUS_05020 gene gyrB 77444 75498 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435982.1 protein_id gnl|my_center|LOCUS_05020 77730 77464 gene locus_tag LOCUS_05030 77730 77464 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026196.1 protein_id gnl|my_center|LOCUS_05030 78917 77748 gene locus_tag LOCUS_05040 gene recF 78917 77748 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_05040 79126 78914 gene locus_tag LOCUS_05050 79126 78914 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941132.1 protein_id gnl|my_center|LOCUS_05050 80254 79142 gene locus_tag LOCUS_05060 gene dnaN 80254 79142 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_05060 81879 80563 gene locus_tag LOCUS_05070 gene dnaA 81879 80563 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_05070 82298 82432 gene locus_tag LOCUS_05080 82298 82432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 82560 82916 gene locus_tag LOCUS_05090 gene rnpA 82560 82916 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_05090 82913 83131 gene locus_tag LOCUS_05100 gene yidD 82913 83131 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081754.1 protein_id gnl|my_center|LOCUS_05100 83198 84412 gene locus_tag LOCUS_05110 83198 84412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 84428 85249 gene locus_tag LOCUS_05120 84428 85249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 85337 86278 gene locus_tag LOCUS_05130 85337 86278 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_05130 86328 87068 gene locus_tag LOCUS_05140 86328 87068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 87102 88529 gene locus_tag LOCUS_05150 87102 88529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 88892 90151 gene locus_tag LOCUS_05160 88892 90151 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889545.1 protein_id gnl|my_center|LOCUS_05160 90258 91232 gene locus_tag LOCUS_05170 90258 91232 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889546.1 protein_id gnl|my_center|LOCUS_05170 91430 92335 gene locus_tag LOCUS_05180 91430 92335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 92308 94446 gene locus_tag LOCUS_05190 92308 94446 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421678.1 protein_id gnl|my_center|LOCUS_05190 95754 94906 gene locus_tag LOCUS_05200 95754 94906 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_05200 96666 95890 gene locus_tag LOCUS_05210 96666 95890 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_05210 97033 98613 gene locus_tag LOCUS_05220 gene spoVB 97033 98613 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964335.1 protein_id gnl|my_center|LOCUS_05220 98610 99080 gene locus_tag LOCUS_05230 gene tadA 98610 99080 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 protein_id gnl|my_center|LOCUS_05230 100282 99293 gene locus_tag LOCUS_05240 100282 99293 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_05240 101444 100275 gene locus_tag LOCUS_05250 101444 100275 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_05250 102990 101437 gene locus_tag LOCUS_05260 102990 101437 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_05260 104345 103170 gene locus_tag LOCUS_05270 104345 103170 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064307.1 protein_id gnl|my_center|LOCUS_05270 105099 104470 gene locus_tag LOCUS_05280 105099 104470 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389803.1 protein_id gnl|my_center|LOCUS_05280 105433 106773 gene locus_tag LOCUS_05290 105433 106773 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461055.1 protein_id gnl|my_center|LOCUS_05290 108122 106962 gene locus_tag LOCUS_05300 108122 106962 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903799.1 protein_id gnl|my_center|LOCUS_05300 108475 108939 gene locus_tag LOCUS_05310 108475 108939 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641137.1 protein_id gnl|my_center|LOCUS_05310 109044 109868 gene locus_tag LOCUS_05320 gene noc 109044 109868 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_05320 110083 110859 gene locus_tag LOCUS_05330 110083 110859 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_05330 110864 111742 gene locus_tag LOCUS_05340 110864 111742 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_05340 111739 112290 gene locus_tag LOCUS_05350 111739 112290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 112351 113643 gene locus_tag LOCUS_05360 gene serS 112351 113643 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963346.1 protein_id gnl|my_center|LOCUS_05360 113971 114456 gene locus_tag LOCUS_05370 gene mscL 113971 114456 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399960.1 protein_id gnl|my_center|LOCUS_05370 114469 114669 gene locus_tag LOCUS_05380 114469 114669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 114682 115401 gene locus_tag LOCUS_05390 gene rsmG 114682 115401 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048453.1 protein_id gnl|my_center|LOCUS_05390 115478 116215 gene locus_tag LOCUS_05400 gene minD 115478 116215 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503309.1 protein_id gnl|my_center|LOCUS_05400 116341 116757 gene locus_tag LOCUS_05410 gene mgsA 116341 116757 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_05410 116858 118216 gene locus_tag LOCUS_05420 gene hisS 116858 118216 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036976.1 protein_id gnl|my_center|LOCUS_05420 118230 118685 gene locus_tag LOCUS_05430 118230 118685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 118695 119159 gene locus_tag LOCUS_05440 118695 119159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 119266 121071 gene locus_tag LOCUS_05450 gene aspS 119266 121071 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_05450 121073 121933 gene locus_tag LOCUS_05460 121073 121933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 122798 122037 gene locus_tag LOCUS_05470 122798 122037 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_05470 124599 122866 gene locus_tag LOCUS_05480 124599 122866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 124662 125378 gene locus_tag LOCUS_05490 124662 125378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 125444 126922 gene locus_tag LOCUS_05500 125444 126922 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109350.1 protein_id gnl|my_center|LOCUS_05500 127832 126996 gene locus_tag LOCUS_05510 127832 126996 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_05510 128865 127927 gene locus_tag LOCUS_05520 128865 127927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 130424 128961 gene locus_tag LOCUS_05530 130424 128961 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460348.1 protein_id gnl|my_center|LOCUS_05530 131038 130421 gene locus_tag LOCUS_05540 131038 130421 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_05540 131507 131073 gene locus_tag LOCUS_05550 gene dtd 131507 131073 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_05550 132758 131934 gene locus_tag LOCUS_05560 132758 131934 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897816.1 protein_id gnl|my_center|LOCUS_05560 133725 132811 gene locus_tag LOCUS_05570 133725 132811 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_05570 134192 133722 gene locus_tag LOCUS_05580 gene lspA 134192 133722 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295859.1 protein_id gnl|my_center|LOCUS_05580 135264 134215 gene locus_tag LOCUS_05590 135264 134215 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176645.1 protein_id gnl|my_center|LOCUS_05590 138122 135366 gene locus_tag LOCUS_05600 gene ileS 138122 135366 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_05600 138990 138271 gene locus_tag LOCUS_05610 138990 138271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 139571 139044 gene locus_tag LOCUS_05620 139571 139044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 140355 139624 gene locus_tag LOCUS_05630 140355 139624 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_05630 141586 140360 gene locus_tag LOCUS_05640 141586 140360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 141916 141662 gene locus_tag LOCUS_05650 gene hfq 141916 141662 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811582.1 protein_id gnl|my_center|LOCUS_05650 142904 141948 gene locus_tag LOCUS_05660 gene miaA 142904 141948 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_05660 145058 142968 gene locus_tag LOCUS_05670 145058 142968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 147681 145093 gene locus_tag LOCUS_05680 gene mutS 147681 145093 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_05680 149345 147942 gene locus_tag LOCUS_05690 gene miaB 149345 147942 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_05690 149546 152911 gene locus_tag LOCUS_05700 149546 152911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 153058 154200 gene locus_tag LOCUS_05710 153058 154200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 154224 155174 gene locus_tag LOCUS_05720 154224 155174 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814607.1 protein_id gnl|my_center|LOCUS_05720 155234 156112 gene locus_tag LOCUS_05730 155234 156112 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272300.1 protein_id gnl|my_center|LOCUS_05730 158870 156276 gene locus_tag LOCUS_05740 gene clpB 158870 156276 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_05740 159536 159108 gene locus_tag LOCUS_05750 159536 159108 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461281.1 protein_id gnl|my_center|LOCUS_05750 160197 161387 gene locus_tag LOCUS_05760 160197 161387 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966117.1 protein_id gnl|my_center|LOCUS_05760 161535 162230 gene locus_tag LOCUS_05770 161535 162230 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_05770 162227 164356 gene locus_tag LOCUS_05780 162227 164356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 164470 164934 gene locus_tag LOCUS_05790 164470 164934 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228021.1 protein_id gnl|my_center|LOCUS_05790 165019 165738 gene locus_tag LOCUS_05800 165019 165738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 165735 166733 gene locus_tag LOCUS_05810 gene spoIID 165735 166733 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_05810 166730 167425 gene locus_tag LOCUS_05820 166730 167425 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289749.1 protein_id gnl|my_center|LOCUS_05820 168085 167489 gene locus_tag LOCUS_05830 gene lexA 168085 167489 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812299.1 protein_id gnl|my_center|LOCUS_05830 170874 168244 gene locus_tag LOCUS_05840 170874 168244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 171695 170898 gene locus_tag LOCUS_05850 gene rlmB 171695 170898 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_05850 171967 174093 gene locus_tag LOCUS_05860 gene ftsH 171967 174093 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048280.1 protein_id gnl|my_center|LOCUS_05860 174093 174833 gene locus_tag LOCUS_05870 174093 174833 CDS product DUF3658 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100871.1 protein_id gnl|my_center|LOCUS_05870 175298 174891 gene locus_tag LOCUS_05880 175298 174891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 176170 175487 gene locus_tag LOCUS_05890 176170 175487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 176669 176157 gene locus_tag LOCUS_05900 176669 176157 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461816.1 protein_id gnl|my_center|LOCUS_05900 176640 176819 gene locus_tag LOCUS_05910 176640 176819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 178801 176816 gene locus_tag LOCUS_05920 gene metG 178801 176816 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_05920 179765 178854 gene locus_tag LOCUS_05930 179765 178854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 180583 179936 gene locus_tag LOCUS_05940 180583 179936 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_05940 181958 180618 gene locus_tag LOCUS_05950 181958 180618 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_05950 182247 182891 gene locus_tag LOCUS_05960 182247 182891 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322652.1 protein_id gnl|my_center|LOCUS_05960 182898 183662 gene locus_tag LOCUS_05970 182898 183662 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_05970 184174 185619 gene locus_tag LOCUS_05980 184174 185619 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_05980 185781 187172 gene locus_tag LOCUS_05990 gene mnmE 185781 187172 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258674.1 protein_id gnl|my_center|LOCUS_05990 188467 187328 gene locus_tag LOCUS_06000 188467 187328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 188841 188464 gene locus_tag LOCUS_06010 188841 188464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 189876 188860 gene locus_tag LOCUS_06020 189876 188860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 190250 189873 gene locus_tag LOCUS_06030 190250 189873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 191375 190269 gene locus_tag LOCUS_06040 191375 190269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 191860 191372 gene locus_tag LOCUS_06050 191860 191372 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_06050 193368 192010 gene locus_tag LOCUS_06060 193368 192010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 194073 196832 gene locus_tag LOCUS_06070 gene secA 194073 196832 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_06070 196935 197747 gene locus_tag LOCUS_06080 gene pgeF 196935 197747 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227882.1 protein_id gnl|my_center|LOCUS_06080 197792 199867 gene locus_tag LOCUS_06090 197792 199867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 200086 201603 gene locus_tag LOCUS_06100 200086 201603 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963666.1 protein_id gnl|my_center|LOCUS_06100 201714 201641 gene locus_tag LOCUS_t00070 201714 201641 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 201908 202825 gene locus_tag LOCUS_06110 201908 202825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965639.1 protein_id gnl|my_center|LOCUS_06110 203190 202909 gene locus_tag LOCUS_06120 203190 202909 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665928.1 protein_id gnl|my_center|LOCUS_06120 203459 203187 gene locus_tag LOCUS_06130 203459 203187 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_06130 203675 204535 gene locus_tag LOCUS_06140 203675 204535 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817462.1 protein_id gnl|my_center|LOCUS_06140 204532 206766 gene locus_tag LOCUS_06150 204532 206766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 206756 207370 gene locus_tag LOCUS_06160 206756 207370 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_06160 207458 207637 gene locus_tag LOCUS_06170 207458 207637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 207757 208122 gene locus_tag LOCUS_06180 207757 208122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 208236 208715 gene locus_tag LOCUS_06190 208236 208715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 208768 210423 gene locus_tag LOCUS_06200 208768 210423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 210586 211038 gene locus_tag LOCUS_06210 210586 211038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 211184 212440 gene locus_tag LOCUS_06220 211184 212440 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_06220 212708 216628 gene locus_tag LOCUS_06230 212708 216628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 216828 218291 gene locus_tag LOCUS_06240 216828 218291 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_06240 218322 219185 gene locus_tag LOCUS_06250 gene rapZ 218322 219185 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_06250 219216 220115 gene locus_tag LOCUS_06260 gene whiA 219216 220115 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_06260 220180 220620 gene locus_tag LOCUS_06270 220180 220620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 220625 224098 gene locus_tag LOCUS_06280 220625 224098 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_06280 224207 225745 gene locus_tag LOCUS_06290 gene cls 224207 225745 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_06290 226529 226272 gene locus_tag LOCUS_06300 226529 226272 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965739.1 protein_id gnl|my_center|LOCUS_06300 227865 226612 gene locus_tag LOCUS_06310 227865 226612 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115768.1 protein_id gnl|my_center|LOCUS_06310 228461 228751 gene locus_tag LOCUS_06320 228461 228751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 228774 229337 gene locus_tag LOCUS_06330 228774 229337 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945394.1 protein_id gnl|my_center|LOCUS_06330 229509 229841 gene locus_tag LOCUS_06340 229509 229841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 229831 230613 gene locus_tag LOCUS_06350 229831 230613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 230997 230563 gene locus_tag LOCUS_06360 230997 230563 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963997.1 protein_id gnl|my_center|LOCUS_06360 231574 231068 gene locus_tag LOCUS_06370 231574 231068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 232377 231571 gene locus_tag LOCUS_06380 gene queG 232377 231571 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438992.1 protein_id gnl|my_center|LOCUS_06380 234626 232473 gene locus_tag LOCUS_06390 gene pnp 234626 232473 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_06390 235119 234853 gene locus_tag LOCUS_06400 gene rpsO 235119 234853 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_06400 235825 235415 gene locus_tag LOCUS_06410 gene mutT 235825 235415 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_06410 236215 235880 gene locus_tag LOCUS_06420 236215 235880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 236379 236230 gene locus_tag LOCUS_06430 236379 236230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 237012 236395 gene locus_tag LOCUS_06440 237012 236395 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809641.1 protein_id gnl|my_center|LOCUS_06440 237346 237023 gene locus_tag LOCUS_06450 237346 237023 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814555.1 protein_id gnl|my_center|LOCUS_06450 237618 237343 gene locus_tag LOCUS_06460 237618 237343 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814556.1 protein_id gnl|my_center|LOCUS_06460 238210 238761 gene locus_tag LOCUS_06470 238210 238761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 240443 238815 gene locus_tag LOCUS_06480 240443 238815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 >Feature sequence03 231 1589 gene locus_tag LOCUS_06490 231 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 1886 1641 gene locus_tag LOCUS_06500 1886 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 3533 1911 gene locus_tag LOCUS_06510 gene rlmD 3533 1911 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914581.1 protein_id gnl|my_center|LOCUS_06510 4604 3696 gene locus_tag LOCUS_06520 4604 3696 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206134.1 protein_id gnl|my_center|LOCUS_06520 4814 5146 gene locus_tag LOCUS_06530 4814 5146 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_06530 5772 7700 gene locus_tag LOCUS_06540 5772 7700 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_06540 10858 7766 gene locus_tag LOCUS_06550 10858 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 13375 11570 gene locus_tag LOCUS_06560 gene lepA 13375 11570 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 protein_id gnl|my_center|LOCUS_06560 13828 13436 gene locus_tag LOCUS_06570 13828 13436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 14141 14827 gene locus_tag LOCUS_06580 14141 14827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 15147 15683 gene locus_tag LOCUS_06590 15147 15683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 15851 16129 gene locus_tag LOCUS_06600 15851 16129 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_06600 16126 16416 gene locus_tag LOCUS_06610 16126 16416 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944457.1 protein_id gnl|my_center|LOCUS_06610 16672 17253 gene locus_tag LOCUS_06620 16672 17253 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965241.1 protein_id gnl|my_center|LOCUS_06620 17310 19310 gene locus_tag LOCUS_06630 17310 19310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 19303 20190 gene locus_tag LOCUS_06640 19303 20190 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_06640 20235 20957 gene locus_tag LOCUS_06650 20235 20957 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476483.1 protein_id gnl|my_center|LOCUS_06650 20954 21259 gene locus_tag LOCUS_06660 20954 21259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 21288 23177 gene locus_tag LOCUS_06670 gene mnmG 21288 23177 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_06670 23184 24098 gene locus_tag LOCUS_06680 23184 24098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 24091 25113 gene locus_tag LOCUS_06690 gene mnmA 24091 25113 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_06690 25129 26121 gene locus_tag LOCUS_06700 25129 26121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 26103 27062 gene locus_tag LOCUS_06710 26103 27062 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964712.1 protein_id gnl|my_center|LOCUS_06710 27578 27129 gene locus_tag LOCUS_06720 27578 27129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 30198 27976 gene locus_tag LOCUS_06730 30198 27976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 32390 30225 gene locus_tag LOCUS_06740 32390 30225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 34527 32413 gene locus_tag LOCUS_06750 34527 32413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 36560 34539 gene locus_tag LOCUS_06760 36560 34539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 37670 36573 gene locus_tag LOCUS_06770 37670 36573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 38060 37695 gene locus_tag LOCUS_06780 38060 37695 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814133.1 protein_id gnl|my_center|LOCUS_06780 39418 38192 gene locus_tag LOCUS_06790 39418 38192 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_06790 39559 40392 gene locus_tag LOCUS_06800 gene yidA 39559 40392 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704455.1 protein_id gnl|my_center|LOCUS_06800 41325 40519 gene locus_tag LOCUS_06810 41325 40519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 42335 41496 gene locus_tag LOCUS_06820 42335 41496 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_06820 43303 42971 gene locus_tag LOCUS_06830 43303 42971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 44121 43321 gene locus_tag LOCUS_06840 44121 43321 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729274.1 protein_id gnl|my_center|LOCUS_06840 44374 44721 gene locus_tag LOCUS_06850 44374 44721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018213024.1 protein_id gnl|my_center|LOCUS_06850 44734 45288 gene locus_tag LOCUS_06860 44734 45288 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789526.1 protein_id gnl|my_center|LOCUS_06860 45442 46527 gene locus_tag LOCUS_06870 gene serC 45442 46527 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_06870 46778 47914 gene locus_tag LOCUS_06880 46778 47914 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490251.1 protein_id gnl|my_center|LOCUS_06880 47932 48429 gene locus_tag LOCUS_06890 47932 48429 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776788.1 protein_id gnl|my_center|LOCUS_06890 48552 49208 gene locus_tag LOCUS_06900 48552 49208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460670.1 protein_id gnl|my_center|LOCUS_06900 49757 49308 gene locus_tag LOCUS_06910 49757 49308 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418487.1 protein_id gnl|my_center|LOCUS_06910 50241 49828 gene locus_tag LOCUS_06920 50241 49828 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130484.1 protein_id gnl|my_center|LOCUS_06920 51276 50368 gene locus_tag LOCUS_06930 51276 50368 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_06930 51551 52348 gene locus_tag LOCUS_06940 51551 52348 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272484.1 protein_id gnl|my_center|LOCUS_06940 52395 52619 gene locus_tag LOCUS_06950 52395 52619 CDS product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939394.1 protein_id gnl|my_center|LOCUS_06950 52706 53065 gene locus_tag LOCUS_06960 52706 53065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 53623 53132 gene locus_tag LOCUS_06970 53623 53132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 53873 55078 gene locus_tag LOCUS_06980 53873 55078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 55609 55148 gene locus_tag LOCUS_06990 55609 55148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 55897 56430 gene locus_tag LOCUS_07000 55897 56430 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_07000 56645 58606 gene locus_tag LOCUS_07010 56645 58606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 58659 60359 gene locus_tag LOCUS_07020 58659 60359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119166.1 protein_id gnl|my_center|LOCUS_07020 61623 60415 gene locus_tag LOCUS_07030 61623 60415 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108877.1 protein_id gnl|my_center|LOCUS_07030 61878 64250 gene locus_tag LOCUS_07040 gene feoB 61878 64250 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_07040 64326 65048 gene locus_tag LOCUS_07050 64326 65048 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_07050 65045 66319 gene locus_tag LOCUS_07060 65045 66319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 66683 66396 gene locus_tag LOCUS_07070 66683 66396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 68195 66741 gene locus_tag LOCUS_07080 gene abfD 68195 66741 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_07080 70136 68580 gene locus_tag LOCUS_07090 70136 68580 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459194.1 protein_id gnl|my_center|LOCUS_07090 70338 71540 gene locus_tag LOCUS_07100 70338 71540 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870115.1 protein_id gnl|my_center|LOCUS_07100 71600 71950 gene locus_tag LOCUS_07110 71600 71950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 72653 72120 gene locus_tag LOCUS_07120 72653 72120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 74491 72773 gene locus_tag LOCUS_07130 74491 72773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 76197 74539 gene locus_tag LOCUS_07140 76197 74539 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_07140 76568 76900 gene locus_tag LOCUS_07150 76568 76900 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812158.1 protein_id gnl|my_center|LOCUS_07150 76897 77877 gene locus_tag LOCUS_07160 76897 77877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943261.1 protein_id gnl|my_center|LOCUS_07160 77892 78851 gene locus_tag LOCUS_07170 77892 78851 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_07170 78857 79792 gene locus_tag LOCUS_07180 78857 79792 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948854.1 protein_id gnl|my_center|LOCUS_07180 79807 81789 gene locus_tag LOCUS_07190 79807 81789 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966642.1 protein_id gnl|my_center|LOCUS_07190 81816 82379 gene locus_tag LOCUS_07200 81816 82379 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_07200 85015 82976 gene locus_tag LOCUS_07210 gene ftsH 85015 82976 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373798.1 protein_id gnl|my_center|LOCUS_07210 85624 85085 gene locus_tag LOCUS_07220 gene hpt 85624 85085 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356260.1 protein_id gnl|my_center|LOCUS_07220 87018 85621 gene locus_tag LOCUS_07230 gene tilS 87018 85621 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_07230 88357 87002 gene locus_tag LOCUS_07240 88357 87002 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 protein_id gnl|my_center|LOCUS_07240 88836 88387 gene locus_tag LOCUS_07250 gene rplI 88836 88387 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_07250 90929 88929 gene locus_tag LOCUS_07260 90929 88929 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_07260 91860 91024 gene locus_tag LOCUS_07270 91860 91024 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_07270 91965 93083 gene locus_tag LOCUS_07280 91965 93083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 93908 93165 gene locus_tag LOCUS_07290 93908 93165 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294240.1 protein_id gnl|my_center|LOCUS_07290 94867 93908 gene locus_tag LOCUS_07300 94867 93908 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943967.1 protein_id gnl|my_center|LOCUS_07300 95900 94971 gene locus_tag LOCUS_07310 95900 94971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 96140 95925 gene locus_tag LOCUS_07320 96140 95925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 96396 96785 gene locus_tag LOCUS_07330 96396 96785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 96790 97293 gene locus_tag LOCUS_07340 96790 97293 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_07340 97298 98281 gene locus_tag LOCUS_07350 97298 98281 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_07350 98300 98686 gene locus_tag LOCUS_07360 98300 98686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386950.1 protein_id gnl|my_center|LOCUS_07360 99057 98755 gene locus_tag LOCUS_07370 99057 98755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 99186 99482 gene locus_tag LOCUS_07380 99186 99482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 99507 99830 gene locus_tag LOCUS_07390 99507 99830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 101722 100241 gene locus_tag LOCUS_07400 101722 100241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 102424 101738 gene locus_tag LOCUS_07410 102424 101738 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_07410 102538 102687 gene locus_tag LOCUS_07420 102538 102687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 103146 102754 gene locus_tag LOCUS_07430 103146 102754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 103342 104277 gene locus_tag LOCUS_07440 103342 104277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 105325 104285 gene locus_tag LOCUS_07450 105325 104285 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 protein_id gnl|my_center|LOCUS_07450 105428 106744 gene locus_tag LOCUS_07460 gene rpoN 105428 106744 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462176.1 protein_id gnl|my_center|LOCUS_07460 106990 107916 gene locus_tag LOCUS_07470 106990 107916 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_07470 107929 108870 gene locus_tag LOCUS_07480 107929 108870 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_07480 108854 109840 gene locus_tag LOCUS_07490 108854 109840 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533422.1 protein_id gnl|my_center|LOCUS_07490 109833 110795 gene locus_tag LOCUS_07500 109833 110795 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_07500 110902 112524 gene locus_tag LOCUS_07510 110902 112524 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_07510 112635 114251 gene locus_tag LOCUS_07520 112635 114251 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869253.1 protein_id gnl|my_center|LOCUS_07520 114981 114325 gene locus_tag LOCUS_07530 114981 114325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 115352 114978 gene locus_tag LOCUS_07540 115352 114978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 115559 116239 gene locus_tag LOCUS_07550 115559 116239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 116370 116657 gene locus_tag LOCUS_07560 116370 116657 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_07560 116635 116946 gene locus_tag LOCUS_07570 116635 116946 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679825.1 protein_id gnl|my_center|LOCUS_07570 117101 117727 gene locus_tag LOCUS_07580 117101 117727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 119060 117765 gene locus_tag LOCUS_07590 119060 117765 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_07590 119315 121222 gene locus_tag LOCUS_07600 gene htpG 119315 121222 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 protein_id gnl|my_center|LOCUS_07600 121436 121909 gene locus_tag LOCUS_07610 gene tnpA 121436 121909 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966797.1 protein_id gnl|my_center|LOCUS_07610 123780 122368 gene locus_tag LOCUS_07620 123780 122368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 124273 125625 gene locus_tag LOCUS_07630 124273 125625 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_07630 125748 127268 gene locus_tag LOCUS_07640 125748 127268 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_07640 127445 128650 gene locus_tag LOCUS_07650 gene thiI 127445 128650 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_07650 128647 129909 gene locus_tag LOCUS_07660 128647 129909 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_07660 130232 134509 gene locus_tag LOCUS_07670 130232 134509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 135485 134601 gene locus_tag LOCUS_07680 135485 134601 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494241.1 protein_id gnl|my_center|LOCUS_07680 136406 135498 gene locus_tag LOCUS_07690 136406 135498 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_07690 137122 136445 gene locus_tag LOCUS_07700 137122 136445 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765568.1 protein_id gnl|my_center|LOCUS_07700 137248 137718 gene locus_tag LOCUS_07710 137248 137718 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814552.1 protein_id gnl|my_center|LOCUS_07710 139244 137865 gene locus_tag LOCUS_07720 gene mgtE 139244 137865 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_07720 139648 141300 gene locus_tag LOCUS_07730 139648 141300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 141846 141427 gene locus_tag LOCUS_07740 141846 141427 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459277.1 protein_id gnl|my_center|LOCUS_07740 142202 142729 gene locus_tag LOCUS_07750 142202 142729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 143454 142813 gene locus_tag LOCUS_07760 143454 142813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 143932 143399 gene locus_tag LOCUS_07770 143932 143399 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922077.1 protein_id gnl|my_center|LOCUS_07770 145478 144138 gene locus_tag LOCUS_07780 145478 144138 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_07780 146035 145469 gene locus_tag LOCUS_07790 gene yfcE 146035 145469 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_07790 146097 146219 gene locus_tag LOCUS_07800 146097 146219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 146221 146733 gene locus_tag LOCUS_07810 146221 146733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 146730 147602 gene locus_tag LOCUS_07820 146730 147602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 147608 148033 gene locus_tag LOCUS_07830 147608 148033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 148228 148350 gene locus_tag LOCUS_07840 148228 148350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 148418 149452 gene locus_tag LOCUS_07850 148418 149452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 149585 150082 gene locus_tag LOCUS_07860 149585 150082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 150437 150874 gene locus_tag LOCUS_07870 150437 150874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 151026 151316 gene locus_tag LOCUS_07880 151026 151316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 151323 151778 gene locus_tag LOCUS_07890 151323 151778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 151775 152251 gene locus_tag LOCUS_07900 151775 152251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 152476 152697 gene locus_tag LOCUS_07910 152476 152697 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257841.1 protein_id gnl|my_center|LOCUS_07910 152694 153638 gene locus_tag LOCUS_07920 gene fabK 152694 153638 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460502.1 protein_id gnl|my_center|LOCUS_07920 153626 154540 gene locus_tag LOCUS_07930 gene fabD 153626 154540 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765648.1 protein_id gnl|my_center|LOCUS_07930 154537 155277 gene locus_tag LOCUS_07940 gene fabG 154537 155277 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_07940 155353 156597 gene locus_tag LOCUS_07950 gene fabF 155353 156597 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_07950 156594 157007 gene locus_tag LOCUS_07960 156594 157007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 157018 157455 gene locus_tag LOCUS_07970 gene fabZ 157018 157455 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939641.1 protein_id gnl|my_center|LOCUS_07970 157437 158744 gene locus_tag LOCUS_07980 157437 158744 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_07980 158779 159642 gene locus_tag LOCUS_07990 gene accD 158779 159642 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173351.1 protein_id gnl|my_center|LOCUS_07990 159639 160439 gene locus_tag LOCUS_08000 159639 160439 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362363.1 protein_id gnl|my_center|LOCUS_08000 160443 162077 gene locus_tag LOCUS_08010 160443 162077 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_08010 162110 162688 gene locus_tag LOCUS_08020 162110 162688 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047752.1 protein_id gnl|my_center|LOCUS_08020 163325 162762 gene locus_tag LOCUS_08030 163325 162762 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_08030 163867 163322 gene locus_tag LOCUS_08040 163867 163322 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_08040 165290 163881 gene locus_tag LOCUS_08050 gene pepV 165290 163881 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459801.1 protein_id gnl|my_center|LOCUS_08050 165945 165298 gene locus_tag LOCUS_08060 165945 165298 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089970.1 protein_id gnl|my_center|LOCUS_08060 166263 166033 gene locus_tag LOCUS_08070 166263 166033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 169395 166444 gene locus_tag LOCUS_08080 169395 166444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 170673 169621 gene locus_tag LOCUS_08090 170673 169621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 171268 170702 gene locus_tag LOCUS_08100 171268 170702 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_08100 172446 171361 gene locus_tag LOCUS_08110 172446 171361 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808730.1 protein_id gnl|my_center|LOCUS_08110 173293 172529 gene locus_tag LOCUS_08120 173293 172529 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243784.1 protein_id gnl|my_center|LOCUS_08120 174075 173290 gene locus_tag LOCUS_08130 174075 173290 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199877.1 protein_id gnl|my_center|LOCUS_08130 175147 174245 gene locus_tag LOCUS_08140 175147 174245 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700054.1 protein_id gnl|my_center|LOCUS_08140 175625 177112 gene locus_tag LOCUS_08150 175625 177112 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 protein_id gnl|my_center|LOCUS_08150 177332 178750 gene locus_tag LOCUS_08160 177332 178750 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346373.1 protein_id gnl|my_center|LOCUS_08160 178911 179588 gene locus_tag LOCUS_08170 gene maeM 178911 179588 CDS product two-component system response regulator MaeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968074.1 protein_id gnl|my_center|LOCUS_08170 179674 181320 gene locus_tag LOCUS_08180 179674 181320 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_08180 181719 182597 gene locus_tag LOCUS_08190 181719 182597 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288377.1 protein_id gnl|my_center|LOCUS_08190 183470 182667 gene locus_tag LOCUS_08200 183470 182667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 183673 183467 gene locus_tag LOCUS_08210 183673 183467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 183980 183708 gene locus_tag LOCUS_08220 183980 183708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 184199 185050 gene locus_tag LOCUS_08230 184199 185050 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888619.1 protein_id gnl|my_center|LOCUS_08230 185221 185406 gene locus_tag LOCUS_08240 185221 185406 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669524.1 protein_id gnl|my_center|LOCUS_08240 185428 185832 gene locus_tag LOCUS_08250 185428 185832 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813029.1 protein_id gnl|my_center|LOCUS_08250 186029 187252 gene locus_tag LOCUS_08260 186029 187252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 187368 188099 gene locus_tag LOCUS_08270 187368 188099 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812187.1 protein_id gnl|my_center|LOCUS_08270 188116 188868 gene locus_tag LOCUS_08280 188116 188868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 188908 190062 gene locus_tag LOCUS_08290 188908 190062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 190059 190751 gene locus_tag LOCUS_08300 190059 190751 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_08300 192802 190814 gene locus_tag LOCUS_08310 192802 190814 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_08310 193971 192799 gene locus_tag LOCUS_08320 193971 192799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 194120 194284 gene locus_tag LOCUS_08330 194120 194284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 194399 194474 gene locus_tag LOCUS_t00080 194399 194474 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 194902 194591 gene locus_tag LOCUS_08340 194902 194591 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813967.1 protein_id gnl|my_center|LOCUS_08340 195070 197028 gene locus_tag LOCUS_08350 195070 197028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 198548 197151 gene locus_tag LOCUS_08360 198548 197151 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461040.1 protein_id gnl|my_center|LOCUS_08360 199077 198823 gene locus_tag LOCUS_08370 199077 198823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 199604 200497 gene locus_tag LOCUS_08380 gene dapA 199604 200497 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_08380 200525 201253 gene locus_tag LOCUS_08390 gene dapB 200525 201253 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438808.1 protein_id gnl|my_center|LOCUS_08390 201312 202607 gene locus_tag LOCUS_08400 gene lysA 201312 202607 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280659.1 protein_id gnl|my_center|LOCUS_08400 203592 202678 gene locus_tag LOCUS_08410 203592 202678 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989930.1 protein_id gnl|my_center|LOCUS_08410 203735 204511 gene locus_tag LOCUS_08420 203735 204511 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902971.1 protein_id gnl|my_center|LOCUS_08420 204574 206835 gene locus_tag LOCUS_08430 gene cutC 204574 206835 CDS product choline trimethylamine-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272795.1 protein_id gnl|my_center|LOCUS_08430 206867 207163 gene locus_tag LOCUS_08440 206867 207163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 207233 208189 gene locus_tag LOCUS_08450 207233 208189 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459063.1 protein_id gnl|my_center|LOCUS_08450 209777 208368 gene locus_tag LOCUS_08460 209777 208368 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901990.1 protein_id gnl|my_center|LOCUS_08460 210587 210006 gene locus_tag LOCUS_08470 210587 210006 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999314.1 protein_id gnl|my_center|LOCUS_08470 211073 211384 gene locus_tag LOCUS_08480 gene rpsJ 211073 211384 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_08480 211525 212250 gene locus_tag LOCUS_08490 gene rplC 211525 212250 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_08490 212270 212890 gene locus_tag LOCUS_08500 gene rplD 212270 212890 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_08500 212887 213183 gene locus_tag LOCUS_08510 gene rplW 212887 213183 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_08510 213199 214035 gene locus_tag LOCUS_08520 gene rplB 213199 214035 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_08520 214054 214326 gene locus_tag LOCUS_08530 gene rpsS 214054 214326 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_08530 214342 214677 gene locus_tag LOCUS_08540 gene rplV 214342 214677 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887891.1 protein_id gnl|my_center|LOCUS_08540 214693 215526 gene locus_tag LOCUS_08550 gene rpsC 214693 215526 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421163.1 protein_id gnl|my_center|LOCUS_08550 215526 215969 gene locus_tag LOCUS_08560 gene rplP 215526 215969 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_08560 215969 216166 gene locus_tag LOCUS_08570 gene rpmC 215969 216166 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_08570 216181 216444 gene locus_tag LOCUS_08580 gene rpsQ 216181 216444 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_08580 216458 216826 gene locus_tag LOCUS_08590 gene rplN 216458 216826 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966402.1 protein_id gnl|my_center|LOCUS_08590 216841 217158 gene locus_tag LOCUS_08600 gene rplX 216841 217158 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_08600 217176 217724 gene locus_tag LOCUS_08610 gene rplE 217176 217724 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_08610 217742 217927 gene locus_tag LOCUS_08620 217742 217927 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_08620 218110 218511 gene locus_tag LOCUS_08630 gene rpsH 218110 218511 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_08630 218527 219072 gene locus_tag LOCUS_08640 gene rplF 218527 219072 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_08640 219090 219449 gene locus_tag LOCUS_08650 gene rplR 219090 219449 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_08650 219468 219968 gene locus_tag LOCUS_08660 gene rpsE 219468 219968 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_08660 219984 220166 gene locus_tag LOCUS_08670 gene rpmD 219984 220166 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814541.1 protein_id gnl|my_center|LOCUS_08670 220180 220620 gene locus_tag LOCUS_08680 gene rplO 220180 220620 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393918.1 protein_id gnl|my_center|LOCUS_08680 220620 221960 gene locus_tag LOCUS_08690 gene secY 220620 221960 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_08690 221974 222606 gene locus_tag LOCUS_08700 221974 222606 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 protein_id gnl|my_center|LOCUS_08700 222609 223370 gene locus_tag LOCUS_08710 gene map 222609 223370 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_08710 223367 223651 gene locus_tag LOCUS_08720 223367 223651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 223655 223882 gene locus_tag LOCUS_08730 gene infA 223655 223882 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_08730 224046 224414 gene locus_tag LOCUS_08740 gene rpsM 224046 224414 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_08740 224432 224830 gene locus_tag LOCUS_08750 gene rpsK 224432 224830 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401717.1 protein_id gnl|my_center|LOCUS_08750 224855 225457 gene locus_tag LOCUS_08760 gene rpsD 224855 225457 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_08760 225535 226482 gene locus_tag LOCUS_08770 225535 226482 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_08770 226534 226875 gene locus_tag LOCUS_08780 gene rplQ 226534 226875 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_08780 227000 227590 gene locus_tag LOCUS_08790 227000 227590 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206680.1 protein_id gnl|my_center|LOCUS_08790 227594 228199 gene locus_tag LOCUS_08800 227594 228199 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 protein_id gnl|my_center|LOCUS_08800 228489 232346 gene locus_tag LOCUS_08810 gene rpoB 228489 232346 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_08810 232369 236250 gene locus_tag LOCUS_08820 gene rpoC 232369 236250 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001788197.1 protein_id gnl|my_center|LOCUS_08820 236427 237359 gene locus_tag LOCUS_08830 gene murB 236427 237359 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963832.1 protein_id gnl|my_center|LOCUS_08830 237378 237968 gene locus_tag LOCUS_08840 237378 237968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence04 290 3565 gene locus_tag LOCUS_08850 290 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 4383 3766 gene locus_tag LOCUS_08860 4383 3766 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_08860 4525 5178 gene locus_tag LOCUS_08870 4525 5178 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390012.1 protein_id gnl|my_center|LOCUS_08870 5514 5233 gene locus_tag LOCUS_08880 5514 5233 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906388.1 protein_id gnl|my_center|LOCUS_08880 5661 5981 gene locus_tag LOCUS_08890 5661 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 8289 6058 gene locus_tag LOCUS_08900 8289 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 8775 8353 gene locus_tag LOCUS_08910 8775 8353 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813977.1 protein_id gnl|my_center|LOCUS_08910 8978 8790 gene locus_tag LOCUS_08920 8978 8790 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530010.1 protein_id gnl|my_center|LOCUS_08920 9195 9728 gene locus_tag LOCUS_08930 9195 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 10091 11851 gene locus_tag LOCUS_08940 10091 11851 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_08940 12769 11939 gene locus_tag LOCUS_08950 12769 11939 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_08950 14073 12766 gene locus_tag LOCUS_08960 gene mtaB 14073 12766 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_08960 14260 14856 gene locus_tag LOCUS_08970 gene yfbR 14260 14856 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482513.1 protein_id gnl|my_center|LOCUS_08970 14943 15215 gene locus_tag LOCUS_08980 14943 15215 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392891.1 protein_id gnl|my_center|LOCUS_08980 15236 16594 gene locus_tag LOCUS_08990 15236 16594 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_08990 16640 17974 gene locus_tag LOCUS_09000 16640 17974 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048231.1 protein_id gnl|my_center|LOCUS_09000 18193 18606 gene locus_tag LOCUS_09010 18193 18606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_09010 18656 19225 gene locus_tag LOCUS_09020 18656 19225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 20477 19305 gene locus_tag LOCUS_09030 20477 19305 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460576.1 protein_id gnl|my_center|LOCUS_09030 20685 20760 gene locus_tag LOCUS_t00090 20685 20760 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21008 21886 gene locus_tag LOCUS_09040 21008 21886 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023905931.1 protein_id gnl|my_center|LOCUS_09040 22282 22109 gene locus_tag LOCUS_09050 22282 22109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 22781 22353 gene locus_tag LOCUS_09060 22781 22353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 23054 23338 gene locus_tag LOCUS_09070 23054 23338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 23352 24617 gene locus_tag LOCUS_09080 gene yqfD 23352 24617 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392129.1 protein_id gnl|my_center|LOCUS_09080 24623 25591 gene locus_tag LOCUS_09090 24623 25591 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_09090 25591 27042 gene locus_tag LOCUS_09100 25591 27042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 27069 27830 gene locus_tag LOCUS_09110 27069 27830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 27827 30202 gene locus_tag LOCUS_09120 27827 30202 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_09120 30350 30613 gene locus_tag LOCUS_09130 30350 30613 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_09130 30704 32554 gene locus_tag LOCUS_09140 gene uvrC 30704 32554 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_09140 32558 33106 gene locus_tag LOCUS_09150 gene rsmD 32558 33106 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_09150 33149 33661 gene locus_tag LOCUS_09160 gene coaD 33149 33661 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388467.1 protein_id gnl|my_center|LOCUS_09160 33642 34202 gene locus_tag LOCUS_09170 33642 34202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 35897 34272 gene locus_tag LOCUS_09180 35897 34272 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435782.1 protein_id gnl|my_center|LOCUS_09180 36190 37137 gene locus_tag LOCUS_09190 gene rsmH 36190 37137 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731975.1 protein_id gnl|my_center|LOCUS_09190 37205 37783 gene locus_tag LOCUS_09200 37205 37783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 37905 40337 gene locus_tag LOCUS_09210 37905 40337 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949034.1 protein_id gnl|my_center|LOCUS_09210 40462 41916 gene locus_tag LOCUS_09220 40462 41916 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_09220 42014 43039 gene locus_tag LOCUS_09230 gene mraY 42014 43039 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731978.1 protein_id gnl|my_center|LOCUS_09230 43073 44308 gene locus_tag LOCUS_09240 gene spoVE 43073 44308 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753510.1 protein_id gnl|my_center|LOCUS_09240 44334 45446 gene locus_tag LOCUS_09250 gene murG 44334 45446 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181833.1 protein_id gnl|my_center|LOCUS_09250 45570 46823 gene locus_tag LOCUS_09260 gene murA 45570 46823 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_09260 46880 47692 gene locus_tag LOCUS_09270 46880 47692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 47842 48936 gene locus_tag LOCUS_09280 gene ftsZ 47842 48936 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_09280 49511 49011 gene locus_tag LOCUS_09290 49511 49011 CDS product SLOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323417.1 protein_id gnl|my_center|LOCUS_09290 49986 50573 gene locus_tag LOCUS_09300 49986 50573 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583215.1 protein_id gnl|my_center|LOCUS_09300 50643 50921 gene locus_tag LOCUS_09310 50643 50921 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986717.1 protein_id gnl|my_center|LOCUS_09310 51145 51387 gene locus_tag LOCUS_09320 51145 51387 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459096.1 protein_id gnl|my_center|LOCUS_09320 51487 51909 gene locus_tag LOCUS_09330 gene rpsL 51487 51909 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142340.1 protein_id gnl|my_center|LOCUS_09330 52171 52641 gene locus_tag LOCUS_09340 gene rpsG 52171 52641 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137493.1 protein_id gnl|my_center|LOCUS_09340 52660 54762 gene locus_tag LOCUS_09350 gene fusA 52660 54762 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_09350 54904 56106 gene locus_tag LOCUS_09360 gene tuf 54904 56106 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_09360 56203 57054 gene locus_tag LOCUS_09370 56203 57054 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_09370 57605 57108 gene locus_tag LOCUS_09380 57605 57108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 57746 58444 gene locus_tag LOCUS_09390 57746 58444 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989966.1 protein_id gnl|my_center|LOCUS_09390 58619 59710 gene locus_tag LOCUS_09400 58619 59710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 59755 60441 gene locus_tag LOCUS_09410 gene ftsE 59755 60441 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 protein_id gnl|my_center|LOCUS_09410 60431 61321 gene locus_tag LOCUS_09420 gene ftsX 60431 61321 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_09420 61353 61484 gene locus_tag LOCUS_09430 61353 61484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 61587 62756 gene locus_tag LOCUS_09440 61587 62756 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_09440 62799 63344 gene locus_tag LOCUS_09450 gene greA 62799 63344 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_09450 63366 65315 gene locus_tag LOCUS_09460 gene lysS 63366 65315 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861998.1 protein_id gnl|my_center|LOCUS_09460 65597 65926 gene locus_tag LOCUS_09470 65597 65926 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703181.1 protein_id gnl|my_center|LOCUS_09470 65932 66282 gene locus_tag LOCUS_09480 65932 66282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 66304 67068 gene locus_tag LOCUS_09490 66304 67068 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027626.1 protein_id gnl|my_center|LOCUS_09490 67287 68573 gene locus_tag LOCUS_09500 67287 68573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 68640 71102 gene locus_tag LOCUS_09510 gene topA 68640 71102 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813282.1 protein_id gnl|my_center|LOCUS_09510 71095 72402 gene locus_tag LOCUS_09520 gene trmFO 71095 72402 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357486.1 protein_id gnl|my_center|LOCUS_09520 72422 73471 gene locus_tag LOCUS_09530 gene plsX 72422 73471 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_09530 73568 73804 gene locus_tag LOCUS_09540 gene acpP 73568 73804 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965054.1 protein_id gnl|my_center|LOCUS_09540 73874 74554 gene locus_tag LOCUS_09550 gene rnc 73874 74554 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_09550 74551 74718 gene locus_tag LOCUS_09560 74551 74718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 74856 75455 gene locus_tag LOCUS_09570 74856 75455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 75455 76393 gene locus_tag LOCUS_09580 75455 76393 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203382.1 protein_id gnl|my_center|LOCUS_09580 76405 77223 gene locus_tag LOCUS_09590 76405 77223 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_09590 77225 78178 gene locus_tag LOCUS_09600 77225 78178 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_09600 78182 79336 gene locus_tag LOCUS_09610 78182 79336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 79837 79433 gene locus_tag LOCUS_09620 79837 79433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 81380 80004 gene locus_tag LOCUS_09630 81380 80004 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_09630 81816 82688 gene locus_tag LOCUS_09640 81816 82688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807791.1 protein_id gnl|my_center|LOCUS_09640 84421 82787 gene locus_tag LOCUS_09650 84421 82787 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810050.1 protein_id gnl|my_center|LOCUS_09650 84984 84421 gene locus_tag LOCUS_09660 gene ahpC 84984 84421 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810052.1 protein_id gnl|my_center|LOCUS_09660 85202 85672 gene locus_tag LOCUS_09670 85202 85672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 85653 86984 gene locus_tag LOCUS_09680 85653 86984 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_09680 87078 88445 gene locus_tag LOCUS_09690 87078 88445 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682237.1 protein_id gnl|my_center|LOCUS_09690 88438 88575 gene locus_tag LOCUS_09700 88438 88575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 89483 88728 gene locus_tag LOCUS_09710 89483 88728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 89653 90858 gene locus_tag LOCUS_09720 89653 90858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 93486 91177 gene locus_tag LOCUS_09730 93486 91177 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764744.1 protein_id gnl|my_center|LOCUS_09730 93630 95084 gene locus_tag LOCUS_09740 93630 95084 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964632.1 protein_id gnl|my_center|LOCUS_09740 95084 96457 gene locus_tag LOCUS_09750 95084 96457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 97273 96503 gene locus_tag LOCUS_09760 97273 96503 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_09760 99899 97299 gene locus_tag LOCUS_09770 99899 97299 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_09770 101273 99921 gene locus_tag LOCUS_09780 101273 99921 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389377.1 protein_id gnl|my_center|LOCUS_09780 103411 101483 gene locus_tag LOCUS_09790 103411 101483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_09790 105159 103411 gene locus_tag LOCUS_09800 105159 103411 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_09800 105622 105122 gene locus_tag LOCUS_09810 105622 105122 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_09810 107352 105847 gene locus_tag LOCUS_09820 107352 105847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 108658 107480 gene locus_tag LOCUS_09830 108658 107480 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424103.1 protein_id gnl|my_center|LOCUS_09830 109264 108773 gene locus_tag LOCUS_09840 109264 108773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911276.1 protein_id gnl|my_center|LOCUS_09840 109856 110980 gene locus_tag LOCUS_09850 109856 110980 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016357.1 protein_id gnl|my_center|LOCUS_09850 111294 111458 gene locus_tag LOCUS_09860 gene rpmG 111294 111458 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_09860 111500 111826 gene locus_tag LOCUS_09870 111500 111826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 111870 112364 gene locus_tag LOCUS_09880 gene nusG 111870 112364 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_09880 112458 112883 gene locus_tag LOCUS_09890 gene rplK 112458 112883 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_09890 112902 113594 gene locus_tag LOCUS_09900 gene rplA 112902 113594 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_09900 113849 114388 gene locus_tag LOCUS_09910 gene rplJ 113849 114388 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 protein_id gnl|my_center|LOCUS_09910 114471 114848 gene locus_tag LOCUS_09920 gene rplL 114471 114848 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357259.1 protein_id gnl|my_center|LOCUS_09920 116293 114938 gene locus_tag LOCUS_09930 116293 114938 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_09930 116499 116942 gene locus_tag LOCUS_09940 gene ruvX 116499 116942 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810863.1 protein_id gnl|my_center|LOCUS_09940 116939 117721 gene locus_tag LOCUS_09950 gene udp 116939 117721 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_09950 117723 118373 gene locus_tag LOCUS_09960 117723 118373 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272550.1 protein_id gnl|my_center|LOCUS_09960 118470 119018 gene locus_tag LOCUS_09970 118470 119018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 119922 119110 gene locus_tag LOCUS_09980 119922 119110 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986756.1 protein_id gnl|my_center|LOCUS_09980 120218 121105 gene locus_tag LOCUS_09990 gene spoIIIAA 120218 121105 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393045.1 protein_id gnl|my_center|LOCUS_09990 121102 121605 gene locus_tag LOCUS_10000 121102 121605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 121621 121815 gene locus_tag LOCUS_10010 gene spoIIIAC 121621 121815 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888937.1 protein_id gnl|my_center|LOCUS_10010 121825 122208 gene locus_tag LOCUS_10020 121825 122208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 122205 123320 gene locus_tag LOCUS_10030 122205 123320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 123337 123825 gene locus_tag LOCUS_10040 123337 123825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 123822 124352 gene locus_tag LOCUS_10050 123822 124352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 124365 124988 gene locus_tag LOCUS_10060 124365 124988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 125118 125966 gene locus_tag LOCUS_10070 125118 125966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 125963 127306 gene locus_tag LOCUS_10080 125963 127306 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_10080 127757 129214 gene locus_tag LOCUS_10090 127757 129214 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412514.1 protein_id gnl|my_center|LOCUS_10090 129329 129700 gene locus_tag LOCUS_10100 129329 129700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 131038 130295 gene locus_tag LOCUS_10110 131038 130295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 131153 131557 gene locus_tag LOCUS_10120 131153 131557 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700685.1 protein_id gnl|my_center|LOCUS_10120 131561 133312 gene locus_tag LOCUS_10130 gene rqcH 131561 133312 CDS product tRNA modification protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886504.1 protein_id gnl|my_center|LOCUS_10130 133326 133532 gene locus_tag LOCUS_10140 133326 133532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 135726 133945 gene locus_tag LOCUS_10150 135726 133945 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861202.1 protein_id gnl|my_center|LOCUS_10150 136681 135764 gene locus_tag LOCUS_10160 136681 135764 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966232.1 protein_id gnl|my_center|LOCUS_10160 138263 136830 gene locus_tag LOCUS_10170 gene purB 138263 136830 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_10170 138417 138902 gene locus_tag LOCUS_10180 138417 138902 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067975.1 protein_id gnl|my_center|LOCUS_10180 139684 138881 gene locus_tag LOCUS_10190 gene thiD 139684 138881 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_10190 140292 139690 gene locus_tag LOCUS_10200 140292 139690 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852949.1 protein_id gnl|my_center|LOCUS_10200 141512 140292 gene locus_tag LOCUS_10210 141512 140292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 142886 141516 gene locus_tag LOCUS_10220 142886 141516 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_10220 143254 143865 gene locus_tag LOCUS_10230 143254 143865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 144001 144909 gene locus_tag LOCUS_10240 144001 144909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 145718 145293 gene locus_tag LOCUS_10250 145718 145293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 146657 145911 gene locus_tag LOCUS_10260 gene truA 146657 145911 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294728.1 protein_id gnl|my_center|LOCUS_10260 146943 148382 gene locus_tag LOCUS_10270 146943 148382 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_10270 148440 148787 gene locus_tag LOCUS_10280 148440 148787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 149384 148764 gene locus_tag LOCUS_10290 149384 148764 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_10290 149660 150880 gene locus_tag LOCUS_10300 149660 150880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 152217 150985 gene locus_tag LOCUS_10310 152217 150985 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538219.1 protein_id gnl|my_center|LOCUS_10310 152858 152214 gene locus_tag LOCUS_10320 gene thiE 152858 152214 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_10320 153666 152845 gene locus_tag LOCUS_10330 gene thiM 153666 152845 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_10330 154486 153803 gene locus_tag LOCUS_10340 154486 153803 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_10340 155092 154625 gene locus_tag LOCUS_10350 155092 154625 CDS product DUF5684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028234.1 protein_id gnl|my_center|LOCUS_10350 157406 155199 gene locus_tag LOCUS_10360 157406 155199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 157612 157376 gene locus_tag LOCUS_10370 157612 157376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 157584 158504 gene locus_tag LOCUS_10380 157584 158504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 158972 159433 gene locus_tag LOCUS_10390 158972 159433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 159455 160291 gene locus_tag LOCUS_10400 159455 160291 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986775.1 protein_id gnl|my_center|LOCUS_10400 162341 160548 gene locus_tag LOCUS_10410 162341 160548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 163117 162893 gene locus_tag LOCUS_10420 163117 162893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 163361 163131 gene locus_tag LOCUS_10430 163361 163131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 163567 163491 gene locus_tag LOCUS_t00100 163567 163491 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 164514 163738 gene locus_tag LOCUS_10440 164514 163738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 165314 164538 gene locus_tag LOCUS_10450 gene murI 165314 164538 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048400.1 protein_id gnl|my_center|LOCUS_10450 166391 166146 gene locus_tag LOCUS_10460 166391 166146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 166364 166594 gene locus_tag LOCUS_10470 166364 166594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 166591 168003 gene locus_tag LOCUS_10480 166591 168003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 168042 168905 gene locus_tag LOCUS_10490 168042 168905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 168945 169508 gene locus_tag LOCUS_10500 168945 169508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 169620 171008 gene locus_tag LOCUS_10510 169620 171008 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_10510 171024 172157 gene locus_tag LOCUS_10520 171024 172157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 172175 172942 gene locus_tag LOCUS_10530 172175 172942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 173345 174628 gene locus_tag LOCUS_10540 173345 174628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 174710 175396 gene locus_tag LOCUS_10550 174710 175396 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_10550 175393 177054 gene locus_tag LOCUS_10560 175393 177054 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_10560 177051 177734 gene locus_tag LOCUS_10570 177051 177734 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_10570 178074 178970 gene locus_tag LOCUS_10580 178074 178970 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_10580 179021 179995 gene locus_tag LOCUS_10590 gene pstC 179021 179995 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073954.1 protein_id gnl|my_center|LOCUS_10590 179999 180868 gene locus_tag LOCUS_10600 gene pstA 179999 180868 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_10600 180875 181684 gene locus_tag LOCUS_10610 gene pstB 180875 181684 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_10610 181684 182367 gene locus_tag LOCUS_10620 gene phoU 181684 182367 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_10620 182488 184248 gene locus_tag LOCUS_10630 182488 184248 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_10630 184825 185133 gene locus_tag LOCUS_10640 184825 185133 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679244.1 protein_id gnl|my_center|LOCUS_10640 185130 185408 gene locus_tag LOCUS_10650 185130 185408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 186977 185583 gene locus_tag LOCUS_10660 gene asnS 186977 185583 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432161.1 protein_id gnl|my_center|LOCUS_10660 187664 187029 gene locus_tag LOCUS_10670 gene udk 187664 187029 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225916.1 protein_id gnl|my_center|LOCUS_10670 189296 187689 gene locus_tag LOCUS_10680 189296 187689 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_10680 190768 189461 gene locus_tag LOCUS_10690 190768 189461 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016570.1 protein_id gnl|my_center|LOCUS_10690 191019 191783 gene locus_tag LOCUS_10700 191019 191783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 193287 191908 gene locus_tag LOCUS_10710 193287 191908 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_10710 194693 193596 gene locus_tag LOCUS_10720 194693 193596 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546390.1 protein_id gnl|my_center|LOCUS_10720 195844 194813 gene locus_tag LOCUS_10730 195844 194813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 196010 196906 gene locus_tag LOCUS_10740 gene rarD 196010 196906 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019815.1 protein_id gnl|my_center|LOCUS_10740 197634 196939 gene locus_tag LOCUS_10750 gene sfsA 197634 196939 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_10750 197775 199007 gene locus_tag LOCUS_10760 gene pepT 197775 199007 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460034.1 protein_id gnl|my_center|LOCUS_10760 199095 199171 gene locus_tag LOCUS_t00110 199095 199171 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 199210 199284 gene locus_tag LOCUS_t00120 199210 199284 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 199288 199363 gene locus_tag LOCUS_t00130 199288 199363 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 200588 199560 gene locus_tag LOCUS_10770 200588 199560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 200807 200715 gene locus_tag LOCUS_t00140 200807 200715 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 201931 200990 gene locus_tag LOCUS_10780 201931 200990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 202565 202176 gene locus_tag LOCUS_10790 202565 202176 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_10790 202887 204296 gene locus_tag LOCUS_10800 202887 204296 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901990.1 protein_id gnl|my_center|LOCUS_10800 204898 204413 gene locus_tag LOCUS_10810 204898 204413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 205280 205684 gene locus_tag LOCUS_10820 205280 205684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 >Feature sequence05 121 197 gene locus_tag LOCUS_t00150 121 197 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 228 304 gene locus_tag LOCUS_t00160 228 304 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 374 448 gene locus_tag LOCUS_t00170 374 448 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 455 530 gene locus_tag LOCUS_t00180 455 530 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1920 760 gene locus_tag LOCUS_10830 1920 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 2217 2951 gene locus_tag LOCUS_10840 2217 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 3109 3705 gene locus_tag LOCUS_10850 3109 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 5453 3780 gene locus_tag LOCUS_10860 5453 3780 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_10860 5736 6542 gene locus_tag LOCUS_10870 5736 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 7849 6656 gene locus_tag LOCUS_10880 7849 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 8123 8545 gene locus_tag LOCUS_10890 8123 8545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 8699 8612 gene locus_tag LOCUS_t00190 8699 8612 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8853 8766 gene locus_tag LOCUS_t00200 8853 8766 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9671 9042 gene locus_tag LOCUS_10900 gene upp 9671 9042 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_10900 10421 9702 gene locus_tag LOCUS_10910 gene tsaB 10421 9702 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_10910 10891 10418 gene locus_tag LOCUS_10920 gene tsaE 10891 10418 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_10920 11051 12148 gene locus_tag LOCUS_10930 gene rodA 11051 12148 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_10930 12456 12193 gene locus_tag LOCUS_10940 12456 12193 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113434.1 protein_id gnl|my_center|LOCUS_10940 12633 13076 gene locus_tag LOCUS_10950 12633 13076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 13391 13110 gene locus_tag LOCUS_10960 13391 13110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 13536 13937 gene locus_tag LOCUS_10970 13536 13937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 14247 14035 gene locus_tag LOCUS_10980 14247 14035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 14137 14571 gene locus_tag LOCUS_10990 14137 14571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 15982 14702 gene locus_tag LOCUS_11000 15982 14702 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986389.1 protein_id gnl|my_center|LOCUS_11000 16201 16013 gene locus_tag LOCUS_11010 16201 16013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 16317 17342 gene locus_tag LOCUS_11020 16317 17342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 17852 17421 gene locus_tag LOCUS_11030 17852 17421 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_11030 19083 17842 gene locus_tag LOCUS_11040 19083 17842 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_11040 20143 19076 gene locus_tag LOCUS_11050 gene sufD 20143 19076 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_11050 21584 20166 gene locus_tag LOCUS_11060 gene sufB 21584 20166 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_11060 22344 21598 gene locus_tag LOCUS_11070 gene sufC 22344 21598 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_11070 22972 25125 gene locus_tag LOCUS_11080 22972 25125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 25341 25868 gene locus_tag LOCUS_11090 25341 25868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 25884 28538 gene locus_tag LOCUS_11100 25884 28538 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_11100 29116 29292 gene locus_tag LOCUS_11110 29116 29292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 29279 29947 gene locus_tag LOCUS_11120 29279 29947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 30089 30535 gene locus_tag LOCUS_11130 30089 30535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 30698 30868 gene locus_tag LOCUS_11140 30698 30868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 31069 31812 gene locus_tag LOCUS_11150 31069 31812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 31982 32503 gene locus_tag LOCUS_11160 31982 32503 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795316.1 protein_id gnl|my_center|LOCUS_11160 32500 33207 gene locus_tag LOCUS_11170 32500 33207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 33506 33709 gene locus_tag LOCUS_11180 33506 33709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 33776 34195 gene locus_tag LOCUS_11190 33776 34195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 34271 35350 gene locus_tag LOCUS_11200 34271 35350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 35362 36591 gene locus_tag LOCUS_11210 35362 36591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 36588 37262 gene locus_tag LOCUS_11220 36588 37262 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722723.1 protein_id gnl|my_center|LOCUS_11220 37351 37806 gene locus_tag LOCUS_11230 gene rimI 37351 37806 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367190.1 protein_id gnl|my_center|LOCUS_11230 37793 38422 gene locus_tag LOCUS_11240 37793 38422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 38445 38855 gene locus_tag LOCUS_11250 38445 38855 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056959.1 protein_id gnl|my_center|LOCUS_11250 38874 39632 gene locus_tag LOCUS_11260 38874 39632 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861832.1 protein_id gnl|my_center|LOCUS_11260 40940 39699 gene locus_tag LOCUS_11270 40940 39699 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_11270 42700 41123 gene locus_tag LOCUS_11280 gene hcp 42700 41123 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_11280 42828 43175 gene locus_tag LOCUS_11290 42828 43175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 43205 43996 gene locus_tag LOCUS_11300 43205 43996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 44106 44032 gene locus_tag LOCUS_t00210 44106 44032 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 45335 44316 gene locus_tag LOCUS_11310 gene tsaD 45335 44316 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_11310 45506 45431 gene locus_tag LOCUS_t00220 45506 45431 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 45672 46514 gene locus_tag LOCUS_11320 45672 46514 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_11320 46516 47475 gene locus_tag LOCUS_11330 46516 47475 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_11330 47754 49160 gene locus_tag LOCUS_11340 47754 49160 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930859.1 protein_id gnl|my_center|LOCUS_11340 49913 51319 gene locus_tag LOCUS_11350 49913 51319 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930859.1 protein_id gnl|my_center|LOCUS_11350 51821 52315 gene locus_tag LOCUS_11360 gene purE 51821 52315 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_11360 52350 53771 gene locus_tag LOCUS_11370 52350 53771 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_11370 53777 54820 gene locus_tag LOCUS_11380 gene purM 53777 54820 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_11380 54814 55428 gene locus_tag LOCUS_11390 gene purN 54814 55428 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_11390 55425 56135 gene locus_tag LOCUS_11400 55425 56135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 56153 57331 gene locus_tag LOCUS_11410 56153 57331 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_11410 57350 58624 gene locus_tag LOCUS_11420 gene purD 57350 58624 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964705.1 protein_id gnl|my_center|LOCUS_11420 58624 62310 gene locus_tag LOCUS_11430 58624 62310 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_11430 62343 63851 gene locus_tag LOCUS_11440 62343 63851 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_11440 63947 65614 gene locus_tag LOCUS_11450 63947 65614 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_11450 65733 66062 gene locus_tag LOCUS_11460 65733 66062 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393007.1 protein_id gnl|my_center|LOCUS_11460 66065 66517 gene locus_tag LOCUS_11470 gene spoIIAB 66065 66517 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_11470 66514 67224 gene locus_tag LOCUS_11480 gene sigF 66514 67224 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 protein_id gnl|my_center|LOCUS_11480 68167 67211 gene locus_tag LOCUS_11490 gene gluQRS 68167 67211 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_11490 68314 69246 gene locus_tag LOCUS_11500 68314 69246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 69294 69767 gene locus_tag LOCUS_11510 69294 69767 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_11510 70291 69920 gene locus_tag LOCUS_11520 70291 69920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 70983 70288 gene locus_tag LOCUS_11530 70983 70288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 71467 70967 gene locus_tag LOCUS_11540 71467 70967 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_11540 71667 71591 gene locus_tag LOCUS_t00230 71667 71591 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 71802 72101 gene locus_tag LOCUS_11550 71802 72101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 72082 72669 gene locus_tag LOCUS_11560 72082 72669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 72757 73092 gene locus_tag LOCUS_11570 72757 73092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 74097 73186 gene locus_tag LOCUS_11580 gene argF 74097 73186 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_11580 75314 74136 gene locus_tag LOCUS_11590 75314 74136 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_11590 76232 75372 gene locus_tag LOCUS_11600 gene argB 76232 75372 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_11600 77500 76265 gene locus_tag LOCUS_11610 gene argJ 77500 76265 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_11610 78451 77519 gene locus_tag LOCUS_11620 gene argC 78451 77519 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919254.1 protein_id gnl|my_center|LOCUS_11620 79833 78454 gene locus_tag LOCUS_11630 gene argH 79833 78454 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940832.1 protein_id gnl|my_center|LOCUS_11630 81187 79949 gene locus_tag LOCUS_11640 81187 79949 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_11640 81437 81521 gene locus_tag LOCUS_t00240 81437 81521 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 81770 84712 gene locus_tag LOCUS_11650 81770 84712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 85029 86393 gene locus_tag LOCUS_11660 85029 86393 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_11660 86506 87219 gene locus_tag LOCUS_11670 86506 87219 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068399.1 protein_id gnl|my_center|LOCUS_11670 87379 88611 gene locus_tag LOCUS_11680 87379 88611 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016570.1 protein_id gnl|my_center|LOCUS_11680 88672 89130 gene locus_tag LOCUS_11690 88672 89130 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_11690 89196 89384 gene locus_tag LOCUS_11700 89196 89384 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811990.1 protein_id gnl|my_center|LOCUS_11700 89542 89997 gene locus_tag LOCUS_11710 89542 89997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 90793 91161 gene locus_tag LOCUS_11720 90793 91161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 91165 91419 gene locus_tag LOCUS_11730 91165 91419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 91695 92558 gene locus_tag LOCUS_11740 91695 92558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 92642 92962 gene locus_tag LOCUS_11750 92642 92962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 93124 93441 gene locus_tag LOCUS_11760 93124 93441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 93463 93765 gene locus_tag LOCUS_11770 93463 93765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 93780 93977 gene locus_tag LOCUS_11780 93780 93977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 93990 94436 gene locus_tag LOCUS_11790 93990 94436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 94459 94920 gene locus_tag LOCUS_11800 94459 94920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 95331 95891 gene locus_tag LOCUS_11810 95331 95891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 95908 96813 gene locus_tag LOCUS_11820 95908 96813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 97232 97816 gene locus_tag LOCUS_11830 97232 97816 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_11830 97813 98121 gene locus_tag LOCUS_11840 97813 98121 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582672.1 protein_id gnl|my_center|LOCUS_11840 98118 99299 gene locus_tag LOCUS_11850 98118 99299 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582673.1 protein_id gnl|my_center|LOCUS_11850 99306 100247 gene locus_tag LOCUS_11860 99306 100247 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_11860 100374 101240 gene locus_tag LOCUS_11870 gene rsmA 100374 101240 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651548.1 protein_id gnl|my_center|LOCUS_11870 101319 103082 gene locus_tag LOCUS_11880 101319 103082 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391166.1 protein_id gnl|my_center|LOCUS_11880 103240 103734 gene locus_tag LOCUS_11890 gene ruvC 103240 103734 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_11890 103770 104372 gene locus_tag LOCUS_11900 gene ruvA 103770 104372 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_11900 104399 105439 gene locus_tag LOCUS_11910 gene ruvB 104399 105439 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_11910 105602 106234 gene locus_tag LOCUS_11920 105602 106234 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387199.1 protein_id gnl|my_center|LOCUS_11920 106295 106570 gene locus_tag LOCUS_11930 106295 106570 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391912.1 protein_id gnl|my_center|LOCUS_11930 106714 107448 gene locus_tag LOCUS_11940 gene ispD 106714 107448 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_11940 107453 107935 gene locus_tag LOCUS_11950 gene ispF 107453 107935 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_11950 108006 108260 gene locus_tag LOCUS_11960 108006 108260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 108257 109375 gene locus_tag LOCUS_11970 108257 109375 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392916.1 protein_id gnl|my_center|LOCUS_11970 109586 110734 gene locus_tag LOCUS_11980 109586 110734 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307263.1 protein_id gnl|my_center|LOCUS_11980 112570 110822 gene locus_tag LOCUS_11990 112570 110822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 113896 112595 gene locus_tag LOCUS_12000 gene eno 113896 112595 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948030.1 protein_id gnl|my_center|LOCUS_12000 115474 113957 gene locus_tag LOCUS_12010 gene gpmI 115474 113957 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541097.1 protein_id gnl|my_center|LOCUS_12010 116344 115571 gene locus_tag LOCUS_12020 gene tpiA 116344 115571 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_12020 117564 116365 gene locus_tag LOCUS_12030 117564 116365 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_12030 118179 117667 gene locus_tag LOCUS_12040 gene trmL 118179 117667 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_12040 119530 118490 gene locus_tag LOCUS_12050 119530 118490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 121002 119545 gene locus_tag LOCUS_12060 121002 119545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 121258 121602 gene locus_tag LOCUS_12070 121258 121602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 121607 121849 gene locus_tag LOCUS_12080 121607 121849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 122321 121944 gene locus_tag LOCUS_12090 122321 121944 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_12090 122569 122318 gene locus_tag LOCUS_12100 122569 122318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 123023 124330 gene locus_tag LOCUS_12110 123023 124330 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968626.1 protein_id gnl|my_center|LOCUS_12110 124327 125058 gene locus_tag LOCUS_12120 124327 125058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 125275 126687 gene locus_tag LOCUS_12130 125275 126687 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948261.1 protein_id gnl|my_center|LOCUS_12130 126800 127894 gene locus_tag LOCUS_12140 gene ychF 126800 127894 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_12140 127887 128654 gene locus_tag LOCUS_12150 127887 128654 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_12150 128752 129432 gene locus_tag LOCUS_12160 128752 129432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 130256 129567 gene locus_tag LOCUS_12170 130256 129567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 131857 130445 gene locus_tag LOCUS_12180 131857 130445 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_12180 132214 134457 gene locus_tag LOCUS_12190 132214 134457 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_12190 134480 135700 gene locus_tag LOCUS_12200 134480 135700 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_12200 135697 136188 gene locus_tag LOCUS_12210 gene folA 135697 136188 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_12210 136321 136157 gene locus_tag LOCUS_12220 136321 136157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 136899 136519 gene locus_tag LOCUS_12230 136899 136519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 138518 136965 gene locus_tag LOCUS_12240 138518 136965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 138747 139625 gene locus_tag LOCUS_12250 138747 139625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 140376 139699 gene locus_tag LOCUS_12260 140376 139699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 140538 142997 gene locus_tag LOCUS_12270 gene pcrA 140538 142997 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233919.1 protein_id gnl|my_center|LOCUS_12270 143673 143053 gene locus_tag LOCUS_12280 143673 143053 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148797.1 protein_id gnl|my_center|LOCUS_12280 144173 143670 gene locus_tag LOCUS_12290 144173 143670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 144349 145740 gene locus_tag LOCUS_12300 gene murC 144349 145740 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_12300 145840 146835 gene locus_tag LOCUS_12310 145840 146835 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_12310 146832 148544 gene locus_tag LOCUS_12320 146832 148544 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008568.1 protein_id gnl|my_center|LOCUS_12320 148699 150333 gene locus_tag LOCUS_12330 148699 150333 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_12330 150367 150708 gene locus_tag LOCUS_12340 150367 150708 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_12340 150705 152432 gene locus_tag LOCUS_12350 gene iorA 150705 152432 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_12350 152453 153028 gene locus_tag LOCUS_12360 152453 153028 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_12360 153493 156144 gene locus_tag LOCUS_12370 gene alaS 153493 156144 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_12370 156164 156493 gene locus_tag LOCUS_12380 156164 156493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 156524 156862 gene locus_tag LOCUS_12390 156524 156862 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047999.1 protein_id gnl|my_center|LOCUS_12390 156946 159231 gene locus_tag LOCUS_12400 156946 159231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 159232 160296 gene locus_tag LOCUS_12410 159232 160296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 160290 160880 gene locus_tag LOCUS_12420 160290 160880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 161056 161601 gene locus_tag LOCUS_12430 161056 161601 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_12430 161812 162621 gene locus_tag LOCUS_12440 161812 162621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 164091 162736 gene locus_tag LOCUS_12450 164091 162736 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214414.1 protein_id gnl|my_center|LOCUS_12450 164251 164403 gene locus_tag LOCUS_12460 164251 164403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence06 547 80 gene locus_tag LOCUS_12470 547 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1261 977 gene locus_tag LOCUS_12480 1261 977 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 protein_id gnl|my_center|LOCUS_12480 1617 1258 gene locus_tag LOCUS_12490 1617 1258 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461083.1 protein_id gnl|my_center|LOCUS_12490 2209 1754 gene locus_tag LOCUS_12500 2209 1754 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860931.1 protein_id gnl|my_center|LOCUS_12500 2573 2220 gene locus_tag LOCUS_12510 2573 2220 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_12510 2747 3094 gene locus_tag LOCUS_12520 2747 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 3376 3101 gene locus_tag LOCUS_12530 3376 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 3264 4475 gene locus_tag LOCUS_12540 3264 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 5628 4873 gene locus_tag LOCUS_12550 5628 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 6077 6976 gene locus_tag LOCUS_12560 6077 6976 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023177.1 protein_id gnl|my_center|LOCUS_12560 7076 7423 gene locus_tag LOCUS_12570 7076 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 7532 8731 gene locus_tag LOCUS_12580 7532 8731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 9476 8985 gene locus_tag LOCUS_12590 9476 8985 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003828945.1 protein_id gnl|my_center|LOCUS_12590 11009 9675 gene locus_tag LOCUS_12600 11009 9675 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_12600 11259 12620 gene locus_tag LOCUS_12610 gene trkA 11259 12620 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_12610 12633 14069 gene locus_tag LOCUS_12620 12633 14069 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_12620 14097 15533 gene locus_tag LOCUS_12630 14097 15533 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_12630 15750 17867 gene locus_tag LOCUS_12640 15750 17867 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783961.1 protein_id gnl|my_center|LOCUS_12640 18095 19426 gene locus_tag LOCUS_12650 18095 19426 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_12650 19582 20532 gene locus_tag LOCUS_12660 19582 20532 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_12660 20529 21326 gene locus_tag LOCUS_12670 20529 21326 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015842.1 protein_id gnl|my_center|LOCUS_12670 21323 22168 gene locus_tag LOCUS_12680 21323 22168 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056352.1 protein_id gnl|my_center|LOCUS_12680 23001 22567 gene locus_tag LOCUS_12690 23001 22567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428343.1 protein_id gnl|my_center|LOCUS_12690 23594 23031 gene locus_tag LOCUS_12700 gene efp 23594 23031 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_12700 24334 23831 gene locus_tag LOCUS_12710 24334 23831 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888598.1 protein_id gnl|my_center|LOCUS_12710 24425 25234 gene locus_tag LOCUS_12720 24425 25234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 25440 25258 gene locus_tag LOCUS_12730 gene rpsU 25440 25258 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_12730 28070 25656 gene locus_tag LOCUS_12740 gene leuS 28070 25656 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_12740 28499 28131 gene locus_tag LOCUS_12750 gene rsfS 28499 28131 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_12750 30187 28562 gene locus_tag LOCUS_12760 30187 28562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 31392 30184 gene locus_tag LOCUS_12770 31392 30184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 31787 31458 gene locus_tag LOCUS_12780 31787 31458 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034585320.1 protein_id gnl|my_center|LOCUS_12780 32367 31771 gene locus_tag LOCUS_12790 gene rdgB 32367 31771 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926068.1 protein_id gnl|my_center|LOCUS_12790 33110 32364 gene locus_tag LOCUS_12800 gene rph 33110 32364 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870262.1 protein_id gnl|my_center|LOCUS_12800 34051 33185 gene locus_tag LOCUS_12810 gene ftsY 34051 33185 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393780.1 protein_id gnl|my_center|LOCUS_12810 37225 34067 gene locus_tag LOCUS_12820 37225 34067 CDS product chromosome segregation SMC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480229.1 protein_id gnl|my_center|LOCUS_12820 38626 37424 gene locus_tag LOCUS_12830 38626 37424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 41228 38796 gene locus_tag LOCUS_12840 41228 38796 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_12840 41926 41300 gene locus_tag LOCUS_12850 41926 41300 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_12850 42792 41923 gene locus_tag LOCUS_12860 gene metF 42792 41923 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_12860 44414 42840 gene locus_tag LOCUS_12870 44414 42840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 45482 44457 gene locus_tag LOCUS_12880 45482 44457 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383750.1 protein_id gnl|my_center|LOCUS_12880 46710 45529 gene locus_tag LOCUS_12890 gene metK 46710 45529 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_12890 48013 46772 gene locus_tag LOCUS_12900 48013 46772 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392227.1 protein_id gnl|my_center|LOCUS_12900 48442 49332 gene locus_tag LOCUS_12910 48442 49332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 49348 49740 gene locus_tag LOCUS_12920 49348 49740 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_12920 49845 50462 gene locus_tag LOCUS_12930 49845 50462 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 protein_id gnl|my_center|LOCUS_12930 53376 50740 gene locus_tag LOCUS_12940 53376 50740 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964263.1 protein_id gnl|my_center|LOCUS_12940 54981 53392 gene locus_tag LOCUS_12950 54981 53392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 56005 54968 gene locus_tag LOCUS_12960 gene ansA 56005 54968 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_12960 57929 56022 gene locus_tag LOCUS_12970 57929 56022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 59632 58028 gene locus_tag LOCUS_12980 59632 58028 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_12980 59849 60214 gene locus_tag LOCUS_12990 59849 60214 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016333.1 protein_id gnl|my_center|LOCUS_12990 60350 60838 gene locus_tag LOCUS_13000 60350 60838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 60864 61466 gene locus_tag LOCUS_13010 60864 61466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 61459 62112 gene locus_tag LOCUS_13020 61459 62112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 63567 62203 gene locus_tag LOCUS_13030 63567 62203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 63955 63656 gene locus_tag LOCUS_13040 63955 63656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 65299 64082 gene locus_tag LOCUS_13050 65299 64082 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_13050 66408 65314 gene locus_tag LOCUS_13060 gene mltG 66408 65314 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_13060 67060 66470 gene locus_tag LOCUS_13070 67060 66470 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834298.1 protein_id gnl|my_center|LOCUS_13070 67748 67041 gene locus_tag LOCUS_13080 67748 67041 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812008.1 protein_id gnl|my_center|LOCUS_13080 68474 67752 gene locus_tag LOCUS_13090 68474 67752 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393842.1 protein_id gnl|my_center|LOCUS_13090 69402 68701 gene locus_tag LOCUS_13100 69402 68701 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966072.1 protein_id gnl|my_center|LOCUS_13100 70234 69428 gene locus_tag LOCUS_13110 70234 69428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 70372 70890 gene locus_tag LOCUS_13120 70372 70890 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130536.1 protein_id gnl|my_center|LOCUS_13120 71633 70971 gene locus_tag LOCUS_13130 71633 70971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 72844 72068 gene locus_tag LOCUS_13140 72844 72068 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_13140 74187 72904 gene locus_tag LOCUS_13150 74187 72904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 75092 74253 gene locus_tag LOCUS_13160 75092 74253 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_13160 76201 75089 gene locus_tag LOCUS_13170 76201 75089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 77476 76226 gene locus_tag LOCUS_13180 77476 76226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 77689 78486 gene locus_tag LOCUS_13190 77689 78486 CDS product DUF4866 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930717.1 protein_id gnl|my_center|LOCUS_13190 79876 78545 gene locus_tag LOCUS_13200 79876 78545 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475463.1 protein_id gnl|my_center|LOCUS_13200 82807 79910 gene locus_tag LOCUS_13210 82807 79910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 83680 82835 gene locus_tag LOCUS_13220 83680 82835 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104281.1 protein_id gnl|my_center|LOCUS_13220 85728 83716 gene locus_tag LOCUS_13230 85728 83716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 86354 85725 gene locus_tag LOCUS_13240 86354 85725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 87414 86347 gene locus_tag LOCUS_13250 gene prfA 87414 86347 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966168.1 protein_id gnl|my_center|LOCUS_13250 87710 87414 gene locus_tag LOCUS_13260 87710 87414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 89637 87748 gene locus_tag LOCUS_13270 89637 87748 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460094.1 protein_id gnl|my_center|LOCUS_13270 89794 90846 gene locus_tag LOCUS_13280 gene mtnA 89794 90846 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583294.1 protein_id gnl|my_center|LOCUS_13280 92314 90926 gene locus_tag LOCUS_13290 92314 90926 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_13290 93394 92345 gene locus_tag LOCUS_13300 93394 92345 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_13300 93886 93707 gene locus_tag LOCUS_13310 93886 93707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 94371 93883 gene locus_tag LOCUS_13320 94371 93883 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675005.1 protein_id gnl|my_center|LOCUS_13320 94661 94473 gene locus_tag LOCUS_13330 94661 94473 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020514.1 protein_id gnl|my_center|LOCUS_13330 94826 94981 gene locus_tag LOCUS_13340 94826 94981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 94978 97020 gene locus_tag LOCUS_13350 94978 97020 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870144.1 protein_id gnl|my_center|LOCUS_13350 97365 100337 gene locus_tag LOCUS_13360 97365 100337 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_13360 100330 101631 gene locus_tag LOCUS_13370 100330 101631 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016932.1 protein_id gnl|my_center|LOCUS_13370 101775 103214 gene locus_tag LOCUS_13380 101775 103214 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812813.1 protein_id gnl|my_center|LOCUS_13380 103453 105891 gene locus_tag LOCUS_13390 103453 105891 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964652.1 protein_id gnl|my_center|LOCUS_13390 106347 107717 gene locus_tag LOCUS_13400 106347 107717 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956936.1 protein_id gnl|my_center|LOCUS_13400 109033 108215 gene locus_tag LOCUS_13410 109033 108215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 110379 109192 gene locus_tag LOCUS_13420 110379 109192 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119279.1 protein_id gnl|my_center|LOCUS_13420 111071 110376 gene locus_tag LOCUS_13430 gene bioD 111071 110376 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986727.1 protein_id gnl|my_center|LOCUS_13430 112058 111075 gene locus_tag LOCUS_13440 gene bioB 112058 111075 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_13440 112661 112086 gene locus_tag LOCUS_13450 112661 112086 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986729.1 protein_id gnl|my_center|LOCUS_13450 112932 112859 gene locus_tag LOCUS_t00250 112932 112859 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 115290 113035 gene locus_tag LOCUS_13460 115290 113035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 115453 115944 gene locus_tag LOCUS_13470 115453 115944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 115941 116180 gene locus_tag LOCUS_13480 115941 116180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 116184 116396 gene locus_tag LOCUS_13490 116184 116396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 116505 117593 gene locus_tag LOCUS_13500 116505 117593 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948050.1 protein_id gnl|my_center|LOCUS_13500 117786 117710 gene locus_tag LOCUS_t00260 117786 117710 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 118155 117973 gene locus_tag LOCUS_13510 118155 117973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 118868 118245 gene locus_tag LOCUS_13520 118868 118245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 119055 119594 gene locus_tag LOCUS_13530 gene yfcE 119055 119594 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706165.1 protein_id gnl|my_center|LOCUS_13530 121691 119598 gene locus_tag LOCUS_13540 121691 119598 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486311.1 protein_id gnl|my_center|LOCUS_13540 123024 121684 gene locus_tag LOCUS_13550 gene dsdA 123024 121684 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016476.1 protein_id gnl|my_center|LOCUS_13550 123732 123151 gene locus_tag LOCUS_13560 123732 123151 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_13560 124198 123737 gene locus_tag LOCUS_13570 124198 123737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 125781 124267 gene locus_tag LOCUS_13580 125781 124267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 126162 127694 gene locus_tag LOCUS_13590 126162 127694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 128686 129360 gene locus_tag LOCUS_13600 128686 129360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 129697 130983 gene locus_tag LOCUS_13610 129697 130983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 130980 132065 gene locus_tag LOCUS_13620 130980 132065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 133944 132199 gene locus_tag LOCUS_13630 133944 132199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 134164 136026 gene locus_tag LOCUS_13640 134164 136026 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_13640 141999 136174 gene locus_tag LOCUS_13650 141999 136174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 143545 142193 gene locus_tag LOCUS_13660 143545 142193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 146074 143579 gene locus_tag LOCUS_13670 146074 143579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 147374 146076 gene locus_tag LOCUS_13680 147374 146076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 149604 147409 gene locus_tag LOCUS_13690 149604 147409 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004318448.1 protein_id gnl|my_center|LOCUS_13690 151292 149604 gene locus_tag LOCUS_13700 151292 149604 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611323.1 protein_id gnl|my_center|LOCUS_13700 152480 151527 gene locus_tag LOCUS_13710 152480 151527 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013877237.1 protein_id gnl|my_center|LOCUS_13710 152600 152836 gene locus_tag LOCUS_13720 152600 152836 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811908.1 protein_id gnl|my_center|LOCUS_13720 153183 155009 gene locus_tag LOCUS_13730 153183 155009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 156254 155043 gene locus_tag LOCUS_13740 156254 155043 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462283.1 protein_id gnl|my_center|LOCUS_13740 158085 156415 gene locus_tag LOCUS_13750 158085 156415 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_13750 <159205 158082 gene locus_tag LOCUS_13760 <159205 158082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase >Feature sequence07 1186 377 gene locus_tag LOCUS_13770 1186 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 3041 1347 gene locus_tag LOCUS_13780 3041 1347 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_13780 4741 3143 gene locus_tag LOCUS_13790 4741 3143 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_13790 5439 4867 gene locus_tag LOCUS_13800 5439 4867 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817527.1 protein_id gnl|my_center|LOCUS_13800 6677 5529 gene locus_tag LOCUS_13810 6677 5529 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_13810 7789 6770 gene locus_tag LOCUS_13820 7789 6770 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417347.1 protein_id gnl|my_center|LOCUS_13820 8620 7811 gene locus_tag LOCUS_13830 gene etfB 8620 7811 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986693.1 protein_id gnl|my_center|LOCUS_13830 10223 9009 gene locus_tag LOCUS_13840 10223 9009 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_13840 11541 10351 gene locus_tag LOCUS_13850 11541 10351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 12060 11620 gene locus_tag LOCUS_13860 12060 11620 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_13860 14725 12257 gene locus_tag LOCUS_13870 14725 12257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 14959 15252 gene locus_tag LOCUS_13880 14959 15252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 15902 17056 gene locus_tag LOCUS_13890 15902 17056 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065465.1 protein_id gnl|my_center|LOCUS_13890 17217 18506 gene locus_tag LOCUS_13900 17217 18506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 18541 19836 gene locus_tag LOCUS_13910 18541 19836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 20631 19966 gene locus_tag LOCUS_13920 20631 19966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 20986 22365 gene locus_tag LOCUS_13930 20986 22365 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_13930 22532 24904 gene locus_tag LOCUS_13940 22532 24904 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384650.1 protein_id gnl|my_center|LOCUS_13940 26279 25050 gene locus_tag LOCUS_13950 26279 25050 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_13950 26447 27637 gene locus_tag LOCUS_13960 26447 27637 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_13960 28301 27720 gene locus_tag LOCUS_13970 28301 27720 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214742.1 protein_id gnl|my_center|LOCUS_13970 28554 28772 gene locus_tag LOCUS_13980 28554 28772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 28769 29020 gene locus_tag LOCUS_13990 28769 29020 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 protein_id gnl|my_center|LOCUS_13990 29808 29074 gene locus_tag LOCUS_14000 29808 29074 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_14000 30720 29923 gene locus_tag LOCUS_14010 30720 29923 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_14010 31409 30708 gene locus_tag LOCUS_14020 31409 30708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 31684 31469 gene locus_tag LOCUS_14030 31684 31469 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_14030 33859 31898 gene locus_tag LOCUS_14040 33859 31898 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811135.1 protein_id gnl|my_center|LOCUS_14040 34470 33856 gene locus_tag LOCUS_14050 34470 33856 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_14050 35150 34467 gene locus_tag LOCUS_14060 gene cmk 35150 34467 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565355.1 protein_id gnl|my_center|LOCUS_14060 36404 35154 gene locus_tag LOCUS_14070 36404 35154 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_14070 37270 36401 gene locus_tag LOCUS_14080 37270 36401 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_14080 38103 37378 gene locus_tag LOCUS_14090 38103 37378 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_14090 39321 38215 gene locus_tag LOCUS_14100 39321 38215 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_14100 42040 39386 gene locus_tag LOCUS_14110 gene polA 42040 39386 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_14110 43804 42128 gene locus_tag LOCUS_14120 43804 42128 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036677.1 protein_id gnl|my_center|LOCUS_14120 44175 43825 gene locus_tag LOCUS_14130 44175 43825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 44358 44555 gene locus_tag LOCUS_14140 44358 44555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 45139 44654 gene locus_tag LOCUS_14150 45139 44654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 46040 45123 gene locus_tag LOCUS_14160 46040 45123 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_14160 46802 46044 gene locus_tag LOCUS_14170 46802 46044 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_14170 47122 48609 gene locus_tag LOCUS_14180 47122 48609 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_14180 48665 49681 gene locus_tag LOCUS_14190 gene asnA 48665 49681 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_14190 50031 49741 gene locus_tag LOCUS_14200 50031 49741 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650837.1 protein_id gnl|my_center|LOCUS_14200 51774 50239 gene locus_tag LOCUS_14210 51774 50239 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_14210 52539 51919 gene locus_tag LOCUS_14220 52539 51919 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965893.1 protein_id gnl|my_center|LOCUS_14220 53702 52554 gene locus_tag LOCUS_14230 53702 52554 CDS product serine-tRNA(Ala) deacylase AlaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435901.1 protein_id gnl|my_center|LOCUS_14230 54847 53828 gene locus_tag LOCUS_14240 54847 53828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 55683 54967 gene locus_tag LOCUS_14250 gene sigE 55683 54967 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_14250 56551 55694 gene locus_tag LOCUS_14260 gene spoIIGA 56551 55694 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_14260 57050 56769 gene locus_tag LOCUS_14270 57050 56769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 57258 57647 gene locus_tag LOCUS_14280 57258 57647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 58400 57744 gene locus_tag LOCUS_14290 58400 57744 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_14290 59114 58404 gene locus_tag LOCUS_14300 gene trmB 59114 58404 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239380.1 protein_id gnl|my_center|LOCUS_14300 59302 59991 gene locus_tag LOCUS_14310 gene radC 59302 59991 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328269.1 protein_id gnl|my_center|LOCUS_14310 60008 61972 gene locus_tag LOCUS_14320 gene uvrB 60008 61972 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_14320 62066 62968 gene locus_tag LOCUS_14330 62066 62968 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904266.1 protein_id gnl|my_center|LOCUS_14330 62975 63466 gene locus_tag LOCUS_14340 gene ybaK 62975 63466 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244878.1 protein_id gnl|my_center|LOCUS_14340 63486 66311 gene locus_tag LOCUS_14350 gene uvrA 63486 66311 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_14350 66340 68592 gene locus_tag LOCUS_14360 66340 68592 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_14360 68617 69276 gene locus_tag LOCUS_14370 68617 69276 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_14370 69376 70404 gene locus_tag LOCUS_14380 69376 70404 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393848.1 protein_id gnl|my_center|LOCUS_14380 70819 70547 gene locus_tag LOCUS_14390 70819 70547 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_14390 71007 72089 gene locus_tag LOCUS_14400 gene spoIVB 71007 72089 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965372.1 protein_id gnl|my_center|LOCUS_14400 72255 73481 gene locus_tag LOCUS_14410 72255 73481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 73772 75040 gene locus_tag LOCUS_14420 73772 75040 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_14420 75107 75562 gene locus_tag LOCUS_14430 75107 75562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 76990 75650 gene locus_tag LOCUS_14440 76990 75650 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_14440 78390 77032 gene locus_tag LOCUS_14450 78390 77032 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_14450 80431 78695 gene locus_tag LOCUS_14460 gene iorA 80431 78695 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_14460 80797 81564 gene locus_tag LOCUS_14470 gene spo0A 80797 81564 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_14470 82075 82518 gene locus_tag LOCUS_14480 gene infC 82075 82518 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886591.1 protein_id gnl|my_center|LOCUS_14480 82543 82746 gene locus_tag LOCUS_14490 gene rpmI 82543 82746 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015481.1 protein_id gnl|my_center|LOCUS_14490 82780 83136 gene locus_tag LOCUS_14500 gene rplT 82780 83136 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028296.1 protein_id gnl|my_center|LOCUS_14500 83981 83217 gene locus_tag LOCUS_14510 83981 83217 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948811.1 protein_id gnl|my_center|LOCUS_14510 84912 83974 gene locus_tag LOCUS_14520 84912 83974 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948810.1 protein_id gnl|my_center|LOCUS_14520 85984 84965 gene locus_tag LOCUS_14530 85984 84965 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_14530 86522 87130 gene locus_tag LOCUS_14540 86522 87130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 87506 87309 gene locus_tag LOCUS_14550 87506 87309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 87714 88586 gene locus_tag LOCUS_14560 87714 88586 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731454.1 protein_id gnl|my_center|LOCUS_14560 88712 89890 gene locus_tag LOCUS_14570 88712 89890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 91392 89989 gene locus_tag LOCUS_14580 gene cysS 91392 89989 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_14580 92062 91379 gene locus_tag LOCUS_14590 92062 91379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 92501 92833 gene locus_tag LOCUS_14600 92501 92833 CDS product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963786.1 protein_id gnl|my_center|LOCUS_14600 93985 93173 gene locus_tag LOCUS_14610 93985 93173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 94699 93998 gene locus_tag LOCUS_14620 94699 93998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 95232 94696 gene locus_tag LOCUS_14630 95232 94696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 96231 95266 gene locus_tag LOCUS_14640 96231 95266 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206433.1 protein_id gnl|my_center|LOCUS_14640 96455 96889 gene locus_tag LOCUS_14650 96455 96889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 97028 97927 gene locus_tag LOCUS_14660 97028 97927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 99278 98121 gene locus_tag LOCUS_14670 99278 98121 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459150.1 protein_id gnl|my_center|LOCUS_14670 100903 99419 gene locus_tag LOCUS_14680 100903 99419 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903237.1 protein_id gnl|my_center|LOCUS_14680 102033 101125 gene locus_tag LOCUS_14690 102033 101125 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892281.1 protein_id gnl|my_center|LOCUS_14690 102187 102423 gene locus_tag LOCUS_14700 102187 102423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 102908 102480 gene locus_tag LOCUS_14710 gene ytfJ 102908 102480 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392871.1 protein_id gnl|my_center|LOCUS_14710 103614 102883 gene locus_tag LOCUS_14720 103614 102883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 104150 103611 gene locus_tag LOCUS_14730 gene scpB 104150 103611 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259764.1 protein_id gnl|my_center|LOCUS_14730 104943 104182 gene locus_tag LOCUS_14740 104943 104182 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351869.1 protein_id gnl|my_center|LOCUS_14740 105657 104959 gene locus_tag LOCUS_14750 105657 104959 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_14750 107657 105819 gene locus_tag LOCUS_14760 gene recQ 107657 105819 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058493.1 protein_id gnl|my_center|LOCUS_14760 107884 108855 gene locus_tag LOCUS_14770 gene pta 107884 108855 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641060.1 protein_id gnl|my_center|LOCUS_14770 109461 109021 gene locus_tag LOCUS_14780 109461 109021 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288290.1 protein_id gnl|my_center|LOCUS_14780 109566 110105 gene locus_tag LOCUS_14790 109566 110105 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020471.1 protein_id gnl|my_center|LOCUS_14790 111165 110644 gene locus_tag LOCUS_14800 111165 110644 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_14800 111684 111208 gene locus_tag LOCUS_14810 gene smpB 111684 111208 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_14810 112232 111813 gene locus_tag LOCUS_14820 112232 111813 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861328.1 protein_id gnl|my_center|LOCUS_14820 112940 112413 gene locus_tag LOCUS_14830 112940 112413 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_14830 113138 113428 gene locus_tag LOCUS_14840 113138 113428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 113460 114347 gene locus_tag LOCUS_14850 113460 114347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 114718 114446 gene locus_tag LOCUS_14860 114718 114446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 114887 115861 gene locus_tag LOCUS_14870 114887 115861 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948398.1 protein_id gnl|my_center|LOCUS_14870 117601 116189 gene locus_tag LOCUS_14880 117601 116189 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_14880 118149 121622 gene locus_tag LOCUS_14890 118149 121622 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425597.1 protein_id gnl|my_center|LOCUS_14890 122095 121688 gene locus_tag LOCUS_14900 122095 121688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 122971 122096 gene locus_tag LOCUS_14910 122971 122096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 124340 123114 gene locus_tag LOCUS_14920 124340 123114 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_14920 124872 125954 gene locus_tag LOCUS_14930 gene mtnA 124872 125954 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392493.1 protein_id gnl|my_center|LOCUS_14930 125951 126613 gene locus_tag LOCUS_14940 125951 126613 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256490.1 protein_id gnl|my_center|LOCUS_14940 126925 127308 gene locus_tag LOCUS_14950 126925 127308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 128804 127476 gene locus_tag LOCUS_14960 128804 127476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 130870 128801 gene locus_tag LOCUS_14970 130870 128801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 131041 132099 gene locus_tag LOCUS_14980 131041 132099 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065256.1 protein_id gnl|my_center|LOCUS_14980 132143 132967 gene locus_tag LOCUS_14990 gene rlmA 132143 132967 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072721.1 protein_id gnl|my_center|LOCUS_14990 134016 133036 gene locus_tag LOCUS_15000 134016 133036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 134394 134041 gene locus_tag LOCUS_15010 134394 134041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 134827 135474 gene locus_tag LOCUS_15020 gene rpe 134827 135474 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_15020 135513 136115 gene locus_tag LOCUS_15030 gene recR 135513 136115 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963454.1 protein_id gnl|my_center|LOCUS_15030 136268 137677 gene locus_tag LOCUS_15040 136268 137677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence08 3357 391 gene locus_tag LOCUS_15050 3357 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 3757 3536 gene locus_tag LOCUS_15060 3757 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 4970 4143 gene locus_tag LOCUS_15070 4970 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 6166 5411 gene locus_tag LOCUS_15080 6166 5411 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861281.1 protein_id gnl|my_center|LOCUS_15080 7218 6163 gene locus_tag LOCUS_15090 7218 6163 CDS product cysteine protease StiP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861280.1 protein_id gnl|my_center|LOCUS_15090 8344 7193 gene locus_tag LOCUS_15100 8344 7193 CDS product phosphoribosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285478.1 protein_id gnl|my_center|LOCUS_15100 11114 8436 gene locus_tag LOCUS_15110 11114 8436 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068264.1 protein_id gnl|my_center|LOCUS_15110 11801 11190 gene locus_tag LOCUS_15120 11801 11190 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246350.1 protein_id gnl|my_center|LOCUS_15120 12425 11817 gene locus_tag LOCUS_15130 12425 11817 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454512.1 protein_id gnl|my_center|LOCUS_15130 13046 12462 gene locus_tag LOCUS_15140 13046 12462 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146731.1 protein_id gnl|my_center|LOCUS_15140 13655 13074 gene locus_tag LOCUS_15150 13655 13074 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420269.1 protein_id gnl|my_center|LOCUS_15150 14838 13690 gene locus_tag LOCUS_15160 14838 13690 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964720.1 protein_id gnl|my_center|LOCUS_15160 17112 14842 gene locus_tag LOCUS_15170 17112 14842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 17289 18245 gene locus_tag LOCUS_15180 17289 18245 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 protein_id gnl|my_center|LOCUS_15180 19994 18312 gene locus_tag LOCUS_15190 19994 18312 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_15190 22092 20143 gene locus_tag LOCUS_15200 22092 20143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 23209 22268 gene locus_tag LOCUS_15210 23209 22268 CDS product DUF4428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459959.1 protein_id gnl|my_center|LOCUS_15210 25233 23569 gene locus_tag LOCUS_15220 25233 23569 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042338789.1 protein_id gnl|my_center|LOCUS_15220 25809 25261 gene locus_tag LOCUS_15230 25809 25261 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812910.1 protein_id gnl|my_center|LOCUS_15230 26359 25940 gene locus_tag LOCUS_15240 26359 25940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 27765 26491 gene locus_tag LOCUS_15250 27765 26491 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007785170.1 protein_id gnl|my_center|LOCUS_15250 28496 27762 gene locus_tag LOCUS_15260 28496 27762 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812913.1 protein_id gnl|my_center|LOCUS_15260 29423 28677 gene locus_tag LOCUS_15270 29423 28677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 29950 29420 gene locus_tag LOCUS_15280 29950 29420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 30144 30695 gene locus_tag LOCUS_15290 30144 30695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 32327 30876 gene locus_tag LOCUS_15300 32327 30876 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016217.1 protein_id gnl|my_center|LOCUS_15300 34220 32589 gene locus_tag LOCUS_15310 34220 32589 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_15310 34846 34316 gene locus_tag LOCUS_15320 34846 34316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 36396 34843 gene locus_tag LOCUS_15330 36396 34843 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461951.1 protein_id gnl|my_center|LOCUS_15330 37087 36572 gene locus_tag LOCUS_15340 37087 36572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 37298 37164 gene locus_tag LOCUS_15350 37298 37164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 39226 37295 gene locus_tag LOCUS_15360 39226 37295 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128807.1 protein_id gnl|my_center|LOCUS_15360 39960 39778 gene locus_tag LOCUS_15370 39960 39778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 41218 40127 gene locus_tag LOCUS_15380 41218 40127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 41807 41328 gene locus_tag LOCUS_15390 41807 41328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 42902 42117 gene locus_tag LOCUS_15400 42902 42117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 45177 43069 gene locus_tag LOCUS_15410 45177 43069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 45771 45292 gene locus_tag LOCUS_15420 45771 45292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 46867 46082 gene locus_tag LOCUS_15430 46867 46082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 48142 47045 gene locus_tag LOCUS_15440 48142 47045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 48803 48246 gene locus_tag LOCUS_15450 48803 48246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 50129 48939 gene locus_tag LOCUS_15460 50129 48939 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372834.1 protein_id gnl|my_center|LOCUS_15460 50798 50370 gene locus_tag LOCUS_15470 50798 50370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 51556 50816 gene locus_tag LOCUS_15480 51556 50816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 52110 51553 gene locus_tag LOCUS_15490 52110 51553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 52333 52704 gene locus_tag LOCUS_15500 52333 52704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 52694 53281 gene locus_tag LOCUS_15510 52694 53281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 53467 54612 gene locus_tag LOCUS_15520 53467 54612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 56352 54679 gene locus_tag LOCUS_15530 56352 54679 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768265.1 protein_id gnl|my_center|LOCUS_15530 56592 57767 gene locus_tag LOCUS_15540 56592 57767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 57810 58073 gene locus_tag LOCUS_15550 57810 58073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 58070 59017 gene locus_tag LOCUS_15560 58070 59017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 60765 59089 gene locus_tag LOCUS_15570 60765 59089 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768265.1 protein_id gnl|my_center|LOCUS_15570 61001 62161 gene locus_tag LOCUS_15580 61001 62161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 63852 62212 gene locus_tag LOCUS_15590 63852 62212 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768265.1 protein_id gnl|my_center|LOCUS_15590 64536 63997 gene locus_tag LOCUS_15600 64536 63997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 64723 66258 gene locus_tag LOCUS_15610 64723 66258 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_15610 66255 66482 gene locus_tag LOCUS_15620 66255 66482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 66485 68053 gene locus_tag LOCUS_15630 66485 68053 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_15630 68084 69934 gene locus_tag LOCUS_15640 68084 69934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 69965 71581 gene locus_tag LOCUS_15650 69965 71581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 71535 72497 gene locus_tag LOCUS_15660 71535 72497 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 protein_id gnl|my_center|LOCUS_15660 72469 72879 gene locus_tag LOCUS_15670 72469 72879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 72911 74134 gene locus_tag LOCUS_15680 72911 74134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 75213 74185 gene locus_tag LOCUS_15690 75213 74185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15690 75489 75340 gene locus_tag LOCUS_15700 75489 75340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 76015 75635 gene locus_tag LOCUS_15710 76015 75635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 77131 76079 gene locus_tag LOCUS_15720 77131 76079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 80206 77873 gene locus_tag LOCUS_15730 80206 77873 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_15730 80552 80199 gene locus_tag LOCUS_15740 80552 80199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 81488 80586 gene locus_tag LOCUS_15750 81488 80586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 81839 81498 gene locus_tag LOCUS_15760 81839 81498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 83356 81836 gene locus_tag LOCUS_15770 83356 81836 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_15770 84205 83582 gene locus_tag LOCUS_15780 84205 83582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 85592 84186 gene locus_tag LOCUS_15790 85592 84186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 85900 85592 gene locus_tag LOCUS_15800 85900 85592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 86090 86437 gene locus_tag LOCUS_15810 86090 86437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 87186 86443 gene locus_tag LOCUS_15820 87186 86443 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038090.1 protein_id gnl|my_center|LOCUS_15820 87436 87170 gene locus_tag LOCUS_15830 87436 87170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 87693 87445 gene locus_tag LOCUS_15840 87693 87445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 88659 87697 gene locus_tag LOCUS_15850 88659 87697 CDS product amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461907.1 protein_id gnl|my_center|LOCUS_15850 89032 88682 gene locus_tag LOCUS_15860 89032 88682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 92282 89103 gene locus_tag LOCUS_15870 92282 89103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 93339 92464 gene locus_tag LOCUS_15880 93339 92464 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_15880 94304 93378 gene locus_tag LOCUS_15890 94304 93378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 94703 94628 gene locus_tag LOCUS_t00270 94703 94628 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 94785 94709 gene locus_tag LOCUS_t00280 94785 94709 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 94865 94790 gene locus_tag LOCUS_t00290 94865 94790 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 94945 94869 gene locus_tag LOCUS_t00300 94945 94869 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 95075 95000 gene locus_tag LOCUS_t00310 95075 95000 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 95220 95111 gene locus_tag LOCUS_r00010 95220 95111 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence09 272 105 gene locus_tag LOCUS_15900 272 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1596 490 gene locus_tag LOCUS_15910 1596 490 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_15910 2218 1700 gene locus_tag LOCUS_15920 2218 1700 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356248.1 protein_id gnl|my_center|LOCUS_15920 3731 2271 gene locus_tag LOCUS_15930 3731 2271 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964320.1 protein_id gnl|my_center|LOCUS_15930 4370 7984 gene locus_tag LOCUS_15940 4370 7984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 8273 12772 gene locus_tag LOCUS_15950 gene gltB 8273 12772 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_15950 12775 14118 gene locus_tag LOCUS_15960 12775 14118 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989797.1 protein_id gnl|my_center|LOCUS_15960 14176 15849 gene locus_tag LOCUS_15970 14176 15849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 16645 16064 gene locus_tag LOCUS_15980 16645 16064 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_15980 16775 17635 gene locus_tag LOCUS_15990 16775 17635 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888619.1 protein_id gnl|my_center|LOCUS_15990 18663 17704 gene locus_tag LOCUS_16000 18663 17704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 20294 18684 gene locus_tag LOCUS_16010 20294 18684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 20550 21377 gene locus_tag LOCUS_16020 20550 21377 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_16020 22132 21452 gene locus_tag LOCUS_16030 gene hitR 22132 21452 CDS product envelope stress response regulator transcription factor HitR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009878919.1 protein_id gnl|my_center|LOCUS_16030 24112 22166 gene locus_tag LOCUS_16040 24112 22166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 24670 27456 gene locus_tag LOCUS_16050 24670 27456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 27721 31146 gene locus_tag LOCUS_16060 27721 31146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 41375 31254 gene locus_tag LOCUS_16070 41375 31254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 41604 41365 gene locus_tag LOCUS_16080 41604 41365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 42041 41715 gene locus_tag LOCUS_16090 42041 41715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 43746 42208 gene locus_tag LOCUS_16100 43746 42208 CDS product BCCT family carnitine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120258.1 protein_id gnl|my_center|LOCUS_16100 44941 43784 gene locus_tag LOCUS_16110 44941 43784 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986546.1 protein_id gnl|my_center|LOCUS_16110 46189 44963 gene locus_tag LOCUS_16120 46189 44963 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986697.1 protein_id gnl|my_center|LOCUS_16120 46809 46267 gene locus_tag LOCUS_16130 46809 46267 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430880.1 protein_id gnl|my_center|LOCUS_16130 47549 46809 gene locus_tag LOCUS_16140 47549 46809 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869338.1 protein_id gnl|my_center|LOCUS_16140 48619 47564 gene locus_tag LOCUS_16150 gene vorB 48619 47564 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890635.1 protein_id gnl|my_center|LOCUS_16150 48840 48634 gene locus_tag LOCUS_16160 48840 48634 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869340.1 protein_id gnl|my_center|LOCUS_16160 50910 49246 gene locus_tag LOCUS_16170 50910 49246 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_16170 53420 50943 gene locus_tag LOCUS_16180 53420 50943 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389901.1 protein_id gnl|my_center|LOCUS_16180 55151 53484 gene locus_tag LOCUS_16190 55151 53484 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_16190 55306 56127 gene locus_tag LOCUS_16200 55306 56127 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391588.1 protein_id gnl|my_center|LOCUS_16200 56276 56473 gene locus_tag LOCUS_16210 gene thiS 56276 56473 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_16210 56475 57131 gene locus_tag LOCUS_16220 gene thiF 56475 57131 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858442.1 protein_id gnl|my_center|LOCUS_16220 57156 57929 gene locus_tag LOCUS_16230 57156 57929 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 protein_id gnl|my_center|LOCUS_16230 57981 59234 gene locus_tag LOCUS_16240 gene thiH 57981 59234 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_16240 59215 59427 gene locus_tag LOCUS_16250 59215 59427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 59507 59821 gene locus_tag LOCUS_16260 59507 59821 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812401.1 protein_id gnl|my_center|LOCUS_16260 62406 59869 gene locus_tag LOCUS_16270 62406 59869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 63221 62406 gene locus_tag LOCUS_16280 63221 62406 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439548.1 protein_id gnl|my_center|LOCUS_16280 63532 64878 gene locus_tag LOCUS_16290 63532 64878 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_16290 67279 64946 gene locus_tag LOCUS_16300 67279 64946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 68485 67313 gene locus_tag LOCUS_16310 68485 67313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 69431 68490 gene locus_tag LOCUS_16320 69431 68490 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242543.1 protein_id gnl|my_center|LOCUS_16320 73984 69428 gene locus_tag LOCUS_16330 73984 69428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 75798 73981 gene locus_tag LOCUS_16340 75798 73981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 77177 75975 gene locus_tag LOCUS_16350 77177 75975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 77329 78531 gene locus_tag LOCUS_16360 gene hemW 77329 78531 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_16360 79584 78595 gene locus_tag LOCUS_16370 79584 78595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 80041 79595 gene locus_tag LOCUS_16380 80041 79595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 80484 80071 gene locus_tag LOCUS_16390 80484 80071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 81052 80537 gene locus_tag LOCUS_16400 81052 80537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 81638 81105 gene locus_tag LOCUS_16410 81638 81105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 82858 81986 gene locus_tag LOCUS_16420 82858 81986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 83451 82855 gene locus_tag LOCUS_16430 83451 82855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 83647 84885 gene locus_tag LOCUS_16440 83647 84885 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_16440 84953 86230 gene locus_tag LOCUS_16450 84953 86230 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_16450 86227 87123 gene locus_tag LOCUS_16460 gene ispE 86227 87123 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722719.1 protein_id gnl|my_center|LOCUS_16460 87189 87815 gene locus_tag LOCUS_16470 gene spoIIR 87189 87815 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768304.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence10 233 1117 gene locus_tag LOCUS_16480 gene ylqF 233 1117 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236706.1 protein_id gnl|my_center|LOCUS_16480 1104 1706 gene locus_tag LOCUS_16490 gene rnhB 1104 1706 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_16490 1703 2077 gene locus_tag LOCUS_16500 1703 2077 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223856.1 protein_id gnl|my_center|LOCUS_16500 2145 3632 gene locus_tag LOCUS_16510 gene thrC 2145 3632 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_16510 3643 4335 gene locus_tag LOCUS_16520 3643 4335 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_16520 4456 5985 gene locus_tag LOCUS_16530 gene tig 4456 5985 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_16530 6038 6619 gene locus_tag LOCUS_16540 gene clpP 6038 6619 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_16540 6689 8008 gene locus_tag LOCUS_16550 gene clpX 6689 8008 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_16550 8152 10599 gene locus_tag LOCUS_16560 gene lon 8152 10599 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_16560 10615 11226 gene locus_tag LOCUS_16570 gene ysxC 10615 11226 CDS product ribosome biogenesis GTP-binding protein YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869113.1 protein_id gnl|my_center|LOCUS_16570 11272 11952 gene locus_tag LOCUS_16580 11272 11952 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964820.1 protein_id gnl|my_center|LOCUS_16580 12525 12058 gene locus_tag LOCUS_16590 gene ribE 12525 12058 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099502.1 protein_id gnl|my_center|LOCUS_16590 13795 12596 gene locus_tag LOCUS_16600 13795 12596 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905673.1 protein_id gnl|my_center|LOCUS_16600 14480 13818 gene locus_tag LOCUS_16610 14480 13818 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_16610 15593 14481 gene locus_tag LOCUS_16620 gene ribD 15593 14481 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905672.1 protein_id gnl|my_center|LOCUS_16620 16233 16958 gene locus_tag LOCUS_16630 gene pyrH 16233 16958 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293877.1 protein_id gnl|my_center|LOCUS_16630 16955 17512 gene locus_tag LOCUS_16640 gene frr 16955 17512 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430598.1 protein_id gnl|my_center|LOCUS_16640 17581 18348 gene locus_tag LOCUS_16650 17581 18348 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_16650 18352 19161 gene locus_tag LOCUS_16660 18352 19161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 19173 20318 gene locus_tag LOCUS_16670 19173 20318 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188776689.1 protein_id gnl|my_center|LOCUS_16670 20349 21407 gene locus_tag LOCUS_16680 gene rseP 20349 21407 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_16680 21411 22451 gene locus_tag LOCUS_16690 gene ispG 21411 22451 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 protein_id gnl|my_center|LOCUS_16690 22482 26681 gene locus_tag LOCUS_16700 gene polC 22482 26681 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966712.1 protein_id gnl|my_center|LOCUS_16700 26778 27413 gene locus_tag LOCUS_16710 26778 27413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 29455 27476 gene locus_tag LOCUS_16720 29455 27476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 30352 29459 gene locus_tag LOCUS_16730 30352 29459 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964157.1 protein_id gnl|my_center|LOCUS_16730 31467 30349 gene locus_tag LOCUS_16740 31467 30349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_16740 35516 31968 gene locus_tag LOCUS_16750 35516 31968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 36532 35558 gene locus_tag LOCUS_16760 36532 35558 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_16760 36782 37279 gene locus_tag LOCUS_16770 36782 37279 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094714.1 protein_id gnl|my_center|LOCUS_16770 37333 37518 gene locus_tag LOCUS_16780 gene rpmF 37333 37518 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_16780 37594 38904 gene locus_tag LOCUS_16790 37594 38904 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_16790 38965 40293 gene locus_tag LOCUS_16800 gene der 38965 40293 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_16800 40301 40960 gene locus_tag LOCUS_16810 gene plsY 40301 40960 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016461.1 protein_id gnl|my_center|LOCUS_16810 40983 41984 gene locus_tag LOCUS_16820 40983 41984 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_16820 42135 42323 gene locus_tag LOCUS_16830 gene rpmB 42135 42323 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_16830 42469 43470 gene locus_tag LOCUS_16840 gene hprK 42469 43470 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_16840 43477 45114 gene locus_tag LOCUS_16850 43477 45114 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678775.1 protein_id gnl|my_center|LOCUS_16850 45216 46181 gene locus_tag LOCUS_16860 45216 46181 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678777.1 protein_id gnl|my_center|LOCUS_16860 46178 47023 gene locus_tag LOCUS_16870 46178 47023 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678776.1 protein_id gnl|my_center|LOCUS_16870 47128 48870 gene locus_tag LOCUS_16880 gene pyk 47128 48870 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_16880 50047 48956 gene locus_tag LOCUS_16890 50047 48956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 51421 50069 gene locus_tag LOCUS_16900 gene gabT 51421 50069 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964736.1 protein_id gnl|my_center|LOCUS_16900 52591 51479 gene locus_tag LOCUS_16910 52591 51479 CDS product 4-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993681.1 protein_id gnl|my_center|LOCUS_16910 53926 52628 gene locus_tag LOCUS_16920 53926 52628 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901990.1 protein_id gnl|my_center|LOCUS_16920 54389 55489 gene locus_tag LOCUS_16930 54389 55489 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 protein_id gnl|my_center|LOCUS_16930 55482 56405 gene locus_tag LOCUS_16940 55482 56405 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_16940 56828 56496 gene locus_tag LOCUS_16950 56828 56496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 56988 57467 gene locus_tag LOCUS_16960 56988 57467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 57464 58204 gene locus_tag LOCUS_16970 57464 58204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 58610 58278 gene locus_tag LOCUS_16980 58610 58278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 58863 58591 gene locus_tag LOCUS_16990 58863 58591 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994775.1 protein_id gnl|my_center|LOCUS_16990 59216 58986 gene locus_tag LOCUS_17000 59216 58986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 61020 59470 gene locus_tag LOCUS_17010 61020 59470 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_17010 61644 61138 gene locus_tag LOCUS_17020 61644 61138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 62495 61641 gene locus_tag LOCUS_17030 62495 61641 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_17030 63205 62492 gene locus_tag LOCUS_17040 63205 62492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 64228 63218 gene locus_tag LOCUS_17050 64228 63218 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943615.1 protein_id gnl|my_center|LOCUS_17050 64660 64364 gene locus_tag LOCUS_17060 64660 64364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 64848 65117 gene locus_tag LOCUS_17070 64848 65117 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272532.1 protein_id gnl|my_center|LOCUS_17070 65114 65443 gene locus_tag LOCUS_17080 65114 65443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 66621 65500 gene locus_tag LOCUS_17090 gene prfB 66621 65500 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191976281.1 protein_id gnl|my_center|LOCUS_17090 66932 66753 gene locus_tag LOCUS_17100 66932 66753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 67101 67187 gene locus_tag LOCUS_t00320 67101 67187 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 67191 67266 gene locus_tag LOCUS_t00330 67191 67266 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 67414 69243 gene locus_tag LOCUS_17110 67414 69243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 69218 70774 gene locus_tag LOCUS_17120 69218 70774 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_17120 70771 70953 gene locus_tag LOCUS_17130 70771 70953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 71209 71003 gene locus_tag LOCUS_17140 71209 71003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 71318 72982 gene locus_tag LOCUS_17150 71318 72982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 73005 73901 gene locus_tag LOCUS_17160 73005 73901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 73903 74277 gene locus_tag LOCUS_17170 73903 74277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 74284 76029 gene locus_tag LOCUS_17180 74284 76029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 76023 77156 gene locus_tag LOCUS_17190 76023 77156 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127133531.1 protein_id gnl|my_center|LOCUS_17190 77146 78828 gene locus_tag LOCUS_17200 77146 78828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 78848 80647 gene locus_tag LOCUS_17210 78848 80647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 81248 83059 gene locus_tag LOCUS_17220 81248 83059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 83061 84104 gene locus_tag LOCUS_17230 83061 84104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 84645 84250 gene locus_tag LOCUS_17240 84645 84250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence11 1148 231 gene locus_tag LOCUS_17250 gene hslO 1148 231 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_17250 1959 1132 gene locus_tag LOCUS_17260 1959 1132 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_17260 2263 1943 gene locus_tag LOCUS_17270 2263 1943 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357450.1 protein_id gnl|my_center|LOCUS_17270 2502 3785 gene locus_tag LOCUS_17280 2502 3785 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404565.1 protein_id gnl|my_center|LOCUS_17280 3980 4198 gene locus_tag LOCUS_17290 3980 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 4389 5231 gene locus_tag LOCUS_17300 4389 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 5869 5249 gene locus_tag LOCUS_17310 5869 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 6009 6695 gene locus_tag LOCUS_17320 gene sigK 6009 6695 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_17320 6840 7979 gene locus_tag LOCUS_17330 6840 7979 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733226.1 protein_id gnl|my_center|LOCUS_17330 7976 10765 gene locus_tag LOCUS_17340 7976 10765 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072762.1 protein_id gnl|my_center|LOCUS_17340 13252 10904 gene locus_tag LOCUS_17350 13252 10904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 14720 13293 gene locus_tag LOCUS_17360 14720 13293 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903800.1 protein_id gnl|my_center|LOCUS_17360 15993 14788 gene locus_tag LOCUS_17370 gene ilvA 15993 14788 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_17370 16223 16588 gene locus_tag LOCUS_17380 16223 16588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 16811 17716 gene locus_tag LOCUS_17390 16811 17716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 17951 18256 gene locus_tag LOCUS_17400 17951 18256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 18356 20470 gene locus_tag LOCUS_17410 18356 20470 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_17410 20980 20639 gene locus_tag LOCUS_17420 20980 20639 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122372.1 protein_id gnl|my_center|LOCUS_17420 21107 22039 gene locus_tag LOCUS_17430 21107 22039 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681808.1 protein_id gnl|my_center|LOCUS_17430 25539 22045 gene locus_tag LOCUS_17440 25539 22045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 28168 25520 gene locus_tag LOCUS_17450 28168 25520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 28427 28999 gene locus_tag LOCUS_17460 28427 28999 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_17460 29752 29084 gene locus_tag LOCUS_17470 29752 29084 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_17470 31233 29749 gene locus_tag LOCUS_17480 31233 29749 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836536.1 protein_id gnl|my_center|LOCUS_17480 32279 31230 gene locus_tag LOCUS_17490 gene cobD 32279 31230 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 protein_id gnl|my_center|LOCUS_17490 33250 32279 gene locus_tag LOCUS_17500 gene cbiB 33250 32279 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_17500 33843 33247 gene locus_tag LOCUS_17510 33843 33247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 34178 33840 gene locus_tag LOCUS_17520 34178 33840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 34945 34175 gene locus_tag LOCUS_17530 gene cobS 34945 34175 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460078.1 protein_id gnl|my_center|LOCUS_17530 35451 34942 gene locus_tag LOCUS_17540 gene cobU 35451 34942 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338347.1 protein_id gnl|my_center|LOCUS_17540 36527 35469 gene locus_tag LOCUS_17550 gene cobT 36527 35469 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_17550 37867 36524 gene locus_tag LOCUS_17560 37867 36524 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258422.1 protein_id gnl|my_center|LOCUS_17560 39057 37864 gene locus_tag LOCUS_17570 39057 37864 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214081.1 protein_id gnl|my_center|LOCUS_17570 39794 39048 gene locus_tag LOCUS_17580 gene cobK 39794 39048 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392609.1 protein_id gnl|my_center|LOCUS_17580 40531 39791 gene locus_tag LOCUS_17590 gene cobJ 40531 39791 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016778.1 protein_id gnl|my_center|LOCUS_17590 41519 40533 gene locus_tag LOCUS_17600 41519 40533 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392607.1 protein_id gnl|my_center|LOCUS_17600 42271 41516 gene locus_tag LOCUS_17610 gene cobM 42271 41516 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392606.1 protein_id gnl|my_center|LOCUS_17610 42972 42268 gene locus_tag LOCUS_17620 gene cobI 42972 42268 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 protein_id gnl|my_center|LOCUS_17620 44096 42957 gene locus_tag LOCUS_17630 gene cbiD 44096 42957 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168467.1 protein_id gnl|my_center|LOCUS_17630 45207 44086 gene locus_tag LOCUS_17640 45207 44086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682004.1 protein_id gnl|my_center|LOCUS_17640 46240 45224 gene locus_tag LOCUS_17650 46240 45224 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682008.1 protein_id gnl|my_center|LOCUS_17650 47482 46310 gene locus_tag LOCUS_17660 47482 46310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 48357 47482 gene locus_tag LOCUS_17670 48357 47482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 49443 48451 gene locus_tag LOCUS_17680 49443 48451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 49675 49460 gene locus_tag LOCUS_17690 49675 49460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 51193 49829 gene locus_tag LOCUS_17700 51193 49829 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_17700 51387 52586 gene locus_tag LOCUS_17710 51387 52586 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793744.1 protein_id gnl|my_center|LOCUS_17710 52682 53275 gene locus_tag LOCUS_17720 52682 53275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 53410 53673 gene locus_tag LOCUS_17730 53410 53673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 53589 53843 gene locus_tag LOCUS_17740 53589 53843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 54912 53902 gene locus_tag LOCUS_17750 54912 53902 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_17750 55184 56512 gene locus_tag LOCUS_17760 55184 56512 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_17760 56540 57088 gene locus_tag LOCUS_17770 56540 57088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 57179 58597 gene locus_tag LOCUS_17780 57179 58597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 60919 58679 gene locus_tag LOCUS_17790 60919 58679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 62523 61291 gene locus_tag LOCUS_17800 62523 61291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 67080 62599 gene locus_tag LOCUS_17810 67080 62599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 67935 67126 gene locus_tag LOCUS_17820 67935 67126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 68841 68137 gene locus_tag LOCUS_17830 68841 68137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 70013 68838 gene locus_tag LOCUS_17840 70013 68838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 72463 70040 gene locus_tag LOCUS_17850 72463 70040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 73263 72466 gene locus_tag LOCUS_17860 73263 72466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 74428 73286 gene locus_tag LOCUS_17870 74428 73286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 78847 74522 gene locus_tag LOCUS_17880 78847 74522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 79526 78870 gene locus_tag LOCUS_17890 79526 78870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 80751 79549 gene locus_tag LOCUS_17900 80751 79549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 83083 80762 gene locus_tag LOCUS_17910 83083 80762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence12 455 1345 gene locus_tag LOCUS_17920 455 1345 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230236.1 protein_id gnl|my_center|LOCUS_17920 1428 1685 gene locus_tag LOCUS_17930 1428 1685 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_17930 1678 2736 gene locus_tag LOCUS_17940 gene hydE 1678 2736 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_17940 2891 4339 gene locus_tag LOCUS_17950 gene hydG 2891 4339 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_17950 5818 4436 gene locus_tag LOCUS_17960 5818 4436 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390018.1 protein_id gnl|my_center|LOCUS_17960 5989 6828 gene locus_tag LOCUS_17970 5989 6828 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475880.1 protein_id gnl|my_center|LOCUS_17970 7385 6885 gene locus_tag LOCUS_17980 gene greA 7385 6885 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830881.1 protein_id gnl|my_center|LOCUS_17980 8741 7455 gene locus_tag LOCUS_17990 8741 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 9129 8734 gene locus_tag LOCUS_18000 9129 8734 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379040.1 protein_id gnl|my_center|LOCUS_18000 9297 9890 gene locus_tag LOCUS_18010 9297 9890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 9892 11841 gene locus_tag LOCUS_18020 9892 11841 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964362.1 protein_id gnl|my_center|LOCUS_18020 12886 11909 gene locus_tag LOCUS_18030 12886 11909 CDS product chromosome condensation regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000385090.1 protein_id gnl|my_center|LOCUS_18030 13986 12916 gene locus_tag LOCUS_18040 gene leuB 13986 12916 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_18040 14487 13990 gene locus_tag LOCUS_18050 gene leuD 14487 13990 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_18050 15750 14491 gene locus_tag LOCUS_18060 gene leuC 15750 14491 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_18060 17541 15847 gene locus_tag LOCUS_18070 17541 15847 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_18070 19234 17927 gene locus_tag LOCUS_18080 19234 17927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 20766 19366 gene locus_tag LOCUS_18090 20766 19366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 20993 22105 gene locus_tag LOCUS_18100 gene hisZ 20993 22105 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393533.1 protein_id gnl|my_center|LOCUS_18100 22102 22752 gene locus_tag LOCUS_18110 gene hisG 22102 22752 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943722.1 protein_id gnl|my_center|LOCUS_18110 22749 24047 gene locus_tag LOCUS_18120 gene hisD 22749 24047 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949111.1 protein_id gnl|my_center|LOCUS_18120 24044 25108 gene locus_tag LOCUS_18130 gene hisC 24044 25108 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966312.1 protein_id gnl|my_center|LOCUS_18130 25110 25694 gene locus_tag LOCUS_18140 gene hisB 25110 25694 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_18140 25691 26314 gene locus_tag LOCUS_18150 gene hisH 25691 26314 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_18150 26316 27041 gene locus_tag LOCUS_18160 gene hisA 26316 27041 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012897810.1 protein_id gnl|my_center|LOCUS_18160 27038 27793 gene locus_tag LOCUS_18170 gene hisF 27038 27793 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964259.1 protein_id gnl|my_center|LOCUS_18170 27812 28459 gene locus_tag LOCUS_18180 gene hisIE 27812 28459 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_18180 28649 29068 gene locus_tag LOCUS_18190 28649 29068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 29085 29588 gene locus_tag LOCUS_18200 29085 29588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 29732 30511 gene locus_tag LOCUS_18210 gene proB 29732 30511 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_18210 30520 31878 gene locus_tag LOCUS_18220 30520 31878 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922104.1 protein_id gnl|my_center|LOCUS_18220 34603 32012 gene locus_tag LOCUS_18230 34603 32012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 35088 37202 gene locus_tag LOCUS_18240 35088 37202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 38005 37316 gene locus_tag LOCUS_18250 38005 37316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 38498 37983 gene locus_tag LOCUS_18260 38498 37983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 39483 38662 gene locus_tag LOCUS_18270 39483 38662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816588.1 protein_id gnl|my_center|LOCUS_18270 40172 39477 gene locus_tag LOCUS_18280 40172 39477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_18280 40558 40169 gene locus_tag LOCUS_18290 40558 40169 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816592.1 protein_id gnl|my_center|LOCUS_18290 40799 41815 gene locus_tag LOCUS_18300 40799 41815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 43311 41896 gene locus_tag LOCUS_18310 43311 41896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 43489 45318 gene locus_tag LOCUS_18320 43489 45318 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128975638.1 protein_id gnl|my_center|LOCUS_18320 45349 45948 gene locus_tag LOCUS_18330 45349 45948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 45988 48030 gene locus_tag LOCUS_18340 45988 48030 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903241.1 protein_id gnl|my_center|LOCUS_18340 48199 50034 gene locus_tag LOCUS_18350 gene typA 48199 50034 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_18350 50178 50438 gene locus_tag LOCUS_18360 50178 50438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 51362 50769 gene locus_tag LOCUS_18370 51362 50769 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459560.1 protein_id gnl|my_center|LOCUS_18370 51981 51379 gene locus_tag LOCUS_18380 51981 51379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 52832 51978 gene locus_tag LOCUS_18390 52832 51978 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_18390 53227 52829 gene locus_tag LOCUS_18400 53227 52829 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_18400 53377 53453 gene locus_tag LOCUS_t00340 53377 53453 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 53559 54116 gene locus_tag LOCUS_18410 53559 54116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 56057 54357 gene locus_tag LOCUS_18420 56057 54357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 57420 56086 gene locus_tag LOCUS_18430 57420 56086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 57670 58065 gene locus_tag LOCUS_18440 57670 58065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 58062 58370 gene locus_tag LOCUS_18450 58062 58370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 58367 58813 gene locus_tag LOCUS_18460 58367 58813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 58867 62466 gene locus_tag LOCUS_18470 58867 62466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 62571 63914 gene locus_tag LOCUS_18480 62571 63914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 63941 65533 gene locus_tag LOCUS_18490 63941 65533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 65780 66205 gene locus_tag LOCUS_18500 65780 66205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 66202 68247 gene locus_tag LOCUS_18510 66202 68247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 68349 69833 gene locus_tag LOCUS_18520 68349 69833 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289234.1 protein_id gnl|my_center|LOCUS_18520 69830 70036 gene locus_tag LOCUS_18530 69830 70036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 70020 70841 gene locus_tag LOCUS_18540 70020 70841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence13 1237 119 gene locus_tag LOCUS_18550 1237 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 1618 2073 gene locus_tag LOCUS_18560 1618 2073 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_18560 2163 3497 gene locus_tag LOCUS_18570 gene nusA 2163 3497 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_18570 3569 3844 gene locus_tag LOCUS_18580 3569 3844 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_18580 3837 4259 gene locus_tag LOCUS_18590 3837 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 4278 6803 gene locus_tag LOCUS_18600 4278 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 6892 7251 gene locus_tag LOCUS_18610 gene rbfA 6892 7251 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428234.1 protein_id gnl|my_center|LOCUS_18610 7248 8198 gene locus_tag LOCUS_18620 7248 8198 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_18620 8191 9060 gene locus_tag LOCUS_18630 gene truB 8191 9060 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100522.1 protein_id gnl|my_center|LOCUS_18630 9065 9970 gene locus_tag LOCUS_18640 9065 9970 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925599.1 protein_id gnl|my_center|LOCUS_18640 11497 10118 gene locus_tag LOCUS_18650 11497 10118 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477816.1 protein_id gnl|my_center|LOCUS_18650 12468 11695 gene locus_tag LOCUS_18660 12468 11695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 12791 14176 gene locus_tag LOCUS_18670 gene ygjG 12791 14176 CDS product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633381.1 protein_id gnl|my_center|LOCUS_18670 14280 15761 gene locus_tag LOCUS_18680 14280 15761 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945999.1 protein_id gnl|my_center|LOCUS_18680 16961 15852 gene locus_tag LOCUS_18690 16961 15852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 18395 17073 gene locus_tag LOCUS_18700 18395 17073 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205413.1 protein_id gnl|my_center|LOCUS_18700 18572 19567 gene locus_tag LOCUS_18710 gene dusB 18572 19567 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_18710 19892 21967 gene locus_tag LOCUS_18720 gene fusA 19892 21967 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_18720 22115 23281 gene locus_tag LOCUS_18730 22115 23281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 24660 23362 gene locus_tag LOCUS_18740 24660 23362 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054058.1 protein_id gnl|my_center|LOCUS_18740 25171 24674 gene locus_tag LOCUS_18750 25171 24674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 26465 25185 gene locus_tag LOCUS_18760 26465 25185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 28237 26462 gene locus_tag LOCUS_18770 gene walK 28237 26462 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288851.1 protein_id gnl|my_center|LOCUS_18770 28996 28283 gene locus_tag LOCUS_18780 gene yycF 28996 28283 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288850.1 protein_id gnl|my_center|LOCUS_18780 29570 29034 gene locus_tag LOCUS_18790 29570 29034 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_18790 29722 29970 gene locus_tag LOCUS_18800 29722 29970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 30338 31636 gene locus_tag LOCUS_18810 30338 31636 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_18810 31774 32256 gene locus_tag LOCUS_18820 gene rlmH 31774 32256 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704775.1 protein_id gnl|my_center|LOCUS_18820 32305 34041 gene locus_tag LOCUS_18830 32305 34041 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396540.1 protein_id gnl|my_center|LOCUS_18830 34380 34102 gene locus_tag LOCUS_18840 34380 34102 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165613498.1 protein_id gnl|my_center|LOCUS_18840 34652 34377 gene locus_tag LOCUS_18850 34652 34377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 34800 35942 gene locus_tag LOCUS_18860 gene dacF 34800 35942 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831996.1 protein_id gnl|my_center|LOCUS_18860 36075 36242 gene locus_tag LOCUS_18870 36075 36242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 36239 36613 gene locus_tag LOCUS_18880 36239 36613 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682305.1 protein_id gnl|my_center|LOCUS_18880 36743 37885 gene locus_tag LOCUS_18890 36743 37885 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_18890 37900 38277 gene locus_tag LOCUS_18900 37900 38277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 38544 39923 gene locus_tag LOCUS_18910 38544 39923 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080841.1 protein_id gnl|my_center|LOCUS_18910 40227 40003 gene locus_tag LOCUS_18920 40227 40003 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_18920 40450 41181 gene locus_tag LOCUS_18930 40450 41181 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410658.1 protein_id gnl|my_center|LOCUS_18930 41178 41504 gene locus_tag LOCUS_18940 gene azlD 41178 41504 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_18940 43413 41527 gene locus_tag LOCUS_18950 43413 41527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 44074 43745 gene locus_tag LOCUS_18960 44074 43745 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423377.1 protein_id gnl|my_center|LOCUS_18960 44517 44173 gene locus_tag LOCUS_18970 44517 44173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 46397 44679 gene locus_tag LOCUS_18980 46397 44679 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_18980 48220 46391 gene locus_tag LOCUS_18990 48220 46391 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_18990 48731 50014 gene locus_tag LOCUS_19000 48731 50014 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_19000 50021 50674 gene locus_tag LOCUS_19010 50021 50674 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_19010 51226 50744 gene locus_tag LOCUS_19020 51226 50744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 52647 51223 gene locus_tag LOCUS_19030 52647 51223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 53371 52682 gene locus_tag LOCUS_19040 gene yycF 53371 52682 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701473.1 protein_id gnl|my_center|LOCUS_19040 53787 53392 gene locus_tag LOCUS_19050 53787 53392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 53930 55915 gene locus_tag LOCUS_19060 53930 55915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 56117 56851 gene locus_tag LOCUS_19070 56117 56851 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_19070 56882 57631 gene locus_tag LOCUS_19080 56882 57631 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428245.1 protein_id gnl|my_center|LOCUS_19080 57694 59058 gene locus_tag LOCUS_19090 gene fumC 57694 59058 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160526.1 protein_id gnl|my_center|LOCUS_19090 59107 60279 gene locus_tag LOCUS_19100 59107 60279 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_19100 61966 60836 gene locus_tag LOCUS_19110 61966 60836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 62596 62150 gene locus_tag LOCUS_19120 62596 62150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 63771 62599 gene locus_tag LOCUS_19130 63771 62599 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173870.1 protein_id gnl|my_center|LOCUS_19130 64550 63933 gene locus_tag LOCUS_19140 64550 63933 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence14 1057 653 gene locus_tag LOCUS_19150 gene rpsI 1057 653 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_19150 1503 1072 gene locus_tag LOCUS_19160 gene rplM 1503 1072 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_19160 1832 2407 gene locus_tag LOCUS_19170 1832 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 2404 2697 gene locus_tag LOCUS_19180 2404 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 2820 3143 gene locus_tag LOCUS_19190 2820 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 3278 4738 gene locus_tag LOCUS_19200 3278 4738 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_19200 4921 4845 gene locus_tag LOCUS_t00350 4921 4845 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5748 5098 gene locus_tag LOCUS_19210 5748 5098 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948375.1 protein_id gnl|my_center|LOCUS_19210 6112 5912 gene locus_tag LOCUS_19220 6112 5912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 7517 6138 gene locus_tag LOCUS_19230 gene scfB 7517 6138 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_19230 7753 7607 gene locus_tag LOCUS_19240 gene scfA 7753 7607 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815210.1 protein_id gnl|my_center|LOCUS_19240 9181 7901 gene locus_tag LOCUS_19250 gene obgE 9181 7901 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_19250 9557 9270 gene locus_tag LOCUS_19260 gene rpmA 9557 9270 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816541.1 protein_id gnl|my_center|LOCUS_19260 9890 9561 gene locus_tag LOCUS_19270 9890 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 10198 9890 gene locus_tag LOCUS_19280 gene rplU 10198 9890 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_19280 11959 10334 gene locus_tag LOCUS_19290 11959 10334 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_19290 12155 13099 gene locus_tag LOCUS_19300 gene prmA 12155 13099 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816472.1 protein_id gnl|my_center|LOCUS_19300 13096 14232 gene locus_tag LOCUS_19310 13096 14232 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721377.1 protein_id gnl|my_center|LOCUS_19310 14491 15048 gene locus_tag LOCUS_19320 14491 15048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 15071 16348 gene locus_tag LOCUS_19330 15071 16348 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_19330 17592 16426 gene locus_tag LOCUS_19340 17592 16426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 17861 19090 gene locus_tag LOCUS_19350 17861 19090 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460305.1 protein_id gnl|my_center|LOCUS_19350 19249 20649 gene locus_tag LOCUS_19360 19249 20649 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_19360 21009 22016 gene locus_tag LOCUS_19370 gene aroF 21009 22016 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_19370 22013 22849 gene locus_tag LOCUS_19380 22013 22849 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_19380 22846 23904 gene locus_tag LOCUS_19390 gene aroB 22846 23904 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775572.1 protein_id gnl|my_center|LOCUS_19390 23901 25175 gene locus_tag LOCUS_19400 gene aroA 23901 25175 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_19400 25213 26316 gene locus_tag LOCUS_19410 gene aroC 25213 26316 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_19410 26320 27465 gene locus_tag LOCUS_19420 gene pheA 26320 27465 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468591.1 protein_id gnl|my_center|LOCUS_19420 27465 28706 gene locus_tag LOCUS_19430 27465 28706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 28678 29112 gene locus_tag LOCUS_19440 gene aroQ 28678 29112 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 protein_id gnl|my_center|LOCUS_19440 29394 29310 gene locus_tag LOCUS_t00360 29394 29310 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 29479 29404 gene locus_tag LOCUS_t00370 29479 29404 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 29624 29842 gene locus_tag LOCUS_19450 29624 29842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 29823 30245 gene locus_tag LOCUS_19460 29823 30245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 30611 31396 gene locus_tag LOCUS_19470 30611 31396 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002349114.1 protein_id gnl|my_center|LOCUS_19470 31393 32268 gene locus_tag LOCUS_19480 gene panB 31393 32268 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_19480 32302 33153 gene locus_tag LOCUS_19490 gene panC 32302 33153 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287875.1 protein_id gnl|my_center|LOCUS_19490 33155 33550 gene locus_tag LOCUS_19500 33155 33550 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287876.1 protein_id gnl|my_center|LOCUS_19500 33610 34806 gene locus_tag LOCUS_19510 gene coaBC 33610 34806 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_19510 35634 34879 gene locus_tag LOCUS_19520 35634 34879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 36265 38604 gene locus_tag LOCUS_19530 gene spoIIE 36265 38604 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243026.1 protein_id gnl|my_center|LOCUS_19530 39573 38680 gene locus_tag LOCUS_19540 39573 38680 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048395.1 protein_id gnl|my_center|LOCUS_19540 40619 39570 gene locus_tag LOCUS_19550 gene mutY 40619 39570 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296955.1 protein_id gnl|my_center|LOCUS_19550 41523 40633 gene locus_tag LOCUS_19560 41523 40633 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079134.1 protein_id gnl|my_center|LOCUS_19560 41618 42160 gene locus_tag LOCUS_19570 41618 42160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 42770 42240 gene locus_tag LOCUS_19580 gene pgsA 42770 42240 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_19580 44179 42767 gene locus_tag LOCUS_19590 gene rimO 44179 42767 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_19590 44813 44202 gene locus_tag LOCUS_19600 44813 44202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 45993 44803 gene locus_tag LOCUS_19610 gene recA 45993 44803 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_19610 46906 46001 gene locus_tag LOCUS_19620 gene prmC 46906 46001 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_19620 47964 46951 gene locus_tag LOCUS_19630 47964 46951 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421392.1 protein_id gnl|my_center|LOCUS_19630 49578 48067 gene locus_tag LOCUS_19640 49578 48067 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_19640 50269 49586 gene locus_tag LOCUS_19650 50269 49586 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896932.1 protein_id gnl|my_center|LOCUS_19650 51685 50330 gene locus_tag LOCUS_19660 51685 50330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 51872 51958 gene locus_tag LOCUS_t00380 51872 51958 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 52169 53161 gene locus_tag LOCUS_19670 52169 53161 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016794.1 protein_id gnl|my_center|LOCUS_19670 55120 53237 gene locus_tag LOCUS_19680 55120 53237 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459352.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19680 55375 55157 gene locus_tag LOCUS_19690 55375 55157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 55629 56621 gene locus_tag LOCUS_19700 55629 56621 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945452.1 protein_id gnl|my_center|LOCUS_19700 57442 56681 gene locus_tag LOCUS_19710 57442 56681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 58196 57555 gene locus_tag LOCUS_19720 58196 57555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 58646 59185 gene locus_tag LOCUS_19730 58646 59185 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_19730 59783 59268 gene locus_tag LOCUS_19740 59783 59268 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_19740 60674 59868 gene locus_tag LOCUS_19750 60674 59868 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763805.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence15 42 233 gene locus_tag LOCUS_19760 42 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 1014 433 gene locus_tag LOCUS_19770 1014 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1137 1592 gene locus_tag LOCUS_19780 1137 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 1576 1746 gene locus_tag LOCUS_19790 1576 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 1830 2456 gene locus_tag LOCUS_19800 1830 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2532 2984 gene locus_tag LOCUS_19810 2532 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2986 3306 gene locus_tag LOCUS_19820 2986 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 3308 3499 gene locus_tag LOCUS_19830 3308 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 3670 3966 gene locus_tag LOCUS_19840 3670 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 4049 4396 gene locus_tag LOCUS_19850 4049 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 4393 4752 gene locus_tag LOCUS_19860 4393 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 4800 5084 gene locus_tag LOCUS_19870 4800 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 5163 6167 gene locus_tag LOCUS_19880 5163 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 6180 6530 gene locus_tag LOCUS_19890 6180 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 6607 7284 gene locus_tag LOCUS_19900 6607 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 7333 7533 gene locus_tag LOCUS_19910 7333 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 7530 7802 gene locus_tag LOCUS_19920 7530 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 7799 8242 gene locus_tag LOCUS_19930 7799 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 8239 9183 gene locus_tag LOCUS_19940 8239 9183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 9176 9385 gene locus_tag LOCUS_19950 9176 9385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 9382 9795 gene locus_tag LOCUS_19960 9382 9795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 9788 10234 gene locus_tag LOCUS_19970 9788 10234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 10276 10521 gene locus_tag LOCUS_19980 10276 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 10533 11420 gene locus_tag LOCUS_19990 10533 11420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 11430 11936 gene locus_tag LOCUS_20000 11430 11936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 11948 12193 gene locus_tag LOCUS_20010 11948 12193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 12193 12879 gene locus_tag LOCUS_20020 12193 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 12916 13209 gene locus_tag LOCUS_20030 12916 13209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 13248 13679 gene locus_tag LOCUS_20040 13248 13679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 13767 13979 gene locus_tag LOCUS_20050 13767 13979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 13976 14695 gene locus_tag LOCUS_20060 13976 14695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 14692 14892 gene locus_tag LOCUS_20070 14692 14892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 14889 15044 gene locus_tag LOCUS_20080 14889 15044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 15045 15413 gene locus_tag LOCUS_20090 15045 15413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 15406 15864 gene locus_tag LOCUS_20100 gene ssb 15406 15864 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365911.1 protein_id gnl|my_center|LOCUS_20100 15886 16431 gene locus_tag LOCUS_20110 15886 16431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 16416 16658 gene locus_tag LOCUS_20120 16416 16658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 16658 17023 gene locus_tag LOCUS_20130 16658 17023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005806128.1 protein_id gnl|my_center|LOCUS_20130 17202 17531 gene locus_tag LOCUS_20140 17202 17531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 17547 17762 gene locus_tag LOCUS_20150 17547 17762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 17740 18282 gene locus_tag LOCUS_20160 17740 18282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 19989 18550 gene locus_tag LOCUS_20170 19989 18550 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389524.1 protein_id gnl|my_center|LOCUS_20170 20425 19994 gene locus_tag LOCUS_20180 20425 19994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 20781 20437 gene locus_tag LOCUS_20190 20781 20437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 20915 21760 gene locus_tag LOCUS_20200 20915 21760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 21773 22183 gene locus_tag LOCUS_20210 21773 22183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 22180 22401 gene locus_tag LOCUS_20220 22180 22401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 22413 22715 gene locus_tag LOCUS_20230 22413 22715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 22731 22949 gene locus_tag LOCUS_20240 22731 22949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 22984 23187 gene locus_tag LOCUS_20250 22984 23187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 23184 23732 gene locus_tag LOCUS_20260 23184 23732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 23772 23951 gene locus_tag LOCUS_20270 23772 23951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 23974 24474 gene locus_tag LOCUS_20280 23974 24474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 24489 24833 gene locus_tag LOCUS_20290 24489 24833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 24830 25135 gene locus_tag LOCUS_20300 24830 25135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 25211 25657 gene locus_tag LOCUS_20310 25211 25657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 25647 26825 gene locus_tag LOCUS_20320 25647 26825 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 protein_id gnl|my_center|LOCUS_20320 26845 27393 gene locus_tag LOCUS_20330 26845 27393 CDS product DUF2815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399690.1 protein_id gnl|my_center|LOCUS_20330 27406 29379 gene locus_tag LOCUS_20340 27406 29379 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_20340 29422 29910 gene locus_tag LOCUS_20350 29422 29910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 29907 32372 gene locus_tag LOCUS_20360 29907 32372 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714181.1 protein_id gnl|my_center|LOCUS_20360 32631 32912 gene locus_tag LOCUS_20370 32631 32912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 32909 34258 gene locus_tag LOCUS_20380 32909 34258 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 protein_id gnl|my_center|LOCUS_20380 34255 34509 gene locus_tag LOCUS_20390 34255 34509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475924.1 protein_id gnl|my_center|LOCUS_20390 34499 35305 gene locus_tag LOCUS_20400 34499 35305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 35302 35631 gene locus_tag LOCUS_20410 35302 35631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 35622 36041 gene locus_tag LOCUS_20420 35622 36041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 36038 36844 gene locus_tag LOCUS_20430 36038 36844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 36909 37610 gene locus_tag LOCUS_20440 gene terS 36909 37610 CDS product phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861025.1 protein_id gnl|my_center|LOCUS_20440 37585 38940 gene locus_tag LOCUS_20450 37585 38940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 38937 40385 gene locus_tag LOCUS_20460 38937 40385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 40390 41703 gene locus_tag LOCUS_20470 40390 41703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 41700 41993 gene locus_tag LOCUS_20480 41700 41993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 42085 42711 gene locus_tag LOCUS_20490 42085 42711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 42734 43705 gene locus_tag LOCUS_20500 42734 43705 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389876.1 protein_id gnl|my_center|LOCUS_20500 43725 44150 gene locus_tag LOCUS_20510 43725 44150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 44119 44553 gene locus_tag LOCUS_20520 44119 44553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 44553 44930 gene locus_tag LOCUS_20530 44553 44930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 44943 45368 gene locus_tag LOCUS_20540 44943 45368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 45373 45927 gene locus_tag LOCUS_20550 45373 45927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 46054 46458 gene locus_tag LOCUS_20560 46054 46458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 46542 47099 gene locus_tag LOCUS_20570 46542 47099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 47078 49666 gene locus_tag LOCUS_20580 47078 49666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 49663 50571 gene locus_tag LOCUS_20590 49663 50571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 50575 51684 gene locus_tag LOCUS_20600 50575 51684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 51684 52739 gene locus_tag LOCUS_20610 51684 52739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 52743 54290 gene locus_tag LOCUS_20620 52743 54290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 54769 55998 gene locus_tag LOCUS_20630 54769 55998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 55901 56230 gene locus_tag LOCUS_20640 55901 56230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 56244 56381 gene locus_tag LOCUS_20650 56244 56381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 56427 56582 gene locus_tag LOCUS_20660 56427 56582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 56598 56963 gene locus_tag LOCUS_20670 56598 56963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 56969 57196 gene locus_tag LOCUS_20680 56969 57196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 57200 58633 gene locus_tag LOCUS_20690 57200 58633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence16 889 119 gene locus_tag LOCUS_20700 gene trpA 889 119 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_20700 2072 882 gene locus_tag LOCUS_20710 gene trpB 2072 882 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_20710 2692 2069 gene locus_tag LOCUS_20720 2692 2069 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169926.1 protein_id gnl|my_center|LOCUS_20720 3477 2689 gene locus_tag LOCUS_20730 gene trpC 3477 2689 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_20730 4508 3474 gene locus_tag LOCUS_20740 gene trpD 4508 3474 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_20740 5092 4505 gene locus_tag LOCUS_20750 5092 4505 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545428.1 protein_id gnl|my_center|LOCUS_20750 6555 5089 gene locus_tag LOCUS_20760 gene trpE 6555 5089 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_20760 9633 7057 gene locus_tag LOCUS_20770 9633 7057 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674108.1 protein_id gnl|my_center|LOCUS_20770 10103 9630 gene locus_tag LOCUS_20780 10103 9630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 10691 10275 gene locus_tag LOCUS_20790 10691 10275 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_20790 12726 11269 gene locus_tag LOCUS_20800 12726 11269 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390018.1 protein_id gnl|my_center|LOCUS_20800 13429 12776 gene locus_tag LOCUS_20810 gene deoC 13429 12776 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439345.1 protein_id gnl|my_center|LOCUS_20810 14668 13511 gene locus_tag LOCUS_20820 14668 13511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 15670 14684 gene locus_tag LOCUS_20830 15670 14684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 16182 15667 gene locus_tag LOCUS_20840 16182 15667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 18942 16297 gene locus_tag LOCUS_20850 18942 16297 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377094.1 protein_id gnl|my_center|LOCUS_20850 19483 20496 gene locus_tag LOCUS_20860 19483 20496 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_20860 20489 21169 gene locus_tag LOCUS_20870 20489 21169 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112597.1 protein_id gnl|my_center|LOCUS_20870 21208 22086 gene locus_tag LOCUS_20880 21208 22086 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_20880 22287 23678 gene locus_tag LOCUS_20890 22287 23678 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930806.1 protein_id gnl|my_center|LOCUS_20890 24554 23865 gene locus_tag LOCUS_20900 24554 23865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 24703 26397 gene locus_tag LOCUS_20910 gene rny 24703 26397 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_20910 26564 27349 gene locus_tag LOCUS_20920 gene ymdB 26564 27349 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_20920 27394 28491 gene locus_tag LOCUS_20930 27394 28491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 28488 30380 gene locus_tag LOCUS_20940 28488 30380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 30443 31090 gene locus_tag LOCUS_20950 30443 31090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 31103 31342 gene locus_tag LOCUS_20960 31103 31342 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234876.1 protein_id gnl|my_center|LOCUS_20960 31532 32365 gene locus_tag LOCUS_20970 31532 32365 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_20970 32384 33691 gene locus_tag LOCUS_20980 32384 33691 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_20980 33719 35329 gene locus_tag LOCUS_20990 33719 35329 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_20990 35357 36181 gene locus_tag LOCUS_21000 35357 36181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 36178 36453 gene locus_tag LOCUS_21010 36178 36453 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814866.1 protein_id gnl|my_center|LOCUS_21010 39926 36864 gene locus_tag LOCUS_21020 39926 36864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 41208 40012 gene locus_tag LOCUS_21030 41208 40012 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861504.1 protein_id gnl|my_center|LOCUS_21030 42081 41248 gene locus_tag LOCUS_21040 42081 41248 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_21040 42369 43196 gene locus_tag LOCUS_21050 42369 43196 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860835.1 protein_id gnl|my_center|LOCUS_21050 43251 43850 gene locus_tag LOCUS_21060 43251 43850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 45334 43985 gene locus_tag LOCUS_21070 gene gdhA 45334 43985 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020063.1 protein_id gnl|my_center|LOCUS_21070 46224 45676 gene locus_tag LOCUS_21080 46224 45676 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861585.1 protein_id gnl|my_center|LOCUS_21080 46500 47966 gene locus_tag LOCUS_21090 46500 47966 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393748.1 protein_id gnl|my_center|LOCUS_21090 48418 48062 gene locus_tag LOCUS_21100 48418 48062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 48596 49786 gene locus_tag LOCUS_21110 48596 49786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 50746 49892 gene locus_tag LOCUS_21120 50746 49892 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064968.1 protein_id gnl|my_center|LOCUS_21120 51810 50770 gene locus_tag LOCUS_21130 51810 50770 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966690.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence17 58 131 gene locus_tag LOCUS_t00390 58 131 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 222 908 gene locus_tag LOCUS_21140 222 908 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_21140 913 2091 gene locus_tag LOCUS_21150 913 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 2095 3495 gene locus_tag LOCUS_21160 2095 3495 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_21160 4774 3569 gene locus_tag LOCUS_21170 gene hydF 4774 3569 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108016.1 protein_id gnl|my_center|LOCUS_21170 5304 4930 gene locus_tag LOCUS_21180 5304 4930 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_21180 5479 6129 gene locus_tag LOCUS_21190 5479 6129 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_21190 6644 6225 gene locus_tag LOCUS_21200 6644 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 7255 6866 gene locus_tag LOCUS_21210 7255 6866 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227791.1 protein_id gnl|my_center|LOCUS_21210 8833 7283 gene locus_tag LOCUS_21220 8833 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 9534 8821 gene locus_tag LOCUS_21230 9534 8821 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460117.1 protein_id gnl|my_center|LOCUS_21230 9729 12098 gene locus_tag LOCUS_21240 9729 12098 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183138.1 protein_id gnl|my_center|LOCUS_21240 12113 12526 gene locus_tag LOCUS_21250 12113 12526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 13061 12648 gene locus_tag LOCUS_21260 13061 12648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 13684 13058 gene locus_tag LOCUS_21270 13684 13058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 15110 13794 gene locus_tag LOCUS_21280 15110 13794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 16498 15107 gene locus_tag LOCUS_21290 16498 15107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 17229 16495 gene locus_tag LOCUS_21300 gene rgbR 17229 16495 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_21300 18706 17537 gene locus_tag LOCUS_21310 18706 17537 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_21310 20096 18690 gene locus_tag LOCUS_21320 20096 18690 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948690.1 protein_id gnl|my_center|LOCUS_21320 21128 20229 gene locus_tag LOCUS_21330 21128 20229 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390170.1 protein_id gnl|my_center|LOCUS_21330 22132 21173 gene locus_tag LOCUS_21340 22132 21173 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861477.1 protein_id gnl|my_center|LOCUS_21340 22831 22151 gene locus_tag LOCUS_21350 22831 22151 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359998.1 protein_id gnl|my_center|LOCUS_21350 23858 22812 gene locus_tag LOCUS_21360 23858 22812 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356948.1 protein_id gnl|my_center|LOCUS_21360 24428 24045 gene locus_tag LOCUS_21370 24428 24045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 25558 24425 gene locus_tag LOCUS_21380 gene mnmA 25558 24425 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393152.1 protein_id gnl|my_center|LOCUS_21380 26318 25659 gene locus_tag LOCUS_21390 26318 25659 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272550.1 protein_id gnl|my_center|LOCUS_21390 27410 26334 gene locus_tag LOCUS_21400 27410 26334 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261890.1 protein_id gnl|my_center|LOCUS_21400 27313 27504 gene locus_tag LOCUS_21410 27313 27504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 28402 27623 gene locus_tag LOCUS_21420 28402 27623 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817405.1 protein_id gnl|my_center|LOCUS_21420 29343 28396 gene locus_tag LOCUS_21430 29343 28396 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261888.1 protein_id gnl|my_center|LOCUS_21430 29645 30010 gene locus_tag LOCUS_21440 29645 30010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 30013 32064 gene locus_tag LOCUS_21450 30013 32064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 32054 32617 gene locus_tag LOCUS_21460 32054 32617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 32996 32688 gene locus_tag LOCUS_21470 gene trxA 32996 32688 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_21470 34404 33085 gene locus_tag LOCUS_21480 34404 33085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 35621 34515 gene locus_tag LOCUS_21490 35621 34515 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659298.1 protein_id gnl|my_center|LOCUS_21490 36222 35665 gene locus_tag LOCUS_21500 36222 35665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 36443 36368 gene locus_tag LOCUS_t00400 36443 36368 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 36978 38663 gene locus_tag LOCUS_21510 36978 38663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 38700 39071 gene locus_tag LOCUS_21520 38700 39071 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_21520 39118 40074 gene locus_tag LOCUS_21530 39118 40074 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963416.1 protein_id gnl|my_center|LOCUS_21530 40107 40520 gene locus_tag LOCUS_21540 40107 40520 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264782.1 protein_id gnl|my_center|LOCUS_21540 42306 40639 gene locus_tag LOCUS_21550 gene tndX 42306 40639 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_21550 42446 42303 gene locus_tag LOCUS_21560 42446 42303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 42709 42551 gene locus_tag LOCUS_21570 42709 42551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 43569 43165 gene locus_tag LOCUS_21580 43569 43165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 43734 43570 gene locus_tag LOCUS_21590 43734 43570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 44250 43882 gene locus_tag LOCUS_21600 44250 43882 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368678.1 protein_id gnl|my_center|LOCUS_21600 44989 44540 gene locus_tag LOCUS_21610 44989 44540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 45543 45010 gene locus_tag LOCUS_21620 45543 45010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 45866 45555 gene locus_tag LOCUS_21630 45866 45555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence18 453 124 gene locus_tag LOCUS_21640 453 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 647 1573 gene locus_tag LOCUS_21650 gene metA 647 1573 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796420.1 protein_id gnl|my_center|LOCUS_21650 2165 3313 gene locus_tag LOCUS_21660 2165 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 3317 3820 gene locus_tag LOCUS_21670 3317 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 4576 3884 gene locus_tag LOCUS_21680 4576 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 5976 4609 gene locus_tag LOCUS_21690 gene lpdA 5976 4609 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461729.1 protein_id gnl|my_center|LOCUS_21690 6966 5983 gene locus_tag LOCUS_21700 6966 5983 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812232.1 protein_id gnl|my_center|LOCUS_21700 8453 7017 gene locus_tag LOCUS_21710 gene gcvPB 8453 7017 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679310.1 protein_id gnl|my_center|LOCUS_21710 9766 8453 gene locus_tag LOCUS_21720 gene gcvPA 9766 8453 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678346.1 protein_id gnl|my_center|LOCUS_21720 10152 9769 gene locus_tag LOCUS_21730 gene gcvH 10152 9769 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973527.1 protein_id gnl|my_center|LOCUS_21730 11299 10205 gene locus_tag LOCUS_21740 gene gcvT 11299 10205 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_21740 11839 12345 gene locus_tag LOCUS_21750 11839 12345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 12373 12987 gene locus_tag LOCUS_21760 12373 12987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 13501 13067 gene locus_tag LOCUS_21770 gene rpiB 13501 13067 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932826.1 protein_id gnl|my_center|LOCUS_21770 14326 13526 gene locus_tag LOCUS_21780 14326 13526 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459478.1 protein_id gnl|my_center|LOCUS_21780 15535 14354 gene locus_tag LOCUS_21790 gene dnaJ 15535 14354 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048002.1 protein_id gnl|my_center|LOCUS_21790 17561 15693 gene locus_tag LOCUS_21800 gene dnaK 17561 15693 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_21800 18271 17630 gene locus_tag LOCUS_21810 18271 17630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 19395 18313 gene locus_tag LOCUS_21820 gene hrcA 19395 18313 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_21820 21009 19693 gene locus_tag LOCUS_21830 21009 19693 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_21830 22164 21100 gene locus_tag LOCUS_21840 22164 21100 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_21840 23926 22262 gene locus_tag LOCUS_21850 gene ilvD 23926 22262 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_21850 24079 24756 gene locus_tag LOCUS_21860 24079 24756 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287585.1 protein_id gnl|my_center|LOCUS_21860 24983 24777 gene locus_tag LOCUS_21870 24983 24777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 25171 25467 gene locus_tag LOCUS_21880 25171 25467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 25471 25671 gene locus_tag LOCUS_21890 25471 25671 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461361.1 protein_id gnl|my_center|LOCUS_21890 26411 25725 gene locus_tag LOCUS_21900 26411 25725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 27154 26609 gene locus_tag LOCUS_21910 gene raiA 27154 26609 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722643.1 protein_id gnl|my_center|LOCUS_21910 27580 27299 gene locus_tag LOCUS_21920 27580 27299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 28952 27594 gene locus_tag LOCUS_21930 28952 27594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 30892 29150 gene locus_tag LOCUS_21940 30892 29150 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_21940 31452 30889 gene locus_tag LOCUS_21950 31452 30889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 32667 31648 gene locus_tag LOCUS_21960 gene ilvC 32667 31648 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_21960 33199 32648 gene locus_tag LOCUS_21970 gene ilvN 33199 32648 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810756.1 protein_id gnl|my_center|LOCUS_21970 34932 33214 gene locus_tag LOCUS_21980 gene ilvB 34932 33214 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_21980 36323 35406 gene locus_tag LOCUS_21990 36323 35406 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812829.1 protein_id gnl|my_center|LOCUS_21990 36587 38362 gene locus_tag LOCUS_22000 36587 38362 CDS product aminopeptidase P family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986733.1 protein_id gnl|my_center|LOCUS_22000 38394 39050 gene locus_tag LOCUS_22010 38394 39050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 39307 39594 gene locus_tag LOCUS_22020 39307 39594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 40120 40398 gene locus_tag LOCUS_22030 40120 40398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 40462 41001 gene locus_tag LOCUS_22040 40462 41001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 41363 41905 gene locus_tag LOCUS_22050 gene raiA 41363 41905 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671185.1 protein_id gnl|my_center|LOCUS_22050 42242 42682 gene locus_tag LOCUS_22060 42242 42682 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_22060 42766 43302 gene locus_tag LOCUS_22070 42766 43302 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532362.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence19 197 1546 gene locus_tag LOCUS_22080 gene glmM 197 1546 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521474.1 protein_id gnl|my_center|LOCUS_22080 1550 2209 gene locus_tag LOCUS_22090 1550 2209 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_22090 2252 3163 gene locus_tag LOCUS_22100 2252 3163 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896738.1 protein_id gnl|my_center|LOCUS_22100 3975 3199 gene locus_tag LOCUS_22110 gene sigG 3975 3199 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_22110 4151 4750 gene locus_tag LOCUS_22120 4151 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 4752 4997 gene locus_tag LOCUS_22130 4752 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 5194 5916 gene locus_tag LOCUS_22140 gene rpsB 5194 5916 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_22140 6012 6941 gene locus_tag LOCUS_22150 gene tsf 6012 6941 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_22150 7813 7274 gene locus_tag LOCUS_22160 7813 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 8417 7986 gene locus_tag LOCUS_22170 8417 7986 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_22170 9767 8469 gene locus_tag LOCUS_22180 9767 8469 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788204.1 protein_id gnl|my_center|LOCUS_22180 10060 10722 gene locus_tag LOCUS_22190 10060 10722 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680231.1 protein_id gnl|my_center|LOCUS_22190 10759 11628 gene locus_tag LOCUS_22200 10759 11628 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_22200 14143 11768 gene locus_tag LOCUS_22210 14143 11768 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_22210 14720 14235 gene locus_tag LOCUS_22220 14720 14235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 16069 14723 gene locus_tag LOCUS_22230 16069 14723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 16874 16110 gene locus_tag LOCUS_22240 gene truA 16874 16110 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_22240 17697 16888 gene locus_tag LOCUS_22250 17697 16888 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_22250 18567 17698 gene locus_tag LOCUS_22260 18567 17698 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_22260 19445 18573 gene locus_tag LOCUS_22270 19445 18573 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_22270 20327 19458 gene locus_tag LOCUS_22280 20327 19458 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_22280 20538 21179 gene locus_tag LOCUS_22290 20538 21179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 22932 21358 gene locus_tag LOCUS_22300 22932 21358 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389524.1 protein_id gnl|my_center|LOCUS_22300 23252 23040 gene locus_tag LOCUS_22310 23252 23040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 23610 23245 gene locus_tag LOCUS_22320 23610 23245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 23895 23635 gene locus_tag LOCUS_22330 23895 23635 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_22330 24464 24036 gene locus_tag LOCUS_22340 24464 24036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 24499 24720 gene locus_tag LOCUS_22350 24499 24720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877351.1 protein_id gnl|my_center|LOCUS_22350 25178 24675 gene locus_tag LOCUS_22360 25178 24675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 25601 25194 gene locus_tag LOCUS_22370 25601 25194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 26012 25626 gene locus_tag LOCUS_22380 26012 25626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 26095 26409 gene locus_tag LOCUS_22390 26095 26409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 26460 26831 gene locus_tag LOCUS_22400 26460 26831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 26900 27118 gene locus_tag LOCUS_22410 26900 27118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 27382 27594 gene locus_tag LOCUS_22420 27382 27594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 27751 27990 gene locus_tag LOCUS_22430 27751 27990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 28025 28366 gene locus_tag LOCUS_22440 28025 28366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 28411 28578 gene locus_tag LOCUS_22450 28411 28578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 28575 28820 gene locus_tag LOCUS_22460 28575 28820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 28817 29053 gene locus_tag LOCUS_22470 28817 29053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 29065 29598 gene locus_tag LOCUS_22480 29065 29598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 29577 29831 gene locus_tag LOCUS_22490 29577 29831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 29828 30040 gene locus_tag LOCUS_22500 29828 30040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 30345 31094 gene locus_tag LOCUS_22510 30345 31094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 31091 31663 gene locus_tag LOCUS_22520 31091 31663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 31784 32248 gene locus_tag LOCUS_22530 31784 32248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 32253 33701 gene locus_tag LOCUS_22540 32253 33701 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_22540 33725 35677 gene locus_tag LOCUS_22550 33725 35677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 35704 36021 gene locus_tag LOCUS_22560 35704 36021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 36165 37091 gene locus_tag LOCUS_22570 36165 37091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 37131 38114 gene locus_tag LOCUS_22580 37131 38114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 39256 38330 gene locus_tag LOCUS_22590 39256 38330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 39442 39747 gene locus_tag LOCUS_22600 39442 39747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 39823 41349 gene locus_tag LOCUS_22610 39823 41349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence20 9 689 gene locus_tag LOCUS_22620 9 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 704 1099 gene locus_tag LOCUS_22630 704 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 1096 2640 gene locus_tag LOCUS_22640 1096 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2660 2989 gene locus_tag LOCUS_22650 2660 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2993 4417 gene locus_tag LOCUS_22660 2993 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 4556 12943 gene locus_tag LOCUS_22670 4556 12943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 13002 13262 gene locus_tag LOCUS_22680 13002 13262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 13259 13474 gene locus_tag LOCUS_22690 13259 13474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 13471 13728 gene locus_tag LOCUS_22700 13471 13728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 13733 14530 gene locus_tag LOCUS_22710 13733 14530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 14824 14748 gene locus_tag LOCUS_t00410 14824 14748 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15530 14943 gene locus_tag LOCUS_22720 15530 14943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 15708 16247 gene locus_tag LOCUS_22730 15708 16247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 17846 16497 gene locus_tag LOCUS_22740 17846 16497 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438549.1 protein_id gnl|my_center|LOCUS_22740 17983 18804 gene locus_tag LOCUS_22750 17983 18804 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902960.1 protein_id gnl|my_center|LOCUS_22750 20507 18867 gene locus_tag LOCUS_22760 20507 18867 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047743.1 protein_id gnl|my_center|LOCUS_22760 21766 20504 gene locus_tag LOCUS_22770 21766 20504 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047742.1 protein_id gnl|my_center|LOCUS_22770 22903 21788 gene locus_tag LOCUS_22780 22903 21788 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_22780 24294 23101 gene locus_tag LOCUS_22790 24294 23101 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_22790 26631 24484 gene locus_tag LOCUS_22800 26631 24484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 30846 30061 gene locus_tag LOCUS_22810 30846 30061 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 protein_id gnl|my_center|LOCUS_22810 32424 30943 gene locus_tag LOCUS_22820 gene spoIVA 32424 30943 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944577.1 protein_id gnl|my_center|LOCUS_22820 32705 34471 gene locus_tag LOCUS_22830 32705 34471 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_22830 35145 34549 gene locus_tag LOCUS_22840 35145 34549 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583891.1 protein_id gnl|my_center|LOCUS_22840 35593 35174 gene locus_tag LOCUS_22850 35593 35174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 35890 36348 gene locus_tag LOCUS_22860 35890 36348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 36377 38125 gene locus_tag LOCUS_22870 gene argS 36377 38125 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462258.1 protein_id gnl|my_center|LOCUS_22870 >Feature sequence21 3035 2481 gene locus_tag LOCUS_22880 3035 2481 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384784.1 protein_id gnl|my_center|LOCUS_22880 3911 3048 gene locus_tag LOCUS_22890 3911 3048 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368724.1 protein_id gnl|my_center|LOCUS_22890 4200 3985 gene locus_tag LOCUS_22900 4200 3985 CDS product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610321.1 protein_id gnl|my_center|LOCUS_22900 6075 4204 gene locus_tag LOCUS_22910 6075 4204 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_22910 6557 6072 gene locus_tag LOCUS_22920 6557 6072 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861118.1 protein_id gnl|my_center|LOCUS_22920 7444 6563 gene locus_tag LOCUS_22930 7444 6563 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_22930 8182 7838 gene locus_tag LOCUS_22940 gene rplS 8182 7838 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583883.1 protein_id gnl|my_center|LOCUS_22940 9007 8336 gene locus_tag LOCUS_22950 9007 8336 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 protein_id gnl|my_center|LOCUS_22950 10033 9191 gene locus_tag LOCUS_22960 gene rsmI 10033 9191 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_22960 10711 10058 gene locus_tag LOCUS_22970 10711 10058 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_22970 11349 10708 gene locus_tag LOCUS_22980 11349 10708 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435254.1 protein_id gnl|my_center|LOCUS_22980 11901 11374 gene locus_tag LOCUS_22990 gene nrdG 11901 11374 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_22990 12095 12847 gene locus_tag LOCUS_23000 12095 12847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 17604 12943 gene locus_tag LOCUS_23010 17604 12943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 19184 18324 gene locus_tag LOCUS_23020 19184 18324 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816742.1 protein_id gnl|my_center|LOCUS_23020 19387 20556 gene locus_tag LOCUS_23030 19387 20556 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228869.1 protein_id gnl|my_center|LOCUS_23030 20562 21191 gene locus_tag LOCUS_23040 20562 21191 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890811.1 protein_id gnl|my_center|LOCUS_23040 21308 22663 gene locus_tag LOCUS_23050 gene brnQ 21308 22663 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032833879.1 protein_id gnl|my_center|LOCUS_23050 24440 22746 gene locus_tag LOCUS_23060 24440 22746 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817202.1 protein_id gnl|my_center|LOCUS_23060 25027 24440 gene locus_tag LOCUS_23070 25027 24440 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860883.1 protein_id gnl|my_center|LOCUS_23070 25374 25024 gene locus_tag LOCUS_23080 25374 25024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 26032 25361 gene locus_tag LOCUS_23090 26032 25361 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_23090 26816 26049 gene locus_tag LOCUS_23100 26816 26049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 27871 26948 gene locus_tag LOCUS_23110 27871 26948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 31758 27964 gene locus_tag LOCUS_23120 31758 27964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 32338 32880 gene locus_tag LOCUS_23130 gene spoVT 32338 32880 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966490.1 protein_id gnl|my_center|LOCUS_23130 33040 33288 gene locus_tag LOCUS_23140 gene spoIIID 33040 33288 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_23140 33915 33379 gene locus_tag LOCUS_23150 33915 33379 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868802.1 protein_id gnl|my_center|LOCUS_23150 36259 34010 gene locus_tag LOCUS_23160 36259 34010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence22 179 412 gene locus_tag LOCUS_23170 179 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 693 451 gene locus_tag LOCUS_23180 693 451 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963633.1 protein_id gnl|my_center|LOCUS_23180 957 1535 gene locus_tag LOCUS_23190 957 1535 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963791.1 protein_id gnl|my_center|LOCUS_23190 1543 2055 gene locus_tag LOCUS_23200 1543 2055 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946311.1 protein_id gnl|my_center|LOCUS_23200 2332 3537 gene locus_tag LOCUS_23210 2332 3537 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_23210 3670 4551 gene locus_tag LOCUS_23220 3670 4551 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_23220 4562 5629 gene locus_tag LOCUS_23230 4562 5629 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_23230 5631 6461 gene locus_tag LOCUS_23240 5631 6461 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_23240 6467 7177 gene locus_tag LOCUS_23250 6467 7177 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_23250 9332 7263 gene locus_tag LOCUS_23260 gene recG 9332 7263 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_23260 9471 9785 gene locus_tag LOCUS_23270 9471 9785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 9782 11041 gene locus_tag LOCUS_23280 9782 11041 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_23280 11077 12300 gene locus_tag LOCUS_23290 11077 12300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 12263 13213 gene locus_tag LOCUS_23300 12263 13213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 13263 13613 gene locus_tag LOCUS_23310 13263 13613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 13643 14677 gene locus_tag LOCUS_23320 13643 14677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 14681 15067 gene locus_tag LOCUS_23330 14681 15067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 15064 15405 gene locus_tag LOCUS_23340 15064 15405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 15402 15920 gene locus_tag LOCUS_23350 15402 15920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 15908 16951 gene locus_tag LOCUS_23360 15908 16951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 16968 17354 gene locus_tag LOCUS_23370 16968 17354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 17351 17995 gene locus_tag LOCUS_23380 17351 17995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 17992 18474 gene locus_tag LOCUS_23390 17992 18474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 18505 19107 gene locus_tag LOCUS_23400 18505 19107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 19123 20076 gene locus_tag LOCUS_23410 19123 20076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 20106 20477 gene locus_tag LOCUS_23420 20106 20477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 20474 20836 gene locus_tag LOCUS_23430 20474 20836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 20862 21914 gene locus_tag LOCUS_23440 20862 21914 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939995.1 protein_id gnl|my_center|LOCUS_23440 21911 22390 gene locus_tag LOCUS_23450 21911 22390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 22661 24988 gene locus_tag LOCUS_23460 22661 24988 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459055.1 protein_id gnl|my_center|LOCUS_23460 25344 27584 gene locus_tag LOCUS_23470 gene nuoF 25344 27584 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_23470 27603 29678 gene locus_tag LOCUS_23480 27603 29678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 30399 29851 gene locus_tag LOCUS_23490 30399 29851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 30572 31108 gene locus_tag LOCUS_23500 30572 31108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 >Feature sequence23 2866 3165 gene locus_tag LOCUS_23510 2866 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 3261 3554 gene locus_tag LOCUS_23520 3261 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 4463 3840 gene locus_tag LOCUS_23530 4463 3840 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813668.1 protein_id gnl|my_center|LOCUS_23530 4641 4456 gene locus_tag LOCUS_23540 4641 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 4710 5015 gene locus_tag LOCUS_23550 4710 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 5060 5389 gene locus_tag LOCUS_23560 5060 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 5530 5805 gene locus_tag LOCUS_23570 5530 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 5913 8960 gene locus_tag LOCUS_23580 5913 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 9056 9424 gene locus_tag LOCUS_23590 9056 9424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 9417 9869 gene locus_tag LOCUS_23600 9417 9869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 9986 10291 gene locus_tag LOCUS_23610 9986 10291 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811036.1 protein_id gnl|my_center|LOCUS_23610 10288 10614 gene locus_tag LOCUS_23620 10288 10614 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811035.1 protein_id gnl|my_center|LOCUS_23620 10808 11590 gene locus_tag LOCUS_23630 10808 11590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 13614 11941 gene locus_tag LOCUS_23640 13614 11941 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_23640 13793 14140 gene locus_tag LOCUS_23650 13793 14140 CDS product DUF3846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272736.1 protein_id gnl|my_center|LOCUS_23650 14137 14277 gene locus_tag LOCUS_23660 14137 14277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 14356 15366 gene locus_tag LOCUS_23670 14356 15366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 15368 16282 gene locus_tag LOCUS_23680 15368 16282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 16405 16974 gene locus_tag LOCUS_23690 16405 16974 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 protein_id gnl|my_center|LOCUS_23690 16967 18073 gene locus_tag LOCUS_23700 16967 18073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 18183 21074 gene locus_tag LOCUS_23710 18183 21074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 21209 22282 gene locus_tag LOCUS_23720 21209 22282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705715.1 protein_id gnl|my_center|LOCUS_23720 23185 22751 gene locus_tag LOCUS_23730 23185 22751 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479949.1 protein_id gnl|my_center|LOCUS_23730 23214 23411 gene locus_tag LOCUS_23740 23214 23411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 23486 24418 gene locus_tag LOCUS_23750 gene cysK 23486 24418 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_23750 24897 25727 gene locus_tag LOCUS_23760 24897 25727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 25757 26710 gene locus_tag LOCUS_23770 25757 26710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 27364 26774 gene locus_tag LOCUS_23780 27364 26774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 >Feature sequence24 1148 108 gene locus_tag LOCUS_23790 1148 108 CDS product IS30-like element ISTde2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956682.1 protein_id gnl|my_center|LOCUS_23790 1520 1278 gene locus_tag LOCUS_23800 1520 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 2399 1623 gene locus_tag LOCUS_23810 2399 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 2709 2392 gene locus_tag LOCUS_23820 2709 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 3177 2725 gene locus_tag LOCUS_23830 3177 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 3461 3192 gene locus_tag LOCUS_23840 3461 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 3744 3448 gene locus_tag LOCUS_23850 3744 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 3837 4220 gene locus_tag LOCUS_23860 3837 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 4233 4601 gene locus_tag LOCUS_23870 4233 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 13868 4620 gene locus_tag LOCUS_23880 13868 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 15409 13889 gene locus_tag LOCUS_23890 15409 13889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 15718 15428 gene locus_tag LOCUS_23900 15718 15428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 17559 15733 gene locus_tag LOCUS_23910 17559 15733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 18061 17573 gene locus_tag LOCUS_23920 18061 17573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 18832 18131 gene locus_tag LOCUS_23930 18832 18131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 19988 18741 gene locus_tag LOCUS_23940 19988 18741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 20798 20376 gene locus_tag LOCUS_23950 20798 20376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 21024 20791 gene locus_tag LOCUS_23960 21024 20791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 21460 21005 gene locus_tag LOCUS_23970 21460 21005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 22036 21476 gene locus_tag LOCUS_23980 22036 21476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23980 23071 22055 gene locus_tag LOCUS_23990 23071 22055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 23610 23191 gene locus_tag LOCUS_24000 23610 23191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 24746 23676 gene locus_tag LOCUS_24010 24746 23676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 25787 24774 gene locus_tag LOCUS_24020 25787 24774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 26274 25963 gene locus_tag LOCUS_24030 26274 25963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 28300 26291 gene locus_tag LOCUS_24040 28300 26291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 29746 28304 gene locus_tag LOCUS_24050 29746 28304 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_24050 29891 29739 gene locus_tag LOCUS_24060 29891 29739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 >Feature sequence25 204 1760 gene locus_tag LOCUS_24070 204 1760 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017097.1 protein_id gnl|my_center|LOCUS_24070 1808 2749 gene locus_tag LOCUS_24080 1808 2749 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086014.1 protein_id gnl|my_center|LOCUS_24080 2877 3731 gene locus_tag LOCUS_24090 2877 3731 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970011.1 protein_id gnl|my_center|LOCUS_24090 3788 4576 gene locus_tag LOCUS_24100 3788 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 4581 5324 gene locus_tag LOCUS_24110 4581 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24110 5629 5417 gene locus_tag LOCUS_24120 5629 5417 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_24120 6134 5832 gene locus_tag LOCUS_24130 6134 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 6389 7126 gene locus_tag LOCUS_24140 6389 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 7219 7920 gene locus_tag LOCUS_24150 7219 7920 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437036.1 protein_id gnl|my_center|LOCUS_24150 7917 9131 gene locus_tag LOCUS_24160 7917 9131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 9163 9753 gene locus_tag LOCUS_24170 9163 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 10763 9807 gene locus_tag LOCUS_24180 10763 9807 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359343.1 protein_id gnl|my_center|LOCUS_24180 11439 11044 gene locus_tag LOCUS_24190 11439 11044 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811644.1 protein_id gnl|my_center|LOCUS_24190 11655 12527 gene locus_tag LOCUS_24200 gene pdxS 11655 12527 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813582.1 protein_id gnl|my_center|LOCUS_24200 12529 13089 gene locus_tag LOCUS_24210 gene pdxT 12529 13089 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113516.1 protein_id gnl|my_center|LOCUS_24210 14509 13202 gene locus_tag LOCUS_24220 14509 13202 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944264.1 protein_id gnl|my_center|LOCUS_24220 15167 14514 gene locus_tag LOCUS_24230 gene catA 15167 14514 CDS product type A chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986550.1 protein_id gnl|my_center|LOCUS_24230 16187 15333 gene locus_tag LOCUS_24240 16187 15333 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_24240 16778 17998 gene locus_tag LOCUS_24250 16778 17998 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_24250 18118 18984 gene locus_tag LOCUS_24260 18118 18984 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_24260 19148 22234 gene locus_tag LOCUS_24270 19148 22234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 22331 23182 gene locus_tag LOCUS_24280 22331 23182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 23172 23621 gene locus_tag LOCUS_24290 23172 23621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 23618 24247 gene locus_tag LOCUS_24300 23618 24247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 26026 26517 gene locus_tag LOCUS_24310 26026 26517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 >Feature sequence26 2296 3588 gene locus_tag LOCUS_24320 2296 3588 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214414.1 protein_id gnl|my_center|LOCUS_24320 3738 4751 gene locus_tag LOCUS_24330 3738 4751 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_24330 4882 5820 gene locus_tag LOCUS_24340 4882 5820 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_24340 5813 6592 gene locus_tag LOCUS_24350 5813 6592 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054430.1 protein_id gnl|my_center|LOCUS_24350 6721 7833 gene locus_tag LOCUS_24360 6721 7833 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678909.1 protein_id gnl|my_center|LOCUS_24360 8971 8051 gene locus_tag LOCUS_24370 8971 8051 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437151.1 protein_id gnl|my_center|LOCUS_24370 12049 9122 gene locus_tag LOCUS_24380 12049 9122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 13265 12159 gene locus_tag LOCUS_24390 13265 12159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 13827 13258 gene locus_tag LOCUS_24400 13827 13258 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 protein_id gnl|my_center|LOCUS_24400 14864 13950 gene locus_tag LOCUS_24410 14864 13950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 15973 14867 gene locus_tag LOCUS_24420 15973 14867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 16192 16052 gene locus_tag LOCUS_24430 16192 16052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 16536 16189 gene locus_tag LOCUS_24440 16536 16189 CDS product DUF3846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272736.1 protein_id gnl|my_center|LOCUS_24440 16715 18385 gene locus_tag LOCUS_24450 16715 18385 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_24450 19869 18793 gene locus_tag LOCUS_24460 19869 18793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 21255 19873 gene locus_tag LOCUS_24470 21255 19873 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085144103.1 protein_id gnl|my_center|LOCUS_24470 21454 21696 gene locus_tag LOCUS_24480 21454 21696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 21687 21857 gene locus_tag LOCUS_24490 21687 21857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 >Feature sequence27 425 78 gene locus_tag LOCUS_24500 425 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 607 2277 gene locus_tag LOCUS_24510 607 2277 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_24510 2289 2588 gene locus_tag LOCUS_24520 2289 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 2783 5350 gene locus_tag LOCUS_24530 gene cas3 2783 5350 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440412.1 protein_id gnl|my_center|LOCUS_24530 5362 6798 gene locus_tag LOCUS_24540 gene casA 5362 6798 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227614.1 protein_id gnl|my_center|LOCUS_24540 6795 7319 gene locus_tag LOCUS_24550 6795 7319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 7323 8465 gene locus_tag LOCUS_24560 gene cas7e 7323 8465 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227612.1 protein_id gnl|my_center|LOCUS_24560 8517 9158 gene locus_tag LOCUS_24570 8517 9158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 9139 9750 gene locus_tag LOCUS_24580 9139 9750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 9847 10669 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtatgccccacgtatgtggggatgaaccg 10692 11165 gene locus_tag LOCUS_24590 10692 11165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24590 11331 11624 gene locus_tag LOCUS_24600 11331 11624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24600 11621 11965 gene locus_tag LOCUS_24610 gene cas2e 11621 11965 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926117.1 protein_id gnl|my_center|LOCUS_24610 12215 13102 gene locus_tag LOCUS_24620 12215 13102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 13344 13772 gene locus_tag LOCUS_24630 13344 13772 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814584.1 protein_id gnl|my_center|LOCUS_24630 13802 14257 gene locus_tag LOCUS_24640 13802 14257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 14254 15582 gene locus_tag LOCUS_24650 14254 15582 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017864221.1 protein_id gnl|my_center|LOCUS_24650 15659 15832 gene locus_tag LOCUS_24660 15659 15832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 15887 16276 gene locus_tag LOCUS_24670 15887 16276 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_24670 16768 16367 gene locus_tag LOCUS_24680 16768 16367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 18414 16822 gene locus_tag LOCUS_24690 gene thrS 18414 16822 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786083.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence28 587 111 gene locus_tag LOCUS_24700 587 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 1384 605 gene locus_tag LOCUS_24710 1384 605 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_24710 3129 1606 gene locus_tag LOCUS_24720 3129 1606 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048415.1 protein_id gnl|my_center|LOCUS_24720 3478 4311 gene locus_tag LOCUS_24730 gene dapF 3478 4311 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_24730 5040 4312 gene locus_tag LOCUS_24740 5040 4312 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460545.1 protein_id gnl|my_center|LOCUS_24740 5793 5044 gene locus_tag LOCUS_24750 5793 5044 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272457.1 protein_id gnl|my_center|LOCUS_24750 6704 5790 gene locus_tag LOCUS_24760 6704 5790 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460543.1 protein_id gnl|my_center|LOCUS_24760 6856 7548 gene locus_tag LOCUS_24770 6856 7548 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460542.1 protein_id gnl|my_center|LOCUS_24770 7545 8813 gene locus_tag LOCUS_24780 7545 8813 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272456.1 protein_id gnl|my_center|LOCUS_24780 9606 8911 gene locus_tag LOCUS_24790 gene dapD 9606 8911 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286875.1 protein_id gnl|my_center|LOCUS_24790 9708 10796 gene locus_tag LOCUS_24800 9708 10796 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286870.1 protein_id gnl|my_center|LOCUS_24800 11327 12187 gene locus_tag LOCUS_24810 11327 12187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 12306 12962 gene locus_tag LOCUS_24820 12306 12962 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120838.1 protein_id gnl|my_center|LOCUS_24820 12976 13761 gene locus_tag LOCUS_24830 12976 13761 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144055.1 protein_id gnl|my_center|LOCUS_24830 14710 13913 gene locus_tag LOCUS_24840 14710 13913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 15002 16519 gene locus_tag LOCUS_24850 15002 16519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 16587 17312 gene locus_tag LOCUS_24860 16587 17312 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989471.1 protein_id gnl|my_center|LOCUS_24860 17373 18176 gene locus_tag LOCUS_24870 17373 18176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 >Feature sequence29 <1 1106 gene locus_tag LOCUS_24880 <1 1106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase 1668 1171 gene locus_tag LOCUS_24890 1668 1171 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681144.1 protein_id gnl|my_center|LOCUS_24890 2255 2019 gene locus_tag LOCUS_24900 2255 2019 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811908.1 protein_id gnl|my_center|LOCUS_24900 2375 3328 gene locus_tag LOCUS_24910 2375 3328 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013877237.1 protein_id gnl|my_center|LOCUS_24910 3373 4062 gene locus_tag LOCUS_24920 3373 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 4173 4451 gene locus_tag LOCUS_24930 4173 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 4453 5535 gene locus_tag LOCUS_24940 4453 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 5541 6050 gene locus_tag LOCUS_24950 5541 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 6043 6372 gene locus_tag LOCUS_24960 6043 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 6545 6967 gene locus_tag LOCUS_24970 6545 6967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 7539 6991 gene locus_tag LOCUS_24980 7539 6991 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 protein_id gnl|my_center|LOCUS_24980 8034 7660 gene locus_tag LOCUS_24990 8034 7660 CDS product DUF3846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272736.1 protein_id gnl|my_center|LOCUS_24990 8960 8046 gene locus_tag LOCUS_25000 8960 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 10069 8963 gene locus_tag LOCUS_25010 10069 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 10288 10148 gene locus_tag LOCUS_25020 10288 10148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 10632 10285 gene locus_tag LOCUS_25030 10632 10285 CDS product DUF3846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272736.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence30 1635 559 gene locus_tag LOCUS_25040 1635 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 3021 1639 gene locus_tag LOCUS_25050 3021 1639 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085144103.1 protein_id gnl|my_center|LOCUS_25050 3220 3462 gene locus_tag LOCUS_25060 3220 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 3453 3623 gene locus_tag LOCUS_25070 3453 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 5455 3689 gene locus_tag LOCUS_25080 5455 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 7482 6046 gene locus_tag LOCUS_25090 7482 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence31 2801 2962 gene locus_tag LOCUS_25100 2801 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 3549 3250 gene locus_tag LOCUS_25110 3549 3250 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869934.1 protein_id gnl|my_center|LOCUS_25110 5057 3771 gene locus_tag LOCUS_25120 5057 3771 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_25120 5131 5565 gene locus_tag LOCUS_25130 5131 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 5626 5898 gene locus_tag LOCUS_25140 5626 5898 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 protein_id gnl|my_center|LOCUS_25140 6451 6038 gene locus_tag LOCUS_25150 6451 6038 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615364.1 protein_id gnl|my_center|LOCUS_25150 7017 6598 gene locus_tag LOCUS_25160 7017 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 7350 7039 gene locus_tag LOCUS_25170 7350 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence32 793 140 gene locus_tag LOCUS_25180 793 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 966 1205 gene locus_tag LOCUS_25190 966 1205 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_25190 1930 1271 gene locus_tag LOCUS_25200 1930 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 2769 2134 gene locus_tag LOCUS_25210 2769 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 3024 4343 gene locus_tag LOCUS_25220 gene rsxC 3024 4343 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428488.1 protein_id gnl|my_center|LOCUS_25220 4356 5405 gene locus_tag LOCUS_25230 4356 5405 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_25230 5408 5974 gene locus_tag LOCUS_25240 5408 5974 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_25240 5988 6623 gene locus_tag LOCUS_25250 5988 6623 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_25250 6623 7210 gene locus_tag LOCUS_25260 gene rsxA 6623 7210 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_25260 7229 8227 gene locus_tag LOCUS_25270 7229 8227 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_25270 8491 8306 gene locus_tag LOCUS_25280 8491 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 8610 8822 gene locus_tag LOCUS_25290 8610 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 8964 9037 gene locus_tag LOCUS_t00420 8964 9037 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence33 81 344 gene locus_tag LOCUS_25300 81 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 366 1016 gene locus_tag LOCUS_25310 366 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 1003 1632 gene locus_tag LOCUS_25320 1003 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 1638 2249 gene locus_tag LOCUS_25330 1638 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 2381 2848 gene locus_tag LOCUS_25340 2381 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 2845 3219 gene locus_tag LOCUS_25350 2845 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 3247 3963 gene locus_tag LOCUS_25360 3247 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922062.1 protein_id gnl|my_center|LOCUS_25360 3963 4622 gene locus_tag LOCUS_25370 3963 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 4636 5523 gene locus_tag LOCUS_25380 4636 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 5526 6497 gene locus_tag LOCUS_25390 5526 6497 CDS product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922474.1 protein_id gnl|my_center|LOCUS_25390 6510 7361 gene locus_tag LOCUS_25400 6510 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 7391 7882 gene locus_tag LOCUS_25410 7391 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 7899 8105 gene locus_tag LOCUS_25420 7899 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 8107 8457 gene locus_tag LOCUS_25430 8107 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence34 2265 184 gene locus_tag LOCUS_25440 gene vanT 2265 184 CDS product serine racemase VanT catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893196.1 protein_id gnl|my_center|LOCUS_25440 3004 2252 gene locus_tag LOCUS_25450 3004 2252 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436406.1 protein_id gnl|my_center|LOCUS_25450 4041 3001 gene locus_tag LOCUS_25460 gene vanG 4041 3001 CDS product D-alanine--D-serine ligase VanG-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861276.1 protein_id gnl|my_center|LOCUS_25460 5279 4173 gene locus_tag LOCUS_25470 5279 4173 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021367800.1 protein_id gnl|my_center|LOCUS_25470 <5893 5272 gene locus_tag LOCUS_25480 <5893 5272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436401.1:vancomycin resistance response regulator transcriptoin factor VanR-G-Cd >Feature sequence35 594 253 gene locus_tag LOCUS_25490 594 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 1218 787 gene locus_tag LOCUS_25500 gene fabZ 1218 787 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 protein_id gnl|my_center|LOCUS_25500 2461 1220 gene locus_tag LOCUS_25510 gene fabF 2461 1220 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_25510 3217 2474 gene locus_tag LOCUS_25520 gene fabG 3217 2474 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_25520 4155 3214 gene locus_tag LOCUS_25530 gene fabD 4155 3214 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356280.1 protein_id gnl|my_center|LOCUS_25530 5225 4152 gene locus_tag LOCUS_25540 5225 4152 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966843.1 protein_id gnl|my_center|LOCUS_25540 >Feature sequence36 879 2018 gene locus_tag LOCUS_25550 879 2018 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_25550 2031 3422 gene locus_tag LOCUS_25560 2031 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 3435 4547 gene locus_tag LOCUS_25570 3435 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 >Feature sequence37 1487 246 gene locus_tag LOCUS_25580 gene fabF 1487 246 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_25580 2244 1501 gene locus_tag LOCUS_25590 gene fabG 2244 1501 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_25590 3182 2241 gene locus_tag LOCUS_25600 gene fabD 3182 2241 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356280.1 protein_id gnl|my_center|LOCUS_25600 <4167 3179 gene locus_tag LOCUS_25610 <4167 3179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966843.1:nitronate monooxygenase family protein >Feature sequence38 800 282 gene locus_tag LOCUS_25620 800 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 1110 814 gene locus_tag LOCUS_25630 gene rpsF 1110 814 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_25630 1345 1800 gene locus_tag LOCUS_25640 gene spoVAC 1345 1800 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418420.1 protein_id gnl|my_center|LOCUS_25640 2076 1864 gene locus_tag LOCUS_25650 2076 1864 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796544.1 protein_id gnl|my_center|LOCUS_25650 3058 2096 gene locus_tag LOCUS_25660 3058 2096 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136824.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence39 1451 822 gene locus_tag LOCUS_25670 1451 822 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548076.1 protein_id gnl|my_center|LOCUS_25670 2920 1718 gene locus_tag LOCUS_25680 gene tuf 2920 1718 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700007.1 protein_id gnl|my_center|LOCUS_25680 >Feature sequence40 1275 202 gene locus_tag LOCUS_25690 1275 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 1533 2546 gene locus_tag LOCUS_25700 gene gap 1533 2546 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_25700 >Feature sequence41 538 1362 gene locus_tag LOCUS_25710 538 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence42 1880 1164 gene locus_tag LOCUS_25720 1880 1164 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107985.1 protein_id gnl|my_center|LOCUS_25720 >Feature sequence43 861 691 gene locus_tag LOCUS_25730 861 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 1049 861 gene locus_tag LOCUS_25740 1049 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 1707 1174 gene locus_tag LOCUS_25750 1707 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 2363 1710 gene locus_tag LOCUS_25760 2363 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 >Feature sequence44 831 661 gene locus_tag LOCUS_25770 831 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 1019 831 gene locus_tag LOCUS_25780 1019 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 1359 1144 gene locus_tag LOCUS_25790 1359 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 2280 1627 gene locus_tag LOCUS_25800 2280 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence45 580 149 gene locus_tag LOCUS_25810 gene fabZ 580 149 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 protein_id gnl|my_center|LOCUS_25810 1823 582 gene locus_tag LOCUS_25820 gene fabF 1823 582 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_25820 <2548 1836 gene locus_tag LOCUS_25830 <2548 1836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460500.1:3-oxoacyl-[acyl-carrier-protein] reductase